Directory of Open Access Journals (Sweden)
Ioanna A Armata
Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.
Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K
2017-04-01
This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.
Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun
2016-10-01
The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA
Jukes, T. H.; Kimura, M.
1984-01-01
The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.
International Nuclear Information System (INIS)
Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.
1990-08-01
The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.
Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong
2017-09-01
While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men
Directory of Open Access Journals (Sweden)
Ahamad Salamian
2008-01-01
Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.
Directory of Open Access Journals (Sweden)
Kourosh Bamdad
2016-12-01
Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion: Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.
Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap
DEFF Research Database (Denmark)
Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey
2011-01-01
A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...
A single nucleotide polymorphism (SNP) assay for population ...
African Journals Online (AJOL)
A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...
Directory of Open Access Journals (Sweden)
Kenji Fukunaga
2015-12-01
Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.
Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V
2017-09-29
Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
2013-01-01
Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Directory of Open Access Journals (Sweden)
Keum-Ju Lee
2011-01-01
Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.
Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Fábio Ferreira Carlos
2017-12-01
Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individualâs genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15Â min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance
Directory of Open Access Journals (Sweden)
Keightley Peter D
2008-09-01
Full Text Available Abstract Background Molecular evolutionary studies in mammals often estimate nucleotide substitution rates within and outside CpG dinucleotides separately. Frequently, in alignments of two sequences, the division of sites into CpG and non-CpG classes is based simply on the presence or absence of a CpG dinucleotide in either sequence, a procedure that we refer to as CpG/non-CpG assignment. Although it likely that this procedure is biased, it is generally assumed that the bias is negligible if species are very closely related. Results Using simulations of DNA sequence evolution we show that assignment of the ancestral CpG state based on the simple presence/absence of the CpG dinucleotide can seriously bias estimates of the substitution rate, because many true non-CpG changes are misassigned as CpG. Paradoxically, this bias is most severe between closely related species, because a minimum of two substitutions are required to misassign a true ancestral CpG site as non-CpG whereas only a single substitution is required to misassign a true ancestral non-CpG site as CpG in a two branch tree. We also show that CpG misassignment bias differentially affects fourfold degenerate and noncoding sites due to differences in base composition such that fourfold degenerate sites can appear to be evolving more slowly than noncoding sites. We demonstrate that the effects predicted by our simulations occur in a real evolutionary setting by comparing substitution rates estimated from human-chimp coding and intronic sequence using CpG/non-CpG assignment with estimates derived from a method that is largely free from bias. Conclusion Our study demonstrates that a common method of assigning sites into CpG and non CpG classes in pairwise alignments is seriously biased and recommends against the adoption of ad hoc methods of ancestral state assignment.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...
African Journals Online (AJOL)
The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
Directory of Open Access Journals (Sweden)
Navin Elango
2008-02-01
Full Text Available Transitions at CpG dinucleotides, referred to as "CpG substitutions", are a major mutational input into vertebrate genomes and a leading cause of human genetic disease. The prevalence of CpG substitutions is due to their mutational origin, which is dependent on DNA methylation. In comparison, other single nucleotide substitutions (for example those occurring at GpC dinucleotides mainly arise from errors during DNA replication. Here we analyzed high quality BAC-based data from human, chimpanzee, and baboon to investigate regional variation of CpG substitution rates. We show that CpG substitutions occur approximately 15 times more frequently than other single nucleotide substitutions in primate genomes, and that they exhibit substantial regional variation. Patterns of CpG rate variation are consistent with differences in methylation level and susceptibility to subsequent deamination. In particular, we propose a "distance-decaying" hypothesis, positing that due to the molecular mechanism of a CpG substitution, rates are correlated with the stability of double-stranded DNA surrounding each CpG dinucleotide, and the effect of local DNA stability may decrease with distance from the CpG dinucleotide.Consistent with our "distance-decaying" hypothesis, rates of CpG substitution are strongly (negatively correlated with regional G+C content. The influence of G+C content decays as the distance from the target CpG site increases. We estimate that the influence of local G+C content extends up to 1,500 approximately 2,000 bps centered on each CpG site. We also show that the distance-decaying relationship persisted when we controlled for the effect of long-range homogeneity of nucleotide composition. GpC sites, in contrast, do not exhibit such "distance-decaying" relationship. Our results highlight an example of the distinctive properties of methylation-dependent substitutions versus substitutions mostly arising from errors during DNA replication. Furthermore
Directory of Open Access Journals (Sweden)
Lingaas Frode
2008-01-01
Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.
Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB
Directory of Open Access Journals (Sweden)
Joon-Ho Lee
2014-09-01
Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.
Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru
2017-04-18
Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.
Single nucleotide polymorphisms in the 5'-flanking region of the ...
African Journals Online (AJOL)
Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2017-04-01
For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Secretion of wound healing mediators by single and bi-layer skin substitutes.
Maarof, Manira; Law, Jia Xian; Chowdhury, Shiplu Roy; Khairoji, Khairul Anuar; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj
2016-10-01
Limitations of current treatments for skin loss caused by major injuries leads to the use of skin substitutes. It is assumed that secretion of wound healing mediators by these skin substitutes plays a role in treating skin loss. In our previous study, single layer keratinocytes (SK), single layer fibroblast (SF) and bilayer (BL; containing keratinocytes and fibroblasts layers) skin substitutes were fabricated using fibrin that had shown potential to heal wounds in preclinical studies. This study aimed to quantify the secretion of wound healing mediators, and compare between single and bi-layer skin substitutes. Skin samples were digested to harvest fibroblasts and keratinocytes, and expanded to obtain sufficient cells for the construction of skin substitutes. Acellular fibrin (AF) construct was used as control. Substitutes i.e. AF, SK, SF and BL were cultured for 2 days, and culture supernatant was collected to analyze secretion of wound healing mediators via multiplex ELISA. Among 19 wound healing mediators tested, BL substitute secreted significantly higher amounts of CXCL1 and GCSF compared to SF and AF substitute but this was not significant with respect to SK substitute. The BL substitute also secreted significantly higher amounts of CXCL5 and IL-6 compared to other substitutes. In contrast, the SK substitute secreted significantly higher amounts of VCAM-1 compared to other substitutes. However, all three skin substitutes also secreted CCL2, CCL5, CCL11, GM-CSF, IL8, IL-1α, TNF-α, ICAM-1, FGF-β, TGF-β, HGF, VEGF-α and PDGF-BB factors, but no significant difference was seen. Secretion of these mediators after transplantation may play a significant role in promoting wound healing process for the treatment of skin loss.
Detection of new single nucleotide polymorphisms by means of real ...
Indian Academy of Sciences (India)
Unknown
amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...
Directory of Open Access Journals (Sweden)
Bianchetti Laurent
2012-11-01
Full Text Available Abstract Background Single Base Substitutions (SBS that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. Methods We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE and Tag-seq (a combination of L-SAGE and deep sequencing, and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT, i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. Results In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP, catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST, i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC, healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. Conclusion If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic.
International Nuclear Information System (INIS)
Bianchetti, Laurent; Kieffer, David; Féderkeil, Rémi; Poch, Olivier
2012-01-01
Single Base Substitutions (SBS) that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE) and Tag-seq (a combination of L-SAGE and deep sequencing), and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT), i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP), catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST), i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC), healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.
Directory of Open Access Journals (Sweden)
Beth M Carpenter
Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.
Bouwman, Aniek C.; Hayes, Ben J.; Calus, Mario P.L.
2017-01-01
Background: Genomic evaluation is used to predict direct genomic values (DGV) for selection candidates in breeding programs, but also to estimate allele substitution effects (ASE) of single nucleotide polymorphisms (SNPs). Scaling of allele counts influences the estimated ASE, because scaling of
A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification
Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.
2016-01-01
The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544
Factor 11 single-nucleotide variants in women with heavy menstrual bleeding
Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene
2017-01-01
In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical
Giangaspero, Massimo; Harasawa, Ryô
2011-06-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the
Li, M-H; Tiirikka, T; Kantanen, J
2013-01-01
In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...
Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...
African Journals Online (AJOL)
Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...
Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms
Drago, Francesca; Karpasitou, Katerina; Poli, Francesca
2009-01-01
We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...
Evaluating rare amino acid substitutions (RGC_CAMs in a yeast model clade.
Directory of Open Access Journals (Sweden)
Kenneth Polzin
Full Text Available When inferring phylogenetic relationships, not all sites in a sequence alignment are equally informative. One recently proposed approach that takes advantage of this inequality relies on sites that contain amino acids whose replacement requires multiple substitutions. Identifying these so-called RGC_CAM substitutions (after Rare Genomic Changes as Conserved Amino acids-Multiple substitutions requires that, first, at any given site in the amino acid sequence alignment, there must be a minimum of two different amino acids; second, each amino acid must be present in at least two taxa; and third, the amino acids must require a minimum of two nucleotide substitutions to replace each other. Although theory suggests that RGC_CAM substitutions are expected to be rare and less likely to be homoplastic, the informativeness of RGC_CAM substitutions has not been extensively evaluated in biological data sets. We investigated the quality of RGC_CAM substitutions by examining their degree of homoplasy and internode certainty in nearly 2.7 million aligned amino acid sites from 5,261 proteins from five species belonging to the yeast Saccharomyces sensu stricto clade whose phylogeny is well-established. We identified 2,647 sites containing RGC_CAM substitutions, a number that contrasts sharply with the 100,887 sites containing RGC_non-CAM substitutions (i.e., changes between amino acids that require only a single nucleotide substitution. We found that RGC_CAM substitutions had significantly lower homoplasy than RGC_non-CAM ones; specifically RGC_CAM substitutions showed a per-site average homoplasy index of 0.100, whereas RGC_non-CAM substitutions had a homoplasy index of 0.215. Internode certainty values were also higher for sites containing RGC_CAM substitutions than for RGC_non-CAM ones. These results suggest that RGC_CAM substitutions possess a strong phylogenetic signal and are useful markers for phylogenetic inference despite their rarity.
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
DEFF Research Database (Denmark)
Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas
2013-01-01
The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...
Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K
2017-06-01
Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3
DEFF Research Database (Denmark)
Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik
2003-01-01
The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...
Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo
2007-09-01
The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Alain Stepanian
Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.
Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma
Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E
2017-01-01
Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.
Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li
2009-03-01
The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.
Directory of Open Access Journals (Sweden)
Zienolddiny S
2011-12-01
Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most
Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...
Indian Academy of Sciences (India)
2017-03-02
Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...
Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor
DEFF Research Database (Denmark)
Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin
2013-01-01
We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....
Giangaspero, Massimo; Harasawa, Ryô
2007-12-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.
International Nuclear Information System (INIS)
Vinnik, D.A.; Zherebtsov, D.A.; Mashkovtseva, L.S.; Nemrava, S.; Bischoff, M.; Perov, N.S.; Semisalova, A.S.; Krivtsov, I.V.; Isaenko, L.I.; Mikhailov, G.G.; Niewa, R.
2014-01-01
Highlights: • Growth of large Al-substituted crystals BaFe 12−x Al x O 19. • Al-content controllable by flux composition. • Crystallographic site preference of Al unraveled. • Magnetic characterization depending on Al-content. - Abstract: Large single crystals of aluminum-substituted M-type barium hexaferrite BaFe 12−x Al x O 19 were obtained from carbonate flux. The Al content in the crystals can be controlled via the Al content of the flux up to x = 1.1 according to single crystal X-ray structure refinements. Al shows a distinct preference to substitute Fe on crystallographic sites with high coordination numbers by oxygen atoms, whereas no significant amounts of Al can be found on a tetrahedrally coordinated site. An increasing amount of the aluminum dopant results in a monotonous reduction of the Curie temperature from 440 to 415 °C and the saturation magnetization at room temperature from 68 to 57 emu/g for single crystal and from 61 to 53 emu/g for powder samples
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
Directory of Open Access Journals (Sweden)
Cheng Deng
Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.
Directory of Open Access Journals (Sweden)
Miguel A Martín-Acebes
Full Text Available West Nile virus (WNV is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu on the highly basic internal capsid or core (C protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.
Martín-Acebes, Miguel A; Blázquez, Ana-Belén; de Oya, Nereida Jiménez; Escribano-Romero, Estela; Shi, Pei-Yong; Saiz, Juan-Carlos
2013-01-01
West Nile virus (WNV) is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu) on the highly basic internal capsid or core (C) protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A) and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.
Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô
2013-09-01
The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. Copyright © 2013 Elsevier B.V. All rights reserved.
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
Directory of Open Access Journals (Sweden)
Voelter-Mahlknecht Susanne
2012-10-01
Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.
International Nuclear Information System (INIS)
Daghero, D.; Gonnelli, R.S.; Ummarino, G.A.; Calzolari, A.; Dellarocca, Valeria; Stepanov, V.A.; Zhigadlo, N.; Kazakov, S.M.; Karpinski, J.
2005-01-01
We studied the effects of carbon and aluminum substitutions on the gaps of the two-band superconductor MgB 2 by means of point-contact measurements in Mg(B 1-x C x ) 2 and Mg 1-y Al y B 2 single crystals with 0≤x≤0.132 and 0≤y≤0.21. The gap amplitudes, Δ ω and Δ π , were determined by fitting the conductance curves of the point contacts with the standard Blonder-Tinkham-Klapwijk (BTK) model generalized to the two-band case. Whenever possible, their values were confirmed by the independent fit (with a single-band BTK model) of the partial contribution of the two bands to the conductance, separated by means of a suitable magnetic field B*. In C-substituted crystals, the two gaps remain clearly distinct up to x∝0.10, but at x=0.132 we observed for the first time their merging into a single gap Δ≅3 meV with a gap ratio 2Δ=k B T c close to the standard BCS value. In Al-substituted crystals, we found no evidence of this gap merging. Instead, Δ π reaches the value 0.4 meV at y=0.21, where Δ π saturates at about 4 meV. These results are compared with other recent experimental findings in polycrystals and with the predictions of the models for multiband superconductivity. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.
Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris
2004-07-14
With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya
2014-01-01
Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301
Directory of Open Access Journals (Sweden)
Viroj Wiwanitkit
2008-06-01
Full Text Available Viroj WiwanitkitDepartment of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, ThailandAbstract: Hemoglobin is an important protein found in the red cells of many animals. In humans, the hemoglobin is mainly distributed in the red blood cell. Single amino acid substitution is the main pathogenesis of most hemoglobin disorders. Here, the author used a new gene ontology technology to predict the molecular function and biological process of four important hemoglobin disorders with single substitution. The four studied important abnormal hemoglobins (Hb with single substitution included Hb S, Hb E, Hb C, and Hb J-Baltimore. Using the GoFigure server, the molecular function and biological process in normal and abnormal hemoglobins was predicted. Compared with normal hemoglobin, all studied abnormal hemoglobins had the same function and biological process. This indicated that the overall function of oxygen transportation is not disturbed in the studied hemoglobin disorders. Clinical findings of oxygen depletion in abnormal hemoglobin should therefore be due to the other processes rather than genomics, proteomics, and expression levels.Keywords: hemoglobin, amino acid, substitution, function
Single nucleotide substitution mutations and polymorphisms in ...
African Journals Online (AJOL)
Administrator
2011-09-14
Sep 14, 2011 ... 1The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Karachi, Pakistan. 2Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, Pakistan. 3Department of Dermatology, Jinnah Postgraduate Medical Center, Karachi, Pakistan. Accepted 7 July, 2011.
Substitution rate and natural selection in parvovirus B19
Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.
2016-01-01
The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080
Nonrandom Distribution of miRNAs Genes and Single Nucleotide Variants in Keratoconus Loci.
Directory of Open Access Journals (Sweden)
Dorota M Nowak
Full Text Available Despite numerous studies, the causes of both development and progression of keratoconus remain elusive. Previous studies of this disorder focused mainly on one or two genetic factors only. However, in the analysis of such complex diseases all potential factors should be taken into consideration. The purpose of this study was a comprehensive analysis of known keratoconus loci to uncover genetic factors involved in this disease causation in the general population, which could be omitted in the original studies. In this investigation genomic data available in various databases and experimental own data were assessed. The lists of single nucleotide variants and miRNA genes localized in reported keratoconus loci were obtained from Ensembl and miRBase, respectively. The potential impact of nonsynonymous amino acid substitutions on protein structure and function was assessed with PolyPhen-2 and SIFT. For selected protein genes the ranking was made to choose those most promising for keratoconus development. Ranking results were based on topological features in the protein-protein interaction network. High specificity for the populations in which the causative sequence variants have been identified was found. In addition, the possibility of links between previously analyzed keratoconus loci was confirmed including miRNA-gene interactions. Identified number of genes associated with oxidative stress and inflammatory agents corroborated the hypothesis of their effect on the disease etiology. Distribution of the numerous sequences variants within both exons and mature miRNA which forces you to search for a broader look at the determinants of keratoconus. Our findings highlight the complexity of the keratoconus genetics.
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments
Directory of Open Access Journals (Sweden)
Tcherepanov Vasily
2004-07-01
Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Maximum parsimony, substitution model, and probability phylogenetic trees.
Weng, J F; Thomas, D A; Mareels, I
2011-01-01
The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.
Directory of Open Access Journals (Sweden)
Hemingway Janet
2007-01-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-07
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
Ris-Stalpers, C.; Trifiro, M. A.; Kuiper, G. G.; Jenster, G.; Romalo, G.; Sai, T.; van Rooij, H. C.; Kaufman, M.; Rosenfield, R. L.; Liao, S.
1991-01-01
We have identified two different single nucleotide alterations in codon 686 (GAC; aspartic acid) in exon 4 of the human androgen receptor gene in three unrelated families with the complete form of androgen insensitivity. One mutation (G----C) results in an aspartic acid----histidine substitution
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2009-01-01
Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.
Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I
2014-06-01
Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.
Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.
1998-01-01
Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763
Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke
2018-06-01
Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.
Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.
2015-01-01
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...
Incorporation of causative quantitative trait nucleotides in single-step GBLUP.
Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy
2017-07-26
Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the
Virtual substitution scan via single-step free energy perturbation.
Chiang, Ying-Chih; Wang, Yi
2016-02-05
With the rapid expansion of our computing power, molecular dynamics (MD) simulations ranging from hundreds of nanoseconds to microseconds or even milliseconds have become increasingly common. The majority of these long trajectories are obtained from plain (vanilla) MD simulations, where no enhanced sampling or free energy calculation method is employed. To promote the 'recycling' of these trajectories, we developed the Virtual Substitution Scan (VSS) toolkit as a plugin of the open-source visualization and analysis software VMD. Based on the single-step free energy perturbation (sFEP) method, VSS enables the user to post-process a vanilla MD trajectory for a fast free energy scan of substituting aryl hydrogens by small functional groups. Dihedrals of the functional groups are sampled explicitly in VSS, which improves the performance of the calculation and is found particularly important for certain groups. As a proof-of-concept demonstration, we employ VSS to compute the solvation free energy change upon substituting the hydrogen of a benzene molecule by 12 small functional groups frequently considered in lead optimization. Additionally, VSS is used to compute the relative binding free energy of four selected ligands of the T4 lysozyme. Overall, the computational cost of VSS is only a fraction of the corresponding multi-step FEP (mFEP) calculation, while its results agree reasonably well with those of mFEP, indicating that VSS offers a promising tool for rapid free energy scan of small functional group substitutions. This article is protected by copyright. All rights reserved. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Majewski Jacek
2006-08-01
Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif
2015-05-15
Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.
DEFF Research Database (Denmark)
Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne
2012-01-01
Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women.......Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women....
Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.
Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline
2012-05-17
The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough
Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.
Drago, Francesca; Karpasitou, Katerina; Poli, Francesca
2009-01-01
We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.
Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T
2010-05-01
This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Kumiko Yanagi
2012-01-01
Full Text Available Mutations in the X-linked genes neuroligin 3 (NLGN3 and neuroligin 4X (NLGN4X were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.
Directory of Open Access Journals (Sweden)
Massimo Giangaspero
2008-06-01
Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.
Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang
2018-02-23
The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.
Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan
2018-01-01
To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (pGraves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.
Role of novel and rare nucleotide substitutions of the β-globin gene
Directory of Open Access Journals (Sweden)
Margherita Vinciguerra
2012-11-01
Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.
2007-01-01
Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.
Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S
2012-11-10
We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.
Crystallographic characterization of single-ortho, N-substituted acetanilide derivatives
International Nuclear Information System (INIS)
Boeyens, J.C.A.; Denner, L.; Painter, S.; Staskun, B.
1987-01-01
The crystal and molecular structures of the three single-ortho, N-substituted amide derivatives, acet-2'-bromo-N-(p-nitrobenzyl)anilide, 3',5'-dimethyl-N-ethyl-2,2,2',4'-tetrachlorobenzoylacetanilide, and difluoro[(1-phenyl-2-(o-ethylphenyl-N-benzylcarbamoyl)vinyl)oxy]borane, have been determined by X-ray diffraction analysis. In each case, the amide carbonyl group was found in the exo-conformation, independent of the nature of the acyl group. The observed conformations correlate well with solution structures, inferred from n.m.r. data
Directory of Open Access Journals (Sweden)
Sourabh Chand
Full Text Available Immunosuppression is cornerstone treatment of antineutrophil cytoplasmic antibody associated vasculitis (AAV but is later complicated by infection, cancer, cardiovascular and chronic kidney disease. Caveolin-1 is an essential structural protein for small cell membrane invaginations known as caveolae. Its functional role has been associated with these complications. For the first time, caveolin-1 (CAV1 gene variation is studied in AAV.CAV1 single nucleotide polymorphism rs4730751 was analysed in genomic DNA from 187 white patients with AAV from Birmingham, United Kingdom. The primary outcome measure was the composite endpoint of time to all-cause mortality or renal replacement therapy. Secondary endpoints included time to all-cause mortality, death from sepsis or vascular disease, cancer and renal replacement therapy. Validation of results was sought from 589 white AAV patients, from two European cohorts.The primary outcome occurred in 41.7% of Birmingham patients. In a multivariate model, non-CC genotype variation at the studied single nucleotide polymorphism was associated with increased risk from: the primary outcome measure [HR 1.86; 95% CI: 1.14-3.04; p=0.013], all-cause mortality [HR:1.83; 95% CI: 1.02-3.27; p=0.042], death from infection [HR:3.71; 95% CI: 1.28-10.77; p=0.016], death from vascular disease [HR:3.13; 95% CI: 1.07-9.10; p=0.037], and cancer [HR:5.55; 95% CI: 1.59-19.31; p=0.007]. In the validation cohort, the primary outcome rate was far lower (10.4%; no association between genotype and the studied endpoints was evident.The presence of a CC genotype in Birmingham is associated with protection from adverse outcomes of immunosuppression treated AAV. Lack of replication in the European cohort may have resulted from low clinical event rates. These findings are worthy of further study in larger cohorts.
Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.
2017-01-01
PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the
Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.
Directory of Open Access Journals (Sweden)
Rui-Jun Su
Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor
International Nuclear Information System (INIS)
Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre
2006-01-01
In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable
Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.
Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko
2017-12-01
A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus
2012-01-01
Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic
Pitfalls of the most commonly used models of context dependent substitution
Directory of Open Access Journals (Sweden)
Huttley Gavin A
2008-12-01
Full Text Available Abstract Background Neighboring nucleotides exert a striking influence on mutation, with the hypermutability of CpG dinucleotides in many genomes being an exemplar. Among the approaches employed to measure the relative importance of sequence neighbors on molecular evolution have been continuous-time Markov process models for substitutions that treat sequences as a series of independent tuples. The most widely used examples are the codon substitution models. We evaluated the suitability of derivatives of the nucleotide frequency weighted (hereafter NF and tuple frequency weighted (hereafter TF models for measuring sequence context dependent substitution. Critical properties we address are their relationships to an independent nucleotide process and the robustness of parameter estimation to changes in sequence composition. We then consider the impact on inference concerning dinucleotide substitution processes from application of these two forms to intron sequence alignments from primates. Results We prove that the NF form always nests the independent nucleotide process and that this is not true for the TF form. As a consequence, using TF to study context effects can be misleading, which is shown by both theoretical calculations and simulations. We describe a simple example where a context parameter estimated under TF is confounded with composition terms unless all sequence states are equi-frequent. We illustrate this for the dinucleotide case by simulation under a nucleotide model, showing that the TF form identifies a CpG effect when none exists. Our analysis of primate introns revealed that the effect of nucleotide neighbors is over-estimated under TF compared with NF. Parameter estimates for a number of contexts are also strikingly discordant between the two model forms. Conclusion Our results establish that the NF form should be used for analysis of independent-tuple context dependent processes. Although neighboring effects in general are
The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...
Ferrell, Georgia; Lu, Minyan; Stoddard, Paul; Sammel, Mary D; Romero, Roberto; Strauss, Jerome F; Matthews, Catherine A
2009-05-01
Pelvic organ prolapse and preterm premature rupture of membranes, the 2 conditions which have in common weakening of the tensile strength of tissues, are thought to be caused, in part, by abnormal extracellular matrix synthesis and/or catabolism. We identified a new single nucleotide polymorphism (NT_010194(LOXL1):g.45008784A>C) in the promoter of the LOXL1 gene, which is essential for elastin synthesis. Promoter studies showed that the minor "C'' allele had significantly greater activity than the major "A'' allele. Case-control studies examined the association of the alleles of this single nucleotide polymorphism with pelvic organ prolapse and preterm premature rupture of membranes. When comparing allele frequencies and genotypes in pelvic organ prolapse cases versus controls, no significant associations were found. A case-control study conducted in African American neonates also found no significant associations between the promoter alleles and preterm premature rupture of membranes. We conclude that a functional single nucleotide polymorphism exists in the promoter region of the LOXL1 gene. Association studies suggest that the promoter single nucleotide polymorphism does not contribute significantly to risk of pelvic organ prolapse or preterm premature rupture of membranes.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
[A population genetic study of 22 autosomal loci of single nucleotide polymorphisms].
Tang, Jian-pin; Jiang, Feng-hui; Shi, Mei-sen; Xu, Chuan-chao; Chen, Rui; Lai, Xiao-pin
2012-12-01
To evaluate polymorphisms and forensic efficiency of 22 non-binary single nucleotide polymorphism (SNP) loci. One hundred ethnic Han Chinese individuals were recruited from Dongguan, Guangdong. The 22 loci were genotyped with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Nine loci were found with a single allele, 4 loci were found to be biallelic, whilst 9 loci were found to have 3 alleles. For 13 polymorphic loci, the combined discrimination power and power of exclusion were 0.999 98 and 0.9330, respectively. For the 9 non-biallelic loci, the combined discrimination power and power of exclusion were 0.9998 and 0.8956, respectively. For motherless cases, the combined power of exclusion was 0.6405 for 13 polymorphic SNPs and 0.6405 for 9 non-binary SNPs. Non-binary loci have a greater discrimination power and exclusion power per SNP.
Bogomolovas, J.; Fleming, J.R.; Anderson, B.R.; Williams, R.; Lange, S.; Simon, B.; Khan, M.M.; Rudolf, R.; Franke, B.; Bullard, B.; Rigden, D.J.; Granzier, H.; Labeit, S.; Mayans, O.
2016-01-01
Missense single-nucleotide polymorphisms (mSNPs) in titin are emerging as a main causative factor of heart failure. However, distinguishing between benign and disease-causing mSNPs is a substantial challenge. Here, we research the question of whether a single mSNP in a generic domain of titin can
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Directory of Open Access Journals (Sweden)
Valerio Costa
2016-06-01
Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.
Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F
2007-08-01
Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.
Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.
2003-01-01
Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,
DEFF Research Database (Denmark)
Milne, Roger L; Benítez, Javier; Nevanlinna, Heli
2009-01-01
BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...
Synthesis and Single Crystal Structures of Substituted-1,3-Selenazol-2-amines
Directory of Open Access Journals (Sweden)
Guoxiong Hua
2016-12-01
Full Text Available The synthesis and X-ray single crystal structures of a series of new 4-substituted-1,3-selenazol-2-amines is reported. The efficient preparation of these compounds was carried out by two-component cyclization of the selenoureas with equimolar amounts of α-haloketones. The selenoureas were obtained from the reaction of Woollins’ reagent with cyanamides, followed by hydrolysis with water. All new compounds have been characterized by IR spectroscopy, multi-NMR (1H, 13C, 77Se spectroscopy, accurate mass measurement and single crystal X-ray structure analysis.
Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan
2017-02-01
Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.
Directory of Open Access Journals (Sweden)
Sudip Paul
2015-09-01
Full Text Available Computational approaches could help in identifying deleterious non-synonymous single nucleotide polymorphisms (nsSNPs in a disease related gene which is a difficult and laborious task through laboratory experiments. In the present study, we analyzed the impacts of nsSNPs on structure and function of Paraxonase 1 (PON1 using different bioinformatics tools. The human PON1 protein sequence and its corresponding gene's SNP information were collected from UniProt and dbSNP databases, respectively. We utilized SIFT, Polyphen, I-Mutant 2.0, MutPred, SNP and GO, PhD-SNP and PANTHER tools in order to examine the total 39 nsSNPs occurring in the PON1 coding region. We filtered the most pathological mutations by combining the scores of the aforementioned servers and found 8 SNPs (G344C, S302L, W281C, D279Y, H134R, F120S, L90P, C42R as deleterious and disease causing. The PDB structure of PON1 protein was obtained from RCSB Protein Data Bank (PDB ID: 1V04. The deleterious SNPs in native PON1 were introduced using Swiss-PDB Viewer package and changes in free energy were observed for six out of eight mutant structures. Two SNPs, S302L (substitution of serine to leucine at 302 position in amino acid sequence and L90P (substitution of leucine to proline at 90 position in amino acid sequence caused the highest energy increase amongst all. The findings implicate that these nsSNPs would be analyzed further in detail to enumerate their possible association with the protein deteriorating and disease causal potentialities.
DEFF Research Database (Denmark)
Børsting, Claus; Morling, Niels
2012-01-01
and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...
Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S
2016-09-19
The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.
Effect of the substitution of F on the photoswitching behavior in single molecular device
Bian, Baoan; Zheng, Yapeng; Yuan, Peipei; Liao, Bin; Chen, Wei; An, Xiuhua; Mo, Xiaotong; Ding, Yuqiang
2017-09-01
We carry out first-principles calculations based on density functional theory and non-equilibrium Green's function to investigate the electronic transport properties of a 5-arylidenehydantoin molecule sandwiched between two Au electrodes. A reversible switching behavior between E and Z isomerization can be observed in the device through light irradiation, and their currents display different characteristic. Furthermore, it is found that the substitution of F in the molecule enlarges the switching ratio of device. The different characteristics of currents for E/Z forms and E/Z with the substitution of F are discussed by the transmission spectra and the molecular projected self-consistent Hamiltonian states. We discuss the change of Fermi level alignment due to the substitution of F, and the polarization effect under bias. We find the negative differential resistance effect in the E form with the substitution of F, which is explained by change of molecule-electrode coupling with the varied bias. The results suggest that the 5-arylidenehydantoin molecule with the substitution of F that improves the performance of device, becoming one of the methods for improving single molecular photoswitching performance in the future.
DEFF Research Database (Denmark)
Krintel, Sophine B; Palermo, Giuseppe; Johansen, Julia S
2012-01-01
Recently, two genome-wide association studies identified single nucleotide polymorphisms (SNPs) significantly associated with the treatment response to tumor necrosis factor α (TNFα) inhibitors in patients with rheumatoid arthritis (RA). We aimed to replicate these results and identify SNPs and t...
Directory of Open Access Journals (Sweden)
Jonathan W Arthur
2010-12-01
Full Text Available Enzymes encoded by the AKR1C1 and AKR1C2 genes are responsible for the metabolism of progesterone and 5α-dihydrotestosterone (DHT, respectively. The effect of amino acid substitutions, resulting from single nucleotide polymorphisms (SNPs in the AKR1C2 gene, on the enzyme kinetics of the AKR1C2 gene product were determined experimentally by Takashi et al. In this paper, we used homology modeling to predict and analyze the structure of AKR1C1 and AKR1C2 genetic variants. The experimental reduction in enzyme activity in the AKR1C2 variants F46Y and L172Q, as determined by Takahashi et al., is predicted to be due to increased instability in cofactor binding, caused by disruptions to the hydrogen bonds between NADP and AKR1C2, resulting from the insertion of polar residues into largely non-polar environments near the site of cofactor binding. Other AKR1C2 variants were shown to involve either conservative substitutions or changes taking place on the surface of the molecule and distant from the active site, confirming the experimental finding of Takahashi et al. that these variants do not result in any statistically significant reduction in enzyme activity. The AKR1C1 R258C variant is predicted to have no effect on enzyme activity for similar reasons. Thus, we provide further insight into the molecular mechanism of the enzyme kinetics of these proteins. Our data also highlight previously reported difficulties with online databases.
Awayn, N H; Rosenberg, M F; Kamis, A B; Aleksandrov, L A; Riordan, J R; Ford, R C
2005-11-01
Cystic fibrosis, one of the major human inherited diseases, is caused by defects in the CFTR (cystic fibrosis transmembrane conductance regulator), a cell-membrane protein. CFTR acts as a chloride channel which can be opened by ATP. Low-resolution structural studies of purified recombinant human CFTR are described in the present paper. Localization of the C-terminal decahistidine tag in CFTR was achieved by Ni2+-nitriloacetate nanogold labelling, followed by electron microscopy and single-particle analysis. The presence of the gold label appears to improve the single-particle-alignment procedure. Projection structures of CFTR from two-dimensional crystals analysed by electron crystallography displayed two alternative conformational states in the presence of nucleotide and nanogold, but only one form of the protein was observed in the quiescent (nucleotide-free) state.
Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.
Multani, Shaleen; Saranath, Dhananjaya
2016-11-01
Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.
Curran, S.; Bolton, P.; Rozsnyai, K.; Chiocchetti, A.; Klauck, S.M.; Duketis, E.; Poustka, F.; Schlitt, S.; Freitag, C.M.; Lee, I. van der; Muglia, P.; Poot, M.; Staal, W.G.; Jonge, M.V. de; Ophoff, R.A.; Lewis, C.; Skuse, D.; Mandy, W.; Vassos, E.; Fossdal, R.; Magnusson, P.; Hreidarsson, S.; Saemundsen, E.; Stefansson, H.; Stefansson, K.; Collier, D.
2011-01-01
The Autism Genome Project (AGP) Consortium recently reported genome-wide significant association between autism and an intronic single nucleotide polymorphism marker, rs4141463, within the MACROD2 gene. In the present study we attempted to replicate this finding using an independent case-control
Single genome retrieval of context-dependent variability in mutation rates for human germline.
Sahakyan, Aleksandr B; Balasubramanian, Shankar
2017-01-13
Accurate knowledge of the core components of substitution rates is of vital importance to understand genome evolution and dynamics. By performing a single-genome and direct analysis of 39,894 retrotransposon remnants, we reveal sequence context-dependent germline nucleotide substitution rates for the human genome. The rates are characterised through rate constants in a time-domain, and are made available through a dedicated program (Trek) and a stand-alone database. Due to the nature of the method design and the imposed stringency criteria, we expect our rate constants to be good estimates for the rates of spontaneous mutations. Benefiting from such data, we study the short-range nucleotide (up to 7-mer) organisation and the germline basal substitution propensity (BSP) profile of the human genome; characterise novel, CpG-independent, substitution prone and resistant motifs; confirm a decreased tendency of moieties with low BSP to undergo somatic mutations in a number of cancer types; and, produce a Trek-based estimate of the overall mutation rate in human. The extended set of rate constants we report may enrich our resources and help advance our understanding of genome dynamics and evolution, with possible implications for the role of spontaneous mutations in the emergence of pathological genotypes and neutral evolution of proteomes.
Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H
2006-06-01
Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator
International Nuclear Information System (INIS)
Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.
2017-01-01
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator
Energy Technology Data Exchange (ETDEWEB)
Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.
Ruijs, Mariëlle W. G.; Schmidt, Marjanka K.; Nevanlinna, Heli; Tommiska, Johanna; Aittomäki, Kristiina; Pruntel, Roelof; Verhoef, Senno; van 't Veer, L. J.
2007-01-01
Li-Fraumeni syndrome (LFS) is an autosomal-dominant cancer predisposition syndrome of which the majority is caused by TP53 germline mutations and is characterised by different tumour types occurring at relatively young age. Recently, it was shown that a single-nucleotide polymorphism (SNP) in the
Czech Academy of Sciences Publication Activity Database
Campa, D.; Pastore, M.; Gentiluomo, M.; Talar-Wojnarowska, R.; Kupcinskas, J.; Malecka-Panas, E.; Neoptolemos, J. P.; Niesen, W.; Vodička, Pavel; Delle Fave, G.; Bueno-de-Mesquita, H. B.; Gazouli, M.; Pacetti, P.; Di Leo, M.; Ito, H.; Klüter, H.; Souček, P.; Corbo, V.; Yamao, K.; Hosono, S.; Kaaks, R.; Vashist, Y.; Gioffreda, D.; Strobel, O.; Shimizu, Y.; Dijk, F.; Andriulli, A.; Ivanauskas, A.; Bugert, P.; Tavano, F.; Vodičková, L.; Zambon, C.F.; Lovecek, M.; Landi, S.; Key, T. J.; Boggi, U.; Pezzilli, R.; Jamroziak, K.; Mohelníková-Duchoňová, B.; Mambrini, A.; Bambi, F.; Busch, O.; Pazienza, V.; Valente, R.; Theodoropoulos, G.E.; Hackert, T.; Capurso, G.; Cavestro, G.M.; Pasquali, C.; Basso, D.; Sperti, C.; Matsuo, K.; Büchler, M.; Khaw, K. T.; Izbicki, J.; Costello, E.; Katzke, V.; Michalski, Ch.; Stepien, A.; Rizzato, C.; Canzian, F.
2016-01-01
Roč. 7, č. 35 (2016), s. 57011-57020 ISSN 1949-2553 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * CDKN2A * single nucleotide polymorphisms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.168, year: 2016
Directory of Open Access Journals (Sweden)
Liam R Brunham
2005-12-01
Full Text Available The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008. These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.
DEFF Research Database (Denmark)
Fabbri, Elena; Caniglia, R.; Mucci, Nadia
2012-01-01
Single nucleotide polymorphisms (SNPs) which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient geno....... We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring....
High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification
Directory of Open Access Journals (Sweden)
Sun Zhenyu
2001-08-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring.
Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C
2015-07-01
To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal
DEFF Research Database (Denmark)
Rembeck, Karolina; Alsiö, Asa; Christensen, Peer Brehm
2012-01-01
Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in proximity to IL28B predict spontaneous clearance of HCV infection as well as outcome following peginterferon and ribavirin therapy among HCV genotype 1 infected patients. The present stu...
DEFF Research Database (Denmark)
Yang, Ziheng; Nielsen, Rasmus
2008-01-01
Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we impl...... codon usage in mammals. Estimates of selection coefficients nevertheless suggest that selection on codon usage is weak and most mutations are nearly neutral. The sensitivity of the analysis on the assumed mutation model is discussed.......Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we...... implement a few population genetics models of codon substitution that explicitly consider mutation bias and natural selection at the DNA level. Selection on codon usage is modeled by introducing codon-fitness parameters, which together with mutation-bias parameters, predict optimal codon frequencies...
Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the
Directory of Open Access Journals (Sweden)
Xiuqing Zhang
Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
DEFF Research Database (Denmark)
Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A
2009-01-01
Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....
Skoczinski, Pia; Volkenborn, Kristina; Fulton, Alexander; Bhadauriya, Anuseema; Nutschel, Christina; Gohlke, Holger; Knapp, Andreas; Jaeger, Karl-Erich
2017-09-25
Bacillus subtilis produces and secretes proteins in amounts of up to 20 g/l under optimal conditions. However, protein production can be challenging if transcription and cotranslational secretion are negatively affected, or the target protein is degraded by extracellular proteases. This study aims at elucidating the influence of a target protein on its own production by a systematic mutational analysis of the homologous B. subtilis model protein lipase A (LipA). We have covered the full natural diversity of single amino acid substitutions at 155 positions of LipA by site saturation mutagenesis excluding only highly conserved residues and qualitatively and quantitatively screened about 30,000 clones for extracellular LipA production. Identified variants with beneficial effects on production were sequenced and analyzed regarding B. subtilis growth behavior, extracellular lipase activity and amount as well as changes in lipase transcript levels. In total, 26 LipA variants were identified showing an up to twofold increase in either amount or activity of extracellular lipase. These variants harbor single amino acid or codon substitutions that did not substantially affect B. subtilis growth. Subsequent exemplary combination of beneficial single amino acid substitutions revealed an additive effect solely at the level of extracellular lipase amount; however, lipase amount and activity could not be increased simultaneously. Single amino acid and codon substitutions can affect LipA secretion and production by B. subtilis. Several codon-related effects were observed that either enhance lipA transcription or promote a more efficient folding of LipA. Single amino acid substitutions could improve LipA production by increasing its secretion or stability in the culture supernatant. Our findings indicate that optimization of the expression system is not sufficient for efficient protein production in B. subtilis. The sequence of the target protein should also be considered as an
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-04-17
The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Directory of Open Access Journals (Sweden)
Roe Bruce A
2007-04-01
Full Text Available Abstract Background The long bone abnormality (lbab mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism
Directory of Open Access Journals (Sweden)
HyoYoung Kim
2014-12-01
Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.
RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.
Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong
2017-07-01
Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-01-01
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Directory of Open Access Journals (Sweden)
Léa Campos de Oliveira
2011-09-01
Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women
Directory of Open Access Journals (Sweden)
Jéssica de Oliveira
2017-05-01
Full Text Available Abstract Butyrylcholinesterase (BChE activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs in the BCHE gene: -116G > A (rs1126680, 1615GA (rs1803274, 1914A 0.05. The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.
Directory of Open Access Journals (Sweden)
E. Gaitán-Solís
2008-11-01
Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.
Yates, Christopher M; Sternberg, Michael J E
2013-11-01
Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.
Osborne, Colin S.; Leitner, Ingrid; Favre, Bertrand; Ryder, Neil S.
2005-01-01
There has only been one clinically confirmed case of terbinafine resistance in dermatophytes, where six sequential Trichophyton rubrum isolates from the same patient were found to be resistant to terbinafine and cross-resistant to other squalene epoxidase (SE) inhibitors. Microsomal SE activity from these resistant isolates was insensitive to terbinafine, suggesting a target-based mechanism of resistance (B. Favre, M. Ghannoum, and N. S. Ryder, Med. Mycol. 42:525-529, 2004). In this study, we have characterized at the molecular level the cause of the resistant phenotype of these clinical isolates. Cloning and sequencing of the SE gene and cDNA from T. rubrum revealed the presence of an intron in the gene and an open reading frame encoding a protein of 489 residues, with an equivalent similarity (57%) to both yeast and mammalian SEs. The nucleotide sequences of SE from two terbinafine-susceptible strains were identical whereas those of terbinafine-resistant strains, serially isolated from the same patient, each contained the same single missense introducing the amino acid substitution L393F. Introduction of the corresponding substitution in the Candida albicans SE gene (L398F) and expression of this gene in Saccharomyces cerevisiae conferred a resistant phenotype to the transformants when compared to those expressing the wild-type sequence. Terbinafine resistance in these T. rubrum clinical isolates appears to be due to a single amino acid substitution in SE. PMID:15980358
Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L
2015-08-01
Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jing Zhang
2015-01-01
Full Text Available Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature.
Analyzing a single nucleotide polymorphism in schizophrenia: a meta-analysis approach
Directory of Open Access Journals (Sweden)
Falola O
2017-08-01
Full Text Available Oluwadamilare Falola,1 Victor Chukwudi Osamor,1,2 Marion Adebiyi,1,2 Ezekiel Adebiyi1,2 1Covenant University Bioinformatics Research (CUBRe, 2Department of Computer and Information Sciences, College of Science and Technology, Covenant University, Ota, Ogun State, Nigeria Background: Schizophrenia is a severe mental disorder affecting >21 million people worldwide. Some genetic studies reported that single nucleotide polymorphism (SNP involving variant rs1344706 from the ZNF804A gene in human beings is associated with the risk of schizophrenia in several populations. Similar results tend to conflict with other reports in literature, indicating that no true significant association exists between rs1344706 and schizophrenia. We seek to determine the level of association of this SNP with schizophrenia in the Asian population using more recent genome-wide association study (GWAS datasets. Methods: Applying a computational approach with inclusion of more recent GWAS datasets, we conducted a meta-analysis to examine the level of association of SNP rs1344706 and the risk of schizophrenia disorder among the Asian population constituting Chinese, Indonesians, Japanese, Kazakhs and Singaporeans. For a total of 21 genetic studies, including a total of 28,842 cases and 35,630 controls, regression analysis, publication bias, Cochran’s Q and I2 tests were performed. The DerSimonian and Laird random-effects model was used to assess the association of the genetic variant to schizophrenia. Leave-one-out sensitivity analysis was also conducted to determine the influence of each study on the final outcome of the association study. Results: Our summarized analysis for Asian population revealed a pooled odds ratio of 1.06, 95% confidence interval of 1.01–1.11 and two-tailed P-value of 0.0228. Our test for heterogeneity showed the presence of large heterogeneity (I2=53.44%, P =0.00207 and Egger’s regression test (P =0.8763 and Begg’s test (P =0
Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu
2012-04-01
Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.
Directory of Open Access Journals (Sweden)
Inês Soares
Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
DEFF Research Database (Denmark)
Pujolar, José Martin; Jacobsen, M.W.; Als, Thomas Damm
2014-01-01
The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify...... species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American...... eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison...
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hidenobu Okuda
Full Text Available The development of novel fertilization treatments, including in vitro fertilization and intracytoplasmic injection, has made pregnancy possible regardless of the level of activity of the spermatozoa; however, the etiology of male-factor infertility is poorly understood. Multiple studies, primarily through the use of transgenic animals, have contributed to a list of candidate genes that may affect male infertility in humans. We examined single nucleotide polymorphisms (SNPs as a cause of male infertility in an analysis of spermatogenesis-specific genes.We carried out the prevalence of SNPs in the coding region of phosphoglycerate mutase 4 (PGAM4 on the X chromosome by the direct sequencing of PCR-amplified DNA from male patients. Using RT-PCR and western blot analyses, we identified that PGAM4 is a functional retrogene that is expressed predominantly in the testes and is associated with male infertility. PGAM4 is expressed in post-meiotic stages, including spermatids and spermatozoa in the testes, and the principal piece of the flagellum and acrosome in ejaculated spermatozoa. A case-control study revealed that 4.5% of infertile patients carry the G75C polymorphism, which causes an amino acid substitution in the encoded protein. Furthermore, an assay for enzymatic activity demonstrated that this polymorphism decreases the enzyme's activity both in vitro and in vivo.These results suggest that PGAM4, an X-linked retrogene, is a fundamental gene in human male reproduction and may escape meiotic sex chromosome inactivation. These findings provide fresh insight into elucidating the mechanisms of male infertility.
Brezina, Paul R; Benner, Andrew; Rechitsky, Svetlana; Kuliev, Anver; Pomerantseva, Ekaterina; Pauling, Dana; Kearns, William G
2011-04-01
To describe a method of amplifying DNA from blastocyst trophectoderm cells (two or three cells) and simultaneously performing 23-chromosome single nucleotide polymorphism microarrays and single-gene preimplantation genetic diagnosis. Case report. IVF clinic and preimplantation genetic diagnostic centers. A 36-year-old woman, gravida 2, para 1011, and her husband who both were carriers of GM(1) gangliosidosis. The couple wished to proceed with microarray analysis for aneuploidy detection coupled with DNA sequencing for GM(1) gangliosidosis. An IVF cycle was performed. Ten blastocyst-stage embryos underwent trophectoderm biopsy. Twenty-three-chromosome microarray analysis for aneuploidy and specific DNA sequencing for GM(1) gangliosidosis mutations were performed. Viable pregnancy. After testing, elective single embryo transfer was performed followed by an intrauterine pregnancy with documented fetal cardiac activity by ultrasound. Twenty-three-chromosome microarray analysis for aneuploidy detection and single-gene evaluation via specific DNA sequencing and linkage analysis are used for preimplantation diagnosis for single-gene disorders and aneuploidy. Because of the minimal amount of genetic material obtained from the day 3 to 5 embryos (up to 6 pg), these modalities have been used in isolation of each other. The use of preimplantation genetic diagnosis for aneuploidy coupled with testing for single-gene disorders via trophectoderm biopsy is a novel approach to maximize pregnancy outcomes. Although further investigation is warranted, preimplantation genetic diagnosis for aneuploidy and single-gene testing seem destined to be used increasingly to optimize ultimate pregnancy success. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Biodentine-a novel dentinal substitute for single visit apexification
Directory of Open Access Journals (Sweden)
Gurudutt Nayak
2014-05-01
Full Text Available Use of an apical plug in management of cases with open apices has gained popularity in recent years. Biodentine, a new calcium silicate-based material has recently been introduced as a dentine substitute, whenever original dentine is damaged. This case report describes single visit apexification in a maxillary central incisor with necrotic pulp and open apex using Biodentine as an apical barrier, and a synthetic collagen material as an internal matrix. Following canal cleaning and shaping, calcium hydroxide was placed as an intracanal medicament for 1 mon. This was followed by placement of small piece of absorbable collagen membrane beyond the root apex to serve as matrix. An apical plug of Biodentine of 5 mm thickness was placed against the matrix using pre-fitted hand pluggers. The remainder of canal was back-filled with thermoplasticized gutta-percha and access cavity was restored with composite resin followed by all-ceramic crown. One year follow-up revealed restored aesthetics and function, absence of clinical signs and symptoms, resolution of periapical rarefaction, and a thin layer of calcific tissue formed apical to the Biodentine barrier. The positive clinical outcome in this case is encouraging for the use of Biodentine as an apical plug in single visit apexification procedures.
International Nuclear Information System (INIS)
Kim, Jin C.; Ha, Ye J.; Roh, Seon A.; Cho, Dong H.; Choi, Eun Y.; Kim, Tae W.; Kim, Jong H.; Kang, Tae W.; Kim, Seon Y.; Kim, Yong S.
2013-01-01
Purpose: Studies aimed at predicting individual responsiveness to preoperative chemoradiation therapy (CRT) are urgently needed, especially considering the risks associated with poorly responsive patients. Methods and Materials: A 3-step strategy for the determination of CRT sensitivity is proposed based on (1) the screening of a human genome-wide single-nucleotide polymorphism (SNP) array in correlation with histopathologic tumor regression grade (TRG); (2) clinical association analysis of 113 patients treated with preoperative CRT; and (3) a cell-based functional assay for biological validation. Results: Genome-wide screening identified 9 SNPs associated with preoperative CRT responses. Positive responses (TRG 1-3) were obtained more frequently in patients carrying the reference allele (C) of the SNP CORO2A rs1985859 than in those with the substitution allele (T) (P=.01). Downregulation of CORO2A was significantly associated with reduced early apoptosis by 27% (P=.048) and 39% (P=.023) in RKO and COLO320DM colorectal cancer cells, respectively, as determined by flow cytometry. Reduced radiosensitivity was confirmed by colony-forming assays in the 2 colorectal cancer cells (P=.034 and .015, respectively). The SNP FAM101A rs7955740 was not associated with radiosensitivity in the clinical association analysis. However, downregulation of FAM101A significantly reduced early apoptosis by 29% in RKO cells (P=.047), and it enhanced colony formation in RKO cells (P=.001) and COLO320DM cells (P=.002). Conclusion: CRT-sensitive SNP markers were identified using a novel 3-step process. The candidate marker CORO2A rs1985859 and the putative marker FAM101A rs7955740 may be of value for the prediction of radiosensitivity to preoperative CRT, although further validation is needed in large cohorts
DEFF Research Database (Denmark)
Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi
2010-01-01
It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
van Binsbergen, R; Veerkamp, R F; Calus, M P L
2012-04-01
The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Salmaninejad, Arash; Mahmoudi, Mahdi; Aslani, Saeed; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima
2017-01-01
Salmaninejad A, Mahmoudi M, Aslani S, Poursani S, Ziaee V, Rezaei N. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients. Turk J Pediatr 2017; 59: 144-149. Juvenile-onset systemic lupus erythematosus (JSLE) is a complex autoimmune disease, characterized by multi-organ involvement. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene have been reported to have relationship with the risk of several autoimmune diseases. Studies have provided evidence that STAT4 may participate in the pathogenesis of JSLE. Therefore, we aimed to evaluate the association of STAT4 SNPs with JSLE in Iranian population. In this case-control study, two SNPs of STAT4 gene, including rs7574865 and rs7601754 were genotyped in 50 Iranian JSLE patients and 281 matched healthy individuals using real-time PCR allelic discrimination approach. Our experiments demonstrated that G and T alleles of rs7574865 SNP had similar distribution between patients and controls (P = 0.16). Additionally, differences in frequency of GG, GT, and TT genotypes (P = 0.14, 0.29, and 0.54, respectively) were not significant. Likewise, A and G alleles, as well as genotypes of rs7601754 SNP did not show significant differences between JSLE patients and healthy individuals. Lack of association of rs7574865 and rs7601754 SNPs in STAT4 gene with susceptibility to JSLE in Iranian population, despite their association with the risk of adult SLE in the same population, implicates on difference of genetic background of JSLE and SLE.
Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel
2011-08-01
Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.
Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa
Directory of Open Access Journals (Sweden)
P. J. Maughan
2012-11-01
Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.
Intrinsic magnetism of a series of Co substituted ZnO single crystals
International Nuclear Information System (INIS)
Lv Peiwen; Huang Feng; Chu Wangsheng; Lin Zhang; Chen Dagui; Li Wei; Chen Dongliang; Wu Ziyu
2008-01-01
Magnetic properties of a series of well-substituted Zn 1-x Co x O (x = 0.018,0.036 and 0.05) single crystals were studied. A typical paramagnetic anisotropy property, which strengthens when x decreases, was found. A magnetization step was observed at 2 K when the magnetic field is parallel to the c axis, indicating that paramagnetic anisotropy is the origin of the strong crystal field effect on Co 2+ ions in ZnO lattices. The Co 2+ single-ion anisotropy parameter 2D is obtained as 7.5 K. The effective moment of Co 2+ takes the values 2.7 μ B , 1.82 μ B , 1.49 μ B when x = 0.018, 0.036 and 0.05, revealing that more antiferromagnetic coupling between Co 2+ ions arises in the perfect crystal when x increases
Energy Technology Data Exchange (ETDEWEB)
Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)
2002-05-01
Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)
Directory of Open Access Journals (Sweden)
Michael E. Østergaard
2017-06-01
Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.
Directory of Open Access Journals (Sweden)
Claire Chewapreecha
2014-08-01
Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.
International Nuclear Information System (INIS)
Shaheen, T.; Zafar, Y.; Rahman, M.
2014-01-01
Single nucleotide polymorphism analysis is an expedient way to study polymorphisms at genomic level. In the present study we have explored Ubiquitin extension protein gene of G. arboreum (A2) and G. herbaceum (A1) of cotton which is a multiple copy gene. We have found SNPs at 16 positions in 200 bp region within A genome of cotton indicating frequency of SNPs 1/13 bp. Both sequences from cotton have shown maximum similarity with UBQ5 and UBQ6 of Arabidopsis thaliana. Sequence obtained from G. arboreum has shown SNPs at 28 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana while sequence obtained from G. herbaceum has shown SNPs at 31 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana. In conclusion although during pace of evolution ubiquitin extension protein genes of both A genome species have got some mutations from nature but still most of their sequence is similar. Single nucleotide polymorphism study can prove a vital tool to identify gene type in case of Multicopy genes. (author)
DEFF Research Database (Denmark)
Alsner, Jan; Andreassen, Christian Nicolaj; Overgaard, Marie
in biological pathways suspected to underlie phenotypes of interest. These variants can be either common alterations like single nucleotide polymorphisms, SNPs, or rare variants in potential susceptibility loci like ATM. In parallel, we are using microarray analysis on normal fibroblasts isolated from patients...
Directory of Open Access Journals (Sweden)
Devita Tetriana
2015-09-01
Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
DEFF Research Database (Denmark)
Ramírez-Soriano, Anna; Nielsen, Rasmus
2009-01-01
Most single-nucleotide polymorphism (SNP) data suffer from an ascertainment bias caused by the process of SNP discovery followed by SNP genotyping. The final genotyped data are biased toward an excess of common alleles compared to directly sequenced data, making standard genetic methods of analysis...... the variances and covariances of these estimators and provide a corrected version of Tajima's D statistic. We reanalyze a human genomewide SNP data set and find substantial differences in the results with or without ascertainment bias correction....
Intrinsic magnetism of a series of Co substituted ZnO single crystals
Energy Technology Data Exchange (ETDEWEB)
Lv Peiwen [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Huang Feng [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chu Wangsheng [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China); Lin Zhang [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chen Dagui [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Li Wei [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chen Dongliang [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China); Wu Ziyu [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China)
2008-01-23
Magnetic properties of a series of well-substituted Zn{sub 1-x}Co{sub x}O (x = 0.018,0.036 and 0.05) single crystals were studied. A typical paramagnetic anisotropy property, which strengthens when x decreases, was found. A magnetization step was observed at 2 K when the magnetic field is parallel to the c axis, indicating that paramagnetic anisotropy is the origin of the strong crystal field effect on Co{sup 2+} ions in ZnO lattices. The Co{sup 2+} single-ion anisotropy parameter 2D is obtained as 7.5 K. The effective moment of Co{sup 2+} takes the values 2.7 {mu}{sub B}, 1.82 {mu}{sub B}, 1.49 {mu}{sub B} when x = 0.018, 0.036 and 0.05, revealing that more antiferromagnetic coupling between Co{sup 2+} ions arises in the perfect crystal when x increases.
Czech Academy of Sciences Publication Activity Database
Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal
-, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Directory of Open Access Journals (Sweden)
Ayman Abunimer
2014-03-01
Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.
Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina
2014-06-01
Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Seong-Jin Jang
Full Text Available Physical dormancy, a structural feature of the seed coat known as hard seededness, is an important characteristic for adaptation of plants against unstable and unpredictable environments. To dissect the molecular basis of qHS1, a quantitative trait locus for hard seededness in soybean (Glycine max (L Merr., we developed a near-isogenic line (NIL of a permeable (soft-seeded cultivar, Tachinagaha, containing a hard-seed allele from wild soybean (G. soja introduced by successive backcrossings. The hard-seed allele made the seed coat of Tachinagaha more rigid by increasing the amount of β-1,4-glucans in the outer layer of palisade cells of the seed coat on the dorsal side of seeds, known to be a point of entrance of water. Fine-mapping and subsequent expression and sequencing analyses revealed that qHS1 encodes an endo-1,4-β-glucanase. A single-nucleotide polymorphism (SNP introduced an amino acid substitution in a substrate-binding cleft of the enzyme, possibly reducing or eliminating its affinity for substrates in permeable cultivars. Introduction of the genomic region of qHS1 from the impermeable (hard-seeded NIL into the permeable cultivar Kariyutaka resulted in accumulation of β-1,4-glucan in the outer layer of palisade cells and production of hard seeds. The SNP allele found in the NIL was further associated with the occurrence of hard seeds in soybean cultivars of various origins. The findings of this and previous studies may indicate that qHS1 is involved in the accumulation of β-1,4-glucan derivatives such as xyloglucan and/or β-(1,3(1,4-glucan that reinforce the impermeability of seed coats in soybean.
Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.
Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung
2017-01-01
Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.
HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.
Directory of Open Access Journals (Sweden)
Michael R Nonnemacher
Full Text Available The large majority of human immunodeficiency virus type 1 (HIV-1 markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs contained within the viral promoter or long terminal repeat (LTR in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count.
Czech Academy of Sciences Publication Activity Database
Janeba, Zlatko; Holý, Antonín
2001-01-01
Roč. 20, 4-7 (2001), s. 1103-1106 ISSN 1525-7770 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.508, year: 2001
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella
2011-01-01
Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...
Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A
2011-07-01
The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.
Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.
Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed
2016-10-17
Preterm birth (PTB), birth at PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.
Single Crystal Growth and Superconducting Properties of Antimony-Substituted NdO0.7F0.3BiS2
Directory of Open Access Journals (Sweden)
Satoshi Demura
2017-12-01
Full Text Available Antimony (Sb substitution of less than 8% was examined on a single crystal of a layered superconductor NdO0.7F0.3BiS2. The superconducting transition temperature of the substituted samples decreased as Sb concentration increased. A lattice constant along the c-axis showed a large decrease compared with that along the a-axis. Since in-plane chemical pressure monotonically decreased as Sb concentration increased, the suppression of the superconductivity is attributed to the decrease in the in-plane chemical pressure.
Wu, M.; Chang, S.; Kampman, E.; Kok, F.J.
2013-01-01
Alcohol drinking is a major risk factor for esophageal cancer (EC) and the metabolism of ethanol has been suggested to play an important role in esophageal carcinogenesis. Epidemiologic studies, including genomewide association studies (GWAS), have identified single nucleotide polymorphisms (SNPs)
Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria
Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung
2017-01-01
Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Li, M-H; Tiirikka, T; Kantanen, J
2014-02-01
In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.
Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin
2009-01-01
Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.
Shirakawa, I; Chaen, S; Bagshaw, C R; Sugi, H
2000-02-01
The kinetics of displacement of a fluorescent nucleotide, 2'(3')-O-[N[2-[[Cy3]amido]ethyl]carbamoyl]-adenosine 5'-triphosphate (Cy3-EDA-ATP), bound to rabbit soleus muscle myofibrils were studied using flash photolysis of caged ATP. Use of myofibrils from this slow twitch muscle allowed better resolution of the kinetics of nucleotide exchange than previous studies with psoas muscle myofibrils (, Biophys. J. 73:2033-2042). Soleus myofibrils in the presence of Cy3-EDA-nucleotides (Cy3-EDA-ATP or Cy3-EDA-ADP) showed selective fluorescence staining of the A-band. The K(m) for Cy3-EDA-ATP and the K(d) for Cy3-EDA-ADP binding to the myofibril A-band were 1.9 microM and 3.8 microM, respectively, indicating stronger binding of nucleotide to soleus cross-bridges compared to psoas cross-bridges (2.6 microM and 50 microM, respectively). After flash photolysis of caged ATP, the A-band fluorescence of the myofibril in the Cy3-EDA-ATP solution under isometric conditions decayed exponentially with a rate constant of 0.045 +/- 0.007 s(-1) (n = 32) at 10 degrees C, which was about seven times slower than that for psoas myofibrils. When a myofibril was allowed to shorten with a constant velocity, the nucleotide displacement rate constant increased from 0.066 s(-1) (isometric) to 0.14 s(-1) at 20 degrees C with increasing shortening velocity up to 0.1 myofibril length/s (V(max), the shortening velocity under no load was approximately 0. 2 myofibril lengths/s). The rate constant was not significantly affected by an isovelocity stretch of up to 0.1 myofibril lengths/s. These results suggest that the cross-bridge kinetics are not significantly affected at higher strain during lengthening but depend on the lower strain during shortening. These data also indicate that the interaction distance between a cross-bridge and the actin filament is at least 16 nm for a single cycle of the ATPase.
Convergent evolution of marine mammals is associated with distinct substitutions in common genes
Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.
2015-01-01
Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748
DEFF Research Database (Denmark)
Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F
2007-01-01
and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...
DEFF Research Database (Denmark)
Nof, Eyal; Cordeiro, Jonathan M; Pérez, Guillermo J
2010-01-01
the mother (both asymptomatic), led to 2 cases of sudden infant death. METHODS AND RESULTS: KCNQ1, KCNH2, SCN5A, KCNE1, KCNE2, CACNA1c, CACNB2b, and KCNJ2 genes were amplified and analyzed by direct sequencing. Functional electrophysiological studies were performed with the single nucleotide polymorphism...... and mutation expressed singly and in combination in Chinese ovary (CHO-K1) and COS-1 cells. An asymptomatic woman presenting after the death of her 2-day-old infant and spontaneous abortion of a second baby in the first trimester was referred for genetic analysis. The newborn infant had nearly incessant...... ventricular tachycardia while in utero and a prolonged QTc (560 ms). The mother was asymptomatic but displayed a prolonged QTc. Genetic screening of the mother revealed a heterozygous nonsense mutation (P926AfsX14) in KCNH2, predicting a stop codon. The father was asymptomatic with a normal QTc but had...
Chen, Chang; Zhang, Jinhu; Dong, Guofeng; Shao, Hezhu; Ning, Bo-Yuan; Zhao, Li; Ning, Xi-Jing; Zhuang, Jun
2014-01-01
In fabrication of nano- and quantum devices, it is sometimes critical to position individual dopants at certain sites precisely to obtain the specific or enhanced functionalities. With first-principles simulations, we propose a method for substitutional doping of individual atom at a certain position on a stepped metal surface by single-atom manipulation. A selected atom at the step of Al (111) surface could be extracted vertically with an Al trimer-apex tip, and then the dopant atom will be positioned to this site. The details of the entire process including potential energy curves are given, which suggests the reliability of the proposed single-atom doping method.
Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.
2011-01-01
Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in
Association of single nucleotide polymorphisms with radiation-induced esophagitis
International Nuclear Information System (INIS)
Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin
2008-01-01
Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)
Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech
2017-03-01
Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.
Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin
2017-05-23
A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.
Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning
2017-11-01
Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Germline contamination and leakage in whole genome somatic single nucleotide variant detection.
Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C
2018-01-31
The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Echoic Sensory Substitution Information in a Single Obstacle Circumvention Task.
Kolarik, Andrew J; Scarfe, Amy C; Moore, Brian C J; Pardhan, Shahina
2016-01-01
Accurate motor control is required when walking around obstacles in order to avoid collisions. When vision is unavailable, sensory substitution can be used to improve locomotion through the environment. Tactile sensory substitution devices (SSDs) are electronic travel aids, some of which indicate the distance of an obstacle using the rate of vibration of a transducer on the skin. We investigated how accurately such an SSD guided navigation in an obstacle circumvention task. Using an SSD, 12 blindfolded participants navigated around a single flat 0.6 x 2 m obstacle. A 3-dimensional Vicon motion capture system was used to quantify various kinematic indices of human movement. Navigation performance under full vision was used as a baseline for comparison. The obstacle position was varied from trial to trial relative to the participant, being placed at two distances 25 cm to the left, right or directly ahead. Under SSD guidance, participants navigated without collision in 93% of trials. No collisions occurred under visual guidance. Buffer space (clearance between the obstacle and shoulder) was larger by a factor of 2.1 with SSD guidance than with visual guidance, movement times were longer by a factor of 9.4, and numbers of velocity corrections were larger by a factor of 5 (all p<0.05). Participants passed the obstacle on the side affording the most space in the majority of trials for both SSD and visual guidance conditions. The results are consistent with the idea that SSD information can be used to generate a protective envelope during locomotion in order to avoid collisions when navigating around obstacles, and to pass on the side of the obstacle affording the most space in the majority of trials.
Echoic Sensory Substitution Information in a Single Obstacle Circumvention Task.
Directory of Open Access Journals (Sweden)
Andrew J Kolarik
Full Text Available Accurate motor control is required when walking around obstacles in order to avoid collisions. When vision is unavailable, sensory substitution can be used to improve locomotion through the environment. Tactile sensory substitution devices (SSDs are electronic travel aids, some of which indicate the distance of an obstacle using the rate of vibration of a transducer on the skin. We investigated how accurately such an SSD guided navigation in an obstacle circumvention task. Using an SSD, 12 blindfolded participants navigated around a single flat 0.6 x 2 m obstacle. A 3-dimensional Vicon motion capture system was used to quantify various kinematic indices of human movement. Navigation performance under full vision was used as a baseline for comparison. The obstacle position was varied from trial to trial relative to the participant, being placed at two distances 25 cm to the left, right or directly ahead. Under SSD guidance, participants navigated without collision in 93% of trials. No collisions occurred under visual guidance. Buffer space (clearance between the obstacle and shoulder was larger by a factor of 2.1 with SSD guidance than with visual guidance, movement times were longer by a factor of 9.4, and numbers of velocity corrections were larger by a factor of 5 (all p<0.05. Participants passed the obstacle on the side affording the most space in the majority of trials for both SSD and visual guidance conditions. The results are consistent with the idea that SSD information can be used to generate a protective envelope during locomotion in order to avoid collisions when navigating around obstacles, and to pass on the side of the obstacle affording the most space in the majority of trials.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V
2015-09-15
In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.
Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark
2013-01-01
Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.
Sifrim, Alejandro; Van Houdt, Jeroen Kj; Tranchevent, Leon-Charles; Nowakowska, Beata; Sakai, Ryo; Pavlopoulos, Georgios A; Devriendt, Koen; Vermeesch, Joris R; Moreau, Yves; Aerts, Jan
2012-01-01
The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org.
Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism
Directory of Open Access Journals (Sweden)
Sukhjiwan Kaur
2014-01-01
Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.
Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia
2008-07-01
Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (Plink with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Nobuhiro Harada
Full Text Available Single nucleotide polymorphisms of interleukin-28B (IL28B rs8099917 are reported to be associated with virologic clearance in interferon-and ribavirin -based treatment for hepatitis C virus (HCV-infected patients. We examined virologic response in accordance with IL28B polymorphisms in our living donor liver transplantation series under a preemptive interferon and RBV treatment approach. Adequate DNA samples from both the recipient and donor for the study of single nucleotide polymorphisms of IL28B were available from 96 cases and were the subjects of the present study. Various clinical factors related with virologic response including early virologic response (EVR and sustained virologic response (SVR were examined. Totally 51% presented with EVR and 44% achieved SVR. Presence of the major allele (TT in either the recipient or the donor corresponded to SVR of 53% and 48%. Presence of the minor allele (TG or GG corresponded to SVR of 26% and 32%. Multivariate analysis revealed that genotype of HCV or EVR, but not IL28B polymorphisms in either the recipient or donor, was an independent factor for achieving SVR. When virologic response to treatment was incorporated into analysis, the impact of IL28B polymorphism on virological clearance remained relative to other factors and was not significantly independent.
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays
Directory of Open Access Journals (Sweden)
Crenshaw Andrew
2009-01-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have emerged as the genetic marker of choice for mapping disease loci and candidate gene association studies, because of their high density and relatively even distribution in the human genomes. There is a need for systems allowing medium multiplexing (ten to hundreds of SNPs with high throughput, which can efficiently and cost-effectively generate genotypes for a very large sample set (thousands of individuals. Methods that are flexible, fast, accurate and cost-effective are urgently needed. This is also important for those who work on high throughput genotyping in non-model systems where off-the-shelf assays are not available and a flexible platform is needed. Results We demonstrate the use of a nanofluidic Integrated Fluidic Circuit (IFC - based genotyping system for medium-throughput multiplexing known as the Dynamic Array, by genotyping 994 individual human DNA samples on 47 different SNP assays, using nanoliter volumes of reagents. Call rates of greater than 99.5% and call accuracies of greater than 99.8% were achieved from our study, which demonstrates that this is a formidable genotyping platform. The experimental set up is very simple, with a time-to-result for each sample of about 3 hours. Conclusion Our results demonstrate that the Dynamic Array is an excellent genotyping system for medium-throughput multiplexing (30-300 SNPs, which is simple to use and combines rapid throughput with excellent call rates, high concordance and low cost. The exceptional call rates and call accuracy obtained may be of particular interest to those working on validation and replication of genome- wide- association (GWA studies.
Directory of Open Access Journals (Sweden)
Ming-Te Yeh
Full Text Available BACKGROUND: Enterovirus 71 (EV71 has emerged as a neuroinvasive virus responsible for several large outbreaks in the Asia-Pacific region while virulence determinant remains unexplored. PRINCIPAL FINDINGS: In this report, we investigated increased virulence of unadapted EV71 clinical isolate 237 as compared with isolate 4643 in mice. A fragment 12 nucleotides in length in stem loop (SL II of 237 5'-untranslated region (UTR visibly reduced survival time and rate in mice was identified by constructing a series of infectious clones harboring chimeric 5'-UTR. In cells transfected with bicistronic plasmids, and replicon RNAs, the 12-nt fragment of isolate 237 enhanced translational activities and accelerated replication of subgenomic EV71. Finally, single nucleotide change from cytosine to uridine at base 158 in this short fragment of 5'-UTR was proven to reduce viral translation and EV71 virulence in mice. Results collectively indicated a pivotal role of novel virulence determinant C158 on virus translation in vitro and EV71 virulence in vivo. CONCLUSIONS: These results presented the first reported virulence determinant in EV71 5'-UTR and first position discovered from unadapted isolates.
Association of single nucleotide polymorphisms with carcass traits in Nellore cattle.
Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D
2009-11-17
The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.
FUNCTIONAL IMPLICATIONS OF THE CLOCK 3111T/C SINGLE-NUCLEOTIDE POLYMORPHISM
Directory of Open Access Journals (Sweden)
Angela Renee Ozburn
2016-04-01
Full Text Available Circadian rhythm disruptions are prominently associated with Bipolar Disorder (BD. Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional-translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (Roybal et al., 2007. The Clock 3111T/C single-nucleotide polymorphism (SNP; rs1801260 is a genetic variation of the human Clock gene that is significantly associated with increased frequency of manic episodes in BD patients (Benedetti et al., 2003. The 3111T/C SNP is located in the 3’ untranslated region of the Clock gene. In this study, we sought to examine the functional implications of the human Clock 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock -/- knockout mice with pcDNA plasmids containing the human Clock gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24 hour time period. We found that the Clock3111C SNP resulted in higher mRNA levels than the Clock 3111T SNP. Further, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with Clock 3111C expression, indicating the 3’UTR SNP affects the expression, function and stability of Clock mRNA.
Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.
Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N
2013-01-01
Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.
Energy Technology Data Exchange (ETDEWEB)
Golan, Gali [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Ishchenko, Alexander A. [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France); Khassenov, Bekbolat [National Center for Biotechnology, Astana (Kazakhstan); Shoham, Gil, E-mail: gil2@vms.huji.ac.il [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Saparbaev, Murat K., E-mail: smurat@igr.fr [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France)
2010-03-01
Aerobic respiration generates reactive oxygen species (ROS) as a by-product of cellular metabolism which can damage DNA. The complex nature of oxidative DNA damage requires actions of several repair pathways. Oxidized DNA bases are substrates for two overlapping pathways: base excision repair (BER) and nucleotide incision repair (NIR). In the BER pathway a DNA glycosylase cleaves the N-glycosylic bond between the abnormal base and deoxyribose, leaving either an abasic site or single-stranded DNA break. Alternatively, in the NIR pathway, an apurinic/apyrimidinic (AP) endonuclease incises duplex DNA 5' next to oxidatively damaged nucleotide. The multifunctional Escherichia coli endonuclease IV (Nfo) is involved in both BER and NIR pathways. Nfo incises duplex DNA 5' of a damaged residue but also possesses an intrinsic 3' {yields} 5' exonuclease activity. Herein, we demonstrate that Nfo-catalyzed NIR and exonuclease activities can generate a single-strand gap at the 5' side of 5,6-dihydrouracil residue. Furthermore, we show that Nfo mutants carrying amino acid substitutions H69A and G149D are deficient in both NIR and exonuclease activities, suggesting that these two functions are genetically linked and governed by the same amino acid residues. The crystal structure of Nfo-H69A mutant reveals the loss of one of the active site zinc atoms (Zn1) and rearrangements of the catalytic site, but no gross changes in the overall enzyme conformation. We hypothesize that these minor changes strongly affect the DNA binding of Nfo. Decreased affinity may lead to a different kinking angle of the DNA helix and this in turn thwart nucleotide incision and exonuclease activities of Nfo mutants but to lesser extent of their AP endonuclease function. Based on the biochemical and genetic data we propose a model where nucleotide incision coupled to 3' {yields} 5' exonuclease activity prevents formation of lethal double-strand breaks when repairing bi
Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H
2013-02-01
Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.
Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.
Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima
2016-07-25
Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
Wang, Quan; Serban, Andrew J.; Wachter, Rebekka M.; Moerner, W. E.
2018-03-01
Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ˜0.1 s-1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.
Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang
2016-03-15
In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.
Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A
2015-07-01
The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia
2017-12-01
Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.
Detecting high-order interactions of single nucleotide polymorphisms using genetic programming.
Nunkesser, Robin; Bernholt, Thorsten; Schwender, Holger; Ickstadt, Katja; Wegener, Ingo
2007-12-15
Not individual single nucleotide polymorphisms (SNPs), but high-order interactions of SNPs are assumed to be responsible for complex diseases such as cancer. Therefore, one of the major goals of genetic association studies concerned with such genotype data is the identification of these high-order interactions. This search is additionally impeded by the fact that these interactions often are only explanatory for a relatively small subgroup of patients. Most of the feature selection methods proposed in the literature, unfortunately, fail at this task, since they can either only identify individual variables or interactions of a low order, or try to find rules that are explanatory for a high percentage of the observations. In this article, we present a procedure based on genetic programming and multi-valued logic that enables the identification of high-order interactions of categorical variables such as SNPs. This method called GPAS cannot only be used for feature selection, but can also be employed for discrimination. In an application to the genotype data from the GENICA study, an association study concerned with sporadic breast cancer, GPAS is able to identify high-order interactions of SNPs leading to a considerably increased breast cancer risk for different subsets of patients that are not found by other feature selection methods. As an application to a subset of the HapMap data shows, GPAS is not restricted to association studies comprising several 10 SNPs, but can also be employed to analyze whole-genome data. Software can be downloaded from http://ls2-www.cs.uni-dortmund.de/~nunkesser/#Software
Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H
2008-03-01
The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.
Directory of Open Access Journals (Sweden)
Heinz Ruth A
2008-01-01
Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop
Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge
2006-12-01
The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.
International Nuclear Information System (INIS)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.
1991-01-01
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation
Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.
Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C
2008-04-01
Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.
Directory of Open Access Journals (Sweden)
Arran Schlosberg
2014-05-01
Full Text Available Improvements in speed and cost of genome sequencing are resulting in increasing numbers of novel non-synonymous single nucleotide polymorphisms (nsSNPs in genes known to be associated with disease. The large number of nsSNPs makes laboratory-based classification infeasible and familial co-segregation with disease is not always possible. In-silico methods for classification or triage are thus utilised. A popular tool based on multiple-species sequence alignments (MSAs and work by Grantham, Align-GVGD, has been shown to underestimate deleterious effects, particularly as sequence numbers increase. We utilised the DEFLATE compression algorithm to account for expected variation across a number of species. With the adjusted Grantham measure we derived a means of quantitatively clustering known neutral and deleterious nsSNPs from the same gene; this was then used to assign novel variants to the most appropriate cluster as a means of binary classification. Scaling of clusters allows for inter-gene comparison of variants through a single pathogenicity score. The approach improves upon the classification accuracy of Align-GVGD while correcting for sensitivity to large MSAs. Open-source code and a web server are made available at https://github.com/aschlosberg/CompressGV.
A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff
Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.
2012-01-01
We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672
Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo
2016-04-01
We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.
Kalinowski, S T; Novak, B J; Drinan, D P; Jennings, R deM; Vu, N V
2011-03-01
We describe 12 diagnostic single nucleotide polymorphism (SNP) assays for use in species identification among rainbow and cutthroat trout: five of these loci have alleles unique to rainbow trout (Oncorhynchus mykiss), three unique to westslope cutthroat trout (O. clarkii lewisi) and four unique to Yellowstone cutthroat trout (O. clarkii bouvieri). These diagnostic assays were identified using a total of 489 individuals from 26 populations and five fish hatchery strains. © 2010 Blackwell Publishing Ltd.
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.
Rotherham, D; Harbison, S A
2011-04-15
Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Raghavan Chinnadurai
2013-01-01
Full Text Available The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS, linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs.
Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin
2004-01-01
Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145
Directory of Open Access Journals (Sweden)
Bleecker Eugene R
2004-10-01
Full Text Available Abstract Background Cystic fibrosis (CF lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1 > 70% and Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity.
Current trend of annotating single nucleotide variation in humans--A case study on SNVrap.
Li, Mulin Jun; Wang, Junwen
2015-06-01
As high throughput methods, such as whole genome genotyping arrays, whole exome sequencing (WES) and whole genome sequencing (WGS), have detected huge amounts of genetic variants associated with human diseases, function annotation of these variants is an indispensable step in understanding disease etiology. Large-scale functional genomics projects, such as The ENCODE Project and Roadmap Epigenomics Project, provide genome-wide profiling of functional elements across different human cell types and tissues. With the urgent demands for identification of disease-causal variants, comprehensive and easy-to-use annotation tool is highly in demand. Here we review and discuss current progress and trend of the variant annotation field. Furthermore, we introduce a comprehensive web portal for annotating human genetic variants. We use gene-based features and the latest functional genomics datasets to annotate single nucleotide variation (SNVs) in human, at whole genome scale. We further apply several function prediction algorithms to annotate SNVs that might affect different biological processes, including transcriptional gene regulation, alternative splicing, post-transcriptional regulation, translation and post-translational modifications. The SNVrap web portal is freely available at http://jjwanglab.org/snvrap. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Changxu Tian
2014-04-01
Full Text Available Growth hormone (GH has been considered as a candidate gene for growth traits in fish. In this study, polymorphisms of the GH gene were evaluated for associations with growth traits in 282 Siniperca chuatsi individuals. Using directly sequencing, four single nucleotide polymorphisms (SNPs were identified in GH gene, with two mutations in intron 4 (g.4940A>C, g.4948A>T, one mutation in exon 5 (g.5045T>C and one in intron 5 (g.5234T>G. Notably, three of them were significantly associated with growth performance, particularly for g.4940A>C which was highly correlated with all the four growth traits. In conclusion, our results demonstrated that these SNPs in GH gene could influence growth performance of S.chuatsi and could be used for marker-assisted selection (MAS in this species.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick
2015-05-01
DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Zhu, L-F; Friák, M; Lymperakis, L; Titrian, H; Aydin, U; Janus, A M; Fabritius, H-O; Ziegler, A; Nikolov, S; Hemzalová, P; Raabe, D; Neugebauer, J
2013-04-01
We employ ab initio calculations and investigate the single-crystalline elastic properties of (Ca,Mg)CO3 crystals covering the whole range of concentrations from pure calcite CaCO3 to pure magnesite MgCO3. Studying different distributions of Ca and Mg atoms within 30-atom supercells, our theoretical results show that the energetically most favorable configurations are characterized by elastic constants that nearly monotonously increase with the Mg content. Based on the first principles-derived single-crystalline elastic anisotropy, the integral elastic response of (Ca,Mg)CO3 polycrystals is determined employing a mean-field self-consistent homogenization method. As in case of single-crystalline elastic properties, the computed polycrystalline elastic parameters sensitively depend on the chemical composition and show a significant stiffening impact of Mg atoms on calcite crystals in agreement with the experimental findings. Our analysis also shows that it is not advantageous to use a higher-scale two-phase mix of stoichiometric calcite and magnesite instead of substituting Ca atoms by Mg ones on the atomic scale. Such two-phase composites are not significantly thermodynamically favorable and do not provide any strong additional stiffening effect. Copyright © 2013 Elsevier Ltd. All rights reserved.
Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...
Pyrrolidine nucleotide analogs with a tunable conformation
Czech Academy of Sciences Publication Activity Database
Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek
2014-01-01
Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205
Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update
Directory of Open Access Journals (Sweden)
Ishfaq A. Sheikh
2016-10-01
Full Text Available Abstract Background Preterm birth (PTB, birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 % of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs that are reported to be associated with PTB. Results A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007–2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. Conclusions A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.
Effects of Single Nucleotide Polymorphism Marker Density on Haplotype Block Partition
Directory of Open Access Journals (Sweden)
Sun Ah Kim
2016-12-01
Full Text Available Many researchers have found that one of the most important characteristics of the structure of linkage disequilibrium is that the human genome can be divided into non-overlapping block partitions in which only a small number of haplotypes are observed. The location and distribution of haplotype blocks can be seen as a population property influenced by population genetic events such as selection, mutation, recombination and population structure. In this study, we investigate the effects of the density of markers relative to the full set of all polymorphisms in the region on the results of haplotype partitioning for five popular haplotype block partition methods: three methods in Haploview (confidence interval, four gamete test, and solid spine, MIG++ implemented in PLINK 1.9 and S-MIG++. We used several experimental datasets obtained by sampling subsets of single nucleotide polymorphism (SNP markers of chromosome 22 region in the 1000 Genomes Project data and also the HapMap phase 3 data to compare the results of haplotype block partitions by five methods. With decreasing sampling ratio down to 20% of the original SNP markers, the total number of haplotype blocks decreases and the length of haplotype blocks increases for all algorithms. When we examined the marker-independence of the haplotype block locations constructed from the datasets of different density, the results using below 50% of the entire SNP markers were very different from the results using the entire SNP markers. We conclude that the haplotype block construction results should be used and interpreted carefully depending on the selection of markers and the purpose of the study.
Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui
2018-01-01
Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352
Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.
2017-05-01
Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.
Aslani, Saeed; Mahmoudi, Mahdi; Salmaninejad, Arash; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima
2017-06-01
Juvenile rheumatoid arthritis (JRA) is a common chronic systemic autoimmune disease in children. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene are suspected to have association with the risk of autoimmune diseases. Previous investigations have indicated that the STAT4 rs7574865 T allele was significantly associated with rheumatoid arthritis. In this study, we aimed to evaluate the association of STAT4 SNPs with JRA in Iranian population. T allele of STAT4 rs7574865 SNP was less frequent in patients than in controls, and the difference was not significant (p = 0.19, OR = 0.72, 95% CI: 0.44 -1.17). In addition, G allele of this SNP was frequent but not significant in JRA patients (p = 0.19, OR = 1.38, 95% CI: 0.85-2.25). Neither alleles nor genotypes of rs7601754 SNP of STAT4 gene demonstrated associations with JRA. We recognize that gene variants of STAT4 did not affect JRA susceptibility in Iranian population.
Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen
2010-03-01
Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.
Directory of Open Access Journals (Sweden)
Sangmin Lee
2014-09-01
Full Text Available Some somatic single nucleotide variants (SNVs are thought to be pathogenic, leading to neurological disease. We hypothesized that heterogeneous nuclear ribonuclear protein A1 (hnRNP A1, an autoantigen associated with multiple sclerosis (MS would contain SNVs. MS patients develop antibodies to hnRNP A1293-304, an epitope within the M9 domain (AA268-305 of hnRNP A1. M9 is hnRNP A1’s nucleocytoplasmic transport domain, which binds transportin-1 (TPNO-1 and allows for hnRNP A1’s transport into and out of the nucleus. Genomic DNA sequencing of M9 revealed nine novel SNVs that resulted in an amino acid substitution in MS patients that were not present in controls. SNVs occurred within the TPNO-1 binding domain (hnRNP A1268-289 and the MS IgG epitope (hnRNP A1293-304, within M9. In contrast to the nuclear localization of wild type (WT hnRNP A1, mutant hnRNP A1 mis-localized to the cytoplasm, co-localized with stress granules and caused cellular apoptosis. Whilst WT hnRNP A1 bound TPNO-1, mutant hnRNP A1 showed reduced TPNO-1 binding. These data suggest SNVs in hnRNP A1 might contribute to pathogenesis of MS.
Directory of Open Access Journals (Sweden)
Sangmin Lee
2014-06-01
Full Text Available Some somatic single nucleotide variants (SNVs are thought to be pathogenic, leading to neurological disease. We hypothesized that heterogeneous nuclear ribonuclear protein A1 (hnRNP A1, an autoantigen associated with multiple sclerosis (MS would contain SNVs. MS patients develop antibodies to hnRNP A1293-304, an epitope within the M9 domain (AA268-305 of hnRNP A1. M9 is hnRNP A1’s nucleocytoplasmic transport domain, which binds transportin-1 (TPNO-1 and allows for hnRNP A1’s transport into and out of the nucleus. Genomic DNA sequencing of M9 revealed nine novel SNVs that resulted in an amino acid substitution in MS patients that were not present in controls. SNVs occurred within the TPNO-1 binding domain (hnRNP A1268-289 and the MS IgG epitope (hnRNP A1293-304, within M9. In contrast to the nuclear localization of wild type (WT hnRNP A1, mutant hnRNP A1 mis-localized to the cytoplasm, co-localized with stress granules and caused cellular apoptosis. Whilst WT hnRNP A1 bound TPNO-1, mutant hnRNP A1 showed reduced TPNO-1 binding. These data suggest SNVs in hnRNP A1 might contribute to pathogenesis of MS.
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses.
Directory of Open Access Journals (Sweden)
Cristina J Wittkopp
2016-10-01
Full Text Available Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188 that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses.
Institute of Scientific and Technical Information of China (English)
ZHAO Fang-ming; LIU Gui-fu; ZHU Hai-tao; DING Xiao-hua; ZENG Rui-zhen; ZHANG Ze-min; LI Wen-tao; ZHANG Gui-quan
2008-01-01
Tiller is one of the most important agronomic traits which influences quantity and quality of effective panicles and finally influences yield in rice.It is important to understand "static" and "dynamic" information of the QTLs for tillers in rice.This work was the first time to simultaneously map unconditional and conditional QTLs for tiller numbers at various stages by using single segment substitution lines in rice.Fourteen QTLs for tiller number,distributing on the corresponding substitution segments of chromosomes 1,2,3,4,6,7 and 8 were detected.Both the number and the effect of the QTLs for tiller number were various at different stages,from 6 to 9 in the number and from 1.49 to 3.49 in the effect,respectively. Tiller number QTLs expressed in a time order,mainly detected at three stages of 0-7d,14-21d and 35-42d after transplanting with 6 positive,9 random and 6 negative expressing QTLs,respectively.Each of the QTLs expressed one time at least during the whole duration of rice.The tiller number at a specific stage was determined by sum of QTL effects estimated by the unconditional method,while the increasing or decreasing number in a given time interval was controlled by the total of QTL effects estimated by the conditional method.These results demonstrated that it is highly effective and accurate for mapping of the QTLs by using single segment substitution lines and the conditional analysis methodology.
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.
Directory of Open Access Journals (Sweden)
Chandra Shekhar Pareek
Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu
2017-01-01
RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive
van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick
2012-03-27
In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society
Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron
2015-11-14
Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and
Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S
2017-06-26
Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
2010-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.
Lavoie, Mathieu; Abou Elela, Sherif
2008-08-19
Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.
Evidence for single nucleotide polymorphisms and their association with bipolar disorder
Directory of Open Access Journals (Sweden)
Szczepankiewicz A
2013-10-01
Full Text Available Aleksandra Szczepankiewicz1,21Laboratory of Molecular and Cell Biology, 2Department of Psychiatric Genetics, Poznan University of Medical Sciences, Poznan, PolandAbstract: Bipolar disorder (BD is a complex disorder with a number of susceptibility genes and environmental risk factors involved in its pathogenesis. In recent years, huge progress has been made in molecular techniques for genetic studies, which have enabled identification of numerous genomic regions and genetic variants implicated in BD across populations. Despite the abundance of genetic findings, the results have often been inconsistent and not replicated for many candidate genes/single nucleotide polymorphisms (SNPs. Therefore, the aim of the review presented here is to summarize the most important data reported so far in candidate gene and genome-wide association studies. Taking into account the abundance of association data, this review focuses on the most extensively studied genes and polymorphisms reported so far for BD to present the most promising genomic regions/SNPs involved in BD. The review of association data reveals evidence for several genes (SLC6A4/5-HTT [serotonin transporter gene], BDNF [brain-derived neurotrophic factor], DAOA [D-amino acid oxidase activator], DTNBP1 [dysbindin], NRG1 [neuregulin 1], DISC1 [disrupted in schizophrenia 1] to be crucial candidates in BD, whereas numerous genome-wide association studies conducted in BD indicate polymorphisms in two genes (CACNA1C [calcium channel, voltage-dependent, L type, alpha 1C subunit], ANK3 [ankyrin 3] replicated for association with BD in most of these studies. Nevertheless, further studies focusing on interactions between multiple candidate genes/SNPs, as well as systems biology and pathway analyses are necessary to integrate and improve the way we analyze the currently available association data.Keywords: candidate gene, genome-wide association study, SLC6A4, BDNF, DAOA, DTNBP1, NRG1, DISC1
EnsembleGASVR: A novel ensemble method for classifying missense single nucleotide polymorphisms
Rapakoulia, Trisevgeni
2014-04-26
Motivation: Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem ofmissing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. Results: To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a twostep algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. © The Author 2014.
Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis
Directory of Open Access Journals (Sweden)
Rabinowicz Pablo D
2010-01-01
Full Text Available Abstract Background Castor bean (Ricinus communis is an agricultural crop and garden ornamental that is widely cultivated and has been introduced worldwide. Understanding population structure and the distribution of castor bean cultivars has been challenging because of limited genetic variability. We analyzed the population genetics of R. communis in a worldwide collection of plants from germplasm and from naturalized populations in Florida, U.S. To assess genetic diversity we conducted survey sequencing of the genomes of seven diverse cultivars and compared the data to a reference genome assembly of a widespread cultivar (Hale. We determined the population genetic structure of 676 samples using single nucleotide polymorphisms (SNPs at 48 loci. Results Bayesian clustering indicated five main groups worldwide and a repeated pattern of mixed genotypes in most countries. High levels of population differentiation occurred between most populations but this structure was not geographically based. Most molecular variance occurred within populations (74% followed by 22% among populations, and 4% among continents. Samples from naturalized populations in Florida indicated significant population structuring consistent with local demes. There was significant population differentiation for 56 of 78 comparisons in Florida (pairwise population ϕPT values, p Conclusion Low levels of genetic diversity and mixing of genotypes have led to minimal geographic structuring of castor bean populations worldwide. Relatively few lineages occur and these are widely distributed. Our approach of determining population genetic structure using SNPs from genome-wide comparisons constitutes a framework for high-throughput analyses of genetic diversity in plants, particularly in species with limited genetic diversity.
International Nuclear Information System (INIS)
Schmidheini, T.; Moesch, H.U.; Braus, G.; Evans, J.N.S.
1990-01-01
Chorismate mutase, a branch-point enzyme in the aromatic amino acid pathway of Saccharomyces cerevisiae, and also a mutant chorismate mutase with a single amino acid substitution in the C-terminal part of the protein have been purified approximately 20-fold and 64-fold from overproducing strains, respectively. The wild-type enzyme is activated by tryptophan and subject to feedback inhibition by tyrosine, whereas the mutant enzyme does not respond to activation by tryptophan nor inhibition by tyrosine. Both enzymes are dimers consisting of two identical subunits of M r 30,000, each one capable of binding one substrate and one activator molecule. Each subunit of the wild-type enzyme also binds one inhibitor molecule, whereas the mutant enzyme lost this ability. The enzyme reaction was observed by 1 H NMR and shows a direct and irreversible conversion of chorismate to prephenate without the accumulation of any enzyme-free intermediates. The kinetic data of the wild-type chorismate mutase show positive cooperativity toward the substrate with a Hill coefficient of 1.71 and a [S] 0.5 value of 4.0 mM. In the presence of the activator tryptophan, the cooperativity is lost. The enzyme has an [S] 0.5 value of 1.2 mM in the presence of 10 μM tryptophan and an increased [S] 0.5 value of 8.6 mM in the presence of 300 μM tyrosine. In the mutant enzyme, a loss of the cooperativity was observed, and [S] 0.5 was reduced to 1.0 mM. This enzyme is therefore locked in the activated state by a single amino acid substitution
Directory of Open Access Journals (Sweden)
Johnson Peter W
2006-03-01
Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
Energy Technology Data Exchange (ETDEWEB)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.
2016-12-21
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.
International Nuclear Information System (INIS)
Zhang, Xinsheng; Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J.; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A.; Parks, Christopher L.
2015-01-01
Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xinsheng, E-mail: xzhang@iavi.org [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States); Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Anzala, Omu [Kenya AIDS Vaccine Initiative (KAVI)-Institute of Clinical Research, Nairobi (Kenya); Sanders, Eduard J. [Centre for Geographic Medicine Research, Kenya Medical Research Institute (KEMRI), Kilifi, Kenya & Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Headington (United Kingdom); Kamali, Anatoli [MRC/UVRI Uganda Virus Research Unit on AIDS, Masaka and Entebbe (Uganda); Karita, Etienne [Projet San Francisco, Kigali (Rwanda); Allen, Susan [Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Fast, Pat [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Gilmour, Jill [Human Immunology Laboratory, International AIDS Vaccine Initiative, London (United Kingdom); Price, Matt A. [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Department of Epidemiology and Biostatistics, University of California at San Francisco, San Francisco, CA (United States); Parks, Christopher L. [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States)
2015-08-15
Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.
DEFF Research Database (Denmark)
Andersen, Gitte; Burgdorf, Kristoffer Sølvsten; Sparsø, Thomas
2008-01-01
been largely successful. We related seven frequent AHSG tag single nucleotide polymorphisms to a range of metabolic traits, including type 2 diabetes, obesity, and dyslipidemia. RESEARCH DESIGN AND METHODS: The polymorphisms were genotyped in 7,683 white Danish subjects using Taqman allelic...... with dyslipidemia (P = 0.003 and P(corr) = 0.009). Thr248Met (rs4917) tended to associate with lower fasting and post-oral glucose tolerance test serum insulin release (P = 0.02, P(corr) = 0.1 for fasting and P = 0.04, P(corr) = 0.2 for area under the insulin curve) and improved insulin sensitivity estimated...
Directory of Open Access Journals (Sweden)
Daniel Amoako-Sakyi
2016-01-01
Full Text Available Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974, total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP. Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001, severe malarial anemia (OR = 0.18, P < 0.001, and cerebral malaria (OR = 0.39, P = 0.022. Levels of total IgE significantly differed among malaria phenotypes (P = 0.044 and rs3024974 genotypes (P = 0.037. Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis.
Directory of Open Access Journals (Sweden)
Gang Li
Full Text Available In order to investigate the influence of the molecular karyotype based on single nucleotide polymorphism (SNP microarray on embryonic development potential in preimplantation genetic diagnosis (PGD, we retrospectively analyzed the clinical data generated by PGD using embryos retrieved from parents with chromosome rearrangements in our center. In total, 929 embryos from 119 couples had exact diagnosis and development status. The blastocyst formation rate of balanced molecular karyotype embryos was 56.6% (276/488, which was significantly higher than that of genetic imbalanced embryos 24.5% (108/441 (P35 respectively. Blastocyst formation rates of male and female embryos were 44.5% (183/411 and 38.8% (201/518 respectively, with no significant difference between them (P>0.05. The rates of balanced molecular karyotype embryos vary from groups of embryos with different cell numbers at 68 hours after insemination. The blastocyst formation rate of embryos with 6-8 cells (48.1% was significantly higher than that of embryos with 8 cells (42.9% (P8 cells, embryos with 6-8 blastomeres have higher rate of balanced molecular karyotype and blastocyst formation.
Directory of Open Access Journals (Sweden)
Stephen eSalton
2013-08-01
Full Text Available The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs, where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs, with neuropsychiatric, endocrine and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A of the human brain-derived neurotrophic factor (BDNF gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.
Directory of Open Access Journals (Sweden)
Puji Rianti
2015-10-01
Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.
Directory of Open Access Journals (Sweden)
J. H. Ha
2015-07-01
Full Text Available The purpose of this study was to characterize genetic architecture of behavior patterns in Sapsaree dogs. The breed population (n = 8,256 has been constructed since 1990 over 12 generations and managed at the Sapsaree Breeding Research Institute, Gyeongsan, Korea. Seven behavioral traits were investigated for 882 individuals. The traits were classified as a quantitative or a categorical group, and heritabilities (h2 and variance components were estimated under the Animal model using ASREML 2.0 software program. In general, the h2 estimates of the traits ranged between 0.00 and 0.16. Strong genetic (rG and phenotypic (rP correlations were observed between nerve stability, affability and adaptability, i.e. 0.9 to 0.94 and 0.46 to 0.68, respectively. To detect significant single nucleotide polymorphism (SNP for the behavioral traits, a total of 134 and 60 samples were genotyped using the Illumina 22K CanineSNP20 and 170K CanineHD bead chips, respectively. Two datasets comprising 60 (Sap60 and 183 (Sap183 samples were analyzed, respectively, of which the latter was based on the SNPs that were embedded on both the 22K and 170K chips. To perform genome-wide association analysis, each SNP was considered with the residuals of each phenotype that were adjusted for sex and year of birth as fixed effects. A least squares based single marker regression analysis was followed by a stepwise regression procedure for the significant SNPs (p<0.01, to determine a best set of SNPs for each trait. A total of 41 SNPs were detected with the Sap183 samples for the behavior traits. The significant SNPs need to be verified using other samples, so as to be utilized to improve behavior traits via marker-assisted selection in the Sapsaree population.
Directory of Open Access Journals (Sweden)
Stefania Dall'Olio
2010-01-01
Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.
Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto
2010-01-01
Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663
Directory of Open Access Journals (Sweden)
Yan Zhao
2015-01-01
Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.
Li, Hengxin; Chen, Jun; Zhang, RuiZhi; Xu, Ran; Zhang, Zhe; Ren, Le; Yang, Qi; Tian, Yumei; Li, Daxu
2017-12-22
Single nucleotide polymorphisms (SNPs) in ZNF208 may be associated with susceptibility to Hepatitis B virus (HBV). In the current study, we analyzed the association between ZNF208 SNPs and risk of HBV in 242 HBV patients and 300 healthy subjects from the Xi'an area of Chinese Han Population. Of the five SNPs examined, rs2188971 (OR: 1.36, 95% CI: 1.04-1.76, P = 0.022), rs8103163 (OR: 1.40, 95% CI: 1.08-1.82, P = 0.010) and rs7248488 (OR: 1.38, 95% CI: 1.07-1.79, P = 0.014) were correlated with HBV susceptibility based on Chi-square tests. After the P -values were adjusted by Bonferroni correction, there only rs8103163 ( P = 0.050) was slightly with increased HBV risk. Additionally, haplotype A rs2188972 T rs2188971 A rs8103163 A rs7248488 (OR = 1.42; 95% C I, 1.10-1.85; P = 0.008) was found to increase susceptibility of suffering from HBV. These findings suggest that ZNF208 polymorphisms may contribute to the development of HBV.
Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein
2011-10-01
The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.
DEFF Research Database (Denmark)
Stegger, Jakob Gerhard; Schmidt, Erik Berg; Tjonneland, Anne
2012-01-01
Background: Interleukin-1B (IL-1B) is a key pro-inflammatory cytokine that has been associated with the development of atherosclerosis and myocardial infarction. However, the prospective associations between functional single nucleotide polymorphisms (SNPs) in IL1B and incident acute coronary...... and 234 women). All cases were validated by review of medical records, and information on covariates was collected by study technicians. The study was conducted according to a case-cohort study design including ACS cases and a sex-stratified sub cohort of 1663 participants drawn randomly from the entire...... IL1B haplotypes and risk factors, respectively. Conclusions/Significance: Genetic variation in the promoter region of IL1B may not be associated with incident ACS in men or women above the age of 50 years....
Photophysical investigation of cyano-substituted terrylenediimide derivatives.
Kennes, Koen; Baeten, Yannick; Vosch, Tom; Sempels, Wouter; Yordanov, Stoyan; Stappert, Sebastian; Chen, Long; Müllen, Klaus; Hofkens, Johan; Van der Auweraer, Mark; Fron, Eduard
2014-12-18
Two new terrylenediimide (TDI) chromophores with cyano substituents in the bay and core area (BCN-TDI and OCN-TDI, respectively) have been characterized by a wide range of techniques, and their applicability for stimulated emission depletion (STED) microscopy has been tested. By cyano substitution an increase of the fluorescence quantum yield and a decrease of the nonradiative rate constant is achieved and attributed to a reduced charge-transfer character of the excited state due to a lower electron density of the TDI core. For BCN-TDI, the substitution in the bay area induces a strong torsional twist in the molecule which, similar to phenoxy bay-perylenediimide (PDI), has a strong effect on the fluorescence lifetime but appears to prevent the aggregation that is observed for OCN-TDI. The single-molecule photobleaching stability of BCN- and OCN-TDI is lower than that of a reference TDI without cyano substitution (C7-TDI), although less so for OCN-TDI. The photophysical properties of the excited singlet state are only slightly influenced by the cyano groups. The observed intense stimulated emission, the pump-dump-probe experiments, and STED single-molecule imaging indicate that STED experiments with the cyano-substituted TDIs are possible. However, because of aggregation and more efficient photobleaching, the performance of BCN- and OCN-TDI is worse than that of the reference compound without cyano groups (C7-TDI). Bay-substituted TDIs are less suitable for STED microscopy.
Directory of Open Access Journals (Sweden)
Tammy M K Cheng
Full Text Available Recent analyses of human genome sequences have given rise to impressive advances in identifying non-synonymous single nucleotide polymorphisms (nsSNPs. By contrast, the annotation of nsSNPs and their links to diseases are progressing at a much slower pace. Many of the current approaches to analysing disease-associated nsSNPs use primarily sequence and evolutionary information, while structural information is relatively less exploited. In order to explore the potential of such information, we developed a structure-based approach, Bongo (Bonds ON Graph, to predict structural effects of nsSNPs. Bongo considers protein structures as residue-residue interaction networks and applies graph theoretical measures to identify the residues that are critical for maintaining structural stability by assessing the consequences on the interaction network of single point mutations. Our results show that Bongo is able to identify mutations that cause both local and global structural effects, with a remarkably low false positive rate. Application of the Bongo method to the prediction of 506 disease-associated nsSNPs resulted in a performance (positive predictive value, PPV, 78.5% similar to that of PolyPhen (PPV, 77.2% and PANTHER (PPV, 72.2%. As the Bongo method is solely structure-based, our results indicate that the structural changes resulting from nsSNPs are closely associated to their pathological consequences.
Directory of Open Access Journals (Sweden)
Ling Z
2018-02-01
Full Text Available Zhixin Ling,1,2,* Zonghao You,1,2,* Ling Hu,3 Lei Zhang,1,2 Yiduo Wang,1,2 Minhao Zhang,1,2 Guangyuan Zhang,1,2 Shuqiu Chen,1,2 Bin Xu,1,2 Ming Chen1,2 1Department of Urology, Affiliated Zhongda Hospital of Southeast University, Nanjing, China; 2Surgical Research Center, Institute of Urology, Medical School of Southeast University, Nanjing, China; 3Department of Nephrology, People’s Hospital of Wuxi City, Wuxi, China *These authors contributed equally to this work Background: Although the relationship between several single nucleotide polymorphisms (SNPs of the oncogene EZH2 and cancer risk has been assessed by some case–control studies, results of subsequent studies are controversial. Sample sizes from single-center studies are also limited, thereby providing unreliable findings. Hence, we conducted a comprehensive search and meta-analysis to evaluate the associations between EZH2 SNPs and cancer risk.Materials and methods: A comprehensive literature search for studies focusing on EZH2 SNPs and cancer risk was conducted on PubMed, Web of Science, Embase, and China National Knowledge Infrastructure online databases. Genotype data were extracted and examined through a meta-analysis, and pooled odds ratios (ORs with 95% CIs were used to assess the corresponding associations. Sensitivity analysis, publication bias assessment, and heterogeneity test were performed using STATA 12.0.Results: Twelve eligible studies were included in this meta-analysis. The association of 4 SNPs, namely, rs887569, rs2302427, rs3757441, and rs41277434, in the EZH2 locus with cancer risk was evaluated. Five studies (1,794 cases and 1,878 controls indicated that rs887569 was related to a decreased cancer risk (CTTT/CC: OR =0.849, 95% CI: [0.740 to 0.973], P=0.019; TT/CCCT: OR =0.793, 95% CI: [0.654 to 0.962], P=0.019. Seven studies (2,408 cases and 2,910 controls showed that rs2302427 was linked to a decreased cancer risk (GG/CC: OR =0.562, 95% CI: [0.400 to 0.792], P
Simvastatin-induced nocturnal leg pain disappears with pravastatin substitution
Directory of Open Access Journals (Sweden)
Stojaković Nataša
2013-01-01
Full Text Available Introduction. Statins have similar side effects that do not always occur at the same rate among the various statins. We present a case of simvastatin-induced muscle toxicity that disappeared when pravastatin was substituted for the original drug. Case Outline. A 74-year-old male, a nonsmoker, complained of severe nocturnal leg cramps. The patient also complained that similar painful cramping occurred when he walked rapidly or jogged. Because some components of his lipid panel exceeded the ‘desirable’ range, and as he had a history of myocardial infarction, his family physician prescribed simvastatin (40 mg/day. The patient had taken this medication for the past eight years. The painful nocturnal episodes started two years ago and affected either one or the other leg. Four months ago we discontinued his simvastatin and prescribed pravastatin (80 mg/day. At a follow-up visit six weeks later, the patient reported that his leg pains at night and the pain experienced after brisk walking had disappeared. Four months after the substitution of pravastatin for simvastatin, the patient reported that his complete lack of symptoms had continued. Conclusion. These painful muscle cramps were probably caused by an inadequate vascular supply to the calf and foot muscles. Perhaps a combination of advanced age and atherosclerotic changes created a predisposition for the simvastatin-induced leg cramps. Pravastatin differs from simvastatin in several ways. It is not metabolized by cytochrome P450 (CYP 3A4 oxidases, and thus is not influenced by CYP 3A4 inhibitors like simvastatin. Also, simvastatin is associated with single-nucleotide polymorphisms located within the SLCO1B1 gene on the chromosome 12 and established myopathy, while pravastatin lacks this association. These differences may contribute to increased tolerance to pravastatin in this particular case.
Simvastatin-lnduced nocturnal leg pain disappears with pravastatin substitution.
Stojaković, Natasa; Igić, Rajko
2013-01-01
Statins have similar side effects that do not always occur at the same rate among the various statins. We present a case of simvastatin-induced muscle toxicity that disappeared when pravastatin was substituted for the original drug. A 74-year-old male, a nonsmoker, complained of severe nocturnal leg cramps. The patient also complained that similar painful cramping occurred when he walked rapidly or jogged. Because some components of his lipid panel exceeded the'desirable' range, and as he had a history of myocardial infarction, his family physician prescribed simvastatin (40 mg/day). The patient had taken this medication for the past eight years. The painful nocturnal episodes started two years ago and affected either one or the other leg. Four months ago we discontinued his simvastatin and prescribed pravastatin (80 mg/day). At a follow-up visit six weeks later, the patient reported that his leg pains at night and the pain experienced after brisk walking had disappeared. Four months after the substitution of pravastatin for simvastatin, the patient reported that his complete lack of symptoms had continued. These painful muscle cramps were probably caused by an inadequate vascular supply to the calf and foot muscles. Perhaps a combination of advanced age and atherosclerotic changes created a predisposition for the simvastatin-induced leg cramps. Pravastatin differs from simvastatin in several ways.l It is not metabolized by cytochrome P450 (CYP) 3A4 oxidases, and thus is not influenced by CYP 3A4 inhibitors like simvastatin. Also, simvastatin is associated with single-nucleotide polymorphisms located within the SLCO1B1 gene on the chromosome 12 and established myopathy, while pravastatin lacks this association. These differences may contribute to increased tolerance to pravastatin in this particular case.
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na
2013-03-15
We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
DEFF Research Database (Denmark)
Yin, Jiaoyang; Vogel, Ulla Birgitte; Ma, Yegang
2008-01-01
To evaluate the joint effect of nine single nucleotide polymorphisms for three DNA repair genes in the region of chromosome 19q13.2-3 on susceptibility of lung cancer in a Chinese population, we conducted a hospital-based case-control study consisting of 247 lung cancer cases and 253 cancer......-free controls matched on age, gender and ethnicity. Associations between the haplotypes and susceptibility of lung cancer were tested. The global test of haplotype association revealed a statistically significant difference in the haplotype distribution between cases and controls (global test: chi(2) = 60.45, d...
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.
Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine
2003-10-01
Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.
Directory of Open Access Journals (Sweden)
Michael J. Fedoruk
2013-11-01
Full Text Available Seed shape, color, and pattern of lentil ( Medik. subsp. are important quality traits as they determine market class and possible end uses. A recombinant inbred line population was phenotyped for seed dimensions over multiple site–years and classified according to cotyledon and seed coat color and pattern. The objectives were to determine the heritability of seed dimensions, identify genomic regions controlling these dimensions, and map seed coat and cotyledon color genes. A genetic linkage map consisting of 563 single nucleotide polymorphisms, 10 simple sequence repeats, and four seed color loci was developed for quantitative trait loci (QTL analysis. Loci for seed coat color and pattern mapped to linkage groups 2 (, 3 (, and 6 ( while the cotyledon color locus ( mapped to linkage group 1. The broad sense heritability estimates were high for seed diameter (broad-sense heritability [] = 0.92 and seed plumpness ( = 0.94 while seed thickness ( = 0.60 and days to flowering ( = 0.45 were more moderate. There were significant seed dimension QTL on six of the seven linkage groups. The most significant QTL for diameter and plumpness was found at the cotyledon color locus (. The markers identified in this study can be used to help enrich breeding populations for desired seed quality characteristics, thereby increasing efficiency in the lentil breeding program.
Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S
2016-06-01
Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.
Anderson, Eric C; Ng, Thomas C
2016-02-01
We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Tess V Clendenen
Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.
Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping
2018-05-01
Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.
Martínez-Herrero, Sonia; Martínez, Alfredo
2013-04-01
The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Directory of Open Access Journals (Sweden)
Wei Lu
2012-06-01
Full Text Available Single nucleotide polymorphisms (SNPs are currently the marker of choice in a variety of genetic studies. Using the high resolution melting (HRM genotyping approach, 101 gene-based SNP markers were developed for Apostichopus japonicus, a sea cucumber species with economic significance for the aquaculture industry in East Asian countries. HRM analysis revealed that all the loci showed polymorphisms when evaluated using 40 A. japonicus individuals collected from a natural population. The minor allele frequency ranged from 0.035 to 0.489. The observed and expected heterozygosities ranged from 0.050 to 0.833 and 0.073 to 0.907, respectively. Thirteen loci were found to depart significantly from Hardy–Weinberg equilibrium (HWE after Bonferroni corrections. Significant linkage disequilibrium (LD was detected in one pair of markers. These SNP markers are expected to be useful for future quantitative trait loci (QTL analysis, and to facilitate marker-assisted selection (MAS in A. japonicus.
Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc
2013-12-01
Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.
Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U
2013-11-01
Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D
2017-08-25
Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Association of FLG single nucleotide variations with clinical phenotypes of atopic dermatitis.
Directory of Open Access Journals (Sweden)
Myungshin Kim
Full Text Available FLG encodes a large protein called profilaggrin, which plays a key role in maintaining an effective skin barrier against the environment. In this study, we identified FLG single nucleotide variations (FLG-SNVs and evaluated the association of FLG-SNVs with clinical phenotypes including atopic dermatitis (AD-associated minor clinical features, presence of specific allergic sensitization, and serum parameters.Eighty-one Korean patients with AD were enrolled. AD-associated minor clinical features as well as allergic rhinitis and asthma were diagnosed by specialists. FLG-SNVs were identified by Sanger sequencing of entire exons through long-range PCR. Allergic sensitization to a specific allergen was evaluated by multiple allergen simultaneous test. Serologic parameters such as serum eosinophil cationic protein (ECP and eosinophil derived neurotoxin (EDN were measured.A total of seventy-three SNVs and 4 LOF mutations were successfully genotyped. rs71626704 and rs76413899 were significantly associated with a history of asthma and cheilitis (P = 0.002 and P = 0.033, respectively, however, the associations were not found statistically significant after adjustment by multiple comparisons. In addition, we detected haplotype blocks which were correlated with non-specific hand or foot dermatitis and scalp scale. We identified FLG-SNVs which were associated with sensitization to environmental allergens; rs62623409 and rs71625199 (P = 0.038 and P = 0.008, respectively. Patients with FLG P478S TT and history of allergic rhinitis showed a higher EDN level, and among those patients, the ones with asthma showed a higher ECP level.This study revealed the association of FLG-SNVs with AD-associated minor clinical features. We firstly identified rs71625199 which was associated with higher environmental allergic sensitization. We also suggest that FLG P478S is a kind of disease modifier which affects serologic parameters such as EDN and ECP.
Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.
Directory of Open Access Journals (Sweden)
Mary Lynn Baniecki
2015-03-01
Full Text Available Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs. Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM, we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding. From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana, Africa (Ethiopia and Asia (Sri Lanka. We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1. Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.
Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections
Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.
2015-01-01
Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890
DEFF Research Database (Denmark)
Bøtkjær, Jane Alrø; Borgbo, Tanni; Kløverpris, Søren
2016-01-01
Objective: To reveal a possible relationship between two single nucleotide polymorphisms (SNPs) in PAPP-A—1224 (rs7020782) and 327 (rs12375498)—and the level and activity of PAPP-A in follicular fluid (FF) of human small antral follicles, and to analyze the intrafollicular hormone levels. Design:...
Directory of Open Access Journals (Sweden)
Yakubu Abdulmojeed
2017-01-01
Full Text Available The Major Histocompatibility Complex (MHC contains highly variable multi-gene families, which play a key role in the adaptive immune response within vertebrates. Among the Capra MHC class II genes, the expressed DRB locus is highly polymorphic, particularly in exon 2, which encodes the antigen-binding site. Models of variable non-synonymous/synonymous rate ratios among sites may provide important insights into functional constraints at different amino acid sites and may be used to detect sites under positive selection. Many non-synonymous single nucleotide polymorphisms (nsSNPs at the DRB locus in goats are suspected to impact protein function. This study, therefore, aimed at comparing the efficiency of six computational approaches to predict the likelihood of a particular non-synonymous (amino acid change coding SNP to cause a functional impact on the protein. This involved the use of PANTHER, SNAP, SIFT, PolyPhen-2, PROVEAN and nsSNPAnalyzer bioinformatics analytical tools in detecting harmful and beneficial effects at H57G, Y89R, V104D and Y112I substitutions in the peptide binding region of the DRB gene of Nigerian goats. The results from PANTHER analysis revealed that H57G, Y89R and Y112I substitutions (Pdeleterious= 0.113, 0.204 and 0.472, respectively were beneficial; while that of V104D was deleterious (Pdeleterious= 0.756, an indication that it was non-neutral. As regards the SNAP approach, H57G and Y89R substitutions were returned neutral with expected accuracy of 53 and 69%, respectively while V104D and Y112I substitutions were harmful. H57G and Y89R substitutions were also found harmless in the SIFT analysis. However, only H57G (PROVEAN and V104D (nsSNPAnalyzer amino acid substitutions were found to be beneficial. Interestingly, the predicted 3D structures of both native and mutant DRB protein appeared similar as validated by Ramachandran plots. The consensus reached by PANTHER, SNAP, SIFT and PolyPhen-2 approaches on the neutrality
Directory of Open Access Journals (Sweden)
Lazzari G
2017-05-01
Full Text Available Grazia Lazzari,1 Maria Iole Natalicchio,2 Angela Terlizzi,3 Francesco Perri,4 Giovanni Silvano1 1Radiation Oncology Unit, San Giuseppe Moscati Hospital, Taranto, 2Molecular Biology Laboratory, Pathological Anatomy Department, Ospedali Riuniti, Foggia, 3Medical Physic Unit, San Giuseppe Moscati Hospital, 4Medical Oncology Unit, Presidio Ospedaliero Centrale - Santissima Annunziata, Taranto, Italy Background: There has recently been a strong interest in the inter-individual variation in normal tissue and tumor response to radiotherapy (RT, because tissue radiosensitivity seems to be under genetic control. Evidence is accumulating on the role of polymorphic genetic variants, such as single nucleotide polymorphisms (SNPs that could influence normal tissue response after radiation. The most studied SNPs include those in genes involved in DNA repair (single- and double-strand breaks, and base excision and those active in the response to oxidative stress.Case report: We present the case report of a 60-year-old woman with early breast cancer who underwent adjuvant hormone therapy and conventional radiotherapy, and subsequently developed unacceptable cosmetic toxicities of the irradiated breast requiring a genetic test of genes involved in DNA repair mechanisms. The patient was found to be heterozygous for G28152A (T/C and C18067T (A/G mutations in X-ray repair cross-complementing group 1 (XRCC1 and 3 (XRCC3, respectively, homozygous for A313G (G/G mutation in glutathione S transferase Pi 1 (GSTP1, and wild-type for A4541G (A/A in XRCC3 and G135C (G/G in RAD51 recombinase.Conclusion: The role of SNPs should be taken into account when a severe phenomenon appears in normal tissues after radiation treatment, because understanding the molecular basis of individual radiosensitivity may be useful for identifying moderately or extremely radiosensitive patients who may need tailored therapeutic strategies. Keywords: radiosensitivity, SNPs, fibrosis, DNA repair
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.
2012-01-01
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756
Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J
2012-02-03
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.
Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W
2012-06-26
In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in
Directory of Open Access Journals (Sweden)
Chen L
2016-11-01
Full Text Available Liang Chen,1 Mei-Mei Liu,1 Hui Liu,1 Dan Lu,2 Xiao-Dan Zhao,3 Xue-Jing Yang4 1Department of Gynecology and Obstetrics, 2Department of Oncology, 3Department of Clinical Laboratory, The 2nd Affiliated Hospital, Harbin Medical University, 4Nursing Department, Harbin Chest Hospital, Harbin, People’s Republic of China Abstract: Our study aimed to investigate the correlation between single nucleotide polymorphisms of ERCC1/XRCC1/XPA genes and postoperative chemotherapy efficacy and prognosis of endometrial carcinoma. Our study included 108 patients with endometrial carcinoma and 100 healthy participants. ERCC1 rs11615/XRCC1 rs25487/XPA rs1800975 gene polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism. Then the chemotherapy efficacy and toxic effects of the patients were assessed. The genotype and allele frequency of ERCC1 rs11615/XRCC1 rs25487 in the case group were significantly different from that in the control group (all P<0.05. The patients with AA + GA in ERCC1 rs11615 had an increased risk of endometrial carcinoma than those with GG, and the risk of endometrial carcinoma for patients with AA + GA was also higher in comparison with patients with GG genotype in XRCC1 rs25487 (all P<0.05. GG on both ERCC1 rs11615/XRCC1 rs25487 had a higher effective rate of chemotherapy than GA + AA (all P<0.05. ERCC1 rs11615/XRCC1 rs25487 gene polymorphisms were linked with toxic effects in liver, kidney, and nervous system. ERCC1 rs11615/XRCC1 rs25487, muscular invasion, and tumor stage were independent risk factors for the prognosis of endometrial carcinoma (all P<0.05. However, no significant associations were observed between XPA rs1800975 polymorphism and chemotherapy efficacy and prognosis of endometrial carcinoma (all P>0.05. These results indicated that ERCC1 and XRCC1 but not XPA polymorphisms correlate with response to chemotherapy in endometrial carcinoma. Keywords: ERCC1, XRCC1, XPA, single nucleotide
In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.
Directory of Open Access Journals (Sweden)
Mohammed Alanazi
Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid
Directory of Open Access Journals (Sweden)
Piotr Czupryna
2017-01-01
Full Text Available Introduction: It is known that in the pathogenesis of tick-borne encephalitis (TBE various molecules play a significant role. The most prominent factors include IL-10, IL-28B, CD-209 and CCR5. It is reasonable to search for genetic predispositions to the development of various clinical forms of TBE related to the genetic variation of IL-10, IL-28B, CD-209 and CCR5. In this study we aimed to search for the relationship between single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and 32 base pair deletion in CCR5 coding region (Δ 32 with the human predisposition to development of various clinical presentations of TBE. We tried to assess the relation between the presence of particular alleles and genotypes with laboratory and clinical parameters. Material/Methods 59 patients with TBE and 57 people, bitten by a tick who never developed TBE (Polish cohort, were included in the study. To assess the distribution of single nucleotide polymorphisms, TaqMan SNP genotyping assays were used for IL10: rs1800872 and rs1800896, for CD 209 rs4804803 and rs2287886, rs12979860 for IL 28B SNPs according to the manufacturer’s protocol using real-time PCR technology on the StepOne thermal cycler. Results Comparison between TBE patients and CG showed that in SNP rs2287886 CD 209 AG heterozygotes were more frequent in the TBE group, while homozygotes GG were more frequent in the CG group. Conclusions SNP rs2287886 CD 209 AG heterozygotes predispose humans to develop TBE. Single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and CCR5 D32 genes does not correlate with the severity of TBE.
Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene
Directory of Open Access Journals (Sweden)
Othman E. Othman
2014-12-01
It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.
Directory of Open Access Journals (Sweden)
Petrović Sandra
2015-01-01
Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046
Karro, J E; Peifer, M; Hardison, R C; Kollmann, M; von Grünberg, H H
2008-02-01
The distribution of guanine and cytosine nucleotides throughout a genome, or the GC content, is associated with numerous features in mammals; understanding the pattern and evolutionary history of GC content is crucial to our efforts to annotate the genome. The local GC content is decaying toward an equilibrium point, but the causes and rates of this decay, as well as the value of the equilibrium point, remain topics of debate. By comparing the results of 2 methods for estimating local substitution rates, we identify 620 Mb of the human genome in which the rates of the various types of nucleotide substitutions are the same on both strands. These strand-symmetric regions show an exponential decay of local GC content at a pace determined by local substitution rates. DNA segments subjected to higher rates experience disproportionately accelerated decay and are AT rich, whereas segments subjected to lower rates decay more slowly and are GC rich. Although we are unable to draw any conclusions about causal factors, the results support the hypothesis proposed by Khelifi A, Meunier J, Duret L, and Mouchiroud D (2006. GC content evolution of the human and mouse genomes: insights from the study of processed pseudogenes in regions of different recombination rates. J Mol Evol. 62:745-752.) that the isochore structure has been reshaped over time. If rate variation were a determining factor, then the current isochore structure of mammalian genomes could result from the local differences in substitution rates. We predict that under current conditions strand-symmetric portions of the human genome will stabilize at an average GC content of 30% (considerably less than the current 42%), thus confirming that the human genome has not yet reached equilibrium.
Directory of Open Access Journals (Sweden)
Michelle D Johnson
2014-12-01
Full Text Available Epigenetic marks such as cytosine methylation are important determinants of cellular and whole-body phenotypes. However, the extent of, and reasons for inter-individual differences in cytosine methylation, and their association with phenotypic variation are poorly characterised. Here we present the first genome-wide study of cytosine methylation at single-nucleotide resolution in an animal model of human disease. We used whole-genome bisulfite sequencing in the spontaneously hypertensive rat (SHR, a model of cardiovascular disease, and the Brown Norway (BN control strain, to define the genetic architecture of cytosine methylation in the mammalian heart and to test for association between methylation and pathophysiological phenotypes. Analysis of 10.6 million CpG dinucleotides identified 77,088 CpGs that were differentially methylated between the strains. In F1 hybrids we found 38,152 CpGs showing allele-specific methylation and 145 regions with parent-of-origin effects on methylation. Cis-linkage explained almost 60% of inter-strain variation in methylation at a subset of loci tested for linkage in a panel of recombinant inbred (RI strains. Methylation analysis in isolated cardiomyocytes showed that in the majority of cases methylation differences in cardiomyocytes and non-cardiomyocytes were strain-dependent, confirming a strong genetic component for cytosine methylation. We observed preferential nucleotide usage associated with increased and decreased methylation that is remarkably conserved across species, suggesting a common mechanism for germline control of inter-individual variation in CpG methylation. In the RI strain panel, we found significant correlation of CpG methylation and levels of serum chromogranin B (CgB, a proposed biomarker of heart failure, which is evidence for a link between germline DNA sequence variation, CpG methylation differences and pathophysiological phenotypes in the SHR strain. Together, these results will
Common single nucleotide variants underlying drug addiction: more than a decade of research.
Bühler, Kora-Mareen; Giné, Elena; Echeverry-Alzate, Victor; Calleja-Conde, Javier; de Fonseca, Fernando Rodriguez; López-Moreno, Jose Antonio
2015-09-01
Drug-related phenotypes are common complex and highly heritable traits. In the last few years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a huge number of single nucleotide polymorphisms (SNPs) associated with drug use, abuse or dependence, mainly related to alcohol or nicotine. Nevertheless, few of these associations have been replicated in independent studies. The aim of this study was to provide a review of the SNPs that have been most significantly associated with alcohol-, nicotine-, cannabis- and cocaine-related phenotypes in humans between the years of 2000 and 2012. To this end, we selected CGAS, GWAS, family-based association and case-only studies published in peer-reviewed international scientific journals (using the PubMed/MEDLINE and Addiction GWAS Resource databases) in which a significant association was reported. A total of 371 studies fit the search criteria. We then filtered SNPs with at least one replication study and performed meta-analysis of the significance of the associations. SNPs in the alcohol metabolizing genes, in the cholinergic gene cluster CHRNA5-CHRNA3-CHRNB4, and in the DRD2 and ANNK1 genes, are, to date, the most replicated and significant gene variants associated with alcohol- and nicotine-related phenotypes. In the case of cannabis and cocaine, a far fewer number of studies and replications have been reported, indicating either a need for further investigation or that the genetics of cannabis/cocaine addiction are more elusive. This review brings a global state-of-the-art vision of the behavioral genetics of addiction and collaborates on formulation of new hypothesis to guide future work. © 2015 Society for the Study of Addiction.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Rudzianskiene Milda; Inciura Arturas; Juozaityte Elona; Gerbutavicius Rolandas; Simoliuniene Renata; Ugenskiene Rasa; Raulinaityte Danguole; Rudzianskas Viktoras; Kiavialaitis Greta Emilia
2014-01-01
Multiple myeloma (MM) cells interact with bone marrow stromal cells stimulating transcription and secretion of cytokines like IL-6 and IL-10, which are implicated in the progression and dissemination of MM. Regulation of cytokines secretion is under genetic control through genetic polymorphisms in their coding and promoter sequences. It seems that single nucleotide polymorphism (SNP) in the promoter region of various genes may regulate the plasma concentrat...
Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†
Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai
2010-01-01
Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A
2016-01-01
Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms
Growth and Characterization of Ce- Substituted Nd2Fe1411B Single Crystals
Energy Technology Data Exchange (ETDEWEB)
Susner, M. A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; Conner, B. S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; Saparov, B. I. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; McGuire, M. A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; Crumlin, E. J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Advanced Light Source; Veith, G. M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Advanced Light Source; Cao, H. B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Quantum Condensed Matter Division; Shanavas, K. V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; Parker, D. S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division; Chakoumakos, B. C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Quantum Condensed Matter Division; Sales, B. C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Materials Science and Technology Division
2015-08-31
Single crystals of (Nd1-xCex)2Fe14B are grown out of Fe-(Nd,Ce) flux. Chemical and structural analysis of the crystals indicates that (Nd1-xCex)2Fe14B forms a solid solution until at least x = 0.38 with a Vegard-like variation of the lattice constants with x. Refinements of single crystal neutron diffraction data indicate that Ce has a slight site preference (7:3) for the 4g rare earth site over the 4f site. Furthermore, magnetization measurements show that for x = 0.38 the saturation magnetization at 400 K, a temperature important to applications, falls from 29.8 for the parent Nd2Fe14B to 27.6 μB/f.u., the anisotropy field decreases from 5.5 T to 4.7 T, and the Curie temperature decreases from 586 to 543 K. First principles calculations carried out within density functional theory are used to explain the decrease in magnetic properties due to Ce substitution. Although the presence of the lower-cost and more abundant Ce slightly affects these important magnetic characteristics, this decrease is not large enough to affect a multitude of applications. Ce-substituted Nd2Fe14B is therefore a potential high-performance permanent magnet material with substantially reduced Nd content.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Directory of Open Access Journals (Sweden)
Mohamed N. Saad
2016-01-01
Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.
Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I
2016-06-01
Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.
Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping
2015-11-01
Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.
Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle
2017-09-29
Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wiseman, Alan
2004-01-01
Single nucleotide polymorphisms (SNPs) are the result of point mutations in nuclear (and mitochondrial) DNA. Such localised damage to DNA (and its replicative mechanisms) may not be excised fully by the DNA repair mechanism in the genome: and therefore can become inheritable; subsequently to manifest later as an inborn error of metabolism (IEM). Causes of mutagenic damage to the DNA can include background radiation (such as emitted by radon gas), and by reactive oxygen species (ROS): and also by mutagenic chemicals that occur naturally (inter alia in the diet). Other causes of DNA damage are variable environmental hazards such as solar-derived short wave ultraviolet light A. Gene therapy involves the placement of missing genes into particular tissues by the harnessing of suitable vectors (originally these were animal viruses such as SV40). For example, gene therapy in the rat for diabetes has succeeded by liver-production of insulin (using genes obtained from pancreatic Islets of Langerhans cells). Many inborn errors of metabolism could be treated in this way: examples may include 100 haemoglobinopathies (such as sickle cell anaemia), phenylketonuria; and other diseases caused by lack of tissue-production of a particular enzyme (in its catalytically-active conformation).
CodonTest: modeling amino acid substitution preferences in coding sequences.
Directory of Open Access Journals (Sweden)
Wayne Delport
2010-08-01
Full Text Available Codon models of evolution have facilitated the interpretation of selective forces operating on genomes. These models, however, assume a single rate of non-synonymous substitution irrespective of the nature of amino acids being exchanged. Recent developments have shown that models which allow for amino acid pairs to have independent rates of substitution offer improved fit over single rate models. However, these approaches have been limited by the necessity for large alignments in their estimation. An alternative approach is to assume that substitution rates between amino acid pairs can be subdivided into rate classes, dependent on the information content of the alignment. However, given the combinatorially large number of such models, an efficient model search strategy is needed. Here we develop a Genetic Algorithm (GA method for the estimation of such models. A GA is used to assign amino acid substitution pairs to a series of rate classes, where is estimated from the alignment. Other parameters of the phylogenetic Markov model, including substitution rates, character frequencies and branch lengths are estimated using standard maximum likelihood optimization procedures. We apply the GA to empirical alignments and show improved model fit over existing models of codon evolution. Our results suggest that current models are poor approximations of protein evolution and thus gene and organism specific multi-rate models that incorporate amino acid substitution biases are preferred. We further anticipate that the clustering of amino acid substitution rates into classes will be biologically informative, such that genes with similar functions exhibit similar clustering, and hence this clustering will be useful for the evolutionary fingerprinting of genes.
Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons.
Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M
2012-06-01
The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02). We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.
Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Ramensky Vasily E
2007-01-01
Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously
Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Sujana Ghanta
Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal
Cyclic nucleotides and radioresistnace
International Nuclear Information System (INIS)
Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.
1982-01-01
The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru
Directory of Open Access Journals (Sweden)
Lu Zheng
2009-09-01
Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age
The Role of Vitamin D Level and Related Single Nucleotide Polymorphisms in Crohn’s Disease
Directory of Open Access Journals (Sweden)
Wen J. Lam
2013-09-01
Full Text Available New Zealand has one of the highest rates of Crohn’s Disease (CD in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D, lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10−6. A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR and rs732594[A] (SCUBE3 showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR, rs732594[A] (SCUBE3, and rs2980[T] and rs2981[A] (PHF-11 showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.
Directory of Open Access Journals (Sweden)
Christine E McLaren
Full Text Available The existence of multiple inherited disorders of iron metabolism suggests genetic contributions to iron deficiency. We previously performed a genome-wide association study of iron-related single nucleotide polymorphisms (SNPs using DNA from white men aged ≥ 25 y and women ≥ 50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF ≤ 12 µg/L (cases and controls (SF >100 µg/L in men, SF >50 µg/L in women. We report a follow-up study of white, African-American, Hispanic, and Asian HEIRS participants, analyzed for association between SNPs and eight iron-related outcomes. Three chromosomal regions showed association across multiple populations, including SNPs in the TF and TMPRSS6 genes, and on chromosome 18q21. A novel SNP rs1421312 in TMPRSS6 was associated with serum iron in whites (p = 3.7 × 10(-6 and replicated in African Americans (p = 0.0012.Twenty SNPs in the TF gene region were associated with total iron-binding capacity in whites (p<4.4 × 10(-5; six SNPs replicated in other ethnicities (p<0.01. SNP rs10904850 in the CUBN gene on 10p13 was associated with serum iron in African Americans (P = 1.0 × 10(-5. These results confirm known associations with iron measures and give unique evidence of their role in different ethnicities, suggesting origins in a common founder.
Directory of Open Access Journals (Sweden)
Ayaka Sasaki
Full Text Available Irritable bowel syndrome (IBS is a common functional disorder with distinct features of stress-related pathophysiology. A key mediator of the stress response is corticotropin-releasing hormone (CRH. Although some candidate genes have been identified in stress-related disorders, few studies have examined CRH-related gene polymorphisms. Therefore, we tested our hypothesis that single-nucleotide polymorphisms (SNPs in CRH-related genes influence the features of IBS.In total, 253 individuals (123 men and 130 women participated in this study. They comprised 111 IBS individuals and 142 healthy controls. The SNP genotypes in CRH (rs28364015 and rs6472258 and CRH-binding protein (CRH-BP (rs10474485 were determined by direct sequencing and real-time polymerase chain reaction. The emotional states of the subjects were evaluated using the State-Trait Anxiety Inventory, Perceived Stress Scale, and the Self-rating Depression Scale.Direct sequencing of the rs28364015 SNP of CRH revealed no genetic variation among the study subjects. There was no difference in the genotype distributions and allele frequencies of rs6472258 and rs10474485 between IBS individuals and controls. However, IBS subjects with diarrhea symptoms without the rs10474485 A allele showed a significantly higher emotional state score than carriers.These results suggest that the CRH and CRH-BP genes have no direct effect on IBS status. However, the CRH-BP SNP rs10474485 has some effect on IBS-related emotional abnormalities and resistance to psychosocial stress.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Czech Academy of Sciences Publication Activity Database
Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor
2012-01-01
Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012
Directory of Open Access Journals (Sweden)
H. Hidayati
2015-09-01
Full Text Available Lipoprotein lipase (LPL is a key enzyme that plays in metabolism and transport lipoprotein andtherefore has an influence on blood triglyceride levels. LPL controls triacylglycerol partitioning betweenadipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids formuscle growth. The research was aimed to explore Single Nucleotide Polymorphisms of LPL gene andto associate SNP with marbling quality. A total of 66 genomic DNAs consisted of sumatera thin-tail edsheep (50 heads and garut sheep (16 heads were used in this study. Polymerase Chain Reaction wasused to amplify genomic DNA and direct sequencing method was to identify polymorphism sequences.The sequences were analyzed with Bio Edit and MEGA 5.2. The BLAST sequence was obtained fromgene bank X.68308.1. The association between the genotype and marbling quality was analyze by oneway ANOVA and further between mean differences were tested using least sgnificant difference. Theresults showed that 3 novel SNPs i.e. insertion g.26>C; insertion g.27> G and c.192T>C on garut sheepand a SNP insertion g.26>C/G on sumatera thin-tail ed sheep. The diversity of LPL gene at c.192T>Cwas associated with heneicosanoic acid, whereas TT genotype (0.04% was higher than CC (0.03% andCT (0.02%.
Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica
2014-01-01
The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.
Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y
2018-06-30
We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jae-Young Yoo
2012-09-01
Full Text Available Gastric cancer is ranked as the most common cancer in Koreans. A recent molecular biological study about the folate pathway gene revealed the correlation with a couple of cancer types. In the folate pathway, several genes are involved, including methylenetetrahydrofolate reductase (MTHFR, methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR, and methyltetrahydrofolate-homocysteine methyltransferase (MTR. The MTHFR gene has been reported several times for the correlation with gastric cancer risk. However, the association of the MTRR or MTR gene has not been reported to date. In this study, we investigated the association between the single nucleotide polymorphisms (SNPs of the MTHFR, MTRR, and MTR genes and the risk of gastric cancer in Koreans. To identify the genetic association with gastric cancer, we selected 17 SNPs sites in folate pathway-associated genes of MTHFR, MTR, and MTRR and tested in 1,261 gastric cancer patients and 375 healthy controls. By genotype analysis, estimating odds ratios and 95% confidence intervals (CI, rs1801394 in the MTRR gene showed increased risk for gastric cacner, with statistical significance both in the codominant model (odds ratio [OR], 1.39; 95% CI, 1.04 to 1.85 and dominant model (OR, 1.34; 95% CI, 1.02 to 1.75. Especially, in the obese group (body mass index ≥ 25 kg/m2, the codominant (OR, 9.08; 95% CI, 1.01 to 94.59 and recessive model (OR, 3.72; 95% CI, 0.92 to 16.59 showed dramatically increased risk (p < 0.05. In conclusion, rs1801394 in the MTRR gene is associated with gastric cancer risk, and its functional significance need to be validated.
1-Hydroxyethyl-2-Substituted Phenoxymethyl Benzimidazoles: Synthesis and Crystal Structures
International Nuclear Information System (INIS)
Wu, J.; Wang, Z.; Gu, H.; Chen, W.; Zhao, L.; Zhao, C.
2016-01-01
Five novel 1-hydroxyethyl-2-substituted phenoxymethyl benzimidazoles c1-c5 were successfully synthesized by a three-step route. Firstly, five substituted phenoxymethyl acids a1-a5 were prepared by the O-carboxymethylation reaction of the starting substituted phenols under microwave irradiation. Then, these compounds reacted with o-phenylendiamine to get the key intermediates 2-substituted phenoxymethyl benzimidazoles b1-b5. At last, the target compounds were synthesized by the N-hydroxyethylation reaction of b1-b5 with 2-chloroethyl alcohol through the solid-liquid phase transfer catalysis method, where tetrabutyl ammonium bromide (TBAB) was used as the catalyst. The structures of the target compounds were well characterized and verified by elemental analysis, MS, IR, 1H NMR, 13C NMR and single crystal X-ray diffraction analysis. (author)
Exfoliation and thermal transformations of Nb-substituted layered titanates
DEFF Research Database (Denmark)
Song, H.; Sjåstad, Anja O.; Fjellvåg, Helmer
2011-01-01
Single-layer Nb-substituted titanate nanosheets of ca. 1 nm thickness were obtained by exfoliating tetrabutylammonium (TBA)-intercalated Nb-substituted titanates in water. AFM images and turbidity measurements reveal that the exfoliated nanosheets crack and corrugate when sonicated. Upon heating...... factors for increasing the transformation temperatures for conversion of the nanosheets to anatase and finally into rutile. It is further tempting to link the delay in crystallization to morphology limitations originating from the nanosheets. The present work shows that layered Nb-titanates...
High coercivity Gd-substituted Ba hexaferrites, prepared by chemical coprecipitation
Litsardakis, G.; Manolakis, I.; Serletis, C.; Efthimiadis, K. G.
2008-04-01
A series of Gd-substituted Ba hexaferrites with nominal formula (Ba1-xGdx)Oṡ5.25 Fe2O3 (x=0-0.30) were prepared by the chemical coprecipitation method from nitrate precursors and heating at T =800-1200°C for 2h. The samples have been examined by x-ray diffraction, vibrating-sample magnetometer, and scanning electron microscopy methods. Gd substituted samples form single phase materials with the M-type hexaferrite structure at all heating temperatures, in the range of x ⩽0.10-0.20. The saturation magnetization (at 1.8T) varies slightly with x in most cases and, for x =0.05-0.10, it increases up to 66.7Am2/kg, exceeding the value of the unsubstituted hexaferrite. A strong enhancement of the coercivity is observed for all substituted samples, with maximum values Hc=457kA/m for the single-phase x =0.10 sample annealed at 1000°C and Hc=477kA/m for the x =0.25 sample annealed at 1100°C which contains Fe2O3 and GdFeO3 impurities. As the variation of coercivity with either substitution rate (x ) or annealing temperature is not monotonic, three different factors may account for the high coercivities that are obtained: (a) an inhibition of grain growth due to the presence of Gd, (b) a possible inherent effect on magnetocrystalline anisotropy, especially for single phase samples, and (c) a microstructural effect of secondary phases.
Synthesis and Antimicrobial Activity of Some Novel Substituted Piperazinyl-quinazolin-3(4H-ones
Directory of Open Access Journals (Sweden)
N. M. Raghavendra
2008-01-01
Full Text Available Several substituted-quinazolin-3(4H-ones were synthesized by condensation of 2-chloro-N-(4-oxo-substituted-quinazolin-3(4H-yl-acetamides with various substituted piperazines through single step reaction. Elemental analysis, IR, 1HNMR and mass spectral data confirmed the structure of the newly synthesized compounds. Synthesized quinazolin-4-one derivatives were investigated for their antibacterial and antifungal activities.
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-07-08
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.
The effect of yttrium substitution on the magnetic properties of magnetite nanoparticles
International Nuclear Information System (INIS)
Mozaffari, M.; Amighian, J.; Tavakoli, R.
2015-01-01
Superparamagnetic Y-substituted magnetite (Y x Fe 3–x O 4 ,with x=0.00, 0.10, 0.15, 0.20 and 0.40) nanoparticles were synthesized via hydrothermal reduction route in the presence of citric acid. The synthesized nanoparticles were characterized by X-ray diffraction (XRD) analysis, Fourier transform infrared (FTIR) spectroscopy, field emission scanning electron microscopy (FESEM), vibrating sample magnetometry (VSM) and gradient field thermomagnetic measurement. The results showed that a minimum amount of citric acid is required to obtain single phase Y-substituted magnetite nanoparticles. Citric acid acts as a modulator and reducing agent in the formation of spinel structure and controls nanoparticle size and crystallinity. Mean crystallite sizes of the single-phase powders were estimated by Williamson–Hall method. Curie temperature measurement of the samples shows that as yttrium content increases, the Curie temperature decreases. Magnetic measurements show that the saturation magnetization of the samples decreases as x increases up to 0.15 and then increases to x=0.20 and finally decreases again for x=0.40. - Highlights: • Single phase yttrium substituted magnetite nanoparticles were synthesized by hydrothermal-reduction route. • Citric acid plays a key role in reduction of Fe 3+ to Fe 2+ , which is necessary for the formation of magnetite phase. • It is possible to substitute yttrium ions for iron ones as high as x=0.4 by hydrothermal reduction route. • Pure magnetite nanoparticles prepared by this route has a high saturation magnetization. • Yttrium substituted magnetite nanoparticles are superparamagnet at room temperature
Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza
2014-07-01
Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.
Directory of Open Access Journals (Sweden)
Yeonhwa Jo
2017-10-01
Full Text Available Soybean is the most important legume crop in the world. Several diseases in soybean lead to serious yield losses in major soybean-producing countries. Moreover, soybean can be infected by diverse viruses. Recently, we carried out a large-scale screening to identify viruses infecting soybean using available soybean transcriptome data. Of the screened transcriptomes, a soybean transcriptome for soybean seed development analysis contains several virus-associated sequences. In this study, we identified five viruses, including soybean mosaic virus (SMV, infecting soybean by de novo transcriptome assembly followed by blast search. We assembled a nearly complete consensus genome sequence of SMV China using transcriptome data. Based on phylogenetic analysis, the consensus genome sequence of SMV China was closely related to SMV isolates from South Korea. We examined single nucleotide variations (SNVs for SMVs in the soybean seed transcriptome revealing 780 SNVs, which were evenly distributed on the SMV genome. Four SNVs, C-U, U-C, A-G, and G-A, were frequently identified. This result demonstrated the quasispecies variation of the SMV genome. Taken together, this study carried out bioinformatics analyses to identify viruses using soybean transcriptome data. In addition, we demonstrated the application of soybean transcriptome data for virus genome assembly and SNV analysis.
Directory of Open Access Journals (Sweden)
Linda S. Pescatello
2013-01-01
Full Text Available The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT. The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years, healthy men (42% and women (58% that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.
Foster, R; Byrnes, E; Meldrum, C; Griffith, R; Ross, G; Upjohn, E; Braue, A; Scott, R; Varigos, G; Ferrao, P; Ashman, L K
2008-11-01
The receptor tyrosine kinase c-KIT plays a key role in normal mast cell development. Point mutations in c-KIT have been associated with sporadic or familial mastocytosis. Two unrelated pairs of apparently identical twins affected by cutaneous mastocytosis attending the Mastocytosis Clinic at the Royal Children's Hospital, Melbourne, provided an opportunity to assess the possible contribution of c-KIT germline mutations or polymorphisms in this disease. Tissue biopsy, blood and/or buccal swab specimens were collected from 10 children with mastocytosis. To detect germline mutations/polymorphisms in c-KIT, we studied all coding exons by denaturing high pressure liquid chromatography. Exons showing mismatches were examined by direct sequencing. The influence of the substitution identified was further examined by expressing the variant form of c-KIT in factor-dependent FDC-P1 cells. In both pairs of twins, a heterozygous ATG to CTG transition in codon 541 was observed, resulting in the substitution of a methionine residue in the transmembrane domain by leucine (M541L). In each case, one parent was also heterozygous for this allele. Expression of M541L KIT in FDC-P1 cells enabled them to grow in human KIT ligand (stem cell factor, SCF) but did not confer factor independence. Compared with cells expressing wild-type KIT at a similar level, M541L KIT-expressing cells displayed enhanced growth at low levels of SCF, and heightened sensitivity to the KIT inhibitor, imatinib mesylate. The data suggest that the single nucleotide polymorphism resulting in the substitution M541L may predispose to paediatric mastocytosis.
A first-principles study of light non-metallic atom substituted blue phosphorene
Energy Technology Data Exchange (ETDEWEB)
Sun, Minglei [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Tang, Wencheng, E-mail: 101000185@seu.edu.cn [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Ren, Qingqiang [State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083, Hunan (China); Wang, Sa-ke [Department of Physics, Southeast University, Nanjing 210096, Jiangsu (China); Yu, Jin [School of Materials Science and Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Jiangsu Key Laboratory of Advanced Metallic Materials, Southeast University, Nanjing 211189, Jiangsu (China); Du, Yanhui [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China)
2015-11-30
Graphical abstract: - Highlights: • All the impurities are covalently bonded to blue phosphorene (with a single vacancy). • All the substituted systems are semiconductors. • B-substituted system exhibits direct bandgap semiconductor behavior. • The band gaps with spin polarization are found in C and O-substituted systems. • Our works can paves a new route at nanoscale for novel functionalities of optical and spintronics devices. - Abstract: First-principles calculations are implemented to study the geometric, electronic and magnetic properties of light non-metallic atom (B, C, N, O and F) substituted blue phosphorene. All the substituted systems are highly stable. The B-substituted system is a direct bandgap semiconductor with a bandgap size about 1.5 eV. The C, O-substituted systems are promising systems to explore two-dimensional diluted magnetic semiconductors. Magnetism is observed for C and O substitution, while for the other impurities no magnetic moment is detected. Our works paves a new route at nanoscale for novel functionalities of optical and spintronics devices.
Directory of Open Access Journals (Sweden)
Sheila J Semaan
2010-03-01
Full Text Available Pro-apoptotic Bax is essential for RGC (retinal ganglion cell death. Gene dosage experiments in mice, yielding a single wild-type Bax allele, indicated that genetic background was able to influence the cell death phenotype. DBA/2J Bax+/− mice exhibited complete resistance to nerve damage after 2 weeks (similar to Bax −/− mice, but 129B6 Bax+/− mice exhibited significant cell loss (similar to wild-type mice. The different cell death phenotype was associated with the level of Bax expression, where 129B6 neurons had twice the level of endogenous Bax mRNA and protein as DBA/2J neurons. Sequence analysis of the Bax promoters between these strains revealed a single nucleotide polymorphism (T129B6 to CDBA/2J at position −515. A 1.5- to 2.5-fold increase in transcriptional activity was observed from the 129B6 promoter in transient transfection assays in a variety of cell types, including RGC5 cells derived from rat RGCs. Since this polymorphism occurred in a p53 half-site, we investigated the requirement of p53 for the differential transcriptional activity. Differential transcriptional activity from either 129B6 or DBA/2J Bax promoters were unaffected in p53−/− cells, and addition of exogenous p53 had no further effect on this difference, thus a role for p53 was excluded. Competitive electrophoretic mobility-shift assays identified two DNA-protein complexes that interacted with the polymorphic region. Those forming Complex 1 bound with higher affinity to the 129B6 polymorphic site, suggesting that these proteins probably comprised a transcriptional activator complex. These studies implicated quantitative expression of the Bax gene as playing a possible role in neuronal susceptibility to damaging stimuli.
Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco
2013-04-01
Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
The electronic configuration of substitutional Fe in silicon
Weyer, G; Fanciulli, M; Fedosseev, V; Gunnlaugsson, H P; Mishin, V I; Sielemann, R
1999-01-01
Ion implantations of radioactive /sup 57/Mn/sup +/ into differently doped silicon single crystals held at 300-600 K have been utilized for /sup 57/Fe Mossbauer studies of interstitial and substitutional Fe. Site and charge state assignments have been made on the basis of the determined hyperfine interaction parameters and Debye temperatures. Substantial fractions of substitutional /sup 57/Mn probe atoms are proposed to occur due to annealing reactions. This site is maintained in the subsequent decay to /sup 57/Fe by
Ruiz, Federico M; Scholz, Barbara A; Buzamet, Eliza; Kopitz, Jürgen; André, Sabine; Menéndez, Margarita; Romero, Antonio; Solís, Dolores; Gabius, Hans-Joachim
2014-03-01
Natural amino acid substitution by single-site nucleotide polymorphism can become a valuable tool for structure-activity correlations, especially if evidence for association to disease parameters exists. Focusing on the F19Y change in human galectin-8, connected clinically to rheumatoid arthritis, we here initiate the study of consequences of a single-site substitution in the carbohydrate recognition domain of this family of cellular effectors. We apply a strategically combined set of structural and cell biological techniques for comparing properties of the wild-type and variant proteins. The overall hydrodynamic behavior of the full-length protein and of the separate N-domain is not noticeably altered, but displacements in the F0 β-strand of the β-sandwich fold in the N-domain are induced, as evidenced by protein crystallography. Analysis of thermal stability by circular dichroism spectroscopy revealed perceptible differences for the full-length proteins, pointing to an impact of the substitution beyond the N-domain. In addition, small differences in thermodynamic parameters of carbohydrate binding are detected. On the level of two types of tumor cells, characteristics of binding appeared rather similar. In further comparison of the influence on proliferation, the variant proved to be more active as growth regulator in the six tested lines of neuroblastoma, erythroleukemia and colon adenocarcinoma. The seemingly subtle structural change identified here thus has functional implications in vitro, encouraging further analysis in autoimmune regulation and, in a broad context, in work with other natural single-site variants, using the documented combined strategy. The atomic coordinates and structure factors (codes 4BMB, 4BME) have been deposited in the Protein Data Bank. © 2014 FEBS.
Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree
2015-07-01
Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).
Directory of Open Access Journals (Sweden)
Ryo Iizuka
Full Text Available Group II chaperonins found in archaea and in eukaryotic cytosol mediate protein folding without a GroES-like cofactor. The function of the cofactor is substituted by the helical protrusion at the tip of the apical domain, which forms a built-in lid on the central cavity. Although many studies on the change in lid conformation coupled to the binding and hydrolysis of nucleotides have been conducted, the molecular mechanism of lid closure remains poorly understood. Here, we performed a single-molecule polarization modulation to probe the rotation of the helical protrusion of a chaperonin from a hyperthermophilic archaeum, Thermococcus sp. strain KS-1. We detected approximately 35° rotation of the helical protrusion immediately after photorelease of ATP. The result suggests that the conformational change from the open lid to the closed lid state is responsible for the approximately 35° rotation of the helical protrusion.
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Raithel, Dominic; Simine, Lena; Pickel, Sebastian; Schötz, Konstantin; Panzer, Fabian; Baderschneider, Sebastian; Schiefer, Daniel; Lohwasser, Ruth; Köhler, Jürgen; Thelakkat, Mukundan; Sommer, Michael; Köhler, Anna; Rossky, Peter J.; Hildner, Richard
2018-03-01
The backbone conformation of conjugated polymers affects, to a large extent, their optical and electronic properties. The usually flexible substituents provide solubility and influence the packing behavior of conjugated polymers in films or in bad solvents. However, the role of the side chains in determining and potentially controlling the backbone conformation, and thus the optical and electronic properties on the single polymer level, is currently under debate. Here, we investigate directly the impact of the side chains by studying the bulky-substituted poly(3-(2,5-dioctylphenyl)thiophene) (PDOPT) and the common poly(3-hexylthiophene) (P3HT), both with a defined molecular weight and high regioregularity, using low-temperature single-chain photoluminescence (PL) spectroscopy and quantum-classical simulations. Surprisingly, the optical transition energy of PDOPT is significantly (˜2,000 cm‑1 or 0.25 eV) red-shifted relative to P3HT despite a higher static and dynamic disorder in the former. We ascribe this red shift to a side-chain induced backbone planarization in PDOPT, supported by temperature-dependent ensemble PL spectroscopy. Our atomistic simulations reveal that the bulkier 2,5-dioctylphenyl side chains of PDOPT adopt a clear secondary helical structural motif and thus protect conjugation, i.e., enforce backbone planarity, whereas, for P3HT, this is not the case. These different degrees of planarity in both thiophenes do not result in different conjugation lengths, which we found to be similar. It is rather the stronger electronic coupling between the repeating units in the more planar PDOPT which gives rise to the observed spectral red shift as well as to a reduced calculated electron‑hole polarization.
Directory of Open Access Journals (Sweden)
Ramoni Marco F
2007-03-01
Full Text Available Abstract Background Recent studies have shown that when individuals are grouped on the basis of genetic similarity, group membership corresponds closely to continental origin. There has been considerable debate about the implications of these findings in the context of larger debates about race and the extent of genetic variation between groups. Some have argued that clustering according to continental origin demonstrates the existence of significant genetic differences between groups and that these differences may have important implications for differences in health and disease. Others argue that clustering according to continental origin requires the use of large amounts of genetic data or specifically chosen markers and is indicative only of very subtle genetic differences that are unlikely to have biomedical significance. Results We used small numbers of randomly selected single nucleotide polymorphisms (SNPs from the International HapMap Project to train naïve Bayes classifiers for prediction of ancestral continent of origin. Predictive accuracy was tested on two independent data sets. Genetically similar groups should be difficult to distinguish, especially if only a small number of genetic markers are used. The genetic differences between continentally defined groups are sufficiently large that one can accurately predict ancestral continent of origin using only a minute, randomly selected fraction of the genetic variation present in the human genome. Genotype data from only 50 random SNPs was sufficient to predict ancestral continent of origin in our primary test data set with an average accuracy of 95%. Genetic variations informative about ancestry were common and widely distributed throughout the genome. Conclusion Accurate characterization of ancestry is possible using small numbers of randomly selected SNPs. The results presented here show how investigators conducting genetic association studies can use small numbers of arbitrarily
Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit
Directory of Open Access Journals (Sweden)
E.M. Abdel-Kafy
2016-09-01
Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.
Association between single nucleotide polymorphisms of the interleukin-4 gene and atopic dermatitis.
Gharagozlou, Mohammad; Behniafard, Nasrin; Amirzargar, Ali Akbar; Hosseinverdi, Sima; Sotoudeh, Soheila; Farhadi, Elham; Khaledi, Mojdeh; Aryan, Zahra; Moghaddam, Zahra Gholizadeh; Mahmoudi, Maryam; Aghamohammadi, Asghar; Rezaei, Nima
2015-01-01
Atopic dermatitis (AD) is an inflammatory skin disease in which both genetic and environmental factors seem to be involved. Several studies investigated the association of certain genetic factors with AD in different ethnic groups, but conflicting data were obtained. This study was performed to check the possible association between single nucleotide polymorphisms (SNPs) of interleukin 4 (IL-4) and the IL-4 receptor α chain (IL-4Rα) and AD in a group of Iranian patients. The allele and genotype frequencies of genes encoding for IL-4 and IL-4Rα were investigated in 89 patients with AD in comparison with 139 healthy controls, using methods based on polymerase chain reaction sequence-specific primers. The most frequent alleles of IL-4 in patients were T at -1098 (P<0.001, odds ratio (OR)=2.35), C at -590 (P<0.001, OR=4.84) and C at -33 (P=0.002, OR=2.08). The most frequent genotypes of IL-4 in patients were TT, CC, and CC at positions -1098 (P<0.001, OR=3.59), -590 (P<0.001, OR=31.25) and -33 (P<0.001, OR=3.46), respectively. We found a significant lower frequency of GT at -1098 GT, TC at -590, and TC at -33 in patients. There were no statistically significant differences in the frequency of alleles and genotypes of IL-4Rα gene at position +1902. A strong positive association was seen between TCC haplotype and AD (68% in patients vs. 23.4% in controls, P<0.001, OR=8.91). We detected a significantly lower frequency of TTC, GCC, and TTT haplotypes (P<0.001, OR=0.02, P<0.001, OR=0.40, P<0.001, OR=0.39, respectively) in patients compared to controls. A significant association between the polymorphisms of the IL-4 gene promoter at positions -1098, -590, and -33 and AD was detected in the Iranian population.
Single nucleotide polymorphisms in CRTC1 and BARX1 are associated with esophageal adenocarcinoma
Directory of Open Access Journals (Sweden)
Anna M. J. van Nistelrooij
2015-01-01
Full Text Available Objective: Recently, single nucleotide polymorphisms (SNPs associated with esophageal adenocarcinoma (EAC and Barrett′s esophagus (BE were identified; rs10419226 (CRTC10, rs11789015 (BARX1, rs2687201 (FOXP10, rs2178146 (FOXF1, rs3111601 (FOXF10, and rs9936833 (FOXF1. These findings indicate that genetic susceptibility could play a role in the initiation of EAC in BE patients. The aim of this study was to validate the association between these previously identified SNPs and the risk of EAC in an independent and large case-control study. Design: Six SNPs found to be associated with EAC and BE were genotyped by a multiplex SNaPshot analysis in 1071 EAC patients diagnosed and treated in the Netherlands. Allele frequencies were compared to a control group derived from the Rotterdam Study, a population-based prospective cohort study (n = 6206. Logistic regression analysis and meta-analysis were performed to calculate odds ratios (OR. Results: Rs10419226 (CRTC1 showed a significantly increased EAC risk for the minor allele (OR = 1.17, P = 0.001, and rs11789015 (BARX1 showed a significantly decreased risk for the minor allele (OR = 0.85, P = 0.004 in the logistic regression analysis. The meta-analysis of the original GWAS and the current study revealed an improved level of significance for rs10419226 (CRTC1 (OR = 1.18, P = 6.66 × 10–10 and rs11789015 (BARX1 (OR = 0.83, P = 1.13 × 10–8 . Conclusions: This independent and large Dutch case-control study confirms the association of rs10419226 (CRTC1 and rs11789015 (BARX1 with the risk of EAC. These findings suggest a contribution of the patient genetic make-up to the development of EAC and might contribute to gain more insight in the etiology of this cancer.
Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra
2015-04-10
In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.
Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken
2014-12-01
In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Xudong Liang
2011-04-01
Full Text Available The virulence factor α-toxin (hla is needed by Staphylococcus aureus in order to cause infections in both animals and humans. Although the complicated regulation of hla expression has been well studied in human S. aureus isolates, the mechanisms of of hla regulation in bovine S. aureus isolates remain undefined. In this study, we found that many bovine S. aureus isolates, including the RF122 strain, generate dramatic amounts of α-toxin in vitro compared with human clinical S. aureus isolates, including MRSA WCUH29 and MRSA USA300. To elucidate potential regulatory mechanisms, we analyzed the hla promoter regions and identified predominant single nucleotide polymorphisms (SNPs at positions -376, -483, and -484 from the start codon in α-toxin hyper-producing isolates. Using site-directed mutagenesis and hla promoter-gfp-luxABCDE dual reporter approaches, we demonstrated that the SNPs contribute to the differential control of hla expression among bovine and human S. aureus isolates. Using a DNA affinity assay, gel-shift assays and a null mutant, we identified and revealed that an hla positive regulator, SarZ, contributes to the involvement of the SNPs in mediating hla expression. In addition, we found that the bovine S. aureus isolate RF122 exhibits higher transcription levels of hla positive regulators, including agrA, saeR, arlR and sarZ, but a lower expression level of hla repressor rot compared to the human S. aureus isolate WCUH29. Our results indicate α-toxin hyperproduction in bovine S. aureus is a multifactorial process, influenced at both the genomic and transcriptional levels. Moreover, the identification of predominant SNPs in the hla promoter region may provide a novel method for genotyping the S. aureus isolates.
Association of the Single Nucleotide Polymorphisms in , , and with Blood Related Traits in Pigs
Directory of Open Access Journals (Sweden)
Jae-Bong Lee
2016-12-01
Full Text Available The aim of this study was to detect positional candidate genes located within the support interval (SI regions based on the results of red blood cell, mean corpuscular volume (MCV, and mean corpuscular hemoglobin quantitative trait locus (QTL in Sus scrofa chromosome 13, and to verify the correlation between specific single-nucleotide polymorphisms (SNPs located in the exonic region of the positional candidate gene and the three genetic traits. The flanking markers of the three QTL SI regions are SW38 and S0215. Within the QTL SI regions, 44 genes were located, and runt-related transcription factor 1, dual-specificity tyrosine-(Y-phosphorylation regulated kinase 1A (DYRK1A, and potassium inwardly-rectifying channel, subfamily J, member 15 KCNJ15–which are reported to be related to the hematological traits and clinical features of Down syndrome–were selected as positional candidate genes. The ten SNPs located in the exonic region of the three genes were detected by next generation sequencing. A total of 1,232 pigs of an F2 resource population between Landrace and Korean native pigs were genotyped. To investigate the effects of the three genes on each genotype, a mixed-effect model which is the considering family structure model was used to evaluate the associations between the SNPs and three genetic traits in the F2 intercross population. Among them, the MCV level was highly significant (nominal p = 9.8×10−9 in association with the DYRK1A-SNP1 (c.2989 G
Analysis of healthy cohorts for single nucleotide polymorphisms in C1q gene cluster
Directory of Open Access Journals (Sweden)
MARIA A. RADANOVA
2015-12-01
Full Text Available C1q is the first component of the classical pathway of complement activation. The coding region for C1q is localized on chromosome 1p34.1–36.3. Mutations or single nucleotide polymorphisms (SNPs in C1q gene cluster can cause developing of Systemic lupus erythematosus (SLE because of C1q deficiency or other unknown reason. We selected five SNPs located in 7.121 kbp region on chromosome 1, which were previously associated with SLE and/or low C1q level, but not causing C1q deficiency and analyzed them in terms of allele frequencies and genotype distribution in comparison with Hispanic, Asian, African and other Caucasian cohorts. These SNPs were: rs587585, rs292001, rs172378, rs294179 and rs631090. One hundred eighty five healthy Bulgarian volunteers were genotyped for the selected five C1q SNPs by quantative real-time PCR methods. International HapMap Project has been used for information about genotype distribution and allele frequencies of the five SNPs in, Hispanics, Asians, Africans and others Caucasian cohorts. Bulgarian healthy volunteers and another pooled Caucasian cohort had similar frequencies of genotypes and alleles of rs587585, rs292001, rs294179 and rs631090 SNPs. Nevertheless, genotype AA of rs172378 was significantly overrepresented in Bulgarians when compared to other healthy Caucasians from USA and UK (60% vs 31%. Genotype distribution of rs172378 in Bulgarians was similar to Greek-Cyriot Caucasians. For all Caucasians the major allele of rs172378 was A. This is the first study analyzing the allele frequencies and genotype distribution of C1q gene cluster SNPs in Bulgarian healthy population.
Energy Technology Data Exchange (ETDEWEB)
Tucker, Susan L., E-mail: sltucker@mdanderson.org [Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Li Minghuan [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Xu Ting; Gomez, Daniel [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Yuan Xianglin [Department of Oncology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Yu Jinming [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Liu Zhensheng; Yin Ming; Guan Xiaoxiang; Wang Lie; Wei Qingyi [Department of Epidemiology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mohan, Radhe [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Vinogradskiy, Yevgeniy [University of Colorado School of Medicine, Aurora, Colorado (United States); Martel, Mary [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)
2013-01-01
Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk of severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
Synthesis, characterization and modelling of zinc and silicate co-substituted hydroxyapatite.
Friederichs, Robert J; Chappell, Helen F; Shepherd, David V; Best, Serena M
2015-07-06
Experimental chemistry and atomic modelling studies were performed here to investigate a novel ionic co-substitution in hydroxyapatite (HA). Zinc, silicate co-substituted HA (ZnSiHA) remained phase pure after heating to 1100 °C with Zn and Si amounts of 0.6 wt% and 1.2 wt%, respectively. Unique lattice expansions in ZnSiHA, silicate Fourier transform infrared peaks and changes to the hydroxyl IR stretching region suggested Zn and silicate co-substitution in ZnSiHA. Zn and silicate insertion into HA was modelled using density functional theory (DFT). Different scenarios were considered where Zn substituted for different calcium sites or at a 2b site along the c-axis, which was suspected in singly substituted ZnHA. The most energetically favourable site in ZnSiHA was Zn positioned at a previously unreported interstitial site just off the c-axis near a silicate tetrahedron sitting on a phosphate site. A combination of experimental chemistry and DFT modelling provided insight into these complex co-substituted calcium phosphates that could find biomedical application as a synthetic bone mineral substitute. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Synthesis, characterization and modelling of zinc and silicate co-substituted hydroxyapatite
Friederichs, Robert J.; Chappell, Helen F.; Shepherd, David V.; Best, Serena M.
2015-01-01
Experimental chemistry and atomic modelling studies were performed here to investigate a novel ionic co-substitution in hydroxyapatite (HA). Zinc, silicate co-substituted HA (ZnSiHA) remained phase pure after heating to 1100°C with Zn and Si amounts of 0.6 wt% and 1.2 wt%, respectively. Unique lattice expansions in ZnSiHA, silicate Fourier transform infrared peaks and changes to the hydroxyl IR stretching region suggested Zn and silicate co-substitution in ZnSiHA. Zn and silicate insertion into HA was modelled using density functional theory (DFT). Different scenarios were considered where Zn substituted for different calcium sites or at a 2b site along the c-axis, which was suspected in singly substituted ZnHA. The most energetically favourable site in ZnSiHA was Zn positioned at a previously unreported interstitial site just off the c-axis near a silicate tetrahedron sitting on a phosphate site. A combination of experimental chemistry and DFT modelling provided insight into these complex co-substituted calcium phosphates that could find biomedical application as a synthetic bone mineral substitute. PMID:26040597
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin
2017-02-01
Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.
Directory of Open Access Journals (Sweden)
Unitsa Sangket
Full Text Available Influenza virus (IFV can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1 universal SNPs, (2 likely common SNPs, and (3 unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks.
Directory of Open Access Journals (Sweden)
Vladimir V. Anokhin
2016-01-01
Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.
DEFF Research Database (Denmark)
Andreassen, Christian Nicolaj; Alsner, Jan; Overgaard, Marie
2006-01-01
Purpose: In two previously published studies, associations with risk of radiation-induced subcutaneous fibrosis were found for single nucleotide polymorphisms (SNP) in TGFB1 (transforming growth factor beta 1 gene), XRCC1 (X-ray repair cross-complementing 1 gene), XRCC3 (X-ray repair cross...... the influence of genetic variation upon normal tissue radiosensitivity...
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
McAllister, Christine A; Miller, Allison J
2016-07-01
Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Wang, Hui; Sui, Weiguo; Xue, Wen; Wu, Junyong; Chen, Jiejing; Dai, Yong
2014-09-01
Immunoglobulin A nephropathy (IgAN) is a complex trait regulated by the interaction among multiple physiologic regulatory systems and probably involving numerous genes, which leads to inconsistent findings in genetic studies. One possibility of failure to replicate some single-locus results is that the underlying genetics of IgAN nephropathy is based on multiple genes with minor effects. To learn the association between 23 single nucleotide polymorphisms (SNPs) in 14 genes predisposing to chronic glomerular diseases and IgAN in Han males, the 23 SNPs genotypes of 21 Han males were detected and analyzed with a BaiO gene chip, and their associations were analyzed with univariate analysis and multiple linear regression analysis. Analysis showed that CTLA4 rs231726 and CR2 rs1048971 revealed a significant association with IgAN. These findings support the multi-gene nature of the etiology of IgAN and propose a potential gene-gene interactive model for future studies.
Energy Technology Data Exchange (ETDEWEB)
Booth, Corwin H.; Kazhdan, Daniel; Werkema, Evan L.; Walter, Marc D.; Lukens, Wayne W.; Bauer, Eric D.; Hu, Yung-Jin; Maron, Laurent; Eisenstein, Odile; Head-Gordon, Martin; Andersen, Richard A.
2011-01-25
Multiconfigurational, intermediate valent ground states are established in several methyl-substituted bipyridine complexes of bispentamethylcyclopentadienylytterbium, Cp*{sub 2} Yb(Me{sub x}-bipy). In contrast to Cp*{sub 2} Yb(bipy) and other substituted-bipy complexes, the nature of both the ground state and the first excited state are altered by changing the position of the methyl or dimethyl substitutions on the bipyridine rings. In particular, certain substitutions result in multiconfigurational, intermediate valent open-shell singlet states in both the ground state and the first excited state. These conclusions are reached after consideration of single-crystal x-ray diffraction (XRD), the temperature dependence of x-ray absorption near-edge structure (XANES), extended x-ray absorption fine-structure (EXAFS), and magnetic susceptibility data, and are supported by CASSCF-MP2 calculations. These results place the various Cp*{sub 2}Yb(bipy) complexes in a new tautomeric class, that is, intermediate-valence tautomers.
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D
2016-06-01
We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Dong-Feng Wu
2014-02-01
Full Text Available The present study was performed to clarify the association between the acyl-CoA:cholesterol acyltransferase-1 (ACAT-1 single nucleotide polymorphism (SNP rs1044925 and the risk of coronary artery disease (CAD and ischemic stroke (IS in the Guangxi Han population. Polymerase chain reaction and restriction fragment length polymorphism was performed to determine the genotypes of the ACAT-1 SNP rs1044925 in 1730 unrelated subjects (CAD, 587; IS, 555; and healthy controls; 588. The genotypic and allelic frequencies of rs1044925 were significantly different between the CAD patients and controls (p = 0.015 and borderline different between the IS patients and controls (p = 0.05. The AC/CC genotypes and C allele were associated with a decreased risk of CAD and IS (CAD: p = 0.014 for AC/CC vs. AA, p = 0.022 for C vs. A; IS: p = 0.014 for AC/CC vs. AA; p = 0.017 for C vs. A. The AC/CC genotypes in the healthy controls, but not in CAD or IS patients, were associated with an increased serum high-density lipoprotein cholesterol (HDL-C concentration. The present study shows that the C allele carriers of ACAT-1 rs1044925 were associated with an increased serum HDL-C level in the healthy controls and decreased risk in CAD and IS patients.
Directory of Open Access Journals (Sweden)
Katharina Röltgen
Full Text Available Buruli ulcer (BU is an emerging necrotizing disease of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. While proximity to stagnant or slow flowing water bodies is a risk factor for acquiring BU, the epidemiology and mode of M. ulcerans transmission is poorly understood. Here we have used high-throughput DNA sequencing and comparisons of the genomes of seven M. ulcerans isolates that appeared monomorphic by existing typing methods. We identified a limited number of single nucleotide polymorphisms (SNPs and developed a real-time PCR SNP typing method based on these differences. We then investigated clinical isolates of M. ulcerans on which we had detailed information concerning patient location and time of diagnosis. Within the Densu river basin of Ghana we observed dominance of one clonal complex and local clustering of some of the variants belonging to this complex. These results reveal focal transmission and demonstrate, that micro-epidemiological analyses by SNP typing has great potential to help us understand how M. ulcerans is transmitted.
Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng
2012-08-21
Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.
Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai
2012-01-01
Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (pmastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (pmastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał
2017-09-01
It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p caries occurrence in Polish children.
Directory of Open Access Journals (Sweden)
Nur Soyer
2017-06-01
Full Text Available We aimed to determine the genotype distribution, allele frequency, and prognostic impact of IDH1/2, TET2, and ASXL1 single nucleotide polymorphisms (SNPs in myeloproliferative neoplasms (MPNs. TET2 (rs763480, ASXL1 (rs2208131, and IDH1 (rs11554137 variant homozygous genotype frequencies were found at rates of 1.5%, 9.2%, and 2.3%, respectively. No IDH2 SNP was identified. IDH1 and TET2 frequencies were 5% in essential thrombocythemia (ET and 1.7% in ET and 5% in primary myelofibrosis (PMF, respectively. ASXL1 frequencies were 8.3%-10% in MPN subgroups. The TET2 mutant allele T and ASXL1 mutant allele G had the highest frequencies with 0.272 in the PMF and 0.322 in the polycythemia vera (PV group, respectively. There was no impact of the SNPs on prognosis. IDH1 frequency in MPNs was found similar to the literature. ASXL1 frequencies were similar between ET, PV, and PMF patients. The ASXL1 and TET2 allele frequencies of the Turkish population are similar to those of the European population. The role of SNPs in MPNs might be further evaluated in larger multicenter studies.
Synthesis and molecular structures of 1-hydroxyethyl-2-(p-substituted) phenoxymethyl benzimidazoles
International Nuclear Information System (INIS)
Wu, J.W.; Zhao, L.; Wang, Z.; Gu, H.; Chen, W.; Zhao, C.
2016-01-01
Five novel 1-hydroxyethyl-2-(p-substituted) phenoxymethyl benzimidazoles were synthesized by a three-step route. Under microwave irradiation, the p-substituted phenols were firstly O-carboxymethylated to prepare the corresponding p-substituted phenoxymethyl acids, which then reacted with o-phenylendiamine to get the key intermediates 2-(p-substituted) phenoxymethyl benzimidazole. Finally, the solid-liquid phase transfer catalysis method, where tetrabutyl ammonium bromide (TBAB) was used as the catalyst, was applied to synthesize the target compounds c/sub 1/-c/sub 5/ by the N-hydroxyethylation reaction with 2-chloroethyl alcohol. The structures of the obtained compounds were well characterized and confirmed by elemental analysis, MS, IR, /sup 1/H NMR, /sup 13/C NMR and single-crystal X-ray diffraction analysis. (author)
Directory of Open Access Journals (Sweden)
Valentina eMione
2015-05-01
Full Text Available Reactive and proactive control of actions are cognitive abilities that allow to deal with a continuously changing environment by adjusting already programmed actions. They also set forthcoming acts by evaluating the outcome of the previous ones. Earlier studies highlighted sex related differences in the strategies and in the pattern of brain activation during cognitive tasks involving reactive and proactive control. To further identify sex-dependent characteristics in the cognitive control of actions, in this study we have assessed whether/how differences in reactive and proactive control were modulated by the COMT Val158Met single nucleotide polymorphism, a genetic factor known to influence the functionality of the dopaminergic system, in particular at the level of prefrontal cortex. Two groups of male and female participants were further sorted according to their genotype (Val/Met, Val/Val and Met/Met and tested in a stop signal task, a consolidated tool to measure reactive and proactive control in experimental and clinical settings. In each group of participants we estimated both a measure of the capacity to react to unexpected events and the ability of monitoring their performance. The between groups comparison of these measures indicated a poorer ability of male individuals carrying the Val/Val genotype in error-monitoring, suggesting that differences between sexes could be influenced by the efficiency of COMT and that other sex-specific factors have to be considered. The comprehension of inter-groups behavioral and physiological correlates of cognitive control will provide more accurate diagnostic tools for predicting the incidence and the development of pathologies like ADHD or deviant behaviors as drug or alcohol abuse.
Kholod, Natalia; Sivogrivov, Dmitry; Latypov, Oleg; Mayorov, Sergey; Kuznitsyn, Rafail; Kajava, Andrey V; Shlyapnikov, Mikhail; Granovsky, Igor
2015-11-01
The article describes substitutions in bacteriophage T4 RNase H which provide so called das-effect. Phage T4 DNA arrest suppression (das) mutations have been described to be capable of partially suppressing the phage DNA arrest phenotype caused by a dysfunction in genes 46 and/or 47 (also known as Mre11/Rad50 complex). Genetic mapping of das13 (one of the das mutations) has shown it to be in the region of the rnh gene encoding RNase H. Here we report that Das13 mutant of RNase H has substitutions of valine 43 and leucine 242 with isoleucines. To investigate the influence of these mutations on RNase H nuclease properties we have designed a novel in vitro assay that allows us to separate and quantify exo- or endonuclease activities of flap endonuclease. The nuclease assay in vitro showed that V43I substitution increased the ratio between exonuclease/endonuclease activities of RNase H whereas L242I substitution did not affect the nuclease activity of RNase H in vitro. However, both mutations were necessary for the full das effect in vivo. Molecular modelling of the nuclease structure suggests that V43I substitution may lead to disposition of H4 helix, responsible for the interaction with the first base pairs of 5'end of branched DNA. These structural changes may affect unwinding of the first base pairs of gapped or nicked DNA generating a short flap and therefore may stabilize the DNA-enzyme complex. L242I substitution did not affect the structure of RNase H and its role in providing das-effect remains unclear. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Seonhyeop Shin
2015-06-01
Full Text Available The elastic properties of KF-substituted perovskite lead titanate (PbTiO3 were investigated by dielectric measurements and Brillouin light scattering. The ferroelectric phase transition occurred at substantially lower temperature due to KF substitution, which was attributed to the modification of the covalency in Pb–O and Ti–O bonds. The longitudinal acoustic (LA mode of KF-substituted PbTiO3 showed a frequency softening in the paraelectric phase, which was accompanied by increasing acoustic damping. This indicated that polarization fluctuations responsible for the acoustic anomalies were enhanced by KF substitution.
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation
Directory of Open Access Journals (Sweden)
Hellberg Michael E
2006-03-01
Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.
International Nuclear Information System (INIS)
Chen, Shaoxia; McMullan, Greg; Faruqi, Abdul R.; Murshudov, Garib N.; Short, Judith M.; Scheres, Sjors H.W.; Henderson, Richard
2013-01-01
Three-dimensional (3D) structure determination by single particle electron cryomicroscopy (cryoEM) involves the calculation of an initial 3D model, followed by extensive iterative improvement of the orientation determination of the individual particle images and the resulting 3D map. Because there is much more noise than signal at high resolution in the images, this creates the possibility of noise reinforcement in the 3D map, which can give a false impression of the resolution attained. The balance between signal and noise in the final map at its limiting resolution depends on the image processing procedure and is not easily predicted. There is a growing awareness in the cryoEM community of how to avoid such over-fitting and over-estimation of resolution. Equally, there has been a reluctance to use the two principal methods of avoidance because they give lower resolution estimates, which some people believe are too pessimistic. Here we describe a simple test that is compatible with any image processing protocol. The test allows measurement of the amount of signal and the amount of noise from overfitting that is present in the final 3D map. We have applied the method to two different sets of cryoEM images of the enzyme beta-galactosidase using several image processing packages. Our procedure involves substituting the Fourier components of the initial particle image stack beyond a chosen resolution by either the Fourier components from an adjacent area of background, or by simple randomisation of the phases of the particle structure factors. This substituted noise thus has the same spectral power distribution as the original data. Comparison of the Fourier Shell Correlation (FSC) plots from the 3D map obtained using the experimental data with that from the same data with high-resolution noise (HR-noise) substituted allows an unambiguous measurement of the amount of overfitting and an accompanying resolution assessment. A simple formula can be used to calculate an
Energy Technology Data Exchange (ETDEWEB)
Chen, Shaoxia; McMullan, Greg; Faruqi, Abdul R.; Murshudov, Garib N.; Short, Judith M.; Scheres, Sjors H.W.; Henderson, Richard, E-mail: rh15@mrc-lmb.cam.ac.uk
2013-12-15
Three-dimensional (3D) structure determination by single particle electron cryomicroscopy (cryoEM) involves the calculation of an initial 3D model, followed by extensive iterative improvement of the orientation determination of the individual particle images and the resulting 3D map. Because there is much more noise than signal at high resolution in the images, this creates the possibility of noise reinforcement in the 3D map, which can give a false impression of the resolution attained. The balance between signal and noise in the final map at its limiting resolution depends on the image processing procedure and is not easily predicted. There is a growing awareness in the cryoEM community of how to avoid such over-fitting and over-estimation of resolution. Equally, there has been a reluctance to use the two principal methods of avoidance because they give lower resolution estimates, which some people believe are too pessimistic. Here we describe a simple test that is compatible with any image processing protocol. The test allows measurement of the amount of signal and the amount of noise from overfitting that is present in the final 3D map. We have applied the method to two different sets of cryoEM images of the enzyme beta-galactosidase using several image processing packages. Our procedure involves substituting the Fourier components of the initial particle image stack beyond a chosen resolution by either the Fourier components from an adjacent area of background, or by simple randomisation of the phases of the particle structure factors. This substituted noise thus has the same spectral power distribution as the original data. Comparison of the Fourier Shell Correlation (FSC) plots from the 3D map obtained using the experimental data with that from the same data with high-resolution noise (HR-noise) substituted allows an unambiguous measurement of the amount of overfitting and an accompanying resolution assessment. A simple formula can be used to calculate an
Directory of Open Access Journals (Sweden)
Bayoh Nabie M
2007-02-01
Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.
Simple, heart-smart substitutions
Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...
International Nuclear Information System (INIS)
Chen Yun; Wu Xiaofeng; Liu Zhong
2009-01-01
This paper studies global synchronization of non-autonomous chaotic electro-mechanical gyrostat systems via variable substitution control. A master-slave non-autonomous synchronization scheme with variable substitution control is mathematically presented. Based on the scheme, some sufficient algebraic criteria for global chaos synchronization of master and slave electro-mechanical gyrostat systems via various single-variable coupling are derived. The effectiveness of the obtained criteria is numerically illustrated by the examples.
A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors
Energy Technology Data Exchange (ETDEWEB)
de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie; Thompson, Andrew J.; Ambepitiya Wickramasinghe, Iresha N.; de la Pena, Alba T. Torrents; van Breemen, Marielle J.; Bouwman, Kim M.; Zhu, Xueyong; McBride, Ryan; Yu, Wenli; Sanders, Rogier W.; Verheije, Monique H.; Wilson, Ian A.; Paulson, James C.
2017-07-10
In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completely switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.
Bougot-Robin, Kristelle
2013-12-20
2D imaging of biochips is particularly interesting for multiplex biosensing. Resonant properties allow label-free detection using the change of refractive index at the chip surface. We demonstrate a new principle of Scanning Of Resonance on Chip by Imaging (SORCI) based on spatial profiles of nanopatterns of resonant waveguide gratings (RWGs) and its embodiment in a fluidic chip for real-time biological studies. This scheme allows multiplexing of the resonance itself by providing nanopattern sensing areas in a bioarray format. Through several chip designs we discuss resonance spatial profiles, dispersion and electric field distribution for optimal light-matter interaction with biological species of different sizes. Fluidic integration is carried out with a black anodized aluminum chamber, advantageous in term of mechanical stability, multiple uses of the chip, temperature control and low optical background. Real-time hybridization experiments are illustrated by SNP (Single Nucleotide Polymorphism) detection in gyrase A of E. coli K12, observed in evolution studies of resistance to the antibiotic ciprofloxacin. We choose a 100 base pairs (bp) DNA target (∼30 kDa) including the codon of interest and demonstrate the high specificity of our technique for probes and targets with close affinity constants. This work validates the safe applicability of our unique combination of RWGs and simple instrumentation for real-time biosensing with sensitivity in buffer solution of ∼10 pg/mm2. Paralleling the success of RWGs sensing for cells sensing, our work opens new avenues for a large number of biological studies. © 2013 Springer Science+Business Media.
Directory of Open Access Journals (Sweden)
Gilbert Gwendolyn L
2008-08-01
Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-08-19
Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling
Gehring, Christoph A; Turek, Ilona S.
2017-01-01
The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.
Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling
Gehring, Christoph A.
2017-10-04
The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.
Directory of Open Access Journals (Sweden)
Alessandra Pasquo
Full Text Available Protein tyrosine phosphatase ρ (PTPρ belongs to the classical receptor type IIB family of protein tyrosine phosphatase, the most frequently mutated tyrosine phosphatase in human cancer. There are evidences to suggest that PTPρ may act as a tumor suppressor gene and dysregulation of Tyr phosphorylation can be observed in diverse diseases, such as diabetes, immune deficiencies and cancer. PTPρ variants in the catalytic domain have been identified in cancer tissues. These natural variants are nonsynonymous single nucleotide polymorphisms, variations of a single nucleotide occurring in the coding region and leading to amino acid substitutions. In this study we investigated the effect of amino acid substitution on the structural stability and on the activity of the membrane-proximal catalytic domain of PTPρ. We expressed and purified as soluble recombinant proteins some of the mutants of the membrane-proximal catalytic domain of PTPρ identified in colorectal cancer and in the single nucleotide polymorphisms database. The mutants show a decreased thermal and thermodynamic stability and decreased activation energy relative to phosphatase activity, when compared to wild- type. All the variants show three-state equilibrium unfolding transitions similar to that of the wild- type, with the accumulation of a folding intermediate populated at ~4.0 M urea.
Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M
2010-01-01
Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Clean Chlorination of Silica Surfaces by a Single-site Substitution Approach
Maity, Niladri; Barman, Samir; Abou-Hamad, Edy; D'Elia, Valerio; Basset, Jean-Marie
2018-01-01
A chlorination method for the selective substitution of well-defined isolated silanol groups of the silica surface has been developed using the catalytic Appel reaction. Spectroscopic analysis, complemented by elemental microanalysis studies, reveals that a quantitative chlorination could be achieved with highly dehydroxylated silica materials that exclusively possess non-hydrogen bonded silanol groups. The employed method did not leave any carbon or phosphorous residue on the silica surface and can be regarded as a promising tool for the future functionalization of metal oxide surfaces.
Clean Chlorination of Silica Surfaces by a Single-site Substitution Approach
Maity, Niladri
2018-02-12
A chlorination method for the selective substitution of well-defined isolated silanol groups of the silica surface has been developed using the catalytic Appel reaction. Spectroscopic analysis, complemented by elemental microanalysis studies, reveals that a quantitative chlorination could be achieved with highly dehydroxylated silica materials that exclusively possess non-hydrogen bonded silanol groups. The employed method did not leave any carbon or phosphorous residue on the silica surface and can be regarded as a promising tool for the future functionalization of metal oxide surfaces.
Directory of Open Access Journals (Sweden)
Mahboobeh Safaeian
Full Text Available Host genetic factors might affect the risk of progression from infection with carcinogenic human papillomavirus (HPV, the etiologic agent for cervical cancer, to persistent HPV infection, and hence to cervical precancer and cancer.We assessed 18,310 tag single nucleotide polymorphisms (SNPs from 1113 genes in 416 cervical intraepithelial neoplasia 3 (CIN3/cancer cases, 356 women with persistent carcinogenic HPV infection (median persistence of 25 months and 425 randomly selected women (non-cases and non-HPV persistent from the 10,049 women from the Guanacaste, Costa Rica HPV natural history cohort. For gene and SNP associations, we computed age-adjusted odds ratio and p-trend. Three comparisons were made: 1 association with CIN3/cancer (compared CIN3/cancer cases to random controls, 2 association with persistence (compared HPV persistence to random controls, and 3 progression (compared CIN3/cancers with HPV-persistent group. Regions statistically significantly associated with CIN3/cancer included genes for peroxiredoxin 3 PRDX3, and ribosomal protein S19 RPS19. The single most significant SNPs from each gene associated with CIN3/cancer were PRDX3 rs7082598 (P(trend<0.0001, and RPS19 rs2305809 (P(trend=0.0007, respectively. Both SNPs were also associated with progression.These data suggest involvement of two genes, RSP19 and PRDX3, or other SNPs in linkage disequilibrium, with cervical cancer risk. Further investigation showed that they may be involved in both the persistence and progression transition stages. Our results require replication but, if true, suggest a role for ribosomal dysfunction, mitochondrial processes, and/or oxidative stress, or other unknown function of these genes in cervical carcinogenesis.
Mutational signatures reveal the role of RAD52 in p53-independent p21-driven genomic instability
DEFF Research Database (Denmark)
Galanos, Panagiotis; Pappas, George; Polyzos, Alexander
2018-01-01
. Consequently, fewer single nucleotide substitutions (SNSs) occur, while formation of highly deleterious DNA double-strand breaks (DSBs) is enhanced, crafting a characteristic mutational signature landscape. Guided by the mutational signatures formed, we find that the DSBs are repaired by Rad52-dependent break...
Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange
DEFF Research Database (Denmark)
Hmelo, Laura R; Borlee, Bradley R; Almblad, Henrik
2015-01-01
Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knock-ins, as well as single-nucleotide insertions, deletions and substitutions, in Pseudomonas aeruginosa. Unlike other approaches to allelic exch...
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Identification of a new human mtDNA polymorphism (A14290G in the NADH dehydrogenase subunit 6 gene
Directory of Open Access Journals (Sweden)
M. Houshmand
2006-06-01
Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited form of retinal ganglion cell degeneration leading to optic atrophy in young adults. Several mutations in different genes can cause LHON (heterogeneity. The ND6 gene is one of the mitochondrial genes that encodes subunit 6 of complex I of the respiratory chain. This gene is a hot spot gene. Fourteen Persian LHON patients were analyzed with single-strand conformational polymorphism and DNA sequencing techniques. None of these patients had four primary mutations, G3460A, G11788A, T14484C, and G14459A, related to this disease. We identified twelve nucleotide substitutions, G13702C, T13879C, T14110C, C14167T, G14199T, A14233G, G14272C, A14290G, G14365C, G14368C, T14766C, and T14798C. Eleven of twelve nucleotide substitutions had already been reported as polymorphism. One of the nucleotide substitutions (A14290G has not been reported. The A14290G nucleotide substitution does not change its amino acid (glutamic acid. We looked for base conservation using DNA star software (MEGALIGN program as a criterion for pathogenic or nonpathogenic nucleotide substitution in A14290G. The results of ND6 gene alignment in humans and in other species (mouse, cow, elegans worm, and Neurospora crassa mold revealed that the 14290th base was not conserved. Fifty normal controls were also investigated for this polymorphism in the Iranian population and two had A14290G polymorphism (4%. This study provides evidence that the mtDNA A14290G allele is a new nonpathogenic polymorphism. We suggest follow-up studies regarding this polymorphism in different populations.
Synthesis and nucleophilic aromatic substitution of 3-fluoro-5-nitro-1-(pentafluorosulfanyl)benzene
Czech Academy of Sciences Publication Activity Database
Ajenjo, Javier; Greenhall, M.; Zarantonello, C.; Beier, Petr
2016-01-01
Roč. 12, Feb 3 (2016), s. 192-197 ISSN 1860-5397 EU Projects: European Commission(XE) 607787 - FLUOR21 Institutional support: RVO:61388963 Keywords : direct fluorination * fluorine * nucleophilic aromatic substitution * pentafluorosulfanyl group * vicarious nucleophilic substitution Subject RIV: CC - Organic Chemistry Impact factor: 2.337, year: 2016 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-12-21
Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life
Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle
2016-03-01
The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the
Pecavar, Verena; Blaschitz, Marion; Hufnagl, Peter; Zeinzinger, Josef; Fiedler, Anita; Allerberger, Franz; Maass, Matthias; Indra, Alexander
2012-06-01
Clostridium difficile, a Gram-positive, spore-forming, anaerobic bacterium, is the main causative agent of hospital-acquired diarrhoea worldwide. In addition to metronidazole and vancomycin, rifaximin, a rifamycin derivative, is a promising antibiotic for the treatment of recurring C. difficile infections (CDI). However, exposure of C. difficile to this antibiotic has led to the development of rifaximin-resistance due to point mutations in the β-subunit of the RNA polymerase (rpoB) gene. In the present study, 348 C. difficile strains with known PCR-ribotypes were investigated for respective single nucleotide polymorphisms (SNPs) within the proposed rpoB hot-spot region by using high-resolution melting (HRM) analysis. This method allows the detection of SNPs by comparing the altered melting behaviour of dsDNA with that of wild-type DNA. Discrimination between wild-type and mutant strains was enhanced by creating heteroduplexes by mixing sample DNA with wild-type DNA, leading to characteristic melting curve shapes from samples containing SNPs in the respective rpoB section. In the present study, we were able to identify 16 different rpoB sequence-types (ST) by sequencing analysis of a 325 bp fragment. The 16 PCR STs displayed a total of 24 different SNPs. Fifteen of these 24 SNPs were located within the proposed 151 bp SNP hot-spot region, resulting in 11 different HRM curve profiles (CP). Eleven SNPs (seven of which were within the proposed hot-spot region) led to amino acid substitutions associated with reduced susceptibility to rifaximin and 13 SNPs (eight of which were within the hot-spot region) were synonymous. This investigation clearly demonstrates that HRM analysis of the proposed SNP hot-spot region in the rpoB gene of C. difficile is a fast and cost-effective method for the identification of C. difficile samples with reduced susceptibility to rifaximin and even allows simultaneous SNP subtyping of the respective C. difficile isolates.
Directory of Open Access Journals (Sweden)
Qian You
2018-02-01
Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.
Directory of Open Access Journals (Sweden)
Juan YI
2016-10-01
Full Text Available Objective To investigate the relations of Fetuin-A gene rs1071592 and rs2593813 single nucleotide polymorphisms (SNPs with the affect ability to polycystic ovary syndrome (PCOS and its endocrine and metabolic characteristics in Chongqing Han population. Methods A case-control study was performed in Chinese Han subjects. The clinical data of 156 cases of normal control and 147 cases of PCOS patients were collected, and their blood glucose, lipids, sex hormone and other biochemical indexes were determined, the SNPs of rs1071592 and rs2593813 were genotyped by TaqMan SNP Genotyping Assay. Hyperinsulinemic-euglycemic clamp was performed in 147 PCOS women and 20 controls. The relative risk of developing PCOS in women with rs1071592 genotype was assessed using a binary logistic regression analysis. Results The distribution frequency of Fetuin-A gene homozygous rs1071592 AA genotype and A allele was significantly increased in PCOS patients than in controls (Pc0.05. Binary logistic regression analysis showed that the risk of developing PCOS was 4.93 times high in women with AA genotype of rs1071592 (OR=4.933, 95%CI 1.593-15.278, P0.05. Conclusion People with SNPs variants of rs1071592 in Fetuin-A gene may have an increased genetic susceptibility to PCOS. However, there won't be significant relationship between SNP of rs2593813 at Fetuin-A gene and PCOS. DOI: 10.11855/j.issn.0577-7402.2016.09.07
Directory of Open Access Journals (Sweden)
Xia Wang
2014-03-01
Full Text Available Objective: To investigate the relationship between single nucleotide polymorphisms (SNP in murine double minute 2 (MDM2 and susceptibility and biological behavior of hepatocellularcarcinoma (HCC. Methods: MDM2 (rs2279744 site polymorphism in peripheral blood from 166 patients with HCC and 157 healthy controls were detected by SYBR GREEN PCR method and the relationship between MDM2 polymorphism and susceptibility and biological behavior of HCC was analyzed by comparing the differences of genotypes in two populations. Results: There was no statistical significance between two groups in terms of MDM2 allele distribution in research population (P = 0.753. The risk of HCC onset in individuals with GG+ TG genotype was 1.698 times of those with TT genotype in case group (95%CI = 1.027 -2.808. MDM2 SNP was associated with HBV infection and the degree of tumor differentiation (P< 0.05. The incidence of alleles in experimental group (T, 0.49; G, 0.51 was very different from that in control group (T, 0.59; G, 0.41 (P = 0.015. The incidence of GG genotype in patients with HCC (22.29% was significantly higher than those without HCC (13.38%. Compared with TT genotype, G allele or GG genotype had more correlation with HCC onset. Conclusion: Compared with TT genotype, MDM2 promoter SNP309 G allele or GG genotype is more associated with HCC onset in Chinese population.
Hsieh, Li-En; Chueh, Ling-Ling
2014-05-21
Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
Directory of Open Access Journals (Sweden)
Katherine Shortt
Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
2012-07-01
Full Text Available Cancers often involve the synergistic effects of gene–gene interactions, but identifying these interactions remains challenging. Here, we present an odds ratio-based genetic algorithm (OR-GA that is able to solve the problems associated with the simultaneous analysis of multiple independent single nucleotide polymorphisms (SNPs that are associated with oral cancer. The SNP interactions between four SNPs—namely rs1799782, rs2040639, rs861539, rs2075685, and belonging to four genes (XRCC1, XRCC2, XRCC3, and XRCC4—were tested in this study, respectively. The GA decomposes the SNPs sets into different SNP combinations with their corresponding genotypes (called SNP barcodes. The GA can effectively identify a specific SNP barcode that has an optimized fitness value and uses this to calculate the difference between the case and control groups. The SNP barcodes with a low fitness value are naturally removed from the population. Using two to four SNPs, the best SNP barcodes with maximum differences in occurrence between the case and control groups were generated by GA algorithm. Subsequently, the OR provides a quantitative measure of the multiple SNP synergies between the oral cancer and control groups by calculating the risk related to the best SNP barcodes and others. When these were compared to their corresponding non-SNP barcodes, the estimated ORs for oral cancer were found to be great than 1 [approx. 1.72–2.23; confidence intervals (CIs: 0.94–5.30, p < 0.03–0.07] for various specific SNP barcodes with two to four SNPs. In conclusion, the proposed OR-GA method successfully generates SNP barcodes, which allow oral cancer risk to be evaluated and in the process the OR-GA method identifies possible SNP–SNP interactions.
Directory of Open Access Journals (Sweden)
Shannon M Clarke
Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.
Zhang, Xueru; McGown, Linda B
2013-06-01
DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin
2013-01-01
Variation in genes encoding the ß2-adrenergic receptor (ADRB2) and angiotensin-converting enzyme (ACE) may influence Q¿ (cardiac output). The 46G>A (G16R) SNP (single nucleotide polymorphism) has been associated with ß2-mediated vasodilation, but the effect of ADRB2 haplotypes on Q¿ has not been...... studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise...... V¿O2 (oxygen uptake) in G16G subjects, but the increase was 0.5 (0.0-0.9) l/min lower in Arg16 carriers (P=0.035). A similar effect size was observed for the Arg16 haplotypes ACCCG and ACCCC. No interaction was found between ADRB2 and ACE polymorphisms. During exercise, the increase in Q¿ was 0...
Electron attachment to DNA single strands: gas phase and aqueous solution.
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F
2007-01-01
The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers
Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun
2016-05-01
To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.
Directory of Open Access Journals (Sweden)
Zhipeng Su
Full Text Available Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs, UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures. The transcriptional units
SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.
Singer, Maxine; Winocour, Ernest
2011-04-10
The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.