
Sample records for single nucleotide substitution

  1. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    Directory of Open Access Journals (Sweden)

    Ioanna A Armata

    Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  2. regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution. (United States)

    Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong


    While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg


    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  4. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit. (United States)

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun


    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  5. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.


    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  6. A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands. (United States)

    Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y


    We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)


    Li, M-H; Tiirikka, T; Kantanen, J


    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...

  8. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs


    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu


    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  9. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries). (United States)

    Li, M-H; Tiirikka, T; Kantanen, J


    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  10. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs. (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu


    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  11. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami


    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  12. Single nucleotide substitution mutations and polymorphisms in ...

    African Journals Online (AJOL)



    Sep 14, 2011 ... 1The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Karachi, Pakistan. 2Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, Pakistan. 3Department of Dermatology, Jinnah Postgraduate Medical Center, Karachi, Pakistan. Accepted 7 July, 2011.

  13. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian


    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  14. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  15. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  16. Plastome-Wide Nucleotide Substitution Rates Reveal Accelerated Rates in Papilionoideae and Correlations with Genome Features Across Legume Subfamilies. (United States)

    Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K


    This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.

  17. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA (United States)

    Jukes, T. H.; Kimura, M.


    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis. (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A


    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  20. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  1. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)


    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  2. Analysis of single nucleotide polymorphisms in case-control studies. (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer


    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  3. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  4. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  5. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  6. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region. (United States)

    Giangaspero, Massimo; Harasawa, Ryô


    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  7. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA. (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V


    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  8. Effect of the assignment of ancestral CpG state on the estimation of nucleotide substitution rates in mammals

    Directory of Open Access Journals (Sweden)

    Keightley Peter D


    Full Text Available Abstract Background Molecular evolutionary studies in mammals often estimate nucleotide substitution rates within and outside CpG dinucleotides separately. Frequently, in alignments of two sequences, the division of sites into CpG and non-CpG classes is based simply on the presence or absence of a CpG dinucleotide in either sequence, a procedure that we refer to as CpG/non-CpG assignment. Although it likely that this procedure is biased, it is generally assumed that the bias is negligible if species are very closely related. Results Using simulations of DNA sequence evolution we show that assignment of the ancestral CpG state based on the simple presence/absence of the CpG dinucleotide can seriously bias estimates of the substitution rate, because many true non-CpG changes are misassigned as CpG. Paradoxically, this bias is most severe between closely related species, because a minimum of two substitutions are required to misassign a true ancestral CpG site as non-CpG whereas only a single substitution is required to misassign a true ancestral non-CpG site as CpG in a two branch tree. We also show that CpG misassignment bias differentially affects fourfold degenerate and noncoding sites due to differences in base composition such that fourfold degenerate sites can appear to be evolving more slowly than noncoding sites. We demonstrate that the effects predicted by our simulations occur in a real evolutionary setting by comparing substitution rates estimated from human-chimp coding and intronic sequence using CpG/non-CpG assignment with estimates derived from a method that is largely free from bias. Conclusion Our study demonstrates that a common method of assigning sites into CpG and non CpG classes in pairwise alignments is seriously biased and recommends against the adoption of ad hoc methods of ancestral state assignment.

  9. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms


    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca


    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  10. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin


    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  11. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee


    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB ( provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  12. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines. (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G


    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  13. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region. (United States)

    Giangaspero, Massimo; Harasawa, Ryô


    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  14. Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions. (United States)

    Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V


    Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.

  15. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders (United States)

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro


    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  16. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms. (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca


    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  17. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan


    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  18. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium. (United States)

    Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K


    Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris


    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  20. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi


    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  1. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin


    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  2. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria. (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung


    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  3. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung


    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  4. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra


    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  5. Single Nucleotide Polymorphism Detection Using Au-Decorated Single-Walled Carbon Nanotube Field Effect Transistors

    Directory of Open Access Journals (Sweden)

    Keum-Ju Lee


    Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.

  6. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey


    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  7. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease. (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima


    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  8. Single nucleotide polymorphisms (SNPs in coding regions of canine dopamine- and serotonin-related genes

    Directory of Open Access Journals (Sweden)

    Lingaas Frode


    Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.

  9. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification. (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  10. Doping monolayer graphene with single atom substitutions

    KAUST Repository

    Wang, Hongtao


    Functionalized graphene has been extensively studied with the aim of tailoring properties for gas sensors, superconductors, supercapacitors, nanoelectronics, and spintronics. A bottleneck is the capability to control the carrier type and density by doping. We demonstrate that a two-step process is an efficient way to dope graphene: create vacancies by high-energy atom/ion bombardment and fill these vacancies with desired dopants. Different elements (Pt, Co, and In) have been successfully doped in the single-atom form. The high binding energy of the metal-vacancy complex ensures its stability and is consistent with in situ observation by an aberration-corrected and monochromated transmission electron microscope. © 2011 American Chemical Society.

  11. Electrical detection and quantification of single and mixed DNA nucleotides in suspension (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah


    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  12. Identification and analysis of Single Nucleotide Polymorphisms (SNPs in the mosquito Anopheles funestus, malaria vector

    Directory of Open Access Journals (Sweden)

    Hemingway Janet


    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.

  13. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos


    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  14. A single-nucleotide polymorphism of human neuropeptide s gene originated from Europe shows decreased bioactivity.

    Directory of Open Access Journals (Sweden)

    Cheng Deng

    Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.

  15. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  16. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase. (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S


    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  17. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method. (United States)

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô


    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Cohort analysis of a single nucleotide polymorphism on DNA chips. (United States)

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F


    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  19. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution. (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru


    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  20. Nonrandom Distribution of miRNAs Genes and Single Nucleotide Variants in Keratoconus Loci.

    Directory of Open Access Journals (Sweden)

    Dorota M Nowak

    Full Text Available Despite numerous studies, the causes of both development and progression of keratoconus remain elusive. Previous studies of this disorder focused mainly on one or two genetic factors only. However, in the analysis of such complex diseases all potential factors should be taken into consideration. The purpose of this study was a comprehensive analysis of known keratoconus loci to uncover genetic factors involved in this disease causation in the general population, which could be omitted in the original studies. In this investigation genomic data available in various databases and experimental own data were assessed. The lists of single nucleotide variants and miRNA genes localized in reported keratoconus loci were obtained from Ensembl and miRBase, respectively. The potential impact of nonsynonymous amino acid substitutions on protein structure and function was assessed with PolyPhen-2 and SIFT. For selected protein genes the ranking was made to choose those most promising for keratoconus development. Ranking results were based on topological features in the protein-protein interaction network. High specificity for the populations in which the causative sequence variants have been identified was found. In addition, the possibility of links between previously analyzed keratoconus loci was confirmed including miRNA-gene interactions. Identified number of genes associated with oxidative stress and inflammatory agents corroborated the hypothesis of their effect on the disease etiology. Distribution of the numerous sequences variants within both exons and mature miRNA which forces you to search for a broader look at the determinants of keratoconus. Our findings highlight the complexity of the keratoconus genetics.

  1. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa. (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke


    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  2. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions. (United States)

    Nishizawa, M; Nishizawa, K


    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  3. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  4. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik


    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  5. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene


    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  6. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr


    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  7. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis. (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q


    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  8. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth


    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  9. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas


    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  10. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction. (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen


    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  11. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.


    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  12. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E


    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  13. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.


    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  14. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)


    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  15. Virtual substitution scan via single-step free energy perturbation. (United States)

    Chiang, Ying-Chih; Wang, Yi


    With the rapid expansion of our computing power, molecular dynamics (MD) simulations ranging from hundreds of nanoseconds to microseconds or even milliseconds have become increasingly common. The majority of these long trajectories are obtained from plain (vanilla) MD simulations, where no enhanced sampling or free energy calculation method is employed. To promote the 'recycling' of these trajectories, we developed the Virtual Substitution Scan (VSS) toolkit as a plugin of the open-source visualization and analysis software VMD. Based on the single-step free energy perturbation (sFEP) method, VSS enables the user to post-process a vanilla MD trajectory for a fast free energy scan of substituting aryl hydrogens by small functional groups. Dihedrals of the functional groups are sampled explicitly in VSS, which improves the performance of the calculation and is found particularly important for certain groups. As a proof-of-concept demonstration, we employ VSS to compute the solvation free energy change upon substituting the hydrogen of a benzene molecule by 12 small functional groups frequently considered in lead optimization. Additionally, VSS is used to compute the relative binding free energy of four selected ligands of the T4 lysozyme. Overall, the computational cost of VSS is only a fraction of the corresponding multi-step FEP (mFEP) calculation, while its results agree reasonably well with those of mFEP, indicating that VSS offers a promising tool for rapid free energy scan of small functional group substitutions. This article is protected by copyright. All rights reserved. © 2016 Wiley Periodicals, Inc.

  16. A nucleotide substitution at the 5′ splice site of intron 1 of rice HEADING DATE 1 (HD1 gene homolog in foxtail millet, broadly found in landraces from Europe and Asia

    Directory of Open Access Journals (Sweden)

    Kenji Fukunaga


    Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.

  17. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms. (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong


    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  18. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay. (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M


    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  19. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes. (United States)

    Chen, Sherry Xi; Seelig, Georg


    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  20. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  1. Increased frequency of single base substitutions in a population of transcripts expressed in cancer cells

    Directory of Open Access Journals (Sweden)

    Bianchetti Laurent


    Full Text Available Abstract Background Single Base Substitutions (SBS that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. Methods We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE and Tag-seq (a combination of L-SAGE and deep sequencing, and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT, i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. Results In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP, catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST, i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC, healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. Conclusion If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic.

  2. Increased frequency of single base substitutions in a population of transcripts expressed in cancer cells

    International Nuclear Information System (INIS)

    Bianchetti, Laurent; Kieffer, David; Féderkeil, Rémi; Poch, Olivier


    Single Base Substitutions (SBS) that alter transcripts expressed in cancer originate from somatic mutations. However, recent studies report SBS in transcripts that are not supported by the genomic DNA of tumor cells. We used sequence based whole genome expression profiling, namely Long-SAGE (L-SAGE) and Tag-seq (a combination of L-SAGE and deep sequencing), and computational methods to identify transcripts with greater SBS frequencies in cancer. Millions of tags produced by 40 healthy and 47 cancer L-SAGE experiments were compared to 1,959 Reference Tags (RT), i.e. tags matching the human genome exactly once. Similarly, tens of millions of tags produced by 7 healthy and 8 cancer Tag-seq experiments were compared to 8,572 RT. For each transcript, SBS frequencies in healthy and cancer cells were statistically tested for equality. In the L-SAGE and Tag-seq experiments, 372 and 4,289 transcripts respectively, showed greater SBS frequencies in cancer. Increased SBS frequencies could not be attributed to known Single Nucleotide Polymorphisms (SNP), catalogued somatic mutations or RNA-editing enzymes. Hypothesizing that Single Tags (ST), i.e. tags sequenced only once, were indicators of SBS, we observed that ST proportions were heterogeneously distributed across Embryonic Stem Cells (ESC), healthy differentiated and cancer cells. ESC had the lowest ST proportions, whereas cancer cells had the greatest. Finally, in a series of experiments carried out on a single patient at 1 healthy and 3 consecutive tumor stages, we could show that SBS frequencies increased during cancer progression. If the mechanisms generating the base substitutions could be known, increased SBS frequency in transcripts would be a new useful biomarker of cancer. With the reduction of sequencing cost, sequence based whole genome expression profiling could be used to characterize increased SBS frequency in patient’s tumor and aid diagnostic

  3. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P


    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  4. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting. (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T


    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA


    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.


    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  6. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair. (United States)

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I


    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  7. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.


    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  8. Biodentine-a novel dentinal substitute for single visit apexification

    Directory of Open Access Journals (Sweden)

    Gurudutt Nayak


    Full Text Available Use of an apical plug in management of cases with open apices has gained popularity in recent years. Biodentine, a new calcium silicate-based material has recently been introduced as a dentine substitute, whenever original dentine is damaged. This case report describes single visit apexification in a maxillary central incisor with necrotic pulp and open apex using Biodentine as an apical barrier, and a synthetic collagen material as an internal matrix. Following canal cleaning and shaping, calcium hydroxide was placed as an intracanal medicament for 1 mon. This was followed by placement of small piece of absorbable collagen membrane beyond the root apex to serve as matrix. An apical plug of Biodentine of 5 mm thickness was placed against the matrix using pre-fitted hand pluggers. The remainder of canal was back-filled with thermoplasticized gutta-percha and access cavity was restored with composite resin followed by all-ceramic crown. One year follow-up revealed restored aesthetics and function, absence of clinical signs and symptoms, resolution of periapical rarefaction, and a thin layer of calcific tissue formed apical to the Biodentine barrier. The positive clinical outcome in this case is encouraging for the use of Biodentine as an apical plug in single visit apexification procedures.

  9. Echoic Sensory Substitution Information in a Single Obstacle Circumvention Task. (United States)

    Kolarik, Andrew J; Scarfe, Amy C; Moore, Brian C J; Pardhan, Shahina


    Accurate motor control is required when walking around obstacles in order to avoid collisions. When vision is unavailable, sensory substitution can be used to improve locomotion through the environment. Tactile sensory substitution devices (SSDs) are electronic travel aids, some of which indicate the distance of an obstacle using the rate of vibration of a transducer on the skin. We investigated how accurately such an SSD guided navigation in an obstacle circumvention task. Using an SSD, 12 blindfolded participants navigated around a single flat 0.6 x 2 m obstacle. A 3-dimensional Vicon motion capture system was used to quantify various kinematic indices of human movement. Navigation performance under full vision was used as a baseline for comparison. The obstacle position was varied from trial to trial relative to the participant, being placed at two distances 25 cm to the left, right or directly ahead. Under SSD guidance, participants navigated without collision in 93% of trials. No collisions occurred under visual guidance. Buffer space (clearance between the obstacle and shoulder) was larger by a factor of 2.1 with SSD guidance than with visual guidance, movement times were longer by a factor of 9.4, and numbers of velocity corrections were larger by a factor of 5 (all p<0.05). Participants passed the obstacle on the side affording the most space in the majority of trials for both SSD and visual guidance conditions. The results are consistent with the idea that SSD information can be used to generate a protective envelope during locomotion in order to avoid collisions when navigating around obstacles, and to pass on the side of the obstacle affording the most space in the majority of trials.

  10. Echoic Sensory Substitution Information in a Single Obstacle Circumvention Task.

    Directory of Open Access Journals (Sweden)

    Andrew J Kolarik

    Full Text Available Accurate motor control is required when walking around obstacles in order to avoid collisions. When vision is unavailable, sensory substitution can be used to improve locomotion through the environment. Tactile sensory substitution devices (SSDs are electronic travel aids, some of which indicate the distance of an obstacle using the rate of vibration of a transducer on the skin. We investigated how accurately such an SSD guided navigation in an obstacle circumvention task. Using an SSD, 12 blindfolded participants navigated around a single flat 0.6 x 2 m obstacle. A 3-dimensional Vicon motion capture system was used to quantify various kinematic indices of human movement. Navigation performance under full vision was used as a baseline for comparison. The obstacle position was varied from trial to trial relative to the participant, being placed at two distances 25 cm to the left, right or directly ahead. Under SSD guidance, participants navigated without collision in 93% of trials. No collisions occurred under visual guidance. Buffer space (clearance between the obstacle and shoulder was larger by a factor of 2.1 with SSD guidance than with visual guidance, movement times were longer by a factor of 9.4, and numbers of velocity corrections were larger by a factor of 5 (all p<0.05. Participants passed the obstacle on the side affording the most space in the majority of trials for both SSD and visual guidance conditions. The results are consistent with the idea that SSD information can be used to generate a protective envelope during locomotion in order to avoid collisions when navigating around obstacles, and to pass on the side of the obstacle affording the most space in the majority of trials.

  11. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton. (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa


    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  12. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments. (United States)

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris


    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  13. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms. (United States)

    Zeng, Lingwen; Xiao, Zhuo


    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  14. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  15. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek


    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  16. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae. (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe


    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  17. Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zienolddiny S


    Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

  18. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A


    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  19. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Børsting, Claus; Morling, Niels


    and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...

  20. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael


    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  1. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa


    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  2. Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

    Directory of Open Access Journals (Sweden)

    Kourosh Bamdad


    Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

  3. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments

    Directory of Open Access Journals (Sweden)

    Tcherepanov Vasily


    Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  4. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan


    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  5. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

    Directory of Open Access Journals (Sweden)

    Roe Bruce A


    Full Text Available Abstract Background The long bone abnormality (lbab mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  6. Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Rui-Jun Su

    Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.

  7. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice. (United States)

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan


    The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  8. Single Nucleotide Polymorphisms in Common Bean: Their Discovery and Genotyping Using a Multiplex Detection System

    Directory of Open Access Journals (Sweden)

    E. Gaitán-Solís


    Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.

  9. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Jing Zhang


    Full Text Available Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature.

  10. [A population genetic study of 22 autosomal loci of single nucleotide polymorphisms]. (United States)

    Tang, Jian-pin; Jiang, Feng-hui; Shi, Mei-sen; Xu, Chuan-chao; Chen, Rui; Lai, Xiao-pin


    To evaluate polymorphisms and forensic efficiency of 22 non-binary single nucleotide polymorphism (SNP) loci. One hundred ethnic Han Chinese individuals were recruited from Dongguan, Guangdong. The 22 loci were genotyped with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Nine loci were found with a single allele, 4 loci were found to be biallelic, whilst 9 loci were found to have 3 alleles. For 13 polymorphic loci, the combined discrimination power and power of exclusion were 0.999 98 and 0.9330, respectively. For the 9 non-biallelic loci, the combined discrimination power and power of exclusion were 0.9998 and 0.8956, respectively. For motherless cases, the combined power of exclusion was 0.6405 for 13 polymorphic SNPs and 0.6405 for 9 non-binary SNPs. Non-binary loci have a greater discrimination power and exclusion power per SNP.

  11. Secretion of wound healing mediators by single and bi-layer skin substitutes. (United States)

    Maarof, Manira; Law, Jia Xian; Chowdhury, Shiplu Roy; Khairoji, Khairul Anuar; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj


    Limitations of current treatments for skin loss caused by major injuries leads to the use of skin substitutes. It is assumed that secretion of wound healing mediators by these skin substitutes plays a role in treating skin loss. In our previous study, single layer keratinocytes (SK), single layer fibroblast (SF) and bilayer (BL; containing keratinocytes and fibroblasts layers) skin substitutes were fabricated using fibrin that had shown potential to heal wounds in preclinical studies. This study aimed to quantify the secretion of wound healing mediators, and compare between single and bi-layer skin substitutes. Skin samples were digested to harvest fibroblasts and keratinocytes, and expanded to obtain sufficient cells for the construction of skin substitutes. Acellular fibrin (AF) construct was used as control. Substitutes i.e. AF, SK, SF and BL were cultured for 2 days, and culture supernatant was collected to analyze secretion of wound healing mediators via multiplex ELISA. Among 19 wound healing mediators tested, BL substitute secreted significantly higher amounts of CXCL1 and GCSF compared to SF and AF substitute but this was not significant with respect to SK substitute. The BL substitute also secreted significantly higher amounts of CXCL5 and IL-6 compared to other substitutes. In contrast, the SK substitute secreted significantly higher amounts of VCAM-1 compared to other substitutes. However, all three skin substitutes also secreted CCL2, CCL5, CCL11, GM-CSF, IL8, IL-1α, TNF-α, ICAM-1, FGF-β, TGF-β, HGF, VEGF-α and PDGF-BB factors, but no significant difference was seen. Secretion of these mediators after transplantation may play a significant role in promoting wound healing process for the treatment of skin loss.

  12. Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages. (United States)

    Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo


    The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

  13. Synthesis of 8-amino and 8-substituted amino derivatives of acyclic purine nucleoside and nucleotide analogs. Alkylation of 8-substituted purine bases

    Czech Academy of Sciences Publication Activity Database

    Janeba, Zlatko; Holý, Antonín


    Roč. 20, 4-7 (2001), s. 1103-1106 ISSN 1525-7770 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.508, year: 2001

  14. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator. (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics. (United States)

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu


    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene. (United States)

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S


    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase† (United States)

    Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.


    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

  18. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer. (United States)

    Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel


    Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

  19. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women

    Directory of Open Access Journals (Sweden)

    Jéssica de Oliveira


    Full Text Available Abstract Butyrylcholinesterase (BChE activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs in the BCHE gene: -116G > A (rs1126680, 1615GA (rs1803274, 1914A 0.05. The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  20. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits]. (United States)

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia


    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (Plink with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  1. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Pujolar, José Martin; Jacobsen, M.W.; Als, Thomas Damm


    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify...... species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American...... eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison...

  2. VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    HyoYoung Kim


    Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.

  3. DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

    Directory of Open Access Journals (Sweden)

    Inês Soares

    Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

  4. Caveolin-1 single nucleotide polymorphism in antineutrophil cytoplasmic antibody associated vasculitis.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Immunosuppression is cornerstone treatment of antineutrophil cytoplasmic antibody associated vasculitis (AAV but is later complicated by infection, cancer, cardiovascular and chronic kidney disease. Caveolin-1 is an essential structural protein for small cell membrane invaginations known as caveolae. Its functional role has been associated with these complications. For the first time, caveolin-1 (CAV1 gene variation is studied in AAV.CAV1 single nucleotide polymorphism rs4730751 was analysed in genomic DNA from 187 white patients with AAV from Birmingham, United Kingdom. The primary outcome measure was the composite endpoint of time to all-cause mortality or renal replacement therapy. Secondary endpoints included time to all-cause mortality, death from sepsis or vascular disease, cancer and renal replacement therapy. Validation of results was sought from 589 white AAV patients, from two European cohorts.The primary outcome occurred in 41.7% of Birmingham patients. In a multivariate model, non-CC genotype variation at the studied single nucleotide polymorphism was associated with increased risk from: the primary outcome measure [HR 1.86; 95% CI: 1.14-3.04; p=0.013], all-cause mortality [HR:1.83; 95% CI: 1.02-3.27; p=0.042], death from infection [HR:3.71; 95% CI: 1.28-10.77; p=0.016], death from vascular disease [HR:3.13; 95% CI: 1.07-9.10; p=0.037], and cancer [HR:5.55; 95% CI: 1.59-19.31; p=0.007]. In the validation cohort, the primary outcome rate was far lower (10.4%; no association between genotype and the studied endpoints was evident.The presence of a CC genotype in Birmingham is associated with protection from adverse outcomes of immunosuppression treated AAV. Lack of replication in the European cohort may have resulted from low clinical event rates. These findings are worthy of further study in larger cohorts.

  5. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

    Directory of Open Access Journals (Sweden)

    Claire Chewapreecha


    Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

  6. Precise detection of de novo single nucleotide variants in human genomes. (United States)

    Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael


    The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

  7. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus (United States)


    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  8. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus. (United States)

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline


    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  9. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.


    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  10. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  11. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm. (United States)

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng


    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  12. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)


    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  13. Novel Single-Nucleotide Polymorphism Markers Predictive of Pathologic Response to Preoperative Chemoradiation Therapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Kim, Jin C.; Ha, Ye J.; Roh, Seon A.; Cho, Dong H.; Choi, Eun Y.; Kim, Tae W.; Kim, Jong H.; Kang, Tae W.; Kim, Seon Y.; Kim, Yong S.


    Purpose: Studies aimed at predicting individual responsiveness to preoperative chemoradiation therapy (CRT) are urgently needed, especially considering the risks associated with poorly responsive patients. Methods and Materials: A 3-step strategy for the determination of CRT sensitivity is proposed based on (1) the screening of a human genome-wide single-nucleotide polymorphism (SNP) array in correlation with histopathologic tumor regression grade (TRG); (2) clinical association analysis of 113 patients treated with preoperative CRT; and (3) a cell-based functional assay for biological validation. Results: Genome-wide screening identified 9 SNPs associated with preoperative CRT responses. Positive responses (TRG 1-3) were obtained more frequently in patients carrying the reference allele (C) of the SNP CORO2A rs1985859 than in those with the substitution allele (T) (P=.01). Downregulation of CORO2A was significantly associated with reduced early apoptosis by 27% (P=.048) and 39% (P=.023) in RKO and COLO320DM colorectal cancer cells, respectively, as determined by flow cytometry. Reduced radiosensitivity was confirmed by colony-forming assays in the 2 colorectal cancer cells (P=.034 and .015, respectively). The SNP FAM101A rs7955740 was not associated with radiosensitivity in the clinical association analysis. However, downregulation of FAM101A significantly reduced early apoptosis by 29% in RKO cells (P=.047), and it enhanced colony formation in RKO cells (P=.001) and COLO320DM cells (P=.002). Conclusion: CRT-sensitive SNP markers were identified using a novel 3-step process. The candidate marker CORO2A rs1985859 and the putative marker FAM101A rs7955740 may be of value for the prediction of radiosensitivity to preoperative CRT, although further validation is needed in large cohorts

  14. Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.

    Directory of Open Access Journals (Sweden)

    Liam R Brunham


    Full Text Available The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008. These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

  15. Incorporation of causative quantitative trait nucleotides in single-step GBLUP. (United States)

    Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy


    Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

  16. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

    Directory of Open Access Journals (Sweden)

    Sun Zhenyu


    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring.

  17. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene. (United States)

    Multani, Shaleen; Saranath, Dhananjaya


    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  18. Genetic variation of classical swine fever virus based on palindromic nucleotide substitutions, a genetic marker in the 5' untranslated region of RNA

    Directory of Open Access Journals (Sweden)

    Massimo Giangaspero


    Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.

  19. Analyzing a single nucleotide polymorphism in schizophrenia: a meta-analysis approach

    Directory of Open Access Journals (Sweden)

    Falola O


    Full Text Available Oluwadamilare Falola,1 Victor Chukwudi Osamor,1,2 Marion Adebiyi,1,2 Ezekiel Adebiyi1,2 1Covenant University Bioinformatics Research (CUBRe, 2Department of Computer and Information Sciences, College of Science and Technology, Covenant University, Ota, Ogun State, Nigeria Background: Schizophrenia is a severe mental disorder affecting >21 million people worldwide. Some genetic studies reported that single nucleotide polymorphism (SNP involving variant rs1344706 from the ZNF804A gene in human beings is associated with the risk of schizophrenia in several populations. Similar results tend to conflict with other reports in literature, indicating that no true significant association exists between rs1344706 and schizophrenia. We seek to determine the level of association of this SNP with schizophrenia in the Asian population using more recent genome-wide association study (GWAS datasets. Methods: Applying a computational approach with inclusion of more recent GWAS datasets, we conducted a meta-analysis to examine the level of association of SNP rs1344706 and the risk of schizophrenia disorder among the Asian population constituting Chinese, Indonesians, Japanese, Kazakhs and Singaporeans. For a total of 21 genetic studies, including a total of 28,842 cases and 35,630 controls, regression analysis, publication bias, Cochran’s Q and I2 tests were performed. The DerSimonian and Laird random-effects model was used to assess the association of the genetic variant to schizophrenia. Leave-one-out sensitivity analysis was also conducted to determine the influence of each study on the final outcome of the association study. Results: Our summarized analysis for Asian population revealed a pooled odds ratio of 1.06, 95% confidence interval of 1.01–1.11 and two-tailed P-value of 0.0228. Our test for heterogeneity showed the presence of large heterogeneity (I2=53.44%, P =0.00207 and Egger’s regression test (P =0.8763 and Begg’s test (P =0

  20. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups. (United States)

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H


    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  1. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms. (United States)

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A


    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  2. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure (United States)

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  3. No association between a common single nucleotide polymorphism, rs4141463, in the MACROD2 gene and autism spectrum disorder.

    NARCIS (Netherlands)

    Curran, S.; Bolton, P.; Rozsnyai, K.; Chiocchetti, A.; Klauck, S.M.; Duketis, E.; Poustka, F.; Schlitt, S.; Freitag, C.M.; Lee, I. van der; Muglia, P.; Poot, M.; Staal, W.G.; Jonge, M.V. de; Ophoff, R.A.; Lewis, C.; Skuse, D.; Mandy, W.; Vassos, E.; Fossdal, R.; Magnusson, P.; Hreidarsson, S.; Saemundsen, E.; Stefansson, H.; Stefansson, K.; Collier, D.


    The Autism Genome Project (AGP) Consortium recently reported genome-wide significant association between autism and an intronic single nucleotide polymorphism marker, rs4141463, within the MACROD2 gene. In the present study we attempted to replicate this finding using an independent case-control

  4. Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Pastore, M.; Gentiluomo, M.; Talar-Wojnarowska, R.; Kupcinskas, J.; Malecka-Panas, E.; Neoptolemos, J. P.; Niesen, W.; Vodička, Pavel; Delle Fave, G.; Bueno-de-Mesquita, H. B.; Gazouli, M.; Pacetti, P.; Di Leo, M.; Ito, H.; Klüter, H.; Souček, P.; Corbo, V.; Yamao, K.; Hosono, S.; Kaaks, R.; Vashist, Y.; Gioffreda, D.; Strobel, O.; Shimizu, Y.; Dijk, F.; Andriulli, A.; Ivanauskas, A.; Bugert, P.; Tavano, F.; Vodičková, L.; Zambon, C.F.; Lovecek, M.; Landi, S.; Key, T. J.; Boggi, U.; Pezzilli, R.; Jamroziak, K.; Mohelníková-Duchoňová, B.; Mambrini, A.; Bambi, F.; Busch, O.; Pazienza, V.; Valente, R.; Theodoropoulos, G.E.; Hackert, T.; Capurso, G.; Cavestro, G.M.; Pasquali, C.; Basso, D.; Sperti, C.; Matsuo, K.; Büchler, M.; Khaw, K. T.; Izbicki, J.; Costello, E.; Katzke, V.; Michalski, Ch.; Stepien, A.; Rizzato, C.; Canzian, F.


    Roč. 7, č. 35 (2016), s. 57011-57020 ISSN 1949-2553 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * CDKN2A * single nucleotide polymorphisms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.168, year: 2016

  5. Effect of secondary structure on single nucleotide polymorphism detection with a porous microarray matrix; implications for probe selection

    NARCIS (Netherlands)

    Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.


    Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,

  6. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma. (United States)

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li


    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  7. Risk of estrogen receptor-positive and -negative breast cancer and single-nucleotide polymorphism 2q35-rs13387042

    DEFF Research Database (Denmark)

    Milne, Roger L; Benítez, Javier; Nevanlinna, Heli


    BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...

  8. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui


    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  9. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.). (United States)

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J


    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  10. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  11. Investigation of single nucleotide polymorphisms and biological pathways associated with response to TNFα inhibitors in patients with rheumatoid arthritis

    DEFF Research Database (Denmark)

    Krintel, Sophine B; Palermo, Giuseppe; Johansen, Julia S


    Recently, two genome-wide association studies identified single nucleotide polymorphisms (SNPs) significantly associated with the treatment response to tumor necrosis factor α (TNFα) inhibitors in patients with rheumatoid arthritis (RA). We aimed to replicate these results and identify SNPs and t...

  12. Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    Sukhjiwan Kaur


    Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

  13. Single nucleotide polymorphisms in ZNF208 are associated with increased risk for HBV in Chinese people. (United States)

    Li, Hengxin; Chen, Jun; Zhang, RuiZhi; Xu, Ran; Zhang, Zhe; Ren, Le; Yang, Qi; Tian, Yumei; Li, Daxu


    Single nucleotide polymorphisms (SNPs) in ZNF208 may be associated with susceptibility to Hepatitis B virus (HBV). In the current study, we analyzed the association between ZNF208 SNPs and risk of HBV in 242 HBV patients and 300 healthy subjects from the Xi'an area of Chinese Han Population. Of the five SNPs examined, rs2188971 (OR: 1.36, 95% CI: 1.04-1.76, P = 0.022), rs8103163 (OR: 1.40, 95% CI: 1.08-1.82, P = 0.010) and rs7248488 (OR: 1.38, 95% CI: 1.07-1.79, P = 0.014) were correlated with HBV susceptibility based on Chi-square tests. After the P -values were adjusted by Bonferroni correction, there only rs8103163 ( P = 0.050) was slightly with increased HBV risk. Additionally, haplotype A rs2188972 T rs2188971 A rs8103163 A rs7248488 (OR = 1.42; 95% C I, 1.10-1.85; P = 0.008) was found to increase susceptibility of suffering from HBV. These findings suggest that ZNF208 polymorphisms may contribute to the development of HBV.

  14. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags. (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi


    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  15. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms. (United States)

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang


    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects. (United States)

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine


    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  17. Quantitative Trait Loci Analysis of Seed Quality Characteristics in Lentil using Single Nucleotide Polymorphism Markers

    Directory of Open Access Journals (Sweden)

    Michael J. Fedoruk


    Full Text Available Seed shape, color, and pattern of lentil ( Medik. subsp. are important quality traits as they determine market class and possible end uses. A recombinant inbred line population was phenotyped for seed dimensions over multiple site–years and classified according to cotyledon and seed coat color and pattern. The objectives were to determine the heritability of seed dimensions, identify genomic regions controlling these dimensions, and map seed coat and cotyledon color genes. A genetic linkage map consisting of 563 single nucleotide polymorphisms, 10 simple sequence repeats, and four seed color loci was developed for quantitative trait loci (QTL analysis. Loci for seed coat color and pattern mapped to linkage groups 2 (, 3 (, and 6 ( while the cotyledon color locus ( mapped to linkage group 1. The broad sense heritability estimates were high for seed diameter (broad-sense heritability [] = 0.92 and seed plumpness ( = 0.94 while seed thickness ( = 0.60 and days to flowering ( = 0.45 were more moderate. There were significant seed dimension QTL on six of the seven linkage groups. The most significant QTL for diameter and plumpness was found at the cotyledon color locus (. The markers identified in this study can be used to help enrich breeding populations for desired seed quality characteristics, thereby increasing efficiency in the lentil breeding program.

  18. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update. (United States)

    Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed


    Preterm birth (PTB), birth at PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  19. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Raghavan Chinnadurai


    Full Text Available The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS, linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs.

  20. EnsembleGASVR: A novel ensemble method for classifying missense single nucleotide polymorphisms

    KAUST Repository

    Rapakoulia, Trisevgeni


    Motivation: Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem ofmissing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. Results: To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a twostep algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. © The Author 2014.

  1. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes. (United States)

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I


    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants. (United States)

    Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong


    Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.

  3. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Stephen eSalton


    Full Text Available The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs, where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs, with neuropsychiatric, endocrine and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A of the human brain-derived neurotrophic factor (BDNF gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  4. A STAT6 Intronic Single-Nucleotide Polymorphism is Associated with Clinical Malaria in Ghanaian Children

    Directory of Open Access Journals (Sweden)

    Daniel Amoako-Sakyi


    Full Text Available Malaria pathogenesis may be influenced by IgE responses and cytokine cross-regulation. Several mutations in the IL-4/STAT6 signaling pathway can alter cytokine cross-regulation and IgE responses during a Plasmodium falciparum malarial infection. This study investigated the relationship between a STAT6 intronic single-nucleotide polymorphism (rs3024974, total IgE, cytokines, and malaria severity in 238 Ghanaian children aged between 0.5 and 13 years. Total IgE and cytokine levels were measured by ELISA, while genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (RFLP. Compared with healthy controls, heterozygosity protected against clinical malaria: uncomplicated malaria (odds ratios [OR] = 0.13, P < 0.001, severe malarial anemia (OR = 0.18, P < 0.001, and cerebral malaria (OR = 0.39, P = 0.022. Levels of total IgE significantly differed among malaria phenotypes (P = 0.044 and rs3024974 genotypes (P = 0.037. Neither cytokine levels nor IL-6/IL-10 ratios were associated with malaria phenotypes or rs3024974 genotypes. This study suggests a role for rs3024974 in malaria pathogenesis and offers further insights into an IL-4/STAT6 pathway mutation in malaria pathogenesis.

  5. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay. (United States)

    Rotherham, D; Harbison, S A


    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti


    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  7. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles. (United States)

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin


    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The Influence of Single Nucleotide Polymorphism Microarray-Based Molecular Karyotype on Preimplantation Embryonic Development Potential.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available In order to investigate the influence of the molecular karyotype based on single nucleotide polymorphism (SNP microarray on embryonic development potential in preimplantation genetic diagnosis (PGD, we retrospectively analyzed the clinical data generated by PGD using embryos retrieved from parents with chromosome rearrangements in our center. In total, 929 embryos from 119 couples had exact diagnosis and development status. The blastocyst formation rate of balanced molecular karyotype embryos was 56.6% (276/488, which was significantly higher than that of genetic imbalanced embryos 24.5% (108/441 (P35 respectively. Blastocyst formation rates of male and female embryos were 44.5% (183/411 and 38.8% (201/518 respectively, with no significant difference between them (P>0.05. The rates of balanced molecular karyotype embryos vary from groups of embryos with different cell numbers at 68 hours after insemination. The blastocyst formation rate of embryos with 6-8 cells (48.1% was significantly higher than that of embryos with 8 cells (42.9% (P8 cells, embryos with 6-8 blastomeres have higher rate of balanced molecular karyotype and blastocyst formation.

  9. Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers. (United States)

    Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C


    Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.


    Directory of Open Access Journals (Sweden)

    H. Hidayati


    Full Text Available Lipoprotein lipase (LPL is a key enzyme that plays in metabolism and transport lipoprotein andtherefore has an influence on blood triglyceride levels. LPL controls triacylglycerol partitioning betweenadipose tissue and muscle that increases fat storage or provides energy in the form of fatty acids formuscle growth. The research was aimed to explore Single Nucleotide Polymorphisms of LPL gene andto associate SNP with marbling quality. A total of 66 genomic DNAs consisted of sumatera thin-tail edsheep (50 heads and garut sheep (16 heads were used in this study. Polymerase Chain Reaction wasused to amplify genomic DNA and direct sequencing method was to identify polymorphism sequences.The sequences were analyzed with Bio Edit and MEGA 5.2. The BLAST sequence was obtained fromgene bank X.68308.1. The association between the genotype and marbling quality was analyze by oneway ANOVA and further between mean differences were tested using least sgnificant difference. Theresults showed that 3 novel SNPs i.e. insertion g.26>C; insertion g.27> G and c.192T>C on garut sheepand a SNP insertion g.26>C/G on sumatera thin-tail ed sheep. The diversity of LPL gene at c.192T>Cwas associated with heneicosanoic acid, whereas TT genotype (0.04% was higher than CC (0.03% andCT (0.02%.

  11. SNPer: an R library for quantitative variant analysis on single nucleotide polymorphisms among influenza virus populations.

    Directory of Open Access Journals (Sweden)

    Unitsa Sangket

    Full Text Available Influenza virus (IFV can evolve rapidly leading to genetic drifts and shifts resulting in human and animal influenza epidemics and pandemics. The genetic shift that gave rise to the 2009 influenza A/H1N1 pandemic originated from a triple gene reassortment of avian, swine and human IFVs. More minor genetic alterations in genetic drift can lead to influenza drug resistance such as the H274Y mutation associated with oseltamivir resistance. Hence, a rapid tool to detect IFV mutations and the potential emergence of new virulent strains can better prepare us for seasonal influenza outbreaks as well as potential pandemics. Furthermore, identification of specific mutations by closely examining single nucleotide polymorphisms (SNPs in IFV sequences is essential to classify potential genetic markers associated with potentially dangerous IFV phenotypes. In this study, we developed a novel R library called "SNPer" to analyze quantitative variants in SNPs among IFV subpopulations. The computational SNPer program was applied to three different subpopulations of published IFV genomic information. SNPer queried SNPs data and grouped the SNPs into (1 universal SNPs, (2 likely common SNPs, and (3 unique SNPs. SNPer outperformed manual visualization in terms of time and labor. SNPer took only three seconds with no errors in SNP comparison events compared with 40 hours with errors using manual visualization. The SNPer tool can accelerate the capacity to capture new and potentially dangerous IFV strains to mitigate future influenza outbreaks.

  12. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity (United States)

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin


    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  13. CLC-2 single nucleotide polymorphisms (SNPs as potential modifiers of cystic fibrosis disease severity

    Directory of Open Access Journals (Sweden)

    Bleecker Eugene R


    Full Text Available Abstract Background Cystic fibrosis (CF lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1 > 70% and Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity.

  14. The Role of Vitamin D Level and Related Single Nucleotide Polymorphisms in Crohn’s Disease

    Directory of Open Access Journals (Sweden)

    Wen J. Lam


    Full Text Available New Zealand has one of the highest rates of Crohn’s Disease (CD in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D, lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10−6. A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR and rs732594[A] (SCUBE3 showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR, rs732594[A] (SCUBE3, and rs2980[T] and rs2981[A] (PHF-11 showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.


    Directory of Open Access Journals (Sweden)

    Angela Renee Ozburn


    Full Text Available Circadian rhythm disruptions are prominently associated with Bipolar Disorder (BD. Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional-translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (Roybal et al., 2007. The Clock 3111T/C single-nucleotide polymorphism (SNP; rs1801260 is a genetic variation of the human Clock gene that is significantly associated with increased frequency of manic episodes in BD patients (Benedetti et al., 2003. The 3111T/C SNP is located in the 3’ untranslated region of the Clock gene. In this study, we sought to examine the functional implications of the human Clock 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock -/- knockout mice with pcDNA plasmids containing the human Clock gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24 hour time period. We found that the Clock3111C SNP resulted in higher mRNA levels than the Clock 3111T SNP. Further, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with Clock 3111C expression, indicating the 3’UTR SNP affects the expression, function and stability of Clock mRNA.

  16. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation. (United States)

    Anderson, Eric C; Ng, Thomas C


    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.

  17. The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma (United States)

    Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui


    Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

  18. Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis. (United States)

    Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N


    Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

  19. Associations between single nucleotide polymorphisms in iron-related genes and iron status in multiethnic populations.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    Full Text Available The existence of multiple inherited disorders of iron metabolism suggests genetic contributions to iron deficiency. We previously performed a genome-wide association study of iron-related single nucleotide polymorphisms (SNPs using DNA from white men aged ≥ 25 y and women ≥ 50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF ≤ 12 µg/L (cases and controls (SF >100 µg/L in men, SF >50 µg/L in women. We report a follow-up study of white, African-American, Hispanic, and Asian HEIRS participants, analyzed for association between SNPs and eight iron-related outcomes. Three chromosomal regions showed association across multiple populations, including SNPs in the TF and TMPRSS6 genes, and on chromosome 18q21. A novel SNP rs1421312 in TMPRSS6 was associated with serum iron in whites (p = 3.7 × 10(-6 and replicated in African Americans (p = 0.0012.Twenty SNPs in the TF gene region were associated with total iron-binding capacity in whites (p<4.4 × 10(-5; six SNPs replicated in other ethnicities (p<0.01. SNP rs10904850 in the CUBN gene on 10p13 was associated with serum iron in African Americans (P = 1.0 × 10(-5. These results confirm known associations with iron measures and give unique evidence of their role in different ethnicities, suggesting origins in a common founder.

  20. A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses.

    Directory of Open Access Journals (Sweden)

    Cristina J Wittkopp


    Full Text Available Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188 that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses.

  1. HIV-1 Promoter Single Nucleotide Polymorphisms Are Associated with Clinical Disease Severity.

    Directory of Open Access Journals (Sweden)

    Michael R Nonnemacher

    Full Text Available The large majority of human immunodeficiency virus type 1 (HIV-1 markers of disease progression/severity previously identified have been associated with alterations in host genetic and immune responses, with few studies focused on viral genetic markers correlate with changes in disease severity. This study presents a cross-sectional/longitudinal study of HIV-1 single nucleotide polymorphisms (SNPs contained within the viral promoter or long terminal repeat (LTR in patients within the Drexel Medicine CNS AIDS Research and Eradication Study (CARES Cohort. HIV-1 LTR SNPs were found to associate with the classical clinical disease parameters CD4+ T-cell count and log viral load. They were found in both defined and undefined transcription factor binding sites of the LTR. A novel SNP identified at position 108 in a known COUP (chicken ovalbumin upstream promoter/AP1 transcription factor binding site was significantly correlated with binding phenotypes that are potentially the underlying cause of the associated clinical outcome (increase in viral load and decrease in CD4+ T-cell count.

  2. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.


    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  3. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms. (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M


    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  4. Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks (United States)

    Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.


    Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

  5. Current trend of annotating single nucleotide variation in humans--A case study on SNVrap. (United States)

    Li, Mulin Jun; Wang, Junwen


    As high throughput methods, such as whole genome genotyping arrays, whole exome sequencing (WES) and whole genome sequencing (WGS), have detected huge amounts of genetic variants associated with human diseases, function annotation of these variants is an indispensable step in understanding disease etiology. Large-scale functional genomics projects, such as The ENCODE Project and Roadmap Epigenomics Project, provide genome-wide profiling of functional elements across different human cell types and tissues. With the urgent demands for identification of disease-causal variants, comprehensive and easy-to-use annotation tool is highly in demand. Here we review and discuss current progress and trend of the variant annotation field. Furthermore, we introduce a comprehensive web portal for annotating human genetic variants. We use gene-based features and the latest functional genomics datasets to annotate single nucleotide variation (SNVs) in human, at whole genome scale. We further apply several function prediction algorithms to annotate SNVs that might affect different biological processes, including transcriptional gene regulation, alternative splicing, post-transcriptional regulation, translation and post-translational modifications. The SNVrap web portal is freely available at Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms. (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y


    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  7. Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes. (United States)

    Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica


    The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

  8. Lack of Association between STAT4 Single Nucleotide Polymorphisms and Iranian Juvenile Rheumatoid Arthritis Patients. (United States)

    Aslani, Saeed; Mahmoudi, Mahdi; Salmaninejad, Arash; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima


    Juvenile rheumatoid arthritis (JRA) is a common chronic systemic autoimmune disease in children. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene are suspected to have association with the risk of autoimmune diseases. Previous investigations have indicated that the STAT4 rs7574865 T allele was significantly associated with rheumatoid arthritis. In this study, we aimed to evaluate the association of STAT4 SNPs with JRA in Iranian population. T allele of STAT4 rs7574865 SNP was less frequent in patients than in controls, and the difference was not significant (p = 0.19, OR = 0.72, 95% CI: 0.44 -1.17). In addition, G allele of this SNP was frequent but not significant in JRA patients (p = 0.19, OR = 1.38, 95% CI: 0.85-2.25). Neither alleles nor genotypes of rs7601754 SNP of STAT4 gene demonstrated associations with JRA. We recognize that gene variants of STAT4 did not affect JRA susceptibility in Iranian population.

  9. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Directory of Open Access Journals (Sweden)

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  10. Single nucleotide polymorphisms and unacceptable late toxicity in breast cancer adjuvant radiotherapy: a case report

    Directory of Open Access Journals (Sweden)

    Lazzari G


    Full Text Available Grazia Lazzari,1 Maria Iole Natalicchio,2 Angela Terlizzi,3 Francesco Perri,4 Giovanni Silvano1 1Radiation Oncology Unit, San Giuseppe Moscati Hospital, Taranto, 2Molecular Biology Laboratory, Pathological Anatomy Department, Ospedali Riuniti, Foggia, 3Medical Physic Unit, San Giuseppe Moscati Hospital, 4Medical Oncology Unit, Presidio Ospedaliero Centrale - Santissima Annunziata, Taranto, Italy Background: There has recently been a strong interest in the inter-individual variation in normal tissue and tumor response to radiotherapy (RT, because tissue radiosensitivity seems to be under genetic control. Evidence is accumulating on the role of polymorphic genetic variants, such as single nucleotide polymorphisms (SNPs that could influence normal tissue response after radiation. The most studied SNPs include those in genes involved in DNA repair (single- and double-strand breaks, and base excision and those active in the response to oxidative stress.Case report: We present the case report of a 60-year-old woman with early breast cancer who underwent adjuvant hormone therapy and conventional radiotherapy, and subsequently developed unacceptable cosmetic toxicities of the irradiated breast requiring a genetic test of genes involved in DNA repair mechanisms. The patient was found to be heterozygous for G28152A (T/C and C18067T (A/G mutations in X-ray repair cross-complementing group 1 (XRCC1 and 3 (XRCC3, respectively, homozygous for A313G (G/G mutation in glutathione S transferase Pi 1 (GSTP1, and wild-type for A4541G (A/A in XRCC3 and G135C (G/G in RAD51 recombinase.Conclusion: The role of SNPs should be taken into account when a severe phenomenon appears in normal tissues after radiation treatment, because understanding the molecular basis of individual radiosensitivity may be useful for identifying moderately or extremely radiosensitive patients who may need tailored therapeutic strategies. Keywords: radiosensitivity, SNPs, fibrosis, DNA repair

  11. Whole Genome Association Study to Detect Single Nucleotide Polymorphisms for Behavior in Sapsaree Dog (

    Directory of Open Access Journals (Sweden)

    J. H. Ha


    Full Text Available The purpose of this study was to characterize genetic architecture of behavior patterns in Sapsaree dogs. The breed population (n = 8,256 has been constructed since 1990 over 12 generations and managed at the Sapsaree Breeding Research Institute, Gyeongsan, Korea. Seven behavioral traits were investigated for 882 individuals. The traits were classified as a quantitative or a categorical group, and heritabilities (h2 and variance components were estimated under the Animal model using ASREML 2.0 software program. In general, the h2 estimates of the traits ranged between 0.00 and 0.16. Strong genetic (rG and phenotypic (rP correlations were observed between nerve stability, affability and adaptability, i.e. 0.9 to 0.94 and 0.46 to 0.68, respectively. To detect significant single nucleotide polymorphism (SNP for the behavioral traits, a total of 134 and 60 samples were genotyped using the Illumina 22K CanineSNP20 and 170K CanineHD bead chips, respectively. Two datasets comprising 60 (Sap60 and 183 (Sap183 samples were analyzed, respectively, of which the latter was based on the SNPs that were embedded on both the 22K and 170K chips. To perform genome-wide association analysis, each SNP was considered with the residuals of each phenotype that were adjusted for sex and year of birth as fixed effects. A least squares based single marker regression analysis was followed by a stepwise regression procedure for the significant SNPs (p<0.01, to determine a best set of SNPs for each trait. A total of 41 SNPs were detected with the Sap183 samples for the behavior traits. The significant SNPs need to be verified using other samples, so as to be utilized to improve behavior traits via marker-assisted selection in the Sapsaree population.

  12. Germline contamination and leakage in whole genome somatic single nucleotide variant detection. (United States)

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C


    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  13. The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels. (United States)

    Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning


    Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Single-molecule diffusometry reveals the nucleotide-dependent oligomerization pathways of Nicotiana tabacum Rubisco activase (United States)

    Wang, Quan; Serban, Andrew J.; Wachter, Rebekka M.; Moerner, W. E.


    Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ˜0.1 s-1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.

  15. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome. (United States)

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron


    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

  16. Highly significant association between two common single nucleotide polymorphisms in CORIN gene and preeclampsia in Caucasian women.

    Directory of Open Access Journals (Sweden)

    Alain Stepanian

    Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.

  17. Sirtuin1 single nucleotide polymorphism (A2191G is a diagnostic marker for vibration-induced white finger disease

    Directory of Open Access Journals (Sweden)

    Voelter-Mahlknecht Susanne


    Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.

  18. Single nucleotide polymorphisms in CRTC1 and BARX1 are associated with esophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Anna M. J. van Nistelrooij


    Full Text Available Objective: Recently, single nucleotide polymorphisms (SNPs associated with esophageal adenocarcinoma (EAC and Barrett′s esophagus (BE were identified; rs10419226 (CRTC10, rs11789015 (BARX1, rs2687201 (FOXP10, rs2178146 (FOXF1, rs3111601 (FOXF10, and rs9936833 (FOXF1. These findings indicate that genetic susceptibility could play a role in the initiation of EAC in BE patients. The aim of this study was to validate the association between these previously identified SNPs and the risk of EAC in an independent and large case-control study. Design: Six SNPs found to be associated with EAC and BE were genotyped by a multiplex SNaPshot analysis in 1071 EAC patients diagnosed and treated in the Netherlands. Allele frequencies were compared to a control group derived from the Rotterdam Study, a population-based prospective cohort study (n = 6206. Logistic regression analysis and meta-analysis were performed to calculate odds ratios (OR. Results: Rs10419226 (CRTC1 showed a significantly increased EAC risk for the minor allele (OR = 1.17, P = 0.001, and rs11789015 (BARX1 showed a significantly decreased risk for the minor allele (OR = 0.85, P = 0.004 in the logistic regression analysis. The meta-analysis of the original GWAS and the current study revealed an improved level of significance for rs10419226 (CRTC1 (OR = 1.18, P = 6.66 × 10–10 and rs11789015 (BARX1 (OR = 0.83, P = 1.13 × 10–8 . Conclusions: This independent and large Dutch case-control study confirms the association of rs10419226 (CRTC1 and rs11789015 (BARX1 with the risk of EAC. These findings suggest a contribution of the patient genetic make-up to the development of EAC and might contribute to gain more insight in the etiology of this cancer.

  19. Correlation of matrix metalloproteinase-2 single nucleotide polymorphisms with the risk of small vessel disease (SVD). (United States)

    Zhang, Min; Zhu, Wusheng; Yun, Wenwei; Wang, Qizhang; Cheng, Maogang; Zhang, Zhizhong; Liu, Xinfeng; Zhou, Xianju; Xu, Gelin


    Maladjustment of matrix metalloproteinases (MMPs) results in cerebral vasculature and blood-brain barrier dysfunction, which is associated with small vessel disease (SVD). This study was to aim at evaluating correlations between matrix metalloproteinase-2 and 9 single nucleotide polymorphisms and the risk of SVD. A total of 178 patients with SVD were enrolled into this study via Nanjing Stroke Registry Program (NSRP) from January 2010 to November 2011. SVD patients were further subtyped as isolated lacunar infarction (ILI, absent or with mild leukoaraiosis) and ischemic leukoaraiosis (ILA, with moderate or severe leukoaraiosis) according to the Fazekas scale. 100 age- and gender-matched individuals from outpatient medical examination were recruited as the control group. The genotypes of MMP-2-1306 T/C and MMP-9-1562 C/T were determined by the TaqMan method. Of 178 SVD patients, 86 and 92 patients were classified as ILI and ILA, respectively. Comparison analysis between SVD patients and controls revealed a significant correlation between SVD and hypertension, as well as a prevalence of hypertension in ILA. Further genotype analysis showed that the frequency of MMP-2-1306 CC genotype was higher in ILA patients than in controls (P=0.009, χ(2) test; P=0.027, the multiple test with Bonferroni correction). Finally, logistic regression analysis with adjustment of age, sex and vascular risk factors showed that the MMP-2-1306 T/C polymorphism was an independent predictor for ILA (OR: 2.605; 95% confidence interval [CI], 1.067-6.364; P=0.036). Our findings suggest that the MMP-2-1306 T/C polymorphism is a direct risk factor for ILA. Copyright © 2015. Published by Elsevier B.V.

  20. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    Directory of Open Access Journals (Sweden)

    Mary Lynn Baniecki


    Full Text Available Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs. Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM, we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding. From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana, Africa (Ethiopia and Asia (Sri Lanka. We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1. Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  1. Identification of single nucleotide polymorphisms associated with hyperproduction of alpha-toxin in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Xudong Liang


    Full Text Available The virulence factor α-toxin (hla is needed by Staphylococcus aureus in order to cause infections in both animals and humans. Although the complicated regulation of hla expression has been well studied in human S. aureus isolates, the mechanisms of of hla regulation in bovine S. aureus isolates remain undefined. In this study, we found that many bovine S. aureus isolates, including the RF122 strain, generate dramatic amounts of α-toxin in vitro compared with human clinical S. aureus isolates, including MRSA WCUH29 and MRSA USA300. To elucidate potential regulatory mechanisms, we analyzed the hla promoter regions and identified predominant single nucleotide polymorphisms (SNPs at positions -376, -483, and -484 from the start codon in α-toxin hyper-producing isolates. Using site-directed mutagenesis and hla promoter-gfp-luxABCDE dual reporter approaches, we demonstrated that the SNPs contribute to the differential control of hla expression among bovine and human S. aureus isolates. Using a DNA affinity assay, gel-shift assays and a null mutant, we identified and revealed that an hla positive regulator, SarZ, contributes to the involvement of the SNPs in mediating hla expression. In addition, we found that the bovine S. aureus isolate RF122 exhibits higher transcription levels of hla positive regulators, including agrA, saeR, arlR and sarZ, but a lower expression level of hla repressor rot compared to the human S. aureus isolate WCUH29. Our results indicate α-toxin hyperproduction in bovine S. aureus is a multifactorial process, influenced at both the genomic and transcriptional levels. Moreover, the identification of predominant SNPs in the hla promoter region may provide a novel method for genotyping the S. aureus isolates.

  2. Common single nucleotide variants underlying drug addiction: more than a decade of research. (United States)

    Bühler, Kora-Mareen; Giné, Elena; Echeverry-Alzate, Victor; Calleja-Conde, Javier; de Fonseca, Fernando Rodriguez; López-Moreno, Jose Antonio


    Drug-related phenotypes are common complex and highly heritable traits. In the last few years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a huge number of single nucleotide polymorphisms (SNPs) associated with drug use, abuse or dependence, mainly related to alcohol or nicotine. Nevertheless, few of these associations have been replicated in independent studies. The aim of this study was to provide a review of the SNPs that have been most significantly associated with alcohol-, nicotine-, cannabis- and cocaine-related phenotypes in humans between the years of 2000 and 2012. To this end, we selected CGAS, GWAS, family-based association and case-only studies published in peer-reviewed international scientific journals (using the PubMed/MEDLINE and Addiction GWAS Resource databases) in which a significant association was reported. A total of 371 studies fit the search criteria. We then filtered SNPs with at least one replication study and performed meta-analysis of the significance of the associations. SNPs in the alcohol metabolizing genes, in the cholinergic gene cluster CHRNA5-CHRNA3-CHRNB4, and in the DRD2 and ANNK1 genes, are, to date, the most replicated and significant gene variants associated with alcohol- and nicotine-related phenotypes. In the case of cannabis and cocaine, a far fewer number of studies and replications have been reported, indicating either a need for further investigation or that the genetics of cannabis/cocaine addiction are more elusive. This review brings a global state-of-the-art vision of the behavioral genetics of addiction and collaborates on formulation of new hypothesis to guide future work. © 2015 Society for the Study of Addiction.

  3. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections (United States)

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.


    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  4. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays (United States)


    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  5. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update

    Directory of Open Access Journals (Sweden)

    Ishfaq A. Sheikh


    Full Text Available Abstract Background Preterm birth (PTB, birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 % of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs that are reported to be associated with PTB. Results A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007–2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. Conclusions A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  6. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  7. Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

    Directory of Open Access Journals (Sweden)

    Deyana Gencheva Hristova


    Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

  8. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data. (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon


    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  9. Analysis of healthy cohorts for single nucleotide polymorphisms in C1q gene cluster

    Directory of Open Access Journals (Sweden)



    Full Text Available C1q is the first component of the classical pathway of complement activation. The coding region for C1q is localized on chromosome 1p34.1–36.3. Mutations or single nucleotide polymorphisms (SNPs in C1q gene cluster can cause developing of Systemic lupus erythematosus (SLE because of C1q deficiency or other unknown reason. We selected five SNPs located in 7.121 kbp region on chromosome 1, which were previously associated with SLE and/or low C1q level, but not causing C1q deficiency and analyzed them in terms of allele frequencies and genotype distribution in comparison with Hispanic, Asian, African and other Caucasian cohorts. These SNPs were: rs587585, rs292001, rs172378, rs294179 and rs631090. One hundred eighty five healthy Bulgarian volunteers were genotyped for the selected five C1q SNPs by quantative real-time PCR methods. International HapMap Project has been used for information about genotype distribution and allele frequencies of the five SNPs in, Hispanics, Asians, Africans and others Caucasian cohorts. Bulgarian healthy volunteers and another pooled Caucasian cohort had similar frequencies of genotypes and alleles of rs587585, rs292001, rs294179 and rs631090 SNPs. Nevertheless, genotype AA of rs172378 was significantly overrepresented in Bulgarians when compared to other healthy Caucasians from USA and UK (60% vs 31%. Genotype distribution of rs172378 in Bulgarians was similar to Greek-Cyriot Caucasians. For all Caucasians the major allele of rs172378 was A. This is the first study analyzing the allele frequencies and genotype distribution of C1q gene cluster SNPs in Bulgarian healthy population.

  10. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle. (United States)

    Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D


    The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.

  11. Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding. (United States)

    Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken


    In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  12. Single nucleotide polymorphism barcoding to evaluate oral cancer risk using odds ratio-based genetic algorithms

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang


    Full Text Available Cancers often involve the synergistic effects of gene–gene interactions, but identifying these interactions remains challenging. Here, we present an odds ratio-based genetic algorithm (OR-GA that is able to solve the problems associated with the simultaneous analysis of multiple independent single nucleotide polymorphisms (SNPs that are associated with oral cancer. The SNP interactions between four SNPs—namely rs1799782, rs2040639, rs861539, rs2075685, and belonging to four genes (XRCC1, XRCC2, XRCC3, and XRCC4—were tested in this study, respectively. The GA decomposes the SNPs sets into different SNP combinations with their corresponding genotypes (called SNP barcodes. The GA can effectively identify a specific SNP barcode that has an optimized fitness value and uses this to calculate the difference between the case and control groups. The SNP barcodes with a low fitness value are naturally removed from the population. Using two to four SNPs, the best SNP barcodes with maximum differences in occurrence between the case and control groups were generated by GA algorithm. Subsequently, the OR provides a quantitative measure of the multiple SNP synergies between the oral cancer and control groups by calculating the risk related to the best SNP barcodes and others. When these were compared to their corresponding non-SNP barcodes, the estimated ORs for oral cancer were found to be great than 1 [approx. 1.72–2.23; confidence intervals (CIs: 0.94–5.30, p < 0.03–0.07] for various specific SNP barcodes with two to four SNPs. In conclusion, the proposed OR-GA method successfully generates SNP barcodes, which allow oral cancer risk to be evaluated and in the process the OR-GA method identifies possible SNP–SNP interactions.

  13. Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons. (United States)

    Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M


     The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02).  We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.

  14. Both COMT Val158Met single nucleotide polymorphism and sex-dependent differences influence response inhibition

    Directory of Open Access Journals (Sweden)

    Valentina eMione


    Full Text Available Reactive and proactive control of actions are cognitive abilities that allow to deal with a continuously changing environment by adjusting already programmed actions. They also set forthcoming acts by evaluating the outcome of the previous ones. Earlier studies highlighted sex related differences in the strategies and in the pattern of brain activation during cognitive tasks involving reactive and proactive control. To further identify sex-dependent characteristics in the cognitive control of actions, in this study we have assessed whether/how differences in reactive and proactive control were modulated by the COMT Val158Met single nucleotide polymorphism, a genetic factor known to influence the functionality of the dopaminergic system, in particular at the level of prefrontal cortex. Two groups of male and female participants were further sorted according to their genotype (Val/Met, Val/Val and Met/Met and tested in a stop signal task, a consolidated tool to measure reactive and proactive control in experimental and clinical settings. In each group of participants we estimated both a measure of the capacity to react to unexpected events and the ability of monitoring their performance. The between groups comparison of these measures indicated a poorer ability of male individuals carrying the Val/Val genotype in error-monitoring, suggesting that differences between sexes could be influenced by the efficiency of COMT and that other sex-specific factors have to be considered. The comprehension of inter-groups behavioral and physiological correlates of cognitive control will provide more accurate diagnostic tools for predicting the incidence and the development of pathologies like ADHD or deviant behaviors as drug or alcohol abuse.

  15. Association of FLG single nucleotide variations with clinical phenotypes of atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Myungshin Kim

    Full Text Available FLG encodes a large protein called profilaggrin, which plays a key role in maintaining an effective skin barrier against the environment. In this study, we identified FLG single nucleotide variations (FLG-SNVs and evaluated the association of FLG-SNVs with clinical phenotypes including atopic dermatitis (AD-associated minor clinical features, presence of specific allergic sensitization, and serum parameters.Eighty-one Korean patients with AD were enrolled. AD-associated minor clinical features as well as allergic rhinitis and asthma were diagnosed by specialists. FLG-SNVs were identified by Sanger sequencing of entire exons through long-range PCR. Allergic sensitization to a specific allergen was evaluated by multiple allergen simultaneous test. Serologic parameters such as serum eosinophil cationic protein (ECP and eosinophil derived neurotoxin (EDN were measured.A total of seventy-three SNVs and 4 LOF mutations were successfully genotyped. rs71626704 and rs76413899 were significantly associated with a history of asthma and cheilitis (P = 0.002 and P = 0.033, respectively, however, the associations were not found statistically significant after adjustment by multiple comparisons. In addition, we detected haplotype blocks which were correlated with non-specific hand or foot dermatitis and scalp scale. We identified FLG-SNVs which were associated with sensitization to environmental allergens; rs62623409 and rs71625199 (P = 0.038 and P = 0.008, respectively. Patients with FLG P478S TT and history of allergic rhinitis showed a higher EDN level, and among those patients, the ones with asthma showed a higher ECP level.This study revealed the association of FLG-SNVs with AD-associated minor clinical features. We firstly identified rs71625199 which was associated with higher environmental allergic sensitization. We also suggest that FLG P478S is a kind of disease modifier which affects serologic parameters such as EDN and ECP.

  16. Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.). (United States)

    Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco


    Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea

    Directory of Open Access Journals (Sweden)

    J. S. Choi


    Full Text Available This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R] and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003. The meats of PRKAG3 (A 0.024/G 0.976 AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699 AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627 AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792 AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs.

  18. SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species. (United States)

    Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra


    In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at

  19. Detecting high-order interactions of single nucleotide polymorphisms using genetic programming. (United States)

    Nunkesser, Robin; Bernholt, Thorsten; Schwender, Holger; Ickstadt, Katja; Wegener, Ingo


    Not individual single nucleotide polymorphisms (SNPs), but high-order interactions of SNPs are assumed to be responsible for complex diseases such as cancer. Therefore, one of the major goals of genetic association studies concerned with such genotype data is the identification of these high-order interactions. This search is additionally impeded by the fact that these interactions often are only explanatory for a relatively small subgroup of patients. Most of the feature selection methods proposed in the literature, unfortunately, fail at this task, since they can either only identify individual variables or interactions of a low order, or try to find rules that are explanatory for a high percentage of the observations. In this article, we present a procedure based on genetic programming and multi-valued logic that enables the identification of high-order interactions of categorical variables such as SNPs. This method called GPAS cannot only be used for feature selection, but can also be employed for discrimination. In an application to the genotype data from the GENICA study, an association study concerned with sporadic breast cancer, GPAS is able to identify high-order interactions of SNPs leading to a considerably increased breast cancer risk for different subsets of patients that are not found by other feature selection methods. As an application to a subset of the HapMap data shows, GPAS is not restricted to association studies comprising several 10 SNPs, but can also be employed to analyze whole-genome data. Software can be downloaded from

  20. Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene. (United States)

    Martínez-Herrero, Sonia; Martínez, Alfredo


    The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

  1. The cardiovascular implication of single nucleotide polymorphisms of chromosome 9p21 locus among Arab population

    Directory of Open Access Journals (Sweden)

    Ayman A El-Menyar


    Full Text Available Background: Based on several reports including genome-wide association studies, genetic variability has been linked with higher (nearly half susceptibility toward coronary artery disease (CAD. We aimed to evaluate the association of chromosome 9p21 single nucleotide polymorphisms (SNPs: rs2383207, rs10757278, and rs10757274 with the risk and severity of CAD among Arab population. Materials and Methods: A prospective observational case-control study was conducted between 2011 and 2012, in which 236 patients with CAD were recruited from the Heart Hospital in Qatar. Patients were categorized according to their coronary angiographic findings. Also, 152 healthy volunteers were studied to determine if SNPs are associated with risk of CAD. All subjects were genotyped for SNPs (rs2383207, rs2383206, rs10757274 and rs10757278 using allele-specific real-time polymerase chain reaction. Results: Patients with CAD had a mean age of 57 ± 10; of them 77% were males, 54% diabetics, and 25% had family history of CAD. All SNPs were in Hardy-Weinberg equilibrium except rs2383206, with call rate >97%. After adjusting for age, sex and body mass index, the carriers of GG genotype for rs2383207 have increased the risk of having CAD with odds ratio (OR of 1.52 (95% confidence interval [CI] = 1.01-2.961, P = 0.046. Also, rs2383207 contributed to CAD severity with adjusted OR 1.80 (95% CI = 1.04-3.12, P = 0.035 based on the dominant genetic model. The other SNPs (rs10757274 and rs10757278 showed no significant association with the risk of CAD or its severity. Conclusion: Among Arab population in Qatar, only G allele of rs2483207 SNP is significantly associated with risk of CAD and its severity.

  2. A high throughput single nucleotide polymorphism multiplex assay for parentage assignment in New Zealand sheep.

    Directory of Open Access Journals (Sweden)

    Shannon M Clarke

    Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.

  3. Real time hybridization studies by resonant waveguide gratings using nanopattern imaging for Single Nucleotide Polymorphism detection

    KAUST Repository

    Bougot-Robin, Kristelle


    2D imaging of biochips is particularly interesting for multiplex biosensing. Resonant properties allow label-free detection using the change of refractive index at the chip surface. We demonstrate a new principle of Scanning Of Resonance on Chip by Imaging (SORCI) based on spatial profiles of nanopatterns of resonant waveguide gratings (RWGs) and its embodiment in a fluidic chip for real-time biological studies. This scheme allows multiplexing of the resonance itself by providing nanopattern sensing areas in a bioarray format. Through several chip designs we discuss resonance spatial profiles, dispersion and electric field distribution for optimal light-matter interaction with biological species of different sizes. Fluidic integration is carried out with a black anodized aluminum chamber, advantageous in term of mechanical stability, multiple uses of the chip, temperature control and low optical background. Real-time hybridization experiments are illustrated by SNP (Single Nucleotide Polymorphism) detection in gyrase A of E. coli K12, observed in evolution studies of resistance to the antibiotic ciprofloxacin. We choose a 100 base pairs (bp) DNA target (∼30 kDa) including the codon of interest and demonstrate the high specificity of our technique for probes and targets with close affinity constants. This work validates the safe applicability of our unique combination of RWGs and simple instrumentation for real-time biosensing with sensitivity in buffer solution of ∼10 pg/mm2. Paralleling the success of RWGs sensing for cells sensing, our work opens new avenues for a large number of biological studies. © 2013 Springer Science+Business Media.

  4. Association of the Single Nucleotide Polymorphisms in , , and with Blood Related Traits in Pigs

    Directory of Open Access Journals (Sweden)

    Jae-Bong Lee


    Full Text Available The aim of this study was to detect positional candidate genes located within the support interval (SI regions based on the results of red blood cell, mean corpuscular volume (MCV, and mean corpuscular hemoglobin quantitative trait locus (QTL in Sus scrofa chromosome 13, and to verify the correlation between specific single-nucleotide polymorphisms (SNPs located in the exonic region of the positional candidate gene and the three genetic traits. The flanking markers of the three QTL SI regions are SW38 and S0215. Within the QTL SI regions, 44 genes were located, and runt-related transcription factor 1, dual-specificity tyrosine-(Y-phosphorylation regulated kinase 1A (DYRK1A, and potassium inwardly-rectifying channel, subfamily J, member 15 KCNJ15–which are reported to be related to the hematological traits and clinical features of Down syndrome–were selected as positional candidate genes. The ten SNPs located in the exonic region of the three genes were detected by next generation sequencing. A total of 1,232 pigs of an F2 resource population between Landrace and Korean native pigs were genotyped. To investigate the effects of the three genes on each genotype, a mixed-effect model which is the considering family structure model was used to evaluate the associations between the SNPs and three genetic traits in the F2 intercross population. Among them, the MCV level was highly significant (nominal p = 9.8×10−9 in association with the DYRK1A-SNP1 (c.2989 G

  5. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F


    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  6. Mitochondrial DNA single nucleotide polymorphism associated with weight estimated breeding values in Nelore cattle (Bos indicus

    Directory of Open Access Journals (Sweden)

    Fernando Henrique Biase


    Full Text Available We sampled 119 Nelore cattle (Bos indicus, 69 harboring B. indicus mtDNA plus 50 carrying Bos taurus mtDNA, to estimate the frequencies of putative mtDNA single nucleotide polymorphisms (SNPs and investigate their association with Nelore weight and scrotal circumference estimated breeding values (EBVs. The PCR restriction fragment length polymorphism (PCR-RFLP method was used to detect polymorphisms in the mitochondrial asparagine, cysteine, glycine, leucine and proline transporter RNA (tRNA genes (tRNAasn, tRNAcys, tRNAgly, tRNAleu and tRNApro. The 50 cattle carrying B. taurus mtDNA were monomorphic for all the tRNA gene SNPs analyzed, suggesting that they are specific to mtDNA from B. indicus cattle. No tRNAcys or tRNAgly polymorphisms were detected in any of the cattle but we did detect polymorphic SNPs in the tRNAasn, tRNAleu and tRNApro genes in the cattle harboring B. indicus mtDNA, with the same allele observed in the B. taurus sequence being present in the following percentage of cattle harboring B. indicus mtDNA: 72.46% for tRNAasn, 95.23% for tRNAleu and 90.62% for tRNApro. Analyses of variance using the tRNAasn SNP as the independent variable and EBVs as the dependent variable showed that the G -> T SNP was significantly associated (p < 0.05 with maternal EBVs for weight at 120 and 210 days (p < 0.05 and animal's EBVs for weight at 210, 365 and 455 days. There was no association of the tRNAasn SNP with the scrotal circumference EBVs. These results confirm that mtDNA can affect weight and that mtDNA polymorphisms can be a source of genetic variation for quantitative traits.

  7. Evidence for single nucleotide polymorphisms and their association with bipolar disorder

    Directory of Open Access Journals (Sweden)

    Szczepankiewicz A


    Full Text Available Aleksandra Szczepankiewicz1,21Laboratory of Molecular and Cell Biology, 2Department of Psychiatric Genetics, Poznan University of Medical Sciences, Poznan, PolandAbstract: Bipolar disorder (BD is a complex disorder with a number of susceptibility genes and environmental risk factors involved in its pathogenesis. In recent years, huge progress has been made in molecular techniques for genetic studies, which have enabled identification of numerous genomic regions and genetic variants implicated in BD across populations. Despite the abundance of genetic findings, the results have often been inconsistent and not replicated for many candidate genes/single nucleotide polymorphisms (SNPs. Therefore, the aim of the review presented here is to summarize the most important data reported so far in candidate gene and genome-wide association studies. Taking into account the abundance of association data, this review focuses on the most extensively studied genes and polymorphisms reported so far for BD to present the most promising genomic regions/SNPs involved in BD. The review of association data reveals evidence for several genes (SLC6A4/5-HTT [serotonin transporter gene], BDNF [brain-derived neurotrophic factor], DAOA [D-amino acid oxidase activator], DTNBP1 [dysbindin], NRG1 [neuregulin 1], DISC1 [disrupted in schizophrenia 1] to be crucial candidates in BD, whereas numerous genome-wide association studies conducted in BD indicate polymorphisms in two genes (CACNA1C [calcium channel, voltage-dependent, L type, alpha 1C subunit], ANK3 [ankyrin 3] replicated for association with BD in most of these studies. Nevertheless, further studies focusing on interactions between multiple candidate genes/SNPs, as well as systems biology and pathway analyses are necessary to integrate and improve the way we analyze the currently available association data.Keywords: candidate gene, genome-wide association study, SLC6A4, BDNF, DAOA, DTNBP1, NRG1, DISC1

  8. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L


    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  9. High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays

    Directory of Open Access Journals (Sweden)

    Crenshaw Andrew


    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have emerged as the genetic marker of choice for mapping disease loci and candidate gene association studies, because of their high density and relatively even distribution in the human genomes. There is a need for systems allowing medium multiplexing (ten to hundreds of SNPs with high throughput, which can efficiently and cost-effectively generate genotypes for a very large sample set (thousands of individuals. Methods that are flexible, fast, accurate and cost-effective are urgently needed. This is also important for those who work on high throughput genotyping in non-model systems where off-the-shelf assays are not available and a flexible platform is needed. Results We demonstrate the use of a nanofluidic Integrated Fluidic Circuit (IFC - based genotyping system for medium-throughput multiplexing known as the Dynamic Array, by genotyping 994 individual human DNA samples on 47 different SNP assays, using nanoliter volumes of reagents. Call rates of greater than 99.5% and call accuracies of greater than 99.8% were achieved from our study, which demonstrates that this is a formidable genotyping platform. The experimental set up is very simple, with a time-to-result for each sample of about 3 hours. Conclusion Our results demonstrate that the Dynamic Array is an excellent genotyping system for medium-throughput multiplexing (30-300 SNPs, which is simple to use and combines rapid throughput with excellent call rates, high concordance and low cost. The exceptional call rates and call accuracy obtained may be of particular interest to those working on validation and replication of genome- wide- association (GWA studies.

  10. Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

    Energy Technology Data Exchange (ETDEWEB)

    Tucker, Susan L., E-mail: [Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Li Minghuan [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Xu Ting; Gomez, Daniel [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Yuan Xianglin [Department of Oncology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Yu Jinming [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Liu Zhensheng; Yin Ming; Guan Xiaoxiang; Wang Lie; Wei Qingyi [Department of Epidemiology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mohan, Radhe [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Vinogradskiy, Yevgeniy [University of Colorado School of Medicine, Aurora, Colorado (United States); Martel, Mary [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)


    Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk of severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.

  11. Effects of Single Nucleotide Polymorphism Marker Density on Haplotype Block Partition

    Directory of Open Access Journals (Sweden)

    Sun Ah Kim


    Full Text Available Many researchers have found that one of the most important characteristics of the structure of linkage disequilibrium is that the human genome can be divided into non-overlapping block partitions in which only a small number of haplotypes are observed. The location and distribution of haplotype blocks can be seen as a population property influenced by population genetic events such as selection, mutation, recombination and population structure. In this study, we investigate the effects of the density of markers relative to the full set of all polymorphisms in the region on the results of haplotype partitioning for five popular haplotype block partition methods: three methods in Haploview (confidence interval, four gamete test, and solid spine, MIG++ implemented in PLINK 1.9 and S-MIG++. We used several experimental datasets obtained by sampling subsets of single nucleotide polymorphism (SNP markers of chromosome 22 region in the 1000 Genomes Project data and also the HapMap phase 3 data to compare the results of haplotype block partitions by five methods. With decreasing sampling ratio down to 20% of the original SNP markers, the total number of haplotype blocks decreases and the length of haplotype blocks increases for all algorithms. When we examined the marker-independence of the haplotype block locations constructed from the datasets of different density, the results using below 50% of the entire SNP markers were very different from the results using the entire SNP markers. We conclude that the haplotype block construction results should be used and interpreted carefully depending on the selection of markers and the purpose of the study.

  12. Association Study between Folate Pathway Gene Single Nucleotide Polymorphisms and Gastric Cancer in Koreans

    Directory of Open Access Journals (Sweden)

    Jae-Young Yoo


    Full Text Available Gastric cancer is ranked as the most common cancer in Koreans. A recent molecular biological study about the folate pathway gene revealed the correlation with a couple of cancer types. In the folate pathway, several genes are involved, including methylenetetrahydrofolate reductase (MTHFR, methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR, and methyltetrahydrofolate-homocysteine methyltransferase (MTR. The MTHFR gene has been reported several times for the correlation with gastric cancer risk. However, the association of the MTRR or MTR gene has not been reported to date. In this study, we investigated the association between the single nucleotide polymorphisms (SNPs of the MTHFR, MTRR, and MTR genes and the risk of gastric cancer in Koreans. To identify the genetic association with gastric cancer, we selected 17 SNPs sites in folate pathway-associated genes of MTHFR, MTR, and MTRR and tested in 1,261 gastric cancer patients and 375 healthy controls. By genotype analysis, estimating odds ratios and 95% confidence intervals (CI, rs1801394 in the MTRR gene showed increased risk for gastric cacner, with statistical significance both in the codominant model (odds ratio [OR], 1.39; 95% CI, 1.04 to 1.85 and dominant model (OR, 1.34; 95% CI, 1.02 to 1.75. Especially, in the obese group (body mass index ≥ 25 kg/m2, the codominant (OR, 9.08; 95% CI, 1.01 to 94.59 and recessive model (OR, 3.72; 95% CI, 0.92 to 16.59 showed dramatically increased risk (p < 0.05. In conclusion, rs1801394 in the MTRR gene is associated with gastric cancer risk, and its functional significance need to be validated.

  13. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  14. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L


    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  15. Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Sujana Ghanta

    Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal

  16. Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis

    Directory of Open Access Journals (Sweden)

    Rabinowicz Pablo D


    Full Text Available Abstract Background Castor bean (Ricinus communis is an agricultural crop and garden ornamental that is widely cultivated and has been introduced worldwide. Understanding population structure and the distribution of castor bean cultivars has been challenging because of limited genetic variability. We analyzed the population genetics of R. communis in a worldwide collection of plants from germplasm and from naturalized populations in Florida, U.S. To assess genetic diversity we conducted survey sequencing of the genomes of seven diverse cultivars and compared the data to a reference genome assembly of a widespread cultivar (Hale. We determined the population genetic structure of 676 samples using single nucleotide polymorphisms (SNPs at 48 loci. Results Bayesian clustering indicated five main groups worldwide and a repeated pattern of mixed genotypes in most countries. High levels of population differentiation occurred between most populations but this structure was not geographically based. Most molecular variance occurred within populations (74% followed by 22% among populations, and 4% among continents. Samples from naturalized populations in Florida indicated significant population structuring consistent with local demes. There was significant population differentiation for 56 of 78 comparisons in Florida (pairwise population ϕPT values, p Conclusion Low levels of genetic diversity and mixing of genotypes have led to minimal geographic structuring of castor bean populations worldwide. Relatively few lineages occur and these are widely distributed. Our approach of determining population genetic structure using SNPs from genome-wide comparisons constitutes a framework for high-throughput analyses of genetic diversity in plants, particularly in species with limited genetic diversity.

  17. Gene-based single nucleotide polymorphism markers for genetic and association mapping in common bean. (United States)

    Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W


    In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in

  18. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology. (United States)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu


    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

  19. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The

  20. Correcting estimators of theta and Tajima's D for ascertainment biases caused by the single-nucleotide polymorphism discovery process

    DEFF Research Database (Denmark)

    Ramírez-Soriano, Anna; Nielsen, Rasmus


    Most single-nucleotide polymorphism (SNP) data suffer from an ascertainment bias caused by the process of SNP discovery followed by SNP genotyping. The final genotyped data are biased toward an excess of common alleles compared to directly sequenced data, making standard genetic methods of analysis...... the variances and covariances of these estimators and provide a corrected version of Tajima's D statistic. We reanalyze a human genomewide SNP data set and find substantial differences in the results with or without ascertainment bias correction....

  1. Comparison of single nucleotide polymorphisms and microsatellites in non-invasive genetic monitoring of a wolf population

    DEFF Research Database (Denmark)

    Fabbri, Elena; Caniglia, R.; Mucci, Nadia


    Single nucleotide polymorphisms (SNPs) which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient geno....... We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring....

  2. In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

    Directory of Open Access Journals (Sweden)

    Mohammed Alanazi

    Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

  3. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui


    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  4. Multi-generational imputation of single nucleotide polymorphism marker genotypes and accuracy of genomic selection. (United States)

    Toghiani, S; Aggrey, S E; Rekaya, R


    Availability of high-density single nucleotide polymorphism (SNP) genotyping platforms provided unprecedented opportunities to enhance breeding programmes in livestock, poultry and plant species, and to better understand the genetic basis of complex traits. Using this genomic information, genomic breeding values (GEBVs), which are more accurate than conventional breeding values. The superiority of genomic selection is possible only when high-density SNP panels are used to track genes and QTLs affecting the trait. Unfortunately, even with the continuous decrease in genotyping costs, only a small fraction of the population has been genotyped with these high-density panels. It is often the case that a larger portion of the population is genotyped with low-density and low-cost SNP panels and then imputed to a higher density. Accuracy of SNP genotype imputation tends to be high when minimum requirements are met. Nevertheless, a certain rate of genotype imputation errors is unavoidable. Thus, it is reasonable to assume that the accuracy of GEBVs will be affected by imputation errors; especially, their cumulative effects over time. To evaluate the impact of multi-generational selection on the accuracy of SNP genotypes imputation and the reliability of resulting GEBVs, a simulation was carried out under varying updating of the reference population, distance between the reference and testing sets, and the approach used for the estimation of GEBVs. Using fixed reference populations, imputation accuracy decayed by about 0.5% per generation. In fact, after 25 generations, the accuracy was only 7% lower than the first generation. When the reference population was updated by either 1% or 5% of the top animals in the previous generations, decay of imputation accuracy was substantially reduced. These results indicate that low-density panels are useful, especially when the generational interval between reference and testing population is small. As the generational interval

  5. Short communication: relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle. (United States)

    Cooper, T A; Wiggans, G R; VanRaden, P M


    Call rates on both a single nucleotide polymorphism (SNP) basis and an animal basis are used as measures of data quality and as screening tools for genomic studies and evaluations of dairy cattle. To investigate the relationship of SNP call rate and genotype accuracy for individual SNP, the correlation between percentages of missing genotypes and parent-progeny conflicts for each SNP was calculated for 103,313 Holsteins. Correlations ranged from 0.14 to 0.38 for the BovineSNP50 and BovineLD (Illumina Inc., San Diego, CA) and GeneSeek Genomic Profiler (Neogen Corp., Lincoln, NE) chips, with lower correlations for newer chips. For US genomic evaluations, genotypes are excluded for animals with a call rate of call rate for 220,175 Holstein, Jersey, and Brown Swiss genotypes was 99.6%. Animal genotypes with a call rate of ≤99% were examined from the US Department of Agriculture genotype database to determine how genotype call rate is related to accuracy of calls on an animal basis. Animal call rate was determined from SNP used in genomic evaluation and is the number of called autosomal and X-specific SNP genotypes divided by the number of SNP from that type of chip. To investigate the relationship of animal call rate and parentage validation, conflicts between a genotyped animal and its sire or dam were determined through a duo test (opposite homozygous SNP genotypes between sire and progeny; 1,374 animal genotypes) and a trio test (also including conflicts with dam and heterozygous SNP genotype for the animal when both parents are the same homozygote; 482 animal genotypes). When animal call rate was ≤ 80%, parentage validation was no longer reliable with the duo test. With the trio test, parentage validation was no longer reliable when animal call rate was ≤ 90%. To investigate how animal call rate was related to genotyping accuracy for animals with multiple genotypes, concordance between genotypes for 1,216 animals that had a genotype with a call rate of ≤ 99

  6. A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Zhipeng Su

    Full Text Available Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs, UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures. The transcriptional units

  7. Association between single nucleotide polymorphisms of the interleukin-4 gene and atopic dermatitis. (United States)

    Gharagozlou, Mohammad; Behniafard, Nasrin; Amirzargar, Ali Akbar; Hosseinverdi, Sima; Sotoudeh, Soheila; Farhadi, Elham; Khaledi, Mojdeh; Aryan, Zahra; Moghaddam, Zahra Gholizadeh; Mahmoudi, Maryam; Aghamohammadi, Asghar; Rezaei, Nima


    Atopic dermatitis (AD) is an inflammatory skin disease in which both genetic and environmental factors seem to be involved. Several studies investigated the association of certain genetic factors with AD in different ethnic groups, but conflicting data were obtained. This study was performed to check the possible association between single nucleotide polymorphisms (SNPs) of interleukin 4 (IL-4) and the IL-4 receptor α chain (IL-4Rα) and AD in a group of Iranian patients. The allele and genotype frequencies of genes encoding for IL-4 and IL-4Rα were investigated in 89 patients with AD in comparison with 139 healthy controls, using methods based on polymerase chain reaction sequence-specific primers. The most frequent alleles of IL-4 in patients were T at -1098 (P<0.001, odds ratio (OR)=2.35), C at -590 (P<0.001, OR=4.84) and C at -33 (P=0.002, OR=2.08). The most frequent genotypes of IL-4 in patients were TT, CC, and CC at positions -1098 (P<0.001, OR=3.59), -590 (P<0.001, OR=31.25) and -33 (P<0.001, OR=3.46), respectively. We found a significant lower frequency of GT at -1098 GT, TC at -590, and TC at -33 in patients. There were no statistically significant differences in the frequency of alleles and genotypes of IL-4Rα gene at position +1902. A strong positive association was seen between TCC haplotype and AD (68% in patients vs. 23.4% in controls, P<0.001, OR=8.91). We detected a significantly lower frequency of TTC, GCC, and TTT haplotypes (P<0.001, OR=0.02, P<0.001, OR=0.40, P<0.001, OR=0.39, respectively) in patients compared to controls. A significant association between the polymorphisms of the IL-4 gene promoter at positions -1098, -590, and -33 and AD was detected in the Iranian population.

  8. Geography and genography: prediction of continental origin using randomly selected single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramoni Marco F


    Full Text Available Abstract Background Recent studies have shown that when individuals are grouped on the basis of genetic similarity, group membership corresponds closely to continental origin. There has been considerable debate about the implications of these findings in the context of larger debates about race and the extent of genetic variation between groups. Some have argued that clustering according to continental origin demonstrates the existence of significant genetic differences between groups and that these differences may have important implications for differences in health and disease. Others argue that clustering according to continental origin requires the use of large amounts of genetic data or specifically chosen markers and is indicative only of very subtle genetic differences that are unlikely to have biomedical significance. Results We used small numbers of randomly selected single nucleotide polymorphisms (SNPs from the International HapMap Project to train naïve Bayes classifiers for prediction of ancestral continent of origin. Predictive accuracy was tested on two independent data sets. Genetically similar groups should be difficult to distinguish, especially if only a small number of genetic markers are used. The genetic differences between continentally defined groups are sufficiently large that one can accurately predict ancestral continent of origin using only a minute, randomly selected fraction of the genetic variation present in the human genome. Genotype data from only 50 random SNPs was sufficient to predict ancestral continent of origin in our primary test data set with an average accuracy of 95%. Genetic variations informative about ancestry were common and widely distributed throughout the genome. Conclusion Accurate characterization of ancestry is possible using small numbers of randomly selected SNPs. The results presented here show how investigators conducting genetic association studies can use small numbers of arbitrarily

  9. Genomic expression and single-nucleotide polymorphism profiling discriminates chromophobe renal cell carcinoma and oncocytoma

    International Nuclear Information System (INIS)

    Tan, Min-Han; Furge, Kyle A; Kort, Eric; Giraud, Sophie; Ferlicot, Sophie; Vielh, Philippe; Amsellem-Ouazana, Delphine; Debré, Bernard; Flam, Thierry; Thiounn, Nicolas; Zerbib, Marc; Wong, Chin Fong; Benoît, Gérard; Droupy, Stéphane; Molinié, Vincent; Vieillefond, Annick; Tan, Puay Hoon; Richard, Stéphane; Teh, Bin Tean; Tan, Hwei Ling; Yang, Ximing J; Ditlev, Jonathon; Matsuda, Daisuke; Khoo, Sok Kean; Sugimura, Jun; Fujioka, Tomoaki


    Chromophobe renal cell carcinoma (chRCC) and renal oncocytoma are two distinct but closely related entities with strong morphologic and genetic similarities. While chRCC is a malignant tumor, oncocytoma is usually regarded as a benign entity. The overlapping characteristics are best explained by a common cellular origin, and the biologic differences between chRCC and oncocytoma are therefore of considerable interest in terms of carcinogenesis, diagnosis and clinical management. Previous studies have been relatively limited in terms of examining the differences between oncocytoma and chromophobe RCC. Gene expression profiling using the Affymetrix HGU133Plus2 platform was applied on chRCC (n = 15) and oncocytoma specimens (n = 15). Supervised analysis was applied to identify a discriminatory gene signature, as well as differentially expressed genes. High throughput single-nucleotide polymorphism (SNP) genotyping was performed on independent samples (n = 14) using Affymetrix GeneChip Mapping 100 K arrays to assess correlation between expression and gene copy number. Immunohistochemical validation was performed in an independent set of tumors. A novel 14 probe-set signature was developed to classify the tumors internally with 93% accuracy, and this was successfully validated on an external data-set with 94% accuracy. Pathway analysis highlighted clinically relevant dysregulated pathways of c-erbB2 and mammalian target of rapamycin (mTOR) signaling in chRCC, but no significant differences in p-AKT or extracellular HER2 expression was identified on immunohistochemistry. Loss of chromosome 1p, reflected in both cytogenetic and expression analysis, is common to both entities, implying this may be an early event in histogenesis. Multiple regional areas of cytogenetic alterations and corresponding expression biases differentiating the two entities were identified. Parafibromin, aquaporin 6, and synaptogyrin 3 were novel immunohistochemical markers effectively discriminating

  10. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed


    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  11. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library. (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E


    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  12. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing

    Directory of Open Access Journals (Sweden)

    Guangtu Gao


    Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and

  13. Genomic expression and single-nucleotide polymorphism profiling discriminates chromophobe renal cell carcinoma and oncocytoma

    Directory of Open Access Journals (Sweden)

    Thiounn Nicolas


    Full Text Available Abstract Background Chromophobe renal cell carcinoma (chRCC and renal oncocytoma are two distinct but closely related entities with strong morphologic and genetic similarities. While chRCC is a malignant tumor, oncocytoma is usually regarded as a benign entity. The overlapping characteristics are best explained by a common cellular origin, and the biologic differences between chRCC and oncocytoma are therefore of considerable interest in terms of carcinogenesis, diagnosis and clinical management. Previous studies have been relatively limited in terms of examining the differences between oncocytoma and chromophobe RCC. Methods Gene expression profiling using the Affymetrix HGU133Plus2 platform was applied on chRCC (n = 15 and oncocytoma specimens (n = 15. Supervised analysis was applied to identify a discriminatory gene signature, as well as differentially expressed genes. High throughput single-nucleotide polymorphism (SNP genotyping was performed on independent samples (n = 14 using Affymetrix GeneChip Mapping 100 K arrays to assess correlation between expression and gene copy number. Immunohistochemical validation was performed in an independent set of tumors. Results A novel 14 probe-set signature was developed to classify the tumors internally with 93% accuracy, and this was successfully validated on an external data-set with 94% accuracy. Pathway analysis highlighted clinically relevant dysregulated pathways of c-erbB2 and mammalian target of rapamycin (mTOR signaling in chRCC, but no significant differences in p-AKT or extracellular HER2 expression was identified on immunohistochemistry. Loss of chromosome 1p, reflected in both cytogenetic and expression analysis, is common to both entities, implying this may be an early event in histogenesis. Multiple regional areas of cytogenetic alterations and corresponding expression biases differentiating the two entities were identified. Parafibromin, aquaporin 6, and synaptogyrin 3 were novel

  14. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E


    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  15. Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit

    Directory of Open Access Journals (Sweden)

    E.M. Abdel-Kafy


    Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.

  16. Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population. (United States)

    Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun


    To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

  17. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress. (United States)

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J


    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

  18. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling. (United States)

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O


    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  19. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)



    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  20. A single amino acid substitution in the core protein of West Nile virus increases resistance to acidotropic compounds.

    Directory of Open Access Journals (Sweden)

    Miguel A Martín-Acebes

    Full Text Available West Nile virus (WNV is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu on the highly basic internal capsid or core (C protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.

  1. A single amino acid substitution in the core protein of West Nile virus increases resistance to acidotropic compounds. (United States)

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; de Oya, Nereida Jiménez; Escribano-Romero, Estela; Shi, Pei-Yong; Saiz, Juan-Carlos


    West Nile virus (WNV) is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu) on the highly basic internal capsid or core (C) protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A) and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.

  2. Single amino acid substitution in important hemoglobinopathies does not disturb molecular function and biological process

    Directory of Open Access Journals (Sweden)

    Viroj Wiwanitkit


    Full Text Available Viroj WiwanitkitDepartment of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, ThailandAbstract: Hemoglobin is an important protein found in the red cells of many animals. In humans, the hemoglobin is mainly distributed in the red blood cell. Single amino acid substitution is the main pathogenesis of most hemoglobin disorders. Here, the author used a new gene ontology technology to predict the molecular function and biological process of four important hemoglobin disorders with single substitution. The four studied important abnormal hemoglobins (Hb with single substitution included Hb S, Hb E, Hb C, and Hb J-Baltimore. Using the GoFigure server, the molecular function and biological process in normal and abnormal hemoglobins was predicted. Compared with normal hemoglobin, all studied abnormal hemoglobins had the same function and biological process. This indicated that the overall function of oxygen transportation is not disturbed in the studied hemoglobin disorders. Clinical findings of oxygen depletion in abnormal hemoglobin should therefore be due to the other processes rather than genomics, proteomics, and expression levels.Keywords: hemoglobin, amino acid, substitution, function

  3. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman


    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  4. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology. (United States)

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu


    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  5. Single nucleotide polymorphisms of cathepsin S and the risks of asthma attack induced by acaroid mites. (United States)

    Li, Chaopin; Chen, Qi; Jiang, Yuxin; Liu, Zhiming


    To investigate association between the three single nucleotide polymorphisms (SNPs, rs146456111, rs143154304 and rs147260142) in cathepsin S (Cat S) and the risks of allergic asthma attack induced by the acaroid mites in the Chinese population. A case-control study was performed in 412 cases and 454 volunteers/controls to evaluate the effects of three SNPs in Cat S on the risks of asthma attack. The genotypes were determined using polymerase chain reaction (PCR) and cleaved amplification polymorphism sequence-tagged sites (PCR-RFLP). The frequencies of genotypes and alleles in these SNPs in the asthmatic group were also analyzed between the two groups. The locus of rs146456111 in Cat S gene, the allele frequency of A and C in asthmatic group were significantly different from the control group (χ(2) = 184.425, P = 0.000), and the difference was significant regarding the distribution of the genotypes (AA, AC, and CC) between asthmatic subjects and normal controls (χ(2) = 177.915, P = 0.000). Logistic regression analysis revealed that the AC, CC, and AC + CC genotypes were significantly increased with the risk of asthma (AC vs. AA, OR = 4.013, 95% CI = 2.989-4.751, P = 0.000; CC vs. AA, OR = 3.167, 95% CI = 2.483-3.785, P = 0.000; AC + CC vs. AA, OR = 3.418, 95% CI = 2.381-4.214, P = 0.000, respectively), compared with AA genotype. Moreover, by comparison with allele A, allele C (OR = 2.187, 95% CI = 1.743-2.281, P asthma; For the locus of rs143154304, compared with the allele frequency G with A in control group, there was no difference (χ(2) = 1.434, P = 0.231) in that of asthmatic group, as well as the distributions of the genotypes (AA, AG, and GG) between asthmatic subjects and normal controls (χ(2) = 1.997, P = 0.369); Logistic regression analysis showed that the AG, GG, and AG + GG genotypes were no risk to asthma (AG vs. AA, OR = 0.991, 95% CI = 0.625-1.507, P = 0.968; GG vs. AA, OR = 0.812, 95% CI = 0.525-1.258, P = 0.352; AG + GG vs. AA, OR = 0.914, 95

  6. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs within potential candidate genes (CGs or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF, Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis

  7. Single base substitution causing the fragrant phenotype and development of a type-specific marker in aromatic coconut (Cocos nucifera). (United States)

    Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S


    The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.

  8. Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes. (United States)

    Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F


    Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

  9. Effect of the substitution of F on the photoswitching behavior in single molecular device (United States)

    Bian, Baoan; Zheng, Yapeng; Yuan, Peipei; Liao, Bin; Chen, Wei; An, Xiuhua; Mo, Xiaotong; Ding, Yuqiang


    We carry out first-principles calculations based on density functional theory and non-equilibrium Green's function to investigate the electronic transport properties of a 5-arylidenehydantoin molecule sandwiched between two Au electrodes. A reversible switching behavior between E and Z isomerization can be observed in the device through light irradiation, and their currents display different characteristic. Furthermore, it is found that the substitution of F in the molecule enlarges the switching ratio of device. The different characteristics of currents for E/Z forms and E/Z with the substitution of F are discussed by the transmission spectra and the molecular projected self-consistent Hamiltonian states. We discuss the change of Fermi level alignment due to the substitution of F, and the polarization effect under bias. We find the negative differential resistance effect in the E form with the substitution of F, which is explained by change of molecule-electrode coupling with the varied bias. The results suggest that the 5-arylidenehydantoin molecule with the substitution of F that improves the performance of device, becoming one of the methods for improving single molecular photoswitching performance in the future.

  10. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe


    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  11. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  12. Single nucleotide polymorphisms of ADH1B, ADH1C and ALDH2 genes and esophageal cancer: A population-based case-control study in China

    NARCIS (Netherlands)

    Wu, M.; Chang, S.; Kampman, E.; Kok, F.J.


    Alcohol drinking is a major risk factor for esophageal cancer (EC) and the metabolism of ethanol has been suggested to play an important role in esophageal carcinogenesis. Epidemiologic studies, including genomewide association studies (GWAS), have identified single nucleotide polymorphisms (SNPs)

  13. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng


    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  14. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo. (United States)

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko


    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease. (United States)

    Sifrim, Alejandro; Van Houdt, Jeroen Kj; Tranchevent, Leon-Charles; Nowakowska, Beata; Sakai, Ryo; Pavlopoulos, Georgios A; Devriendt, Koen; Vermeesch, Joris R; Moreau, Yves; Aerts, Jan


    The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at

  16. Growth, structural and magnetic characterization of Al-substituted barium hexaferrite single crystals

    International Nuclear Information System (INIS)

    Vinnik, D.A.; Zherebtsov, D.A.; Mashkovtseva, L.S.; Nemrava, S.; Bischoff, M.; Perov, N.S.; Semisalova, A.S.; Krivtsov, I.V.; Isaenko, L.I.; Mikhailov, G.G.; Niewa, R.


    Highlights: • Growth of large Al-substituted crystals BaFe 12−x Al x O 19. • Al-content controllable by flux composition. • Crystallographic site preference of Al unraveled. • Magnetic characterization depending on Al-content. - Abstract: Large single crystals of aluminum-substituted M-type barium hexaferrite BaFe 12−x Al x O 19 were obtained from carbonate flux. The Al content in the crystals can be controlled via the Al content of the flux up to x = 1.1 according to single crystal X-ray structure refinements. Al shows a distinct preference to substitute Fe on crystallographic sites with high coordination numbers by oxygen atoms, whereas no significant amounts of Al can be found on a tetrahedrally coordinated site. An increasing amount of the aluminum dopant results in a monotonous reduction of the Curie temperature from 440 to 415 °C and the saturation magnetization at room temperature from 68 to 57 emu/g for single crystal and from 61 to 53 emu/g for powder samples

  17. Association of polycystic ovary syndrome susceptibility single nucleotide polymorphism rs2479106 and PCOS in Caucasian patients with PCOS or hirsutism as referral diagnosis

    DEFF Research Database (Denmark)

    Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne


    Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women.......Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women....

  18. Synthesis and Single Crystal Structures of Substituted-1,3-Selenazol-2-amines

    Directory of Open Access Journals (Sweden)

    Guoxiong Hua


    Full Text Available The synthesis and X-ray single crystal structures of a series of new 4-substituted-1,3-selenazol-2-amines is reported. The efficient preparation of these compounds was carried out by two-component cyclization of the selenoureas with equimolar amounts of α-haloketones. The selenoureas were obtained from the reaction of Woollins’ reagent with cyanamides, followed by hydrolysis with water. All new compounds have been characterized by IR spectroscopy, multi-NMR (1H, 13C, 77Se spectroscopy, accurate mass measurement and single crystal X-ray structure analysis.

  19. Modeling single nucleotide polymorphisms in the human AKR1C1 and AKR1C2 genes: implications for functional and genotyping analyses.

    Directory of Open Access Journals (Sweden)

    Jonathan W Arthur


    Full Text Available Enzymes encoded by the AKR1C1 and AKR1C2 genes are responsible for the metabolism of progesterone and 5α-dihydrotestosterone (DHT, respectively. The effect of amino acid substitutions, resulting from single nucleotide polymorphisms (SNPs in the AKR1C2 gene, on the enzyme kinetics of the AKR1C2 gene product were determined experimentally by Takashi et al. In this paper, we used homology modeling to predict and analyze the structure of AKR1C1 and AKR1C2 genetic variants. The experimental reduction in enzyme activity in the AKR1C2 variants F46Y and L172Q, as determined by Takahashi et al., is predicted to be due to increased instability in cofactor binding, caused by disruptions to the hydrogen bonds between NADP and AKR1C2, resulting from the insertion of polar residues into largely non-polar environments near the site of cofactor binding. Other AKR1C2 variants were shown to involve either conservative substitutions or changes taking place on the surface of the molecule and distant from the active site, confirming the experimental finding of Takahashi et al. that these variants do not result in any statistically significant reduction in enzyme activity. The AKR1C1 R258C variant is predicted to have no effect on enzyme activity for similar reasons. Thus, we provide further insight into the molecular mechanism of the enzyme kinetics of these proteins. Our data also highlight previously reported difficulties with online databases.

  20. In silico Analysis of the Functional and Structural Impacts of Non-synonymous Single Nucleotide Polymorphisms in the Human Paraxonase 1 Gene

    Directory of Open Access Journals (Sweden)

    Sudip Paul


    Full Text Available Computational approaches could help in identifying deleterious non-synonymous single nucleotide polymorphisms (nsSNPs in a disease related gene which is a difficult and laborious task through laboratory experiments. In the present study, we analyzed the impacts of nsSNPs on structure and function of Paraxonase 1 (PON1 using different bioinformatics tools. The human PON1 protein sequence and its corresponding gene's SNP information were collected from UniProt and dbSNP databases, respectively. We utilized SIFT, Polyphen, I-Mutant 2.0, MutPred, SNP and GO, PhD-SNP and PANTHER tools in order to examine the total 39 nsSNPs occurring in the PON1 coding region. We filtered the most pathological mutations by combining the scores of the aforementioned servers and found 8 SNPs (G344C, S302L, W281C, D279Y, H134R, F120S, L90P, C42R as deleterious and disease causing. The PDB structure of PON1 protein was obtained from RCSB Protein Data Bank (PDB ID: 1V04. The deleterious SNPs in native PON1 were introduced using Swiss-PDB Viewer package and changes in free energy were observed for six out of eight mutant structures. Two SNPs, S302L (substitution of serine to leucine at 302 position in amino acid sequence and L90P (substitution of leucine to proline at 90 position in amino acid sequence caused the highest energy increase amongst all. The findings implicate that these nsSNPs would be analyzed further in detail to enumerate their possible association with the protein deteriorating and disease causal potentialities.

  1. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A


    Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop

  2. Measurement of nucleotide exchange rate constants in single rabbit soleus myofibrils during shortening and lengthening using a fluorescent ATP analog. (United States)

    Shirakawa, I; Chaen, S; Bagshaw, C R; Sugi, H


    The kinetics of displacement of a fluorescent nucleotide, 2'(3')-O-[N[2-[[Cy3]amido]ethyl]carbamoyl]-adenosine 5'-triphosphate (Cy3-EDA-ATP), bound to rabbit soleus muscle myofibrils were studied using flash photolysis of caged ATP. Use of myofibrils from this slow twitch muscle allowed better resolution of the kinetics of nucleotide exchange than previous studies with psoas muscle myofibrils (, Biophys. J. 73:2033-2042). Soleus myofibrils in the presence of Cy3-EDA-nucleotides (Cy3-EDA-ATP or Cy3-EDA-ADP) showed selective fluorescence staining of the A-band. The K(m) for Cy3-EDA-ATP and the K(d) for Cy3-EDA-ADP binding to the myofibril A-band were 1.9 microM and 3.8 microM, respectively, indicating stronger binding of nucleotide to soleus cross-bridges compared to psoas cross-bridges (2.6 microM and 50 microM, respectively). After flash photolysis of caged ATP, the A-band fluorescence of the myofibril in the Cy3-EDA-ATP solution under isometric conditions decayed exponentially with a rate constant of 0.045 +/- 0.007 s(-1) (n = 32) at 10 degrees C, which was about seven times slower than that for psoas myofibrils. When a myofibril was allowed to shorten with a constant velocity, the nucleotide displacement rate constant increased from 0.066 s(-1) (isometric) to 0.14 s(-1) at 20 degrees C with increasing shortening velocity up to 0.1 myofibril length/s (V(max), the shortening velocity under no load was approximately 0. 2 myofibril lengths/s). The rate constant was not significantly affected by an isovelocity stretch of up to 0.1 myofibril lengths/s. These results suggest that the cross-bridge kinetics are not significantly affected at higher strain during lengthening but depend on the lower strain during shortening. These data also indicate that the interaction distance between a cross-bridge and the actin filament is at least 16 nm for a single cycle of the ATPase.

  3. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines. (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif


    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  4. Frequency of single nucleotide polymorphisms of some immune response genes in a population sample from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Léa Campos de Oliveira


    Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.

  5. A common single nucleotide polymorphism can exacerbate long-QT type 2 syndrome leading to sudden infant death

    DEFF Research Database (Denmark)

    Nof, Eyal; Cordeiro, Jonathan M; Pérez, Guillermo J


    the mother (both asymptomatic), led to 2 cases of sudden infant death. METHODS AND RESULTS: KCNQ1, KCNH2, SCN5A, KCNE1, KCNE2, CACNA1c, CACNB2b, and KCNJ2 genes were amplified and analyzed by direct sequencing. Functional electrophysiological studies were performed with the single nucleotide polymorphism...... and mutation expressed singly and in combination in Chinese ovary (CHO-K1) and COS-1 cells. An asymptomatic woman presenting after the death of her 2-day-old infant and spontaneous abortion of a second baby in the first trimester was referred for genetic analysis. The newborn infant had nearly incessant...... ventricular tachycardia while in utero and a prolonged QTc (560 ms). The mother was asymptomatic but displayed a prolonged QTc. Genetic screening of the mother revealed a heterozygous nonsense mutation (P926AfsX14) in KCNH2, predicting a stop codon. The father was asymptomatic with a normal QTc but had...

  6. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time. (United States)

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett


    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  7. Genome-wide single nucleotide polymorphisms (SNPs) for a model invasive ascidian Botryllus schlosseri. (United States)

    Gao, Yangchun; Li, Shiguo; Zhan, Aibin


    Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.

  8. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  9. Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods. (United States)

    Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge


    The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

  10. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms. (United States)

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H


    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  11. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.


    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  12. A single nucleotide in stem loop II of 5'-untranslated region contributes to virulence of enterovirus 71 in mice.

    Directory of Open Access Journals (Sweden)

    Ming-Te Yeh

    Full Text Available BACKGROUND: Enterovirus 71 (EV71 has emerged as a neuroinvasive virus responsible for several large outbreaks in the Asia-Pacific region while virulence determinant remains unexplored. PRINCIPAL FINDINGS: In this report, we investigated increased virulence of unadapted EV71 clinical isolate 237 as compared with isolate 4643 in mice. A fragment 12 nucleotides in length in stem loop (SL II of 237 5'-untranslated region (UTR visibly reduced survival time and rate in mice was identified by constructing a series of infectious clones harboring chimeric 5'-UTR. In cells transfected with bicistronic plasmids, and replicon RNAs, the 12-nt fragment of isolate 237 enhanced translational activities and accelerated replication of subgenomic EV71. Finally, single nucleotide change from cytosine to uridine at base 158 in this short fragment of 5'-UTR was proven to reduce viral translation and EV71 virulence in mice. Results collectively indicated a pivotal role of novel virulence determinant C158 on virus translation in vitro and EV71 virulence in vivo. CONCLUSIONS: These results presented the first reported virulence determinant in EV71 5'-UTR and first position discovered from unadapted isolates.

  13. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection. (United States)

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina


    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  14. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations. (United States)

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C


    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

  15. Preliminary Study on the Single Nucleotide Polymorphism (SNP of XRCC1 Gene Identificationto Improve the Outcomes of Radiotherapy for Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Devita Tetriana


    Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks

  16. Crystallographic characterization of single-ortho, N-substituted acetanilide derivatives

    International Nuclear Information System (INIS)

    Boeyens, J.C.A.; Denner, L.; Painter, S.; Staskun, B.


    The crystal and molecular structures of the three single-ortho, N-substituted amide derivatives, acet-2'-bromo-N-(p-nitrobenzyl)anilide, 3',5'-dimethyl-N-ethyl-2,2,2',4'-tetrachlorobenzoylacetanilide, and difluoro[(1-phenyl-2-(o-ethylphenyl-N-benzylcarbamoyl)vinyl)oxy]borane, have been determined by X-ray diffraction analysis. In each case, the amide carbonyl group was found in the exo-conformation, independent of the nature of the acyl group. The observed conformations correlate well with solution structures, inferred from n.m.r. data

  17. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad


    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  18. Single Nucleotide Polymorphisms in Growth Hormone Gene and Their Association with Growth Traits in Siniperca chuatsi (Basilewsky

    Directory of Open Access Journals (Sweden)

    Changxu Tian


    Full Text Available Growth hormone (GH has been considered as a candidate gene for growth traits in fish. In this study, polymorphisms of the GH gene were evaluated for associations with growth traits in 282 Siniperca chuatsi individuals. Using directly sequencing, four single nucleotide polymorphisms (SNPs were identified in GH gene, with two mutations in intron 4 (g.4940A>C, g.4948A>T, one mutation in exon 5 (g.5045T>C and one in intron 5 (g.5234T>G. Notably, three of them were significantly associated with growth performance, particularly for g.4940A>C which was highly correlated with all the four growth traits. In conclusion, our results demonstrated that these SNPs in GH gene could influence growth performance of S.chuatsi and could be used for marker-assisted selection (MAS in this species.

  19. Single Nucleotide Polymorphisms in IL1B and the Risk of Acute Coronary Syndrome: A Danish Case-Cohort Study

    DEFF Research Database (Denmark)

    Stegger, Jakob Gerhard; Schmidt, Erik Berg; Tjonneland, Anne


    Background: Interleukin-1B (IL-1B) is a key pro-inflammatory cytokine that has been associated with the development of atherosclerosis and myocardial infarction. However, the prospective associations between functional single nucleotide polymorphisms (SNPs) in IL1B and incident acute coronary...... and 234 women). All cases were validated by review of medical records, and information on covariates was collected by study technicians. The study was conducted according to a case-cohort study design including ACS cases and a sex-stratified sub cohort of 1663 participants drawn randomly from the entire...... IL1B haplotypes and risk factors, respectively. Conclusions/Significance: Genetic variation in the promoter region of IL1B may not be associated with incident ACS in men or women above the age of 50 years....

  20. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis (United States)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo


    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  1. Exploration of pathomechanisms triggered by a single-nucleotide polymorphism in titin's I-band: the cardiomyopathy-linked mutation T2580I

    NARCIS (Netherlands)

    Bogomolovas, J.; Fleming, J.R.; Anderson, B.R.; Williams, R.; Lange, S.; Simon, B.; Khan, M.M.; Rudolf, R.; Franke, B.; Bullard, B.; Rigden, D.J.; Granzier, H.; Labeit, S.; Mayans, O.


    Missense single-nucleotide polymorphisms (mSNPs) in titin are emerging as a main causative factor of heart failure. However, distinguishing between benign and disease-causing mSNPs is a substantial challenge. Here, we research the question of whether a single mSNP in a generic domain of titin can

  2. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer


    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  3. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information. (United States)

    van Binsbergen, R; Veerkamp, R F; Calus, M P L


    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm. (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei


    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  5. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients. (United States)

    Salmaninejad, Arash; Mahmoudi, Mahdi; Aslani, Saeed; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima


    Salmaninejad A, Mahmoudi M, Aslani S, Poursani S, Ziaee V, Rezaei N. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients. Turk J Pediatr 2017; 59: 144-149. Juvenile-onset systemic lupus erythematosus (JSLE) is a complex autoimmune disease, characterized by multi-organ involvement. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene have been reported to have relationship with the risk of several autoimmune diseases. Studies have provided evidence that STAT4 may participate in the pathogenesis of JSLE. Therefore, we aimed to evaluate the association of STAT4 SNPs with JSLE in Iranian population. In this case-control study, two SNPs of STAT4 gene, including rs7574865 and rs7601754 were genotyped in 50 Iranian JSLE patients and 281 matched healthy individuals using real-time PCR allelic discrimination approach. Our experiments demonstrated that G and T alleles of rs7574865 SNP had similar distribution between patients and controls (P = 0.16). Additionally, differences in frequency of GG, GT, and TT genotypes (P = 0.14, 0.29, and 0.54, respectively) were not significant. Likewise, A and G alleles, as well as genotypes of rs7601754 SNP did not show significant differences between JSLE patients and healthy individuals. Lack of association of rs7574865 and rs7601754 SNPs in STAT4 gene with susceptibility to JSLE in Iranian population, despite their association with the risk of adult SLE in the same population, implicates on difference of genetic background of JSLE and SLE.

  6. Intrinsic magnetism of a series of Co substituted ZnO single crystals

    International Nuclear Information System (INIS)

    Lv Peiwen; Huang Feng; Chu Wangsheng; Lin Zhang; Chen Dagui; Li Wei; Chen Dongliang; Wu Ziyu


    Magnetic properties of a series of well-substituted Zn 1-x Co x O (x = 0.018,0.036 and 0.05) single crystals were studied. A typical paramagnetic anisotropy property, which strengthens when x decreases, was found. A magnetization step was observed at 2 K when the magnetic field is parallel to the c axis, indicating that paramagnetic anisotropy is the origin of the strong crystal field effect on Co 2+ ions in ZnO lattices. The Co 2+ single-ion anisotropy parameter 2D is obtained as 7.5 K. The effective moment of Co 2+ takes the values 2.7 μ B , 1.82 μ B , 1.49 μ B when x = 0.018, 0.036 and 0.05, revealing that more antiferromagnetic coupling between Co 2+ ions arises in the perfect crystal when x increases

  7. HIV control through a single nucleotide on the HLA-B locus

    DEFF Research Database (Denmark)

    Kløverpris, Henrik N; Harndahl, Mikkel; Leslie, Alasdair J


    Genetic variation within the HLA-B locus has the strongest impact on HIV disease progression of any polymorphisms within the human genome. However, identifying the exact mechanism involved is complicated by several factors. HLA-Bw4 alleles provide ligands for NK cells and for CD8 T cells, and str......Genetic variation within the HLA-B locus has the strongest impact on HIV disease progression of any polymorphisms within the human genome. However, identifying the exact mechanism involved is complicated by several factors. HLA-Bw4 alleles provide ligands for NK cells and for CD8 T cells......:02, which differ by only a single amino acid. Crucially, they occur primarily on identical HLA class I haplotypes and, as Bw6 alleles, do not act as NK cell ligands and are therefore largely unconfounded by other genetic factors. We show that in an outbred cohort (n = 2,093) of HIV C......-clade-infected individuals, a single amino acid change at position 9 of the HLA-B molecule critically affects peptide binding and significantly alters the cytotoxic T lymphocyte (CTL) epitopes targeted, measured directly ex vivo by gamma interferon (IFN-γ) enzyme-linked immunospot (ELISPOT) assay (P = 2 × 10...

  8. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease. (United States)

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan


    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (pGraves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  9. Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

    Directory of Open Access Journals (Sweden)

    Johnson Peter W


    Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

  10. Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

    Directory of Open Access Journals (Sweden)

    Petrović Sandra


    Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

  11. A Single-Nucleotide Polymorphism in an Endo-1,4-β-Glucanase Gene Controls Seed Coat Permeability in Soybean.

    Directory of Open Access Journals (Sweden)

    Seong-Jin Jang

    Full Text Available Physical dormancy, a structural feature of the seed coat known as hard seededness, is an important characteristic for adaptation of plants against unstable and unpredictable environments. To dissect the molecular basis of qHS1, a quantitative trait locus for hard seededness in soybean (Glycine max (L Merr., we developed a near-isogenic line (NIL of a permeable (soft-seeded cultivar, Tachinagaha, containing a hard-seed allele from wild soybean (G. soja introduced by successive backcrossings. The hard-seed allele made the seed coat of Tachinagaha more rigid by increasing the amount of β-1,4-glucans in the outer layer of palisade cells of the seed coat on the dorsal side of seeds, known to be a point of entrance of water. Fine-mapping and subsequent expression and sequencing analyses revealed that qHS1 encodes an endo-1,4-β-glucanase. A single-nucleotide polymorphism (SNP introduced an amino acid substitution in a substrate-binding cleft of the enzyme, possibly reducing or eliminating its affinity for substrates in permeable cultivars. Introduction of the genomic region of qHS1 from the impermeable (hard-seeded NIL into the permeable cultivar Kariyutaka resulted in accumulation of β-1,4-glucan in the outer layer of palisade cells and production of hard seeds. The SNP allele found in the NIL was further associated with the occurrence of hard seeds in soybean cultivars of various origins. The findings of this and previous studies may indicate that qHS1 is involved in the accumulation of β-1,4-glucan derivatives such as xyloglucan and/or β-(1,3(1,4-glucan that reinforce the impermeability of seed coats in soybean.

  12. A single nucleotide polymorphism within the novel sex-linked testis-specific retrotransposed PGAM4 gene influences human male fertility.

    Directory of Open Access Journals (Sweden)

    Hidenobu Okuda

    Full Text Available The development of novel fertilization treatments, including in vitro fertilization and intracytoplasmic injection, has made pregnancy possible regardless of the level of activity of the spermatozoa; however, the etiology of male-factor infertility is poorly understood. Multiple studies, primarily through the use of transgenic animals, have contributed to a list of candidate genes that may affect male infertility in humans. We examined single nucleotide polymorphisms (SNPs as a cause of male infertility in an analysis of spermatogenesis-specific genes.We carried out the prevalence of SNPs in the coding region of phosphoglycerate mutase 4 (PGAM4 on the X chromosome by the direct sequencing of PCR-amplified DNA from male patients. Using RT-PCR and western blot analyses, we identified that PGAM4 is a functional retrogene that is expressed predominantly in the testes and is associated with male infertility. PGAM4 is expressed in post-meiotic stages, including spermatids and spermatozoa in the testes, and the principal piece of the flagellum and acrosome in ejaculated spermatozoa. A case-control study revealed that 4.5% of infertile patients carry the G75C polymorphism, which causes an amino acid substitution in the encoded protein. Furthermore, an assay for enzymatic activity demonstrated that this polymorphism decreases the enzyme's activity both in vitro and in vivo.These results suggest that PGAM4, an X-linked retrogene, is a fundamental gene in human male reproduction and may escape meiotic sex chromosome inactivation. These findings provide fresh insight into elucidating the mechanisms of male infertility.

  13. Genotyping of single nucleotide polymorphism by probe-gated silica nanoparticles. (United States)

    Ercan, Meltem; Ozalp, Veli C; Tuna, Bilge G


    The development of simple, reliable, and rapid approaches for molecular detection of common mutations is important for prevention and early diagnosis of genetic diseases, including Thalessemia. Oligonucleotide-gated mesoporous nanoparticles-based analysis is a new platform for mutation detection that has the advantages of sensitivity, rapidity, accuracy, and convenience. A specific mutation in β-thalassemia, one of the most prevalent inherited diseases in several countries, was used as model disease in this study. An assay for detection of IVS110 point mutation (A > G reversion) was developed by designing probe-gated mesoporous silica nanoparticles (MCM-41) loaded with reporter fluorescein molecules. The silica nanoparticles were characterized by AFM, TEM and BET analysis for having 180 nm diameter and 2.83 nm pore size regular hexagonal shape. Amine group functionalized nanoparticles were analysed with FTIR technique. Mutated and normal sequence probe oligonucleotides)about 12.7 nmol per mg nanoparticles) were used to entrap reporter fluorescein molecules inside the pores and hybridization with single stranded DNA targets amplified by PCR gave different fluorescent signals for mutated targets. Samples from IVS110 mutated and normal patients resulted in statistically significant differences when the assay procedure were applied. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Single Nucleotide Polymorphisms in the HIRA Gene Affect Litter Size in Small Tail Han Sheep

    Directory of Open Access Journals (Sweden)

    Mei Zhou


    Full Text Available Maintenance of appropriate levels of fecundity is critical for efficient sheep production. Opportunities to increase sheep litter size include identifying single gene mutations with major effects on ovulation rate and litter size. Whole-genome sequencing (WGS data of 89 Chinese domestic sheep from nine different geographical locations and ten Australian sheep were analyzed to detect new polymorphisms affecting litter size. Comparative genomic analysis of sheep with contrasting litter size detected a novel set of candidate genes. Two SNPs, g.71874104G>A and g.71833755T>C, were genotyped in 760 Small Tail Han sheep and analyzed for association with litter size. The two SNPs were significantly associated with litter size, being in strong linkage disequilibrium in the region 71.80–71.87 Mb. This haplotype block contains one gene that may affect litter size, Histone Cell Cycle Regulator (HIRA. HIRA mRNA levels in sheep with different lambing ability were significantly higher in ovaries of Small Tail Han sheep (high fecundity than in Sunite sheep (low fecundity. Moreover, the expression levels of HIRA in eight tissues of uniparous Small Tail Han sheep were significantly higher than in multiparous Small Tail Han sheep (p < 0.05. HIRA SNPs significantly affect litter size in sheep and are useful as genetic markers for litter size.

  15. DEFLATE Compression Algorithm Corrects for Overestimation of Phylogenetic Diversity by Grantham Approach to Single-Nucleotide Polymorphism Classification

    Directory of Open Access Journals (Sweden)

    Arran Schlosberg


    Full Text Available Improvements in speed and cost of genome sequencing are resulting in increasing numbers of novel non-synonymous single nucleotide polymorphisms (nsSNPs in genes known to be associated with disease. The large number of nsSNPs makes laboratory-based classification infeasible and familial co-segregation with disease is not always possible. In-silico methods for classification or triage are thus utilised. A popular tool based on multiple-species sequence alignments (MSAs and work by Grantham, Align-GVGD, has been shown to underestimate deleterious effects, particularly as sequence numbers increase. We utilised the DEFLATE compression algorithm to account for expected variation across a number of species. With the adjusted Grantham measure we derived a means of quantitatively clustering known neutral and deleterious nsSNPs from the same gene; this was then used to assign novel variants to the most appropriate cluster as a means of binary classification. Scaling of clusters allows for inter-gene comparison of variants through a single pathogenicity score. The approach improves upon the classification accuracy of Align-GVGD while correcting for sensitivity to large MSAs. Open-source code and a web server are made available at

  16. CARD15 single nucleotide polymorphisms 8, 12 and 13 are not increased in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F


    and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...

  17. Prediction by graph theoretic measures of structural effects in proteins arising from non-synonymous single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Tammy M K Cheng

    Full Text Available Recent analyses of human genome sequences have given rise to impressive advances in identifying non-synonymous single nucleotide polymorphisms (nsSNPs. By contrast, the annotation of nsSNPs and their links to diseases are progressing at a much slower pace. Many of the current approaches to analysing disease-associated nsSNPs use primarily sequence and evolutionary information, while structural information is relatively less exploited. In order to explore the potential of such information, we developed a structure-based approach, Bongo (Bonds ON Graph, to predict structural effects of nsSNPs. Bongo considers protein structures as residue-residue interaction networks and applies graph theoretical measures to identify the residues that are critical for maintaining structural stability by assessing the consequences on the interaction network of single point mutations. Our results show that Bongo is able to identify mutations that cause both local and global structural effects, with a remarkably low false positive rate. Application of the Bongo method to the prediction of 506 disease-associated nsSNPs resulted in a performance (positive predictive value, PPV, 78.5% similar to that of PolyPhen (PPV, 77.2% and PANTHER (PPV, 72.2%. As the Bongo method is solely structure-based, our results indicate that the structural changes resulting from nsSNPs are closely associated to their pathological consequences.

  18. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions. (United States)

    Yates, Christopher M; Sternberg, Michael J E


    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  19. Single-gene testing combined with single nucleotide polymorphism microarray preimplantation genetic diagnosis for aneuploidy: a novel approach in optimizing pregnancy outcome. (United States)

    Brezina, Paul R; Benner, Andrew; Rechitsky, Svetlana; Kuliev, Anver; Pomerantseva, Ekaterina; Pauling, Dana; Kearns, William G


    To describe a method of amplifying DNA from blastocyst trophectoderm cells (two or three cells) and simultaneously performing 23-chromosome single nucleotide polymorphism microarrays and single-gene preimplantation genetic diagnosis. Case report. IVF clinic and preimplantation genetic diagnostic centers. A 36-year-old woman, gravida 2, para 1011, and her husband who both were carriers of GM(1) gangliosidosis. The couple wished to proceed with microarray analysis for aneuploidy detection coupled with DNA sequencing for GM(1) gangliosidosis. An IVF cycle was performed. Ten blastocyst-stage embryos underwent trophectoderm biopsy. Twenty-three-chromosome microarray analysis for aneuploidy and specific DNA sequencing for GM(1) gangliosidosis mutations were performed. Viable pregnancy. After testing, elective single embryo transfer was performed followed by an intrauterine pregnancy with documented fetal cardiac activity by ultrasound. Twenty-three-chromosome microarray analysis for aneuploidy detection and single-gene evaluation via specific DNA sequencing and linkage analysis are used for preimplantation diagnosis for single-gene disorders and aneuploidy. Because of the minimal amount of genetic material obtained from the day 3 to 5 embryos (up to 6 pg), these modalities have been used in isolation of each other. The use of preimplantation genetic diagnosis for aneuploidy coupled with testing for single-gene disorders via trophectoderm biopsy is a novel approach to maximize pregnancy outcomes. Although further investigation is warranted, preimplantation genetic diagnosis for aneuploidy and single-gene testing seem destined to be used increasingly to optimize ultimate pregnancy success. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  20. Study on the introgression of beef breeds in Canchim cattle using single nucleotide polymorphism markers.

    Directory of Open Access Journals (Sweden)

    Marcos Eli Buzanskas

    Full Text Available The aim of this study was to evaluate the level of introgression of breeds in the Canchim (CA: 62.5% Charolais-37.5% Zebu and MA genetic group (MA: 65.6% Charolais-34.4% Zebu cattle using genomic information on Charolais (CH, Nelore (NE, and Indubrasil (IB breeds. The number of animals used was 395 (CA and MA, 763 (NE, 338 (CH, and 37 (IB. The Bovine50SNP BeadChip from Illumina panel was used to estimate the levels of introgression of breeds considering the Maximum likelihood, Bayesian, and Single Regression method. After genotype quality control, 32,308 SNPs were considered in the analysis. Furthermore, three thresholds to prune out SNPs in linkage disequilibrium higher than 0.10, 0.05, and 0.01 were considered, resulting in 15,286, 7,652, and 1,582 SNPs, respectively. For k = 2, the proportion of taurine and indicine varied from the expected proportion based on pedigree for all methods studied. For k = 3, the Regression method was able to differentiate the animals in three main clusters assigned to each purebred breed, showing more reasonable according to its biological viewpoint. Analyzing the data considering k = 2 seems to be more appropriate for Canchim-MA animals due to its biological interpretation. The usage of 32,308 SNPs in the analyses resulted in similar findings between the estimated and expected breed proportions. Using the Regression approach, a contribution of Indubrasil was observed in Canchim-MA when k = 3 was considered. Genetic parameter estimation could account for this breed composition information as a source of variation in order to improve the accuracy of genetic models. Our findings may help assemble appropriate reference populations for genomic prediction for Canchim-MA in order to improve prediction accuracy. Using the information on the level of introgression in each individual could also be useful in breeding or crossing design to improve individual heterosis in crossbred cattle.

  1. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices. (United States)

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V


    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  2. ERCC1 and XRCC1 but not XPA single nucleotide polymorphisms correlate with response to chemotherapy in endometrial carcinoma

    Directory of Open Access Journals (Sweden)

    Chen L


    Full Text Available Liang Chen,1 Mei-Mei Liu,1 Hui Liu,1 Dan Lu,2 Xiao-Dan Zhao,3 Xue-Jing Yang4 1Department of Gynecology and Obstetrics, 2Department of Oncology, 3Department of Clinical Laboratory, The 2nd Affiliated Hospital, Harbin Medical University, 4Nursing Department, Harbin Chest Hospital, Harbin, People’s Republic of China Abstract: Our study aimed to investigate the correlation between single nucleotide polymorphisms of ERCC1/XRCC1/XPA genes and postoperative chemotherapy efficacy and prognosis of endometrial carcinoma. Our study included 108 patients with endometrial carcinoma and 100 healthy participants. ERCC1 rs11615/XRCC1 rs25487/XPA rs1800975 gene polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism. Then the chemotherapy efficacy and toxic effects of the patients were assessed. The genotype and allele frequency of ERCC1 rs11615/XRCC1 rs25487 in the case group were significantly different from that in the control group (all P<0.05. The patients with AA + GA in ERCC1 rs11615 had an increased risk of endometrial carcinoma than those with GG, and the risk of endometrial carcinoma for patients with AA + GA was also higher in comparison with patients with GG genotype in XRCC1 rs25487 (all P<0.05. GG on both ERCC1 rs11615/XRCC1 rs25487 had a higher effective rate of chemotherapy than GA + AA (all P<0.05. ERCC1 rs11615/XRCC1 rs25487 gene polymorphisms were linked with toxic effects in liver, kidney, and nervous system. ERCC1 rs11615/XRCC1 rs25487, muscular invasion, and tumor stage were independent risk factors for the prognosis of endometrial carcinoma (all P<0.05. However, no significant associations were observed between XPA rs1800975 polymorphism and chemotherapy efficacy and prognosis of endometrial carcinoma (all P>0.05. These results indicated that ERCC1 and XRCC1 but not XPA polymorphisms correlate with response to chemotherapy in endometrial carcinoma. Keywords: ERCC1, XRCC1, XPA, single nucleotide

  3. Yeast allosteric chorismate mutase is locked in the activated state by a single amino acid substitution

    International Nuclear Information System (INIS)

    Schmidheini, T.; Moesch, H.U.; Braus, G.; Evans, J.N.S.


    Chorismate mutase, a branch-point enzyme in the aromatic amino acid pathway of Saccharomyces cerevisiae, and also a mutant chorismate mutase with a single amino acid substitution in the C-terminal part of the protein have been purified approximately 20-fold and 64-fold from overproducing strains, respectively. The wild-type enzyme is activated by tryptophan and subject to feedback inhibition by tyrosine, whereas the mutant enzyme does not respond to activation by tryptophan nor inhibition by tyrosine. Both enzymes are dimers consisting of two identical subunits of M r 30,000, each one capable of binding one substrate and one activator molecule. Each subunit of the wild-type enzyme also binds one inhibitor molecule, whereas the mutant enzyme lost this ability. The enzyme reaction was observed by 1 H NMR and shows a direct and irreversible conversion of chorismate to prephenate without the accumulation of any enzyme-free intermediates. The kinetic data of the wild-type chorismate mutase show positive cooperativity toward the substrate with a Hill coefficient of 1.71 and a [S] 0.5 value of 4.0 mM. In the presence of the activator tryptophan, the cooperativity is lost. The enzyme has an [S] 0.5 value of 1.2 mM in the presence of 10 μM tryptophan and an increased [S] 0.5 value of 8.6 mM in the presence of 300 μM tyrosine. In the mutant enzyme, a loss of the cooperativity was observed, and [S] 0.5 was reduced to 1.0 mM. This enzyme is therefore locked in the activated state by a single amino acid substitution

  4. Impact of IL28B-Related Single Nucleotide Polymorphisms on Liver Histopathology in Chronic Hepatitis C Genotype 2 and 3

    DEFF Research Database (Denmark)

    Rembeck, Karolina; Alsiö, Asa; Christensen, Peer Brehm


    Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in proximity to IL28B predict spontaneous clearance of HCV infection as well as outcome following peginterferon and ribavirin therapy among HCV genotype 1 infected patients. The present stu...

  5. The single-nucleotide polymorphism 309 in the MDM2 gene contributes to the Li-Fraumeni syndrome and related phenotypes

    NARCIS (Netherlands)

    Ruijs, Mariëlle W. G.; Schmidt, Marjanka K.; Nevanlinna, Heli; Tommiska, Johanna; Aittomäki, Kristiina; Pruntel, Roelof; Verhoef, Senno; van 't Veer, L. J.


    Li-Fraumeni syndrome (LFS) is an autosomal-dominant cancer predisposition syndrome of which the majority is caused by TP53 germline mutations and is characterised by different tumour types occurring at relatively young age. Recently, it was shown that a single-nucleotide polymorphism (SNP) in the

  6. Correlations between clinical normal tissue radiosensitivity and single nucleotide polymorphisms in ATM, XRCC1, XRCC3, APEX, SOD2, and TGF-B1

    DEFF Research Database (Denmark)

    Alsner, Jan; Andreassen, Christian Nicolaj; Overgaard, Marie

    in biological pathways suspected to underlie phenotypes of interest. These variants can be either common alterations like single nucleotide polymorphisms, SNPs, or rare variants in potential susceptibility loci like ATM. In parallel, we are using microarray analysis on normal fibroblasts isolated from patients...

  7. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population]. (United States)

    Wu, Lei; He, Yao; Zhang, Di


    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  8. A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi


    It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...

  9. A single nucleotide polymorphism in the promoter of the LOXL1 gene and its relationship to pelvic organ prolapse and preterm premature rupture of membranes. (United States)

    Ferrell, Georgia; Lu, Minyan; Stoddard, Paul; Sammel, Mary D; Romero, Roberto; Strauss, Jerome F; Matthews, Catherine A


    Pelvic organ prolapse and preterm premature rupture of membranes, the 2 conditions which have in common weakening of the tensile strength of tissues, are thought to be caused, in part, by abnormal extracellular matrix synthesis and/or catabolism. We identified a new single nucleotide polymorphism (NT_010194(LOXL1):g.45008784A>C) in the promoter of the LOXL1 gene, which is essential for elastin synthesis. Promoter studies showed that the minor "C'' allele had significantly greater activity than the major "A'' allele. Case-control studies examined the association of the alleles of this single nucleotide polymorphism with pelvic organ prolapse and preterm premature rupture of membranes. When comparing allele frequencies and genotypes in pelvic organ prolapse cases versus controls, no significant associations were found. A case-control study conducted in African American neonates also found no significant associations between the promoter alleles and preterm premature rupture of membranes. We conclude that a functional single nucleotide polymorphism exists in the promoter region of the LOXL1 gene. Association studies suggest that the promoter single nucleotide polymorphism does not contribute significantly to risk of pelvic organ prolapse or preterm premature rupture of membranes.

  10. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis. (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping


    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  11. Single nucleotide polymorphism array lesions, TET2, DNMT3A, ASXL1 and CBL mutations are present in systemic mastocytosis.

    Directory of Open Access Journals (Sweden)

    Fabiola Traina

    Full Text Available We hypothesized that analysis of single nucleotide polymorphism arrays (SNP-A and new molecular defects may provide new insight in the pathogenesis of systemic mastocytosis (SM. SNP-A karyotyping was applied to identify recurrent areas of loss of heterozygosity and bidirectional sequencing was performed to evaluate the mutational status of TET2, DNMT3A, ASXL1, EZH2, IDH1/IDH2 and the CBL gene family. Overall survival (OS was analyzed using the Kaplan-Meier method. We studied a total of 26 patients with SM. In 67% of SM patients, SNP-A karyotyping showed new chromosomal abnormalities including uniparental disomy of 4q and 2p spanning TET2/KIT and DNMT3A. Mutations in TET2, DNMT3A, ASXL1 and CBL were found in 23%, 12%, 12%, and 4% of SM patients, respectively. No mutations were observed in EZH2 and IDH1/IDH2. Significant differences in OS were observed for SM mutated patients grouped based on the presence of combined TET2/DNMT3A/ASXL1 mutations independent of KIT (P = 0.04 and sole TET2 mutations (P<0.001. In conclusion, TET2, DNMT3A and ASXL1 mutations are also present in mastocytosis and these mutations may affect prognosis, as demonstrated by worse OS in mutated patients.

  12. Single nucleotide polymorphism typing of Mycobacterium ulcerans reveals focal transmission of buruli ulcer in a highly endemic region of Ghana.

    Directory of Open Access Journals (Sweden)

    Katharina Röltgen

    Full Text Available Buruli ulcer (BU is an emerging necrotizing disease of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. While proximity to stagnant or slow flowing water bodies is a risk factor for acquiring BU, the epidemiology and mode of M. ulcerans transmission is poorly understood. Here we have used high-throughput DNA sequencing and comparisons of the genomes of seven M. ulcerans isolates that appeared monomorphic by existing typing methods. We identified a limited number of single nucleotide polymorphisms (SNPs and developed a real-time PCR SNP typing method based on these differences. We then investigated clinical isolates of M. ulcerans on which we had detailed information concerning patient location and time of diagnosis. Within the Densu river basin of Ghana we observed dominance of one clonal complex and local clustering of some of the variants belonging to this complex. These results reveal focal transmission and demonstrate, that micro-epidemiological analyses by SNP typing has great potential to help us understand how M. ulcerans is transmitted.

  13. Study on Association between Single Nucleotide Polymorphisms in Murine Double Minute 2 and Susceptibility of Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Xia Wang


    Full Text Available Objective: To investigate the relationship between single nucleotide polymorphisms (SNP in murine double minute 2 (MDM2 and susceptibility and biological behavior of hepatocellularcarcinoma (HCC. Methods: MDM2 (rs2279744 site polymorphism in peripheral blood from 166 patients with HCC and 157 healthy controls were detected by SYBR GREEN PCR method and the relationship between MDM2 polymorphism and susceptibility and biological behavior of HCC was analyzed by comparing the differences of genotypes in two populations. Results: There was no statistical significance between two groups in terms of MDM2 allele distribution in research population (P = 0.753. The risk of HCC onset in individuals with GG+ TG genotype was 1.698 times of those with TT genotype in case group (95%CI = 1.027 -2.808. MDM2 SNP was associated with HBV infection and the degree of tumor differentiation (P< 0.05. The incidence of alleles in experimental group (T, 0.49; G, 0.51 was very different from that in control group (T, 0.59; G, 0.41 (P = 0.015. The incidence of GG genotype in patients with HCC (22.29% was significantly higher than those without HCC (13.38%. Compared with TT genotype, G allele or GG genotype had more correlation with HCC onset. Conclusion: Compared with TT genotype, MDM2 promoter SNP309 G allele or GG genotype is more associated with HCC onset in Chinese population.

  14. Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP Array

    Directory of Open Access Journals (Sweden)

    Qian You


    Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

  15. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    Directory of Open Access Journals (Sweden)

    Mônica Barcellos Arruda

    Full Text Available Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs, and 8 to protease inhibitors (PIs containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001, while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009. Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  16. Glu504Lys Single Nucleotide Polymorphism of Aldehyde Dehydrogenase 2 Gene and the Risk of Human Diseases

    Directory of Open Access Journals (Sweden)

    Yan Zhao


    Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.

  17. Single Nucleotide Polymorphisms of the GJB2 and GJB6 Genes Are Associated with Autosomal Recessive Nonsyndromic Hearing Loss

    Directory of Open Access Journals (Sweden)

    Ana Paula Grillo


    Full Text Available Single nucleotide polymorphisms (SNPs are important markers in many studies that link DNA sequence variations to phenotypic changes; such studies are expected to advance the understanding of human physiology and elucidate the molecular basis of diseases. The DFNB1 locus, which contains the GJB2 and GJB6 genes, plays a key role in nonsyndromic hearing loss. Previous studies have identified important mutations in this locus, but the contribution of SNPs in the genes has not yet been much investigated. The aim of this study was to investigate the association of nine polymorphisms located within the DFNB1 locus with the occurrence of autosomal recessive nonsyndromic hearing loss (ARNSHL. The SNPs rs3751385 (C/T, rs7994748 (C/T, rs7329857 (C/T, rs7987302 (G/A, rs7322538 (G/A, rs9315400 (C/T, rs877098 (C/T, rs945369 (A/C, and rs7333214 (T/G were genotyped in 122 deaf patients and 132 healthy controls using allele-specific PCR. There were statistically significant differences between patients and controls, in terms of allelic frequencies in the SNPs rs3751385, rs7994748, rs7329857, rs7987302, rs945369, and rs7333214 (P<0.05. No significant differences between the two groups were observed for rs7322538, rs9315400, and rs877098. Our results suggest that SNPs present in the GJB2 and GJB6 genes may have an influence on ARNSHL in humans.

  18. De novo Genome Assembly and Single Nucleotide Variations for Soybean Mosaic Virus Using Soybean Seed Transcriptome Data

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo


    Full Text Available Soybean is the most important legume crop in the world. Several diseases in soybean lead to serious yield losses in major soybean-producing countries. Moreover, soybean can be infected by diverse viruses. Recently, we carried out a large-scale screening to identify viruses infecting soybean using available soybean transcriptome data. Of the screened transcriptomes, a soybean transcriptome for soybean seed development analysis contains several virus-associated sequences. In this study, we identified five viruses, including soybean mosaic virus (SMV, infecting soybean by de novo transcriptome assembly followed by blast search. We assembled a nearly complete consensus genome sequence of SMV China using transcriptome data. Based on phylogenetic analysis, the consensus genome sequence of SMV China was closely related to SMV isolates from South Korea. We examined single nucleotide variations (SNVs for SMVs in the soybean seed transcriptome revealing 780 SNVs, which were evenly distributed on the SMV genome. Four SNVs, C-U, U-C, A-G, and G-A, were frequently identified. This result demonstrated the quasispecies variation of the SMV genome. Taken together, this study carried out bioinformatics analyses to identify viruses using soybean transcriptome data. In addition, we demonstrated the application of soybean transcriptome data for virus genome assembly and SNV analysis.

  19. Landscape genomics and biased FST approaches reveal single nucleotide polymorphisms under selection in goat breeds of North-East Mediterranean

    Directory of Open Access Journals (Sweden)

    Joost Stephane


    Full Text Available Abstract Background In this study we compare outlier loci detected using a FST based method with those identified by a recently described method based on spatial analysis (SAM. We tested a panel of single nucleotide polymorphisms (SNPs previously genotyped in individuals of goat breeds of southern areas of the Mediterranean basin (Italy, Greece and Albania. We evaluate how the SAM method performs with SNPs, which are increasingly employed due to their high number, low cost and easy of scoring. Results The combined use of the two outlier detection approaches, never tested before using SNP polymorphisms, resulted in the identification of the same three loci involved in milk and meat quality data by using the two methods, while the FST based method identified 3 more loci as under selection sweep in the breeds examined. Conclusion Data appear congruent by using the two methods for FST values exceeding the 99% confidence limits. The methods of FST and SAM can independently detect signatures of selection and therefore can reduce the probability of finding false positives if employed together. The outlier loci identified in this study could indicate adaptive variation in the analysed species, characterized by a large range of climatic conditions in the rearing areas and by a history of intense trade, that implies plasticity in adapting to new environments.

  20. Gene therapy for the circumvention of inborn errors of metabolism (IEM) caused by single-nucleotide-polymorphisms (SNPs). (United States)

    Wiseman, Alan


    Single nucleotide polymorphisms (SNPs) are the result of point mutations in nuclear (and mitochondrial) DNA. Such localised damage to DNA (and its replicative mechanisms) may not be excised fully by the DNA repair mechanism in the genome: and therefore can become inheritable; subsequently to manifest later as an inborn error of metabolism (IEM). Causes of mutagenic damage to the DNA can include background radiation (such as emitted by radon gas), and by reactive oxygen species (ROS): and also by mutagenic chemicals that occur naturally (inter alia in the diet). Other causes of DNA damage are variable environmental hazards such as solar-derived short wave ultraviolet light A. Gene therapy involves the placement of missing genes into particular tissues by the harnessing of suitable vectors (originally these were animal viruses such as SV40). For example, gene therapy in the rat for diabetes has succeeded by liver-production of insulin (using genes obtained from pancreatic Islets of Langerhans cells). Many inborn errors of metabolism could be treated in this way: examples may include 100 haemoglobinopathies (such as sickle cell anaemia), phenylketonuria; and other diseases caused by lack of tissue-production of a particular enzyme (in its catalytically-active conformation).

  1. A Caenorhabditis elegans wild type defies the temperature-size rule owing to a single nucleotide polymorphism in tra-3.

    Directory of Open Access Journals (Sweden)

    Jan E Kammenga


    Full Text Available Ectotherms rely for their body heat on surrounding temperatures. A key question in biology is why most ectotherms mature at a larger size at lower temperatures, a phenomenon known as the temperature-size rule. Since temperature affects virtually all processes in a living organism, current theories to explain this phenomenon are diverse and complex and assert often from opposing assumptions. Although widely studied, the molecular genetic control of the temperature-size rule is unknown. We found that the Caenorhabditis elegans wild-type N2 complied with the temperature-size rule, whereas wild-type CB4856 defied it. Using a candidate gene approach based on an N2 x CB4856 recombinant inbred panel in combination with mutant analysis, complementation, and transgenic studies, we show that a single nucleotide polymorphism in tra-3 leads to mutation F96L in the encoded calpain-like protease. This mutation attenuates the ability of CB4856 to grow larger at low temperature. Homology modelling predicts that F96L reduces TRA-3 activity by destabilizing the DII-A domain. The data show that size adaptation of ectotherms to temperature changes may be less complex than previously thought because a subtle wild-type polymorphism modulates the temperature responsiveness of body size. These findings provide a novel step toward the molecular understanding of the temperature-size rule, which has puzzled biologists for decades.

  2. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing. (United States)

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc


    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  3. A Genome Wide Association Study on Age at First Calving Using High Density Single Nucleotide Polymorphism Chips in Hanwoo (

    Directory of Open Access Journals (Sweden)

    K.-E. Hyeong


    Full Text Available Age at first calving is an important trait for achieving earlier reproductive performance. To detect quantitative trait loci (QTL for reproductive traits, a genome wide association study was conducted on the 96 Hanwoo cows that were born between 2008 and 2010 from 13 sires in a local farm (Juk-Am Hanwoo farm, Suncheon, Korea and genotyped with the Illumina 50K bovine single nucleotide polymorphism (SNP chips. Phenotypes were regressed on additive and dominance effects for each SNP using a simple linear regression model after the effects of birth-year-month and polygenes were considered. A forward regression procedure was applied to determine the best set of SNPs for age at first calving. A total of 15 QTL were detected at the comparison-wise 0.001 level. Two QTL with strong statistical evidence were found at 128.9 Mb and 111.1 Mb on bovine chromosomes (BTA 2 and 7, respectively, each of which accounted for 22% of the phenotypic variance. Also, five significant SNPs were detected on BTAs 10, 16, 20, 26, and 29. Multiple QTL were found on BTAs 1, 2, 7, and 14. The significant QTLs may be applied via marker assisted selection to increase rate of genetic gain for the trait, after validation tests in other Hanwoo cow populations.

  4. Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation (United States)

    Thomas, Laurent F.; Sætrom, Pål


    Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

  5. Identification of novel single nucleotide polymorphisms (SNPs in deer (Odocoileus spp. using the BovineSNP50 BeadChip.

    Directory of Open Access Journals (Sweden)

    Gwilym D Haynes

    Full Text Available Single nucleotide polymorphisms (SNPs are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer and O. virginianus (white-tailed deer in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068 were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878 and loci under selection (n = 190 were identified with the F(ST-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present.

  6. No association between a common single nucleotide polymorphism, rs4141463, in the MACROD2 gene and autism spectrum disorder. (United States)

    Curran, Sarah; Bolton, Patrick; Rozsnyai, Kinga; Chiocchetti, Andreas; Klauck, Sabine M; Duketis, Eftichia; Poustka, Fritz; Schlitt, Sabine; Freitag, Christine M; Lee, Irene; Muglia, Pierandrea; Poot, Martin; Staal, Wouter; de Jonge, Maretha V; Ophoff, Roel A; Lewis, Cathryn; Skuse, David; Mandy, Will; Vassos, Evangelos; Fossdal, Ragnheidur; Magnusson, Páll; Hreidarsson, Stefan; Saemundsen, Evald; Stefansson, Hreinn; Stefansson, Kari; Collier, David


    The Autism Genome Project (AGP) Consortium recently reported genome-wide significant association between autism and an intronic single nucleotide polymorphism marker, rs4141463, within the MACROD2 gene. In the present study we attempted to replicate this finding using an independent case-control design of 1,170 cases with autism spectrum disorder (ASD) (874 of which fulfilled narrow criteria for Autism (A)) from five centers within Europe (UK, Germany, the Netherlands, Italy, and Iceland), and 35,307 controls. The combined sample size gave us a non-centrality parameter (NCP) of 11.9, with 93% power to detect allelic association of rs4141463 at an alpha of 0.05 with odds ratio of 0.84 (the best odds ratio estimate of the AGP Consortium data), and for the narrow diagnosis of autism, an NCP of 8.9 and power of 85%. Our case-control data were analyzed for association, stratified by each center, and the summary statistics were combined using the meta-analysis program, GWAMA. This resulted in an odds ratio (OR) of 1.03 (95% CI 0.944-1.133), with a P-value of 0.5 for ASD and OR of 0.99 (95% CI 0.88-1.11) with P-value = 0.85 for the Autism (A) sub-group. Therefore, this study does not provide support for the reported association between rs4141463 and autism. Copyright © 2011 Wiley-Liss, Inc.

  7. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA). (United States)

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza


    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  8. Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging. (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei


    DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

  9. Single nucleotide polymorphisms typing of Mycobacterium leprae reveals focal transmission of leprosy in high endemic regions of India. (United States)

    Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U


    Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  10. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method. (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan


    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  11. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types (United States)

    Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto


    Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663

  12. Genetic homogeneity of the invasive lionfish across the Northwestern Atlantic and the Gulf of Mexico based on Single Nucleotide Polymorphisms. (United States)

    Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F


    Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.

  13. Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio


    Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

  14. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  15. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome. (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki


    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  16. Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera. (United States)

    Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S


    Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

  17. Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola. (United States)

    Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin


    Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

  18. A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians. (United States)

    Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I


    Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

  19. Association analysis of two single-nucleotide polymorphisms of the RELN gene with autism in the South African population

    KAUST Repository

    Sharma, Jyoti Rajan


    Background: Autism (MIM209850) is a neurodevelopmental disorder characterized by a triad of impairments, namely impairment in social interaction, impaired communication skills, and restrictive and repetitive behavior. A number of family and twin studies have demonstrated that genetic factors play a pivotal role in the etiology of autistic disorder. Various reports of reduced levels of reelin protein in the brain and plasma in autistic patients highlighted the role of the reelin gene (RELN) in autism. There is no such published study on the South African (SA) population. Aims: The aim of the present study was to find the genetic association of intronic rs736707 and exonic rs362691 (single-nucleotide polymorphisms [SNPs] of the RELN gene) with autism in a SA population. Methods: Genomic DNA was isolated from cheek cell swabs from autistic (136) as well as control (208) subjects. The TaqMan ® Real-Time polymerase chain reaction and genotyping assay was utilized to determine the genotypes. Results: A significant association of SNP rs736707, but not for SNP rs362691, with autism in the SA population is observed. Conclusion: There might be a possible role of RELN in autism, especially for SA populations. The present study represents the first report on genetic association studies on the RELN gene in the SA population. © 2013, Mary Ann Liebert, Inc.

  20. Single nucleotide polymorphism in IL1B is associated with infection risk in paediatric acute myeloid leukaemia. (United States)

    Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D


    We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  1. TET2, ASXL1, IDH1, and IDH2 Single Nucleotide Polymorphisms in Turkish Patients with Chronic Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Nur Soyer


    Full Text Available We aimed to determine the genotype distribution, allele frequency, and prognostic impact of IDH1/2, TET2, and ASXL1 single nucleotide polymorphisms (SNPs in myeloproliferative neoplasms (MPNs. TET2 (rs763480, ASXL1 (rs2208131, and IDH1 (rs11554137 variant homozygous genotype frequencies were found at rates of 1.5%, 9.2%, and 2.3%, respectively. No IDH2 SNP was identified. IDH1 and TET2 frequencies were 5% in essential thrombocythemia (ET and 1.7% in ET and 5% in primary myelofibrosis (PMF, respectively. ASXL1 frequencies were 8.3%-10% in MPN subgroups. The TET2 mutant allele T and ASXL1 mutant allele G had the highest frequencies with 0.272 in the PMF and 0.322 in the polycythemia vera (PV group, respectively. There was no impact of the SNPs on prognosis. IDH1 frequency in MPNs was found similar to the literature. ASXL1 frequencies were similar between ET, PV, and PMF patients. The ASXL1 and TET2 allele frequencies of the Turkish population are similar to those of the European population. The role of SNPs in MPNs might be further evaluated in larger multicenter studies.

  2. Previously Unidentified Single Nucleotide Polymorphisms in HIV/AIDS Cases Associate with Clinical Parameters and Disease Progression

    Directory of Open Access Journals (Sweden)

    Vladimir V. Anokhin


    Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.

  3. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    Directory of Open Access Journals (Sweden)

    Linda S. Pescatello


    Full Text Available The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT. The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years, healthy men (42% and women (58% that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  4. Multiple thrombophilic single nucleotide polymorphisms lack a significant effect on outcomes in fresh IVF cycles: an analysis of 1717 patients. (United States)

    Patounakis, George; Bergh, Eric; Forman, Eric J; Tao, Xin; Lonczak, Agnieszka; Franasiak, Jason M; Treff, Nathan; Scott, Richard T


    The aim of the study is to determine if thrombophilic single nucleotide polymorphisms (SNPs) affect outcomes in fresh in vitro fertilization (IVF) cycles in a large general infertility population. A prospective cohort analysis was performed at a university-affiliated private IVF center of female patients undergoing fresh non-donor IVF cycles. The effect of the following thrombophilic SNPs on IVF outcomes were explored: factor V (Leiden and H1299R), prothrombin (G20210A), factor XIII (V34L), β-fibrinogen (-455G → A), plasminogen activator inhibitor-1 (4G/5G), human platelet antigen-1 (a/b9L33P), and methylenetetrahydrofolate reductase (C677T and A1298C). The main outcome measures included positive pregnancy test, clinical pregnancy, embryo implantation, live birth, and pregnancy loss. Patients (1717) were enrolled in the study, and a total of 4169 embryos were transferred. There were no statistically significant differences in positive pregnancy test, clinical pregnancy, embryo implantation, live birth, or pregnancy loss in the analysis of 1717 patients attempting their first cycle of IVF. Receiver operator characteristics and logistic regression analyses showed that outcomes cannot be predicted by the cumulative number of thrombophilic mutations present in the patient. Individual and cumulative thrombophilic SNPs do not affect IVF outcomes. Therefore, initial screening for these SNPs is not indicated.

  5. A comprehensive experiment for molecular biology: Determination of single nucleotide polymorphism in human REV3 gene using PCR-RFLP. (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui


    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  6. High performance computing enabling exhaustive analysis of higher order single nucleotide polymorphism interaction in Genome Wide Association Studies. (United States)

    Goudey, Benjamin; Abedini, Mani; Hopper, John L; Inouye, Michael; Makalic, Enes; Schmidt, Daniel F; Wagner, John; Zhou, Zeyu; Zobel, Justin; Reumann, Matthias


    Genome-wide association studies (GWAS) are a common approach for systematic discovery of single nucleotide polymorphisms (SNPs) which are associated with a given disease. Univariate analysis approaches commonly employed may miss important SNP associations that only appear through multivariate analysis in complex diseases. However, multivariate SNP analysis is currently limited by its inherent computational complexity. In this work, we present a computational framework that harnesses supercomputers. Based on our results, we estimate a three-way interaction analysis on 1.1 million SNP GWAS data requiring over 5.8 years on the full "Avoca" IBM Blue Gene/Q installation at the Victorian Life Sciences Computation Initiative. This is hundreds of times faster than estimates for other CPU based methods and four times faster than runtimes estimated for GPU methods, indicating how the improvement in the level of hardware applied to interaction analysis may alter the types of analysis that can be performed. Furthermore, the same analysis would take under 3 months on the currently largest IBM Blue Gene/Q supercomputer "Sequoia" at the Lawrence Livermore National Laboratory assuming linear scaling is maintained as our results suggest. Given that the implementation used in this study can be further optimised, this runtime means it is becoming feasible to carry out exhaustive analysis of higher order interaction studies on large modern GWAS.

  7. A single nucleotide polymorphism in the dimethylarginine dimethylaminohydrolase gene is associated with lower risk of pulmonary hypertension in bronchopulmonary dysplasia (United States)

    Trittmann, JK; Gastier-Foster, JM; Zmuda, EJ; Frick, J; Rogers, LK; Vieland, VJ; Chicoine, LG; Nelin, LD


    Aim Pulmonary hypertension (PH) develops in 25–40% of bronchopulmonary dysplasia (BPD) patients, substantially increasing mortality. We have previously found that asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide (NO) production, is elevated in patients with BPD-associated PH. ADMA is metabolized by NG,NG- dimethylarginine dimethylaminohydrolase (DDAH). Presently, we test the hypothesis that there are single nucleotide polymorphisms (SNPs) in DDAH1 and/or DDAH2 associated with the development of PH in BPD patients. Methods BPD patients were enrolled (n=98) at Nationwide Children’s Hospital. Clinical characteristics and 36 SNPs in DDAH1 and DDAH2 were compared between BPD-associated PH patients (cases) and BPD-alone patients (controls). Results In BPD patients, 25 (26%) had echocardiographic evidence of PH (cases). In this cohort, DDAH1 wildtype rs480414 was 92% sensitive and 53% specific for PH in BPD, and the DDAH1 SNP rs480414 decreased the risk of PH in an additive model of inheritance (OR=0.39; 95% CI [0.18–0.88], p=0.01). Conclusion The rs480414 SNP in DDAH1 may be protective against the development of PH in patients with BPD. Furthermore, the DDAH1 rs480414 may be a useful biomarker in developing predictive models for PH in patients with BPD. PMID:26663142

  8. Association between Single Nucleotide Polymorphism rs1044925 and the Risk of Coronary Artery Disease and Ischemic Stroke

    Directory of Open Access Journals (Sweden)

    Dong-Feng Wu


    Full Text Available The present study was performed to clarify the association between the acyl-CoA:cholesterol acyltransferase-1 (ACAT-1 single nucleotide polymorphism (SNP rs1044925 and the risk of coronary artery disease (CAD and ischemic stroke (IS in the Guangxi Han population. Polymerase chain reaction and restriction fragment length polymorphism was performed to determine the genotypes of the ACAT-1 SNP rs1044925 in 1730 unrelated subjects (CAD, 587; IS, 555; and healthy controls; 588. The genotypic and allelic frequencies of rs1044925 were significantly different between the CAD patients and controls (p = 0.015 and borderline different between the IS patients and controls (p = 0.05. The AC/CC genotypes and C allele were associated with a decreased risk of CAD and IS (CAD: p = 0.014 for AC/CC vs. AA, p = 0.022 for C vs. A; IS: p = 0.014 for AC/CC vs. AA; p = 0.017 for C vs. A. The AC/CC genotypes in the healthy controls, but not in CAD or IS patients, were associated with an increased serum high-density lipoprotein cholesterol (HDL-C concentration. The present study shows that the C allele carriers of ACAT-1 rs1044925 were associated with an increased serum HDL-C level in the healthy controls and decreased risk in CAD and IS patients.

  9. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children. (United States)

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał


    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p caries occurrence in Polish children.

  10. Identification of field caught Anopheles gambiae s.s. and Anopheles arabiensis by TaqMan single nucleotide polymorphism genotyping

    Directory of Open Access Journals (Sweden)

    Bayoh Nabie M


    Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.

  11. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii. (United States)

    McAllister, Christine A; Miller, Allison J


    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  12. Single nucleotide polymorphisms in the PRDX3 and RPS19 and risk of HPV persistence and cervical precancer/cancer.

    Directory of Open Access Journals (Sweden)

    Mahboobeh Safaeian

    Full Text Available Host genetic factors might affect the risk of progression from infection with carcinogenic human papillomavirus (HPV, the etiologic agent for cervical cancer, to persistent HPV infection, and hence to cervical precancer and cancer.We assessed 18,310 tag single nucleotide polymorphisms (SNPs from 1113 genes in 416 cervical intraepithelial neoplasia 3 (CIN3/cancer cases, 356 women with persistent carcinogenic HPV infection (median persistence of 25 months and 425 randomly selected women (non-cases and non-HPV persistent from the 10,049 women from the Guanacaste, Costa Rica HPV natural history cohort. For gene and SNP associations, we computed age-adjusted odds ratio and p-trend. Three comparisons were made: 1 association with CIN3/cancer (compared CIN3/cancer cases to random controls, 2 association with persistence (compared HPV persistence to random controls, and 3 progression (compared CIN3/cancers with HPV-persistent group. Regions statistically significantly associated with CIN3/cancer included genes for peroxiredoxin 3 PRDX3, and ribosomal protein S19 RPS19. The single most significant SNPs from each gene associated with CIN3/cancer were PRDX3 rs7082598 (P(trend<0.0001, and RPS19 rs2305809 (P(trend=0.0007, respectively. Both SNPs were also associated with progression.These data suggest involvement of two genes, RSP19 and PRDX3, or other SNPs in linkage disequilibrium, with cervical cancer risk. Further investigation showed that they may be involved in both the persistence and progression transition stages. Our results require replication but, if true, suggest a role for ribosomal dysfunction, mitochondrial processes, and/or oxidative stress, or other unknown function of these genes in cervical carcinogenesis.

  13. A Single Nucleotide Polymorphism in the Bax Gene Promoter Affects Transcription and Influences Retinal Ganglion Cell Death

    Directory of Open Access Journals (Sweden)

    Sheila J Semaan


    Full Text Available Pro-apoptotic Bax is essential for RGC (retinal ganglion cell death. Gene dosage experiments in mice, yielding a single wild-type Bax allele, indicated that genetic background was able to influence the cell death phenotype. DBA/2J Bax+/− mice exhibited complete resistance to nerve damage after 2 weeks (similar to Bax −/− mice, but 129B6 Bax+/− mice exhibited significant cell loss (similar to wild-type mice. The different cell death phenotype was associated with the level of Bax expression, where 129B6 neurons had twice the level of endogenous Bax mRNA and protein as DBA/2J neurons. Sequence analysis of the Bax promoters between these strains revealed a single nucleotide polymorphism (T129B6 to CDBA/2J at position −515. A 1.5- to 2.5-fold increase in transcriptional activity was observed from the 129B6 promoter in transient transfection assays in a variety of cell types, including RGC5 cells derived from rat RGCs. Since this polymorphism occurred in a p53 half-site, we investigated the requirement of p53 for the differential transcriptional activity. Differential transcriptional activity from either 129B6 or DBA/2J Bax promoters were unaffected in p53−/− cells, and addition of exogenous p53 had no further effect on this difference, thus a role for p53 was excluded. Competitive electrophoretic mobility-shift assays identified two DNA-protein complexes that interacted with the polymorphic region. Those forming Complex 1 bound with higher affinity to the 129B6 polymorphic site, suggesting that these proteins probably comprised a transcriptional activator complex. These studies implicated quantitative expression of the Bax gene as playing a possible role in neuronal susceptibility to damaging stimuli.

  14. [Single nucleotide polymorphisms of HIV coreceptor CCR5 gene in Chinese Yi ethnic group and its association with HIV infection]. (United States)

    Ma, Li-ying; Hong, Kun-xue; Lu, Xiao-zhi; Qin, Guang-ming; Chen, Jian-ping; Chen, Kang-lin; Ruan, Yu-hua; Xing, Hui; Zhu, Jia-hong; Shao, Yi-ming


    To investigate the single nucleotide polymorphism (SNP) of HIV-1 coreceptor CCR5 gene in Chinese Yi ethnic group and the association between these SNPs and HIV/AIDS. Peripheral blood samples of 102 HIV negative persons of Chinese Yi nationality, 87 males amd 15 females, aged 23 (12-37), and 68 HIV carriers, 61 males and 7 females, aged 27 (17-51). The regulatory and structural regions of the HIV coreceptor CCR5 gene were amplified from the genomic DNA by nested PCR, each of the two regions was divided into three gene fragments which were overlapped. High throughput DHPLC was used for screening of unknown mutations in each gene fragment. The PCR products showing different peak traces from wild types in DHPLC were sequenced by forward and reverse primers respectively. The sequences were analyzed with the help of Sequence Navigator software to search for SNP loci. Statistical analysis by SPSS and PPAP softwares were made to study the association between these SNPs and HIV infection. Five SNPs (A77G, G316A, T532C, C921T, and G668A) and a AGA deletion of the 686-688 nucleotides were discovered in the coding region of this gene in Chinese Yi ethnic group. C921T mutation was a nonsense mutation, and the other SNPs (A77G, G316A, T532C, and G668A) are sense mutation, with the amino acid changes of K26R, G106R, C178R, and R223Q. Only the frequency of R223Q allelic gene was high (0.08) but those of the others were low (less than 0.01). There was no significant difference in the allele frequency between the HIV negative and HIV positive groups (all P > 0.05). Five SNP loci (T58934G, G59029A, T59353C, G59402A, and C59653T) were found in the regulatory region of CCR5 gene with high allelic frequencies of 0.1912-0.2941. Between the HIV negative and HIV positive groups, there were no differences in the SNP loc (all P > 0.05). Statistical analysis of the association between the linkage of mutation loci with HIV infection suggested a significant difference in the haplotype frequency

  15. Genetic analysis of the cardiac methylome at single nucleotide resolution in a model of human cardiovascular disease.

    Directory of Open Access Journals (Sweden)

    Michelle D Johnson


    Full Text Available Epigenetic marks such as cytosine methylation are important determinants of cellular and whole-body phenotypes. However, the extent of, and reasons for inter-individual differences in cytosine methylation, and their association with phenotypic variation are poorly characterised. Here we present the first genome-wide study of cytosine methylation at single-nucleotide resolution in an animal model of human disease. We used whole-genome bisulfite sequencing in the spontaneously hypertensive rat (SHR, a model of cardiovascular disease, and the Brown Norway (BN control strain, to define the genetic architecture of cytosine methylation in the mammalian heart and to test for association between methylation and pathophysiological phenotypes. Analysis of 10.6 million CpG dinucleotides identified 77,088 CpGs that were differentially methylated between the strains. In F1 hybrids we found 38,152 CpGs showing allele-specific methylation and 145 regions with parent-of-origin effects on methylation. Cis-linkage explained almost 60% of inter-strain variation in methylation at a subset of loci tested for linkage in a panel of recombinant inbred (RI strains. Methylation analysis in isolated cardiomyocytes showed that in the majority of cases methylation differences in cardiomyocytes and non-cardiomyocytes were strain-dependent, confirming a strong genetic component for cytosine methylation. We observed preferential nucleotide usage associated with increased and decreased methylation that is remarkably conserved across species, suggesting a common mechanism for germline control of inter-individual variation in CpG methylation. In the RI strain panel, we found significant correlation of CpG methylation and levels of serum chromogranin B (CgB, a proposed biomarker of heart failure, which is evidence for a link between germline DNA sequence variation, CpG methylation differences and pathophysiological phenotypes in the SHR strain. Together, these results will

  16. Intrinsic magnetism of a series of Co substituted ZnO single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Lv Peiwen [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Huang Feng [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chu Wangsheng [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China); Lin Zhang [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chen Dagui [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Li Wei [Laboratory of Materials Chemistry and Physics, Fujian Institute of Research on the Structure of Matter, National Engineering Research Center for Optoelectronic Crystalline Materials, Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Chen Dongliang [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China); Wu Ziyu [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, Chinese Academy of Sciences, 100049 Beijing (China)


    Magnetic properties of a series of well-substituted Zn{sub 1-x}Co{sub x}O (x = 0.018,0.036 and 0.05) single crystals were studied. A typical paramagnetic anisotropy property, which strengthens when x decreases, was found. A magnetization step was observed at 2 K when the magnetic field is parallel to the c axis, indicating that paramagnetic anisotropy is the origin of the strong crystal field effect on Co{sup 2+} ions in ZnO lattices. The Co{sup 2+} single-ion anisotropy parameter 2D is obtained as 7.5 K. The effective moment of Co{sup 2+} takes the values 2.7 {mu}{sub B}, 1.82 {mu}{sub B}, 1.49 {mu}{sub B} when x = 0.018, 0.036 and 0.05, revealing that more antiferromagnetic coupling between Co{sup 2+} ions arises in the perfect crystal when x increases.

  17. Effects of four single nucleotide polymorphisms of EZH2 on cancer risk: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Ling Z


    Full Text Available Zhixin Ling,1,2,* Zonghao You,1,2,* Ling Hu,3 Lei Zhang,1,2 Yiduo Wang,1,2 Minhao Zhang,1,2 Guangyuan Zhang,1,2 Shuqiu Chen,1,2 Bin Xu,1,2 Ming Chen1,2 1Department of Urology, Affiliated Zhongda Hospital of Southeast University, Nanjing, China; 2Surgical Research Center, Institute of Urology, Medical School of Southeast University, Nanjing, China; 3Department of Nephrology, People’s Hospital of Wuxi City, Wuxi, China *These authors contributed equally to this work Background: Although the relationship between several single nucleotide polymorphisms (SNPs of the oncogene EZH2 and cancer risk has been assessed by some case–control studies, results of subsequent studies are controversial. Sample sizes from single-center studies are also limited, thereby providing unreliable findings. Hence, we conducted a comprehensive search and meta-analysis to evaluate the associations between EZH2 SNPs and cancer risk.Materials and methods: A comprehensive literature search for studies focusing on EZH2 SNPs and cancer risk was conducted on PubMed, Web of Science, Embase, and China National Knowledge Infrastructure online databases. Genotype data were extracted and examined through a meta-analysis, and pooled odds ratios (ORs with 95% CIs were used to assess the corresponding associations. Sensitivity analysis, publication bias assessment, and heterogeneity test were performed using STATA 12.0.Results: Twelve eligible studies were included in this meta-analysis. The association of 4 SNPs, namely, rs887569, rs2302427, rs3757441, and rs41277434, in the EZH2 locus with cancer risk was evaluated. Five studies (1,794 cases and 1,878 controls indicated that rs887569 was related to a decreased cancer risk (CTTT/CC: OR =0.849, 95% CI: [0.740 to 0.973], P=0.019; TT/CCCT: OR =0.793, 95% CI: [0.654 to 0.962], P=0.019. Seven studies (2,408 cases and 2,910 controls showed that rs2302427 was linked to a decreased cancer risk (GG/CC: OR =0.562, 95% CI: [0.400 to 0.792], P

  18. The superconducting gaps of C-substituted and Al-substituted MgB2 single crystals by point-contact spectroscopy

    International Nuclear Information System (INIS)

    Daghero, D.; Gonnelli, R.S.; Ummarino, G.A.; Calzolari, A.; Dellarocca, Valeria; Stepanov, V.A.; Zhigadlo, N.; Kazakov, S.M.; Karpinski, J.


    We studied the effects of carbon and aluminum substitutions on the gaps of the two-band superconductor MgB 2 by means of point-contact measurements in Mg(B 1-x C x ) 2 and Mg 1-y Al y B 2 single crystals with 0≤x≤0.132 and 0≤y≤0.21. The gap amplitudes, Δ ω and Δ π , were determined by fitting the conductance curves of the point contacts with the standard Blonder-Tinkham-Klapwijk (BTK) model generalized to the two-band case. Whenever possible, their values were confirmed by the independent fit (with a single-band BTK model) of the partial contribution of the two bands to the conductance, separated by means of a suitable magnetic field B*. In C-substituted crystals, the two gaps remain clearly distinct up to x∝0.10, but at x=0.132 we observed for the first time their merging into a single gap Δ≅3 meV with a gap ratio 2Δ=k B T c close to the standard BCS value. In Al-substituted crystals, we found no evidence of this gap merging. Instead, Δ π reaches the value 0.4 meV at y=0.21, where Δ π saturates at about 4 meV. These results are compared with other recent experimental findings in polycrystals and with the predictions of the models for multiband superconductivity. (copyright 2005 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng


    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  20. Analysis of single nucleotide polymorphisms of CRYGA and CRYGB genes in control population of western Indian origin

    Directory of Open Access Journals (Sweden)

    Kapur Suman


    Full Text Available Aim: Polymorphisms in γ-crystallins ( CRYG can serve as markers for lens differentiation and eye disorders leading to cataract. Several investigators have reported the presence of sequence variations within crystallin genes, with or without apparent effects on the function of the proteins both in mice and humans. Delineation of these polymorphic sites may explain the differences observed in the susceptibility to cataract observed among various ethnic groups. An easier Restriction Fragment Length Polymorphism (RFLP-based method has been used to detect the frequency of four single nucleotide polymorphisms (SNPs in CRYGA / CRYGB genes in control subjects of western Indian origin. Materials and Methods: A total of 137 healthy volunteers from western India were studied. Examination was performed to exclude volunteers with any ocular defects. Polymerase chain reaction (PCR-RFLP based method was developed for genotyping of G198A (Intron A, T196C (Exon 3 of CRYGA and T47C (Promoter, G449T (Exon 2 of CRYGB genes. Results: The exonic SNPs in CRYGA and CRYGB were found to have an allele frequency 0.03 and 1.00 for ancestral allele respectively, while frequency of non-coding SNP in CRYGA was 0.72. Allele frequency of T90C of CRYGB varied significantly ( P = 0.02 among different age groups. An in-silico analysis reveals that this sequence variation in CRYGB promoter impacts the binding of two transcription factors, ACE2 (Member of CLB2 cluster and Progesterone Receptor (PR which may impact the expression of CRYGB gene. Conclusions: This study establishes baseline frequency data for four SNPs in CRYGA and CRYGB genes for future case control studies on the role of these SNPs in the genetic basis of cataract.

  1. Replication of endometriosis-associated single-nucleotide polymorphisms from genome-wide association studies in a Caucasian population. (United States)

    Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H


    Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation

  2. A study of possible associations between single nucleotide polymorphisms in the estrogen receptor 2 gene and female sexual desire. (United States)

    Gunst, Annika; Jern, Patrick; Westberg, Lars; Johansson, Ada; Salo, Benny; Burri, Andrea; Spector, Tim; Eriksson, Elias; Sandnabba, N Kenneth; Santtila, Pekka


    Female sexual desire and arousal problems have been shown to have a heritable component of moderate size. Previous molecular genetic studies on sexual desire have mainly focused on genes associated with neurotransmitters such as dopamine and serotonin. Nevertheless, there is reason to believe that hormones with more specific functions concerning sexuality could have an impact on sexual desire and arousal. The aim of the present study was to investigate the possible effects of 17 single nucleotide polymorphisms (SNPs) located in estrogen receptor genes on female sexual desire and subjective and genital arousal (lubrication). Based on previous research, we hypothesized that ESR1 and ESR2 are relevant genes that contribute to female sexual desire and arousal. The desire, arousal, and lubrication subdomains of the Female Sexual Function Index self-report questionnaire were used. The present study involved 2,448 female twins and their sisters aged 18-49 who had submitted saliva samples for genotyping. The participants were a subset from a large-scale, population-based sample. We found nominally significant main effects on sexual desire for three ESR2 -linked SNPs when controlled for anxiety, suggesting that individuals homozygous for the G allele of the rs1271572 SNP, and the A allele of the rs4986938 and rs928554 SNPs had lower levels of sexual desire. The rs4986938 SNP also had a nominally significant effect on lubrication. No effects for any of the SNPs on subjective arousal could be detected. The number of nominally significant results for SNPs in the ESR2 gene before correcting for multiple testing suggests that further studies on the possible influence of this gene on interindividual variation in female sexual functioning are warranted. In contrast, no support for an involvement of ESR1 was obtained. Our results should be interpreted with caution until replicated in independent, large samples. © 2014 International Society for Sexual Medicine.

  3. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  4. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene. (United States)

    Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena


    The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  5. Predictive single nucleotide polymorphism markers for acute oral mucositis in patients with nasopharyngeal carcinoma treated with radiotherapy (United States)

    Le, Ziyu; Niu, Xiaoshuang; Chen, Ying; Ou, Xiaomin; Zhao, Guoqi; Liu, Qi; Tu, Wenzhi; Hu, Chaosu; Kong, Lin; Liu, Yong


    The aim of this study was to investigate the association between the susceptibility of severe oral mucositis (OM) in Chinese nasopharyngeal carcinoma (NPC) patients treated with radiotherapy and single nucleotide polymorphisms (SNPs) across the whole genome. SNPs were screened in a total of 24 patients with NPC and an additional 6 were subjected to mRNA expression analysis. Patients were subdivided into CTC 0-2 (CTC toxicity grade 0, 1, and 2) and CTC 3+ (CTC toxicity grade 3 and above) groups according to their CTC (common toxicity criteria) scores. The GTEx dataset was used to performed eQTL analyses and in-vitro functional assays were performed for eQTL-associated genes. Our data identified 7 functional SNPs associated with the development of OM. We observed that rs11081899-A, located in the 5′-UTR of the ZNF24 gene, was significantly correlated with a higher risk of severe mucositis (OR = 14.631, 95% CI = 2.61-105.46, p = 1.2 × 10−4), and positively associated with ZNF24 mRNA expression (p = 4.1 × 10−6) from GTEx dataset. In addition, high ZNF24 mRNA expression was associated with severe OM in patients with NPC (p = 0.02). Further functional assays revealed that ZNF24 knockdown reduced p65 expression and suppressed TNF-α-induced NF-κB activation and pro-inflammatory cytokines release. These findings suggested that rs11081899-A may be a genetic susceptibility factor for radiation-induced OM in patients with NPC, although its value in clinical application needs to be further verified in a large cohort. Also, we suggested that downregulation of ZNF24 may attenuate the development of mucositis by suppressing NF-κB activation. PMID:28968968

  6. Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections. (United States)

    Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J


    In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P 10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

  7. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea (United States)

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun


    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  8. The association between single nucleotide polymorphism in interleukin-27 gene and recurrent pregnancy loss in Iranian women

    Directory of Open Access Journals (Sweden)

    Zeinab Nematollahi


    Full Text Available Background: Recurrent pregnancy loss (RPL has been defined as two or more miscarriages before 20th week of gestation. It seems that IL-27 may reduce inflammatory responses and affect the survival of the embryo during human pregnancy. IL-27 polymorphisms may influence RPL by altering the levels or the activity of gene product. Objective: We studied for the first time the association of IL-27 -964 A>G single nucleotide polymorphism (SNP with RPL in Iranian women. Materials and Methods: A case-controlled study was performed on two groups consisting of 150 healthy women with at least one delivery (control group and 150 women with two or more primary RPLs history (RPL group. The -964 A>G SNP in IL-27 gene was determined by PCR-RFLP technique. Genotype and allele frequencies were compared using 2 tests between two groups. Results: There was no difference between the two groups regarding age of women (29±4.4 [control] vs. 30.84±5.2 years [case]. In the RPL group, the genotype frequencies of -964 A>G polymorphism were AG (49.3%, AA (40%, and GG (10.7%, and in the control group, they were AG (43.3%, AA (48.7%, and GG (8%. There was no significant difference between the genotypes of AA, AG, and GG in two groups (p=0.23. As the frequency of allele A was 64.7% in the RPL group and 70.3% in the control group, the difference in frequency of allele A in -964 A>G between two groups was not significant (p=0.19. Conclusion: Our findings indicate that SNP of -964 A>G in IL-27 gene is not a risk factor for RPL in Iranian women.

  9. Cell Line Controls for the Genotyping of a Spectrum of Human Single Nucleotide Polymorphisms in the Clinical Laboratory. (United States)

    Kimbacher, Christine; Paar, Christian; Freystetter, Andrea; Berg, Joerg


    Genotyping for clinically important single nucleotide polymorphisms (SNPs) is performed by many clinical routine laboratories. To support testing, quality controls and reference materials are needed. Those may be derived from residual patient samples, left over samples of external quality assurance schemes, plasmid DNA or DNA from cell lines. DNAs from cell lines are commutable and available in large amounts. DNA from 38 cell lines were examined for suitability as controls in 11 SNP assays that are frequently used in a clinical routine laboratory: FV (1691G>A), FII (20210G>A), PAI-1 4G/5G polymorphism, MTHFR (677C>T, 1298A>C), HFE (H63D, S65C, C282Y), APOE (E2, E3, E4), LPH (-13910C>T), UGT1A1 (*28, *36, *37), TPMT (*2, *3A, *3B, *3C), VKORC1 (-1639G>A, 1173C>T), CYP2C9 (*2, *3, *5). Genotyping was performed by real-time PCR with melting curve analysis and confirmed by bi-directional sequencing. We find an almost complete spectrum of genotypic constellations within these 38 cell lines. About 12 cell lines appear sufficient as genotypic controls for the 11 SNP assays by covering almost all of the genotypes. However, hetero- and homozygous genotypes for FII and the alleles TPMT*2, UGT1A1*37 and CYP2C9*5 were not detected in any of the cell lines. DNA from most of the examined cell lines appear suitable as quality controls for these SNP assays in the laboratory routine, as to the implementation of those assays or to prepare samples for quality assurance schemes. Our study may serve as a pilot to further characterize these cell lines to arrive at the status of reference materials.

  10. Single nucleotide polymorphisms of DNA mismatch repair genes MSH2 and MLH1 confer susceptibility to esophageal cancer. (United States)

    Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong


    Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.

  11. TGFB1 Single Nucleotide Polymorphisms Are Associated With Adverse Quality of Life in Prostate Cancer Patients Treated With Radiotherapy

    International Nuclear Information System (INIS)

    Peters, Christopher A.; Stock, Richard G.; Cesaretti, Jamie A.; Atencio, David P.; Peters, Sheila B.A.; Burri, Ryan J.; Stone, Nelson N.; Ostrer, Harry; Rosenstein, Barry S.


    Purpose: To investigate whether the presence of single nucleotide polymorphisms (SNPs) located within TGFB1 might be predictive for the development of adverse quality-of-life outcomes in prostate cancer patients treated with radiotherapy. Methods and Materials: A total of 141 prostate cancer patients treated with radiotherapy were screened for SNPs in TGFB1 using DNA sequencing. Three quality-of-life outcomes were investigated: (1) prospective decline in erectile function, (2) urinary quality of life, and (3) rectal bleeding. Median follow-up was 51.3 months (range, 12-138 months; SD, 24.4 months). Results: Those patients who possessed either the T/T genotype at position -509, the C/C genotype at position 869 (pro/pro, codon 10) or the G/C genotype at position 915 (arg/pro, codon 25) were significantly associated with the development of a decline in erectile function compared with those who did not have these genotypes: 56% (9 of 16) vs. 24% (11 of 45) (p = 0.02). In addition, patients with the -509 T/T genotype had a significantly increased risk of developing late rectal bleeding compared with those who had either the C/T or C/C genotype at this position: 55% (6 of 11) vs. 26% (34 of 130) (p = 0.05). Conclusions: Possession of certain TGFB1 genotypes is associated with the development of both erectile dysfunction and late rectal bleeding in patients treated with radiotherapy for prostate cancer. Therefore, identification of patients harboring these genotypes may represent a means to predict which men are most likely to suffer from poor quality-of-life outcomes after radiotherapy for prostate cancer

  12. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia (United States)

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.


    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  13. Single nucleotide polymorphism in gene encoding transcription factor Prep1 is associated with HIV-1-associated dementia.

    Directory of Open Access Journals (Sweden)

    Sebastiaan M Bol

    Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.

  14. An Improved Consensus Linkage Map of Barley Based on Flow-Sorted Chromosomes and Single Nucleotide Polymorphism Markers

    Directory of Open Access Journals (Sweden)

    María Muñoz-Amatriaín


    Full Text Available Recent advances in high-throughput genotyping have made it easier to combine information from different mapping populations into consensus genetic maps, which provide increased marker density and genome coverage compared to individual maps. Previously, a single nucleotide polymorphism (SNP-based genotyping platform was developed and used to genotype 373 individuals in four barley ( L. mapping populations. This led to a 2943 SNP consensus genetic map with 975 unique positions. In this work, we add data from six additional populations and more individuals from one of the original populations to develop an improved consensus map from 1133 individuals. A stringent and systematic analysis of each of the 10 populations was performed to achieve uniformity. This involved reexamination of the four populations included in the previous map. As a consequence, we present a robust consensus genetic map that contains 2994 SNP loci mapped to 1163 unique positions. The map spans 1137.3 cM with an average density of one marker bin per 0.99 cM. A novel application of the genotyping platform for gene detection allowed the assignment of 2930 genes to flow-sorted chromosomes or arms, confirmed the position of 2545 SNP-mapped loci, added chromosome or arm allocations to an additional 370 SNP loci, and delineated pericentromeric regions for chromosomes 2H to 7H. Marker order has been improved and map resolution has been increased by almost 20%. These increased precision outcomes enable more optimized SNP selection for marker-assisted breeding and support association genetic analysis and map-based cloning. It will also improve the anchoring of DNA sequence scaffolds and the barley physical map to the genetic map.

  15. Association of single nucleotide polymorphisms in the MVP gene with platinum resistance and survival in patients with epithelial ovarian cancer. (United States)

    Zhao, Ya-Nan; He, Dong-Ning; Wang, Ya-DI; Li, Jun-Jie; Ha, Min-Wen


    The human major vault protein (MVP) has been linked to the development of multidrug resistance in cancer cells, and overexpression of MVP has been observed in ovarian cancer tissues. The aim of the present study was to investigate the association between single nucleotide polymorphisms (SNPs) in the MVP gene and the tumor response to platinum-based chemotherapy and survival of patients affected by epithelial ovarian cancer (EOC), in addition to confirm whether tetra-primer amplification-refractory mutation system (ARMS)-polymerase chain reaction (PCR) is an accurate genotyping method. For this purpose, two polymorphisms in the MVP gene, namely reference SNP (rs)1057451 and rs4788186, were selected from the data obtained by the International haplotype map (HapMap) Project regarding Chinese Han population, and were evaluated by tetra-primer ARMS-PCR. Upon validation by DNA sequencing, the association of these polymorphisms with platinum resistance, progression-free survival (PFS) and overall survival (OS) in patients with EOC was assessed. The results of tetra-primer ARMS-PCR were in agreement with those derived from DNA sequencing. No significant differences were observed between platinum-sensitive and platinum-resistant cohorts in terms of allele and genotype distribution of these two polymorphisms in the MVP gene, which were not associated with PFS or OS. However, a trend toward prolonged PFS was observed in patients carrying the heterozygous AG allele at the rs4788186 locus. These results suggest that rs1057451 and rs4788186 variants in the MVP gene are not associated with favorable therapeutic response to platinum or longer survival in Chinese Han patients affected by EOC. In addition, the data of the present study confirm that tetra-primer ARMS-PCR is a trustworthy and economical genotyping method.

  16. Analyses of single nucleotide polymorphisms in selected nutrient-sensitive genes in weight-regain prevention: the DIOGENES study. (United States)

    Larsen, Lesli H; Angquist, Lars; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Kunesova, Marie; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild Ia; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M


    Differences in the interindividual response to dietary intervention could be modified by genetic variation in nutrient-sensitive genes. This study examined single nucleotide polymorphisms (SNPs) in presumed nutrient-sensitive candidate genes for obesity and obesity-related diseases for main and dietary interaction effects on weight, waist circumference, and fat mass regain over 6 mo. In total, 742 participants who had lost ≥ 8% of their initial body weight were randomly assigned to follow 1 of 5 different ad libitum diets with different glycemic indexes and contents of dietary protein. The SNP main and SNP-diet interaction effects were analyzed by using linear regression models, corrected for multiple testing by using Bonferroni correction and evaluated by using quantile-quantile (Q-Q) plots. After correction for multiple testing, none of the SNPs were significantly associated with weight, waist circumference, or fat mass regain. Q-Q plots showed that ALOX5AP rs4769873 showed a higher observed than predicted P value for the association with less waist circumference regain over 6 mo (-3.1 cm/allele; 95% CI: -4.6, -1.6; P/Bonferroni-corrected P = 0.000039/0.076), independently of diet. Additional associations were identified by using Q-Q plots for SNPs in ALOX5AP, TNF, and KCNJ11 for main effects; in LPL and TUB for glycemic index interaction effects on waist circumference regain; in GHRL, CCK, MLXIPL, and LEPR on weight; in PPARC1A, PCK2, ALOX5AP, PYY, and ADRB3 on waist circumference; and in PPARD, FABP1, PLAUR, and LPIN1 on fat mass regain for dietary protein interaction. The observed effects of SNP-diet interactions on weight, waist, and fat mass regain suggest that genetic variation in nutrient-sensitive genes can modify the response to diet. This trial was registered at as NCT00390637.

  17. Correlation of Fetuin-A gene rs1071592 and rs2593813 single nucleotide polymorphisms with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Juan YI


    Full Text Available Objective  To investigate the relations of Fetuin-A gene rs1071592 and rs2593813 single nucleotide polymorphisms (SNPs with the affect ability to polycystic ovary syndrome (PCOS and its endocrine and metabolic characteristics in Chongqing Han population. Methods  A case-control study was performed in Chinese Han subjects. The clinical data of 156 cases of normal control and 147 cases of PCOS patients were collected, and their blood glucose, lipids, sex hormone and other biochemical indexes were determined, the SNPs of rs1071592 and rs2593813 were genotyped by TaqMan SNP Genotyping Assay. Hyperinsulinemic-euglycemic clamp was performed in 147 PCOS women and 20 controls. The relative risk of developing PCOS in women with rs1071592 genotype was assessed using a binary logistic regression analysis. Results  The distribution frequency of Fetuin-A gene homozygous rs1071592 AA genotype and A allele was significantly increased in PCOS patients than in controls (Pc0.05. Binary logistic regression analysis showed that the risk of developing PCOS was 4.93 times high in women with AA genotype of rs1071592 (OR=4.933, 95%CI 1.593-15.278, P0.05. Conclusion  People with SNPs variants of rs1071592 in Fetuin-A gene may have an increased genetic susceptibility to PCOS. However, there won't be significant relationship between SNP of rs2593813 at Fetuin-A gene and PCOS. DOI: 10.11855/j.issn.0577-7402.2016.09.07

  18. Impacts of Nonsynonymous Single Nucleotide Polymorphisms of Adiponectin Receptor 1 Gene on Corresponding Protein Stability: A Computational Approach

    Directory of Open Access Journals (Sweden)

    Md. Abu Saleh


    Full Text Available Despite the reported association of adiponectin receptor 1 (ADIPOR1 gene mutations with vulnerability to several human metabolic diseases, there is lack of computational analysis on the functional and structural impacts of single nucleotide polymorphisms (SNPs of the human ADIPOR1 at protein level. Therefore, sequence- and structure-based computational tools were employed in this study to functionally and structurally characterize the coding nsSNPs of ADIPOR1 gene listed in the dbSNP database. Our in silico analysis by SIFT, nsSNPAnalyzer, PolyPhen-2, Fathmm, I-Mutant 2.0, SNPs&GO, PhD-SNP, PANTHER, and SNPeffect tools identified the nsSNPs with distorting functional impacts, namely, rs765425383 (A348G, rs752071352 (H341Y, rs759555652 (R324L, rs200326086 (L224F, and rs766267373 (L143P from 74 nsSNPs of ADIPOR1 gene. Finally the aforementioned five deleterious nsSNPs were introduced using Swiss-PDB Viewer package within the X-ray crystal structure of ADIPOR1 protein, and changes in free energy for these mutations were computed. Although increased free energy was observed for all the mutants, the nsSNP H341Y caused the highest energy increase amongst all. RMSD and TM scores predicted that mutants were structurally similar to wild type protein. Our analyses suggested that the aforementioned variants especially H341Y could directly or indirectly destabilize the amino acid interactions and hydrogen bonding networks of ADIPOR1.

  19. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes. (United States)

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel


    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  20. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data. (United States)

    Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R


    Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  1. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    Directory of Open Access Journals (Sweden)

    Sang Y Lee

    Full Text Available Human hemochromatosis protein (HFE is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM. However, the effect of other single nucleotide variation (SNV in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA GBM (Caucasian only database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI: 0.2119-0.3223 or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159 HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  2. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Directory of Open Access Journals (Sweden)

    Diego Hepp

    Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  3. Wheat in the Mediterranean revisited--tetraploid wheat landraces assessed with elite bread wheat Single Nucleotide Polymorphism markers. (United States)

    Oliveira, Hugo R; Hagenblad, Jenny; Leino, Matti W; Leigh, Fiona J; Lister, Diane L; Penã-Chocarro, Leonor; Jones, Martin K


    Single Nucleotide Polymorphism (SNP) panels recently developed for the assessment of genetic diversity in wheat are primarily based on elite varieties, mostly those of bread wheat. The usefulness of such SNP panels for studying wheat evolution and domestication has not yet been fully explored and ascertainment bias issues can potentially affect their applicability when studying landraces and tetraploid ancestors of bread wheat. We here evaluate whether population structure and evolutionary history can be assessed in tetraploid landrace wheats using SNP markers previously developed for the analysis of elite cultivars of hexaploid wheat. We genotyped more than 100 tetraploid wheat landraces and wild emmer wheat accessions, some of which had previously been screened with SSR markers, for an existing SNP panel and obtained publically available genotypes for the same SNPs for hexaploid wheat varieties and landraces. Results showed that quantification of genetic diversity can be affected by ascertainment bias but that the effects of ascertainment bias can at least partly be alleviated by merging SNPs to haplotypes. Analyses of population structure and genetic differentiation show strong subdivision between the tetraploid wheat subspecies, except for durum and rivet that are not separable. A more detailed population structure of durum landraces could be obtained than with SSR markers. The results also suggest an emmer, rather than durum, ancestry of bread wheat and with gene flow from wild emmer. SNP markers developed for elite cultivars show great potential for inferring population structure and can address evolutionary questions in landrace wheat. Issues of marker genome specificity and mapping need, however, to be addressed. Ascertainment bias does not seem to interfere with the ability of a SNP marker system developed for elite bread wheat accessions to detect population structure in other types of wheat.

  4. Association of single nucleotide polymorphisms in pro-inflammatory cytokine and toll-like receptor genes with pediatric hematogenous osteomyelitis. (United States)

    Osman, A E; Mubasher, M; ElSheikh, N E; AlHarthi, H; AlZahrani, M S; Ahmed, N; ElGhazali, G; Bradley, B A; Fadil, A-S A


    Hematogenous osteomyelitis (HO) is a bone infection wherein bacteria penetrate to the bone through the blood stream. Several single nucleotide polymorphisms (SNPs) have been associated with susceptibility to infectious diseases. In this study, we investigated the contribution of SNPs in interleukin (IL)-1B1 (rs16944), IL1A (rs1800587), IL1B (rs1143634), toll-like receptor (TLR)-2 (rs3804099), TLR4 (rs4986790), TLR4 (rs4986791), IL1R (rs2234650), tumor necrosis factor (TNF)-α (rs1800629), TNF (rs361525), and IL1RN (rs315952) towards the development of HO in Saudi patients and compared to healthy controls. Fifty-two patients diagnosed with HO and 103 healthy individuals were genotyped. The frequencies of genotypes GG (rs16944) and AA (rs16944) were lower and higher in patients [odds ratio (OR) = 0.34, Pc = 0.05] and controls (OR = 1.33, Pc = 0.05), respectively, suggesting that SNPs at this locus could alter HO susceptibility. In addition, the patients and controls exhibited lower and higher frequencies of the alleles G (rs16944) (OR = 0.43, Pc = 0.007) and A (rs16944) (OR = 2.32, Pc = 0.007), respectively. The expression of alleles C (rs3804099) and T (rs3804099) were higher in patients (OR = 2.05, Pc = 0.04) and controls (OR = 0.49, Pc = 0.04), respectively. In conclusion, SNPs at rs16944 and rs3804099 were found to be associated with HO in the Saudi population.

  5. A Long-Read Transcriptome Assembly of Cotton (Gossypium hirsutum L. and Intraspecific Single Nucleotide Polymorphism Discovery

    Directory of Open Access Journals (Sweden)

    Hamid Ashrafi


    Full Text Available Upland cotton ( L. has a narrow germplasm base, which constrains marker development and hampers intraspecific breeding. A pressing need exists for high-throughput single nucleotide polymorphism (SNP markers that can be readily applied to germplasm in breeding and breeding-related research programs. Despite progress made in developing new sequencing technologies during the past decade, the cost of sequencing remains substantial when one is dealing with numerous samples and large genomes. Several strategies have been proposed to lower the cost of sequencing for multiple genotypes of large-genome species like cotton, such as transcriptome sequencing and reduced-representation DNA sequencing. This paper reports the development of a transcriptome assembly of the inbred line Texas Marker-1 (TM-1, a genetic standard for cotton, its usefulness as a reference for RNA sequencing (RNA-seq-based SNP identification, and the availability of transcriptome sequences of four other cotton cultivars. An assembly of TM-1 was made using Roche 454 transcriptome reads combined with an assembly of all available public expressed sequence tag (EST sequences of TM-1. The TM-1 assembly consists of 72,450 contigs with a total of 70 million bp. Functional predictions of the transcripts were estimated by alignment to selected protein databases. Transcriptome sequences of the five lines, including TM-1, were obtained using an Illumina Genome Analyzer-II, and the short reads were mapped to the TM-1 assembly to discover SNPs among the five lines. We identified >14,000 unfiltered allelic SNPs, of which ∼3,700 SNPs were retained for assay development after applying several rigorous filters. This paper reports availability of the reference transcriptome assembly and shows its utility in developing intraspecific SNP markers in upland cotton.

  6. Identification and genotyping of feline infectious peritonitis-associated single nucleotide polymorphisms in the feline interferon-γ gene. (United States)

    Hsieh, Li-En; Chueh, Ling-Ling


    Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.

  7. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients. (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric


    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  8. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    Directory of Open Access Journals (Sweden)

    Jaewoo Song

    Full Text Available VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC study for the association of single nucleotide polymorphisms (SNPs in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  9. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity. (United States)

    Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei


    VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  10. Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population. (United States)

    Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M


    Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

  11. The effects of noncoding aquaporin-4 single-nucleotide polymorphisms on cognition and functional progression of Alzheimer's disease. (United States)

    Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J


    The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.

  12. Generation of Transcript Assemblies and Identification of Single Nucleotide Polymorphisms from Seven Lowland and Upland Cultivars of Switchgrass

    Directory of Open Access Journals (Sweden)

    Kevin L. Childs


    Full Text Available Switchgrass is a North American perennial prairie species that has been used as a rangeland and forage crop and has recently been targeted as a potential biofuel feedstock species. Switchgrass, which occurs as tetraploid and octoploid forms, is classified into lowland or upland ecotypes that differ in growth phenotypes and adaptation to distinct habitats. Using RNA-sequencing (RNA-seq reads derived from crown, young shoot, and leaf tissues, we generated sequence data from seven switchgrass cultivars, three lowland and four upland, to enable comparative analyses between switchgrass cultivars and to identify single nucleotide polymorphisms (SNPs for use in breeding and genetic analysis. We also generated individual transcript assemblies for each of the cultivars. Transcript data indicate that subgenomes of octoploid switchgrass are not substantially different from subgenomes of tetraploids as expected for an autopolyploid origin of switchgrass octoploids. Using RNA-seq reads aligned to the switchgrass Release 0 AP13 reference genome, we identified 1,305,976 high-confidence SNPs. Of these SNPs, 438,464 were unique to lowland cultivars, but only 12,002 were found in all lowlands. Conversely, 723,678 SNPs were unique to upland cultivars, with only 34,665 observed in all uplands. Comparison of our high-confidence transcriptome-derived SNPs with SNPs previously identified in a genotyping-by-sequencing (GBS study of an association panel revealed limited overlap between the two methods, highlighting the utility of transcriptome-based SNP discovery in augmenting genome diversity polymorphism datasets. The transcript and SNP data described here provide a useful resource for switchgrass gene annotation and marker-based analyses of the switchgrass genome.

  13. Associations between Single-Nucleotide Polymorphisms in Corticotropin-Releasing Hormone-Related Genes and Irritable Bowel Syndrome.

    Directory of Open Access Journals (Sweden)

    Ayaka Sasaki

    Full Text Available Irritable bowel syndrome (IBS is a common functional disorder with distinct features of stress-related pathophysiology. A key mediator of the stress response is corticotropin-releasing hormone (CRH. Although some candidate genes have been identified in stress-related disorders, few studies have examined CRH-related gene polymorphisms. Therefore, we tested our hypothesis that single-nucleotide polymorphisms (SNPs in CRH-related genes influence the features of IBS.In total, 253 individuals (123 men and 130 women participated in this study. They comprised 111 IBS individuals and 142 healthy controls. The SNP genotypes in CRH (rs28364015 and rs6472258 and CRH-binding protein (CRH-BP (rs10474485 were determined by direct sequencing and real-time polymerase chain reaction. The emotional states of the subjects were evaluated using the State-Trait Anxiety Inventory, Perceived Stress Scale, and the Self-rating Depression Scale.Direct sequencing of the rs28364015 SNP of CRH revealed no genetic variation among the study subjects. There was no difference in the genotype distributions and allele frequencies of rs6472258 and rs10474485 between IBS individuals and controls. However, IBS subjects with diarrhea symptoms without the rs10474485 A allele showed a significantly higher emotional state score than carriers.These results suggest that the CRH and CRH-BP genes have no direct effect on IBS status. However, the CRH-BP SNP rs10474485 has some effect on IBS-related emotional abnormalities and resistance to psychosocial stress.

  14. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.


    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  15. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs). (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S


    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  16. Assembling a dual purpose TaqMan-based panel of single-nucleotide polymorphism markers in rainbow trout and steelhead (Oncorhynchus mykiss) for association mapping and population genetics analysis

    DEFF Research Database (Denmark)

    Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede


    We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...

  17. Dissecting tocopherols content in maize (Zea mays L.), using two segregating populations and high-density single nucleotide polymorphism markers (United States)


    Background Tocopherols, which are vitamin E compounds, play an important role in maintaining human health. Compared with other staple foods, maize grains contain high level of tocopherols. Results Two F2 populations (K22/CI7 and K22/Dan340, referred to as POP-1 and POP-2, respectively), which share a common parent (K22), were developed and genotyped using a GoldenGate assay containing 1,536 single nucleotide polymorphism (SNP) markers. An integrated genetic linkage map was constructed using 619 SNP markers, spanning a total of 1649.03 cM of the maize genome with an average interval of 2.67 cM. Seventeen quantitative trait loci (QTLs) for all the traits were detected in the first map and 13 in the second. In these two maps, QTLs for different traits were localized to the same genomic regions and some were co-located with candidate genes in the tocopherol biosynthesis pathway. Single QTL was responsible for 3.03% to 52.75% of the phenotypic variation and the QTLs in sum explained23.4% to 66.52% of the total phenotypic variation. A major QTL (qc5-1/qd5-1) affecting α-tocopherol (αT) was identified on chromosome 5 between the PZA03161.1 and PZA02068.1 in the POP-2. The QTL region was narrowed down from 18.7 Mb to 5.4 Mb by estimating the recombination using high-density markers of the QTL region. This allowed the identification of the candidate gene VTE4 which encodes γ-tocopherol methyltransferase, an enzyme that transforms γ-tocopherol (γT)to αT. Conclusions These results demonstrate that a few QTLs with major effects and several QTLs with medium to minor effects might contribute to the natural variation of tocopherols in maize grain. The high-density markers will help to fine map and identify the QTLs with major effects even in the preliminary segregating populations. Furthermore, this study provides a simple guide line for the breeders to improve traits that minimize the risk of malnutrition, especially in developing countries. PMID:23122295

  18. Association of single nucleotide polymorphisms in TCF2 with type 2 diabetes susceptibility in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Xuelong Zhang

    Full Text Available Hepatocyte nuclear factor 1β (HNF1β, a transcription factor encoded by the transcription factor 2 gene (TCF2, plays a critical role in pancreatic cell formation and glucose homeostasis. It has been suggested that single nucleotide polymorphisms (SNPs of TCF2 are associated with susceptibility to type 2 diabetes (T2D. However, published results are inconsistent and inclusive. To further investigate the role of these common variants, we examined the association of TCF2 polymorphisms with the risk of T2D in a Han population in northeastern China. We genotyped five SNPs in 624 T2D patients and 630 healthy controls by using a SNaPshot method, and evaluated the T2D risk conferred by individual SNPs and haplotypes. In the single-locus analysis, we found that rs752010, rs4430796 and rs7501939 showed allelic differences between T2D patients and healthy controls, with an OR of 1.26 (95% CI 1.08-1.51, P = 0.003, an OR of 1.23 (95% CI 1.06-1.55, P = 0.001 and an OR of 1.28 (95% CI 1.10-1.61, P = 0.001, respectively. Genotype association analysis of each locus also revealed that the homozygous carriers of the at-risk allele had a significant increased T2D risk compared to homozygous carriers of the other allele (OR 1.78, 95% CI 1.20-2.64 for rs752010; OR 1.82, 95% CI 1.24-2.67 for rs4430796; OR 1.95, 95% CI 1.31-2.90 for rs7501939, even after Bonferroni correction for multiple comparisons. Besides, the haplotype-based analysis demonstrated that AGT in block rs752010-rs4430796-rs7501939 was associated with about 30% increase in T2D risk (OR 1.31, 95% CI 1.09-1.57, P = 0.01. Our findings suggested that TCF2 variants may be involved in T2D risk in a Han population of northeastern China. Larger studies with ethnically diverse populations are warranted to confirm the results reported in this investigation.

  19. Direct observation of backbone planarization via side-chain alignment in single bulky-substituted polythiophenes (United States)

    Raithel, Dominic; Simine, Lena; Pickel, Sebastian; Schötz, Konstantin; Panzer, Fabian; Baderschneider, Sebastian; Schiefer, Daniel; Lohwasser, Ruth; Köhler, Jürgen; Thelakkat, Mukundan; Sommer, Michael; Köhler, Anna; Rossky, Peter J.; Hildner, Richard


    The backbone conformation of conjugated polymers affects, to a large extent, their optical and electronic properties. The usually flexible substituents provide solubility and influence the packing behavior of conjugated polymers in films or in bad solvents. However, the role of the side chains in determining and potentially controlling the backbone conformation, and thus the optical and electronic properties on the single polymer level, is currently under debate. Here, we investigate directly the impact of the side chains by studying the bulky-substituted poly(3-(2,5-dioctylphenyl)thiophene) (PDOPT) and the common poly(3-hexylthiophene) (P3HT), both with a defined molecular weight and high regioregularity, using low-temperature single-chain photoluminescence (PL) spectroscopy and quantum-classical simulations. Surprisingly, the optical transition energy of PDOPT is significantly (˜2,000 cm‑1 or 0.25 eV) red-shifted relative to P3HT despite a higher static and dynamic disorder in the former. We ascribe this red shift to a side-chain induced backbone planarization in PDOPT, supported by temperature-dependent ensemble PL spectroscopy. Our atomistic simulations reveal that the bulkier 2,5-dioctylphenyl side chains of PDOPT adopt a clear secondary helical structural motif and thus protect conjugation, i.e., enforce backbone planarity, whereas, for P3HT, this is not the case. These different degrees of planarity in both thiophenes do not result in different conjugation lengths, which we found to be similar. It is rather the stronger electronic coupling between the repeating units in the more planar PDOPT which gives rise to the observed spectral red shift as well as to a reduced calculated electron‑hole polarization.

  20. Crystallographic and single-particle analyses of native- and nucleotide-bound forms of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. (United States)

    Awayn, N H; Rosenberg, M F; Kamis, A B; Aleksandrov, L A; Riordan, J R; Ford, R C


    Cystic fibrosis, one of the major human inherited diseases, is caused by defects in the CFTR (cystic fibrosis transmembrane conductance regulator), a cell-membrane protein. CFTR acts as a chloride channel which can be opened by ATP. Low-resolution structural studies of purified recombinant human CFTR are described in the present paper. Localization of the C-terminal decahistidine tag in CFTR was achieved by Ni2+-nitriloacetate nanogold labelling, followed by electron microscopy and single-particle analysis. The presence of the gold label appears to improve the single-particle-alignment procedure. Projection structures of CFTR from two-dimensional crystals analysed by electron crystallography displayed two alternative conformational states in the presence of nucleotide and nanogold, but only one form of the protein was observed in the quiescent (nucleotide-free) state.

  1. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.


    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  3. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease. (United States)

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang


    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  4. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça


    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  5. Diagnostic single nucleotide polymorphisms for identifying westslope cutthroat trout (Oncorhynchus clarki lewisi), Yellowstone cutthroat trout (Oncorhynchus clarkii bouvieri) and rainbow trout (Oncorhynchus mykiss). (United States)

    Kalinowski, S T; Novak, B J; Drinan, D P; Jennings, R deM; Vu, N V


    We describe 12 diagnostic single nucleotide polymorphism (SNP) assays for use in species identification among rainbow and cutthroat trout: five of these loci have alleles unique to rainbow trout (Oncorhynchus mykiss), three unique to westslope cutthroat trout (O. clarkii lewisi) and four unique to Yellowstone cutthroat trout (O. clarkii bouvieri). These diagnostic assays were identified using a total of 489 individuals from 26 populations and five fish hatchery strains. © 2010 Blackwell Publishing Ltd.

  6. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Irish cattle population

    Directory of Open Access Journals (Sweden)

    Hartshorne David


    Full Text Available Abstract Background Animal identification is pivotal in governmental agricultural policy, enabling the management of subsidy payments, movement of livestock, test scheduling and control of disease. Advances in bovine genomics have made it possible to utilise inherent genetic variability to uniquely identify individual animals by DNA profiling, much as has been achieved with humans over the past 20 years. A DNA profiling test based on bi-allelic single nucleotide polymorphism (SNP markers would offer considerable advantages over current short tandem repeat (STR based industry standard tests, in that it would be easier to analyse and interpret. In this study, a panel of 51 genome-wide SNPs were genotyped across panels of semen DNA from 6 common breeds for the purposes of ascertaining allelic frequency. For SNPs on the same chromosome, the extent of linkage disequilbrium was determined from genotype data by Expectation Maximization (EM algorithm. Minimum probabilities of unique identification were determined for each breed panel. The usefulness of this SNP panel was ascertained by comparison to the current bovine STR Stockmarks II assay. A statistically representative random sampling of bovine animals from across Northern Ireland was assembled for the purposes of determining the population allele frequency for these STR loci and subsequently, the minimal probability of unique identification they conferred in sampled bovine animals from Northern Ireland. Results 6 SNPs exhibiting a minor allele frequency of less than 0.2 in more than 3 of the breed panels were excluded. 2 Further SNPs were found to reside in coding areas of the cattle genome and were excluded from the final panel. The remaining 43 SNPs exhibited genotype frequencies which were in Hardy Weinberg Equilibrium. SNPs on the same chromosome were observed to have no significant linkage disequilibrium/allelic association. Minimal probabilities of uniquely identifying individual animals from

  7. Integrative analysis of single nucleotide polymorphisms and gene expression efficiently distinguishes samples from closely related ethnic populations

    Directory of Open Access Journals (Sweden)

    Yang Hsin-Chou


    Full Text Available Abstract Background Ancestry informative markers (AIMs are a type of genetic marker that is informative for tracing the ancestral ethnicity of individuals. Application of AIMs has gained substantial attention in population genetics, forensic sciences, and medical genetics. Single nucleotide polymorphisms (SNPs, the materials of AIMs, are useful for classifying individuals from distinct continental origins but cannot discriminate individuals with subtle genetic differences from closely related ancestral lineages. Proof-of-principle studies have shown that gene expression (GE also is a heritable human variation that exhibits differential intensity distributions among ethnic groups. GE supplies ethnic information supplemental to SNPs; this motivated us to integrate SNP and GE markers to construct AIM panels with a reduced number of required markers and provide high accuracy in ancestry inference. Few studies in the literature have considered GE in this aspect, and none have integrated SNP and GE markers to aid classification of samples from closely related ethnic populations. Results We integrated a forward variable selection procedure into flexible discriminant analysis to identify key SNP and/or GE markers with the highest cross-validation prediction accuracy. By analyzing genome-wide SNP and/or GE markers in 210 independent samples from four ethnic groups in the HapMap II Project, we found that average testing accuracies for a majority of classification analyses were quite high, except for SNP-only analyses that were performed to discern study samples containing individuals from two close Asian populations. The average testing accuracies ranged from 0.53 to 0.79 for SNP-only analyses and increased to around 0.90 when GE markers were integrated together with SNP markers for the classification of samples from closely related Asian populations. Compared to GE-only analyses, integrative analyses of SNP and GE markers showed comparable testing

  8. Relationship between single nucleotide polymorphism of chemokine CXCL10 G-210A and the chronicity and severity of HBV infection

    Directory of Open Access Journals (Sweden)

    Li-ming LIU


    Full Text Available Objective To investigate the single nucleotide polymorphism(SNP in the promoter of chemokine CXCL10 G-201A,and explore the relationship between the SNP and the chronicity and severity of hepatitis B virus(HBV infection.Methods Blood samples were collected from 792 patients with HBV infection,including 200 with acute hepatitis B(AHB,200 with mild/moderate chronic hepatitis B(CHB-M,192 with severe chronic hepatitis B(CHB-S and 200 with acute liver failure of chronic hepatitis(ACLF,and 300 healthy people were enrolled as normal control(NC.DNA were extracted and subjected to PCR amplification of fragment containing C-1596 site that links with G-201 variation,followed by restriction fragment length polymerase(RFLP analysis.Simultaneously,400 samples were randomly extracted from various groups for direct sequencing of G-201 variation.The consistency of SNP typing results of the two methods was analyzed.Results Variation rates of G-201A were 17.77% for AHB group,25.26% for CHB-M group,26.59% for CHB-S group,21.28% for ACLF group,and 13.82% for NC group.The overall P value obtained from the general χ2 test among the 5 groups was 0.0037.The correlation test(P=0.0015 demonstrated that the variation rate was related to different disease status,and the linear trend test(P=0.0029,Z=-2.9748 indicated an increasing trend of variation rate with the disease progression.Paired comparison showed that the differences in variation rate between CHB-M and NC(P=0.0024,CHB-S and NC(P=0.0007,ACLF and NC(P=0.0428,as well as CHB-S and CHB(P=0.0488 were statistically significant.Direct PCR sequencing showed 98.68% identity with the results from PCR-RFLP.Kappa test(U=58.425,P < 0.05 indicated that the consistency of the two assays met the statistical requirements.Conclusion The G-201A variation in CXCL10 promoter is related to chronicity of HBV infection,and the relations between the variation and the severity of HBV infection remains to be further clarified.

  9. An Investigation of Modifying Effects of Metallothionein Single-Nucleotide Polymorphisms on the Association between Mercury Exposure and Biomarker Levels (United States)

    Wang, Yi; Goodrich, Jaclyn M.; Gillespie, Brenda; Werner, Robert; Basu, Niladri


    Background: Recent studies have suggested that several genes that mediate mercury metabolism are polymorphic in humans. Objective: We hypothesized that single-nucleotide polymorphisms (SNPs) in metallothionein (MT) genes may underlie interindividual differences in mercury biomarker levels. We studied the potential modifying effects of MT SNPs on mercury exposure–biomarker relationships. Methods: We measured total mercury in urine and hair samples of 515 dental professionals. We also surveyed occupational and personal exposures to dental amalgam and dietary fish consumption, from which daily methylmercury (MeHg) intake was estimated. Log-transformed urine and hair levels were modeled in multivariable linear regression separately against respective exposure surrogates, and the effect modification of 13 MT SNPs on exposure was investigated. Results: The mean mercury levels in urine (1.06 μg/L) and hair (0.51 μg/g) were not significantly different from the U.S. general population (0.95 μg/L and 0.47 μg/g, respectively). The mean estimated daily MeHg intake was 0.084 μg/kg/day (range, 0–0.98 μg/kg/day), with 25% of study population intakes exceeding the current U.S. Environmental Protection Agency reference dose of 0.1 μg/kg/day. Multivariate regression analysis showed that subjects with the MT1M (rs2270837) AA genotype (n = 10) or the MT2A (rs10636) CC genotype (n = 42) had lower urinary mercury levels than did those with the MT1M or MT2A GG genotype (n = 329 and 251, respectively) after controlling for exposure and potential confounders. After controlling for MeHg intake, subjects with MT1A (rs8052394) GA and GG genotypes (n = 24) or the MT1M (rs9936741) TT genotype (n = 459) had lower hair mercury levels than did subjects with MT1A AA (n = 113) or MT1M TC and CC genotypes (n = 15), respectively. Conclusion: Our findings suggest that some MT genetic polymorphisms may influence mercury biomarker concentrations at levels of exposure relevant to the general

  10. Single Nucleotide Polymorphism TGFβ1 R25P Correlates with Acute Toxicity during Neoadjuvant Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Smith, J. Joshua; Wasserman, Isaac; Milgrom, Sarah A.; Chow, Oliver S.; Chen, Chin-Tung; Patil, Sujata; Goodman, Karyn A.; Garcia-Aguilar, Julio


    Purpose: To validate the finding of an association between single nucleotide polymorphisms (SNPs) and toxicity during chemoradiotherapy (CRT) in rectal cancer patients, in an independent population. Methods and Materials: The cohort consisted of 165 patients who received CRT for rectal cancer from 2006 to 2012. Prospectively recorded toxicity information, graded according to the Common Terminology Criteria for Adverse Events version 3.0, was retrieved from the medical record. Additionally, a subset of 52 patients recorded their gastrointestinal symptoms weekly during CRT, using the 7-item Bowel Problems Scale. Deoxyribonucleic acid was extracted from normal tissue in the proctectomy specimens and screened for 3 SNPs: XRCC1 R399Q, XPD K751Q, and TGFβ1 R25P. Univariable and multivariable logistic regression models were constructed. Results: The median radiation dose was 50.4 Gy, and all patients received concurrent chemotherapy. Toxicities measured by the Common Terminology Criteria for Adverse Events were closely associated with patient-reported outcomes for the patients who completed the 7-item Bowel Problems Scale. Grade ≥3 toxicity occurred during CRT in 14 patients (8%). All 14 patients had either XRCC1 R399Q or TGFβ1 R25P polymorphisms. The TGFβ1 R25P polymorphism was significantly associated with grade ≥3 toxicity (odds ratio [OR] 3.47, P=.04) and, in patients who completed the Bowel Problems Scale, with grade ≥4 toxicity (OR 5.61, P=.02). The latter finding persisted in a multivariable logistic regression model controlling for ethnicity, age, and sex (adjusted OR 1.83, P=.02). Conclusions: We have validated the correlation between the TGFβ1 R25P SNP and acute toxicity during CRT in an independent cohort using both clinician- and patient-reported toxicity. The information from our study could be used as a basis to formulate a prospective trial testing the utility of this SNP as a biomarker of acute toxicity during neoadjuvant treatment in locally

  11. Species trees from consensus single nucleotide polymorphism (SNP) data: Testing phylogenetic approaches with simulated and empirical data. (United States)

    Schmidt-Lebuhn, Alexander N; Aitken, Nicola C; Chuah, Aaron


    Datasets of hundreds or thousands of SNPs (Single Nucleotide Polymorphisms) from multiple individuals per species are increasingly used to study population structure, species delimitation and shallow phylogenetics. The principal software tool to infer species or population trees from SNP data is currently the BEAST template SNAPP which uses a Bayesian coalescent analysis. However, it is computationally extremely demanding and tolerates only small amounts of missing data. We used simulated and empirical SNPs from plants (Australian Craspedia, Asteraceae, and Pelargonium, Geraniaceae) to compare species trees produced (1) by SNAPP, (2) using SVD quartets, and (3) using Bayesian and parsimony analysis with several different approaches to summarising data from multiple samples into one set of traits per species. Our aims were to explore the impact of tree topology and missing data on the results, and to test which data summarising and analyses approaches would best approximate the results obtained from SNAPP for empirical data. SVD quartets retrieved the correct topology from simulated data, as did SNAPP except in the case of a very unbalanced phylogeny. Both methods failed to retrieve the correct topology when large amounts of data were missing. Bayesian analysis of species level summary data scoring the two alleles of each SNP as independent characters and parsimony analysis of data scoring each SNP as one character produced trees with branch length distributions closest to the true trees on which SNPs were simulated. For empirical data, Bayesian inference and Dollo parsimony analysis of data scored allele-wise produced phylogenies most congruent with the results of SNAPP. In the case of study groups divergent enough for missing data to be phylogenetically informative (because of additional mutations preventing amplification of genomic fragments or bioinformatic establishment of homology), scoring of SNP data as a presence/absence matrix irrespective of allele

  12. Single nucleotide polymorphisms of one-carbon metabolism and cancers of the esophagus, stomach, and liver in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Shen-Chih Chang

    Full Text Available One-carbon metabolism (folate metabolism is considered important in carcinogenesis because of its involvement in DNA synthesis and biological methylation reactions. We investigated the associations of single nucleotide polymorphisms (SNPs in folate metabolic pathway and the risk of three GI cancers in a population-based case-control study in Taixing City, China, with 218 esophageal cancer cases, 206 stomach cancer cases, 204 liver cancer cases, and 415 healthy population controls. Study participants were interviewed with a standardized questionnaire, and blood samples were collected after the interviews. We genotyped SNPs of the MTHFR, MTR, MTRR, DNMT1, and ALDH2 genes, using PCR-RFLP, SNPlex, or TaqMan assays. To account for multiple comparisons and reduce the chances of false reports, we employed semi-Bayes (SB shrinkage analysis. After shrinkage and adjusting for potential confounding factors, we found positive associations between MTHFR rs1801133 and stomach cancer (any T versus C/C, SB odds-ratio [SBOR]: 1.79, 95% posterior limits: 1.18, 2.71 and liver cancer (SBOR: 1.51, 95% posterior limits: 0.98, 2.32. There was an inverse association between DNMT1 rs2228612 and esophageal cancer (any G versus A/A, SBOR: 0.60, 95% posterior limits: 0.39, 0.94. In addition, we detected potential heterogeneity across alcohol drinking status for ORs relating MTRR rs1801394 to esophageal (posterior homogeneity P = 0.005 and stomach cancer (posterior homogeneity P = 0.004, and ORs relating MTR rs1805087 to liver cancer (posterior homogeneity P = 0.021. Among non-alcohol drinkers, the variant allele (allele G of these two SNPs was inversely associated with the risk of these cancers; while a positive association was observed among ever-alcohol drinkers. Our results suggest that genetic polymorphisms related to one-carbon metabolism may be associated with cancers of the esophagus, stomach, and liver. Heterogeneity across alcohol consumption status of

  13. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents

    Directory of Open Access Journals (Sweden)

    Nur Lisa Zaharan


    Full Text Available BackgroundSeveral non-synonymous single-nucleotide polymorphisms (nsSNPs have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA in relation to adiposity parameters among adolescents in Malaysia.MethodsWe examined whether (a PA and (b selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (n = 1,151. Body mass indices, waist–hip ratio, and percentage body fat (% BF were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C. Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3 rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS. Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.ResultsPAQ-C scores were associated with % BF (β = −0.44 [95% confidence interval −0.72, −0.16], p = 0.002. The CC genotype of ADRB3 rs4994 (β = −0.16 [−0.28, −0.05], corrected p = 0.01 and AA genotype of MC3R rs3827103 (β = −0.06 [−0.12, −0.00], p = 0.02 were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = −0.05 [−0.10, −0.01], p = 0.02 and combined GRS (β = −0.03 [−0.04, −0.01], p = 0.01 for % BF.ConclusionHigher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention

  14. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents. (United States)

    Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen


    Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n  = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p  = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p  = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p  = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p  = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p  = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.

  15. Single nucleotide polymorphisms in native South American Atlantic coast populations of smooth shelled mussels: hybridization with invasive European Mytilus galloprovincialis. (United States)

    Zbawicka, Małgorzata; Trucco, María I; Wenne, Roman


    Throughout the world, harvesting of mussels Mytilus spp. is based on the exploitation of natural populations and aquaculture. Aquaculture activities include transfers of spat and live adult mussels between various geographic locations, which may result in large-scale changes in the world distribution of Mytilus taxa. Mytilus taxa are morphologically similar and difficult to distinguish. In spite of much research on taxonomy, evolution and geographic distribution, the native Mytilus taxa of the Southern Hemisphere are poorly understood. Recently, single nucleotide polymorphisms (SNPs) have been used to clarify the taxonomic status of populations of smooth shelled mussels from the Pacific coast of South America. In this paper, we used a set of SNPs to characterize, for the first time, populations of smooth shelled mussels Mytilus from the Atlantic coast of South America. Mytilus spp. samples were collected from eastern South America. Six reference samples from the Northern Hemisphere were used: Mytilus edulis from USA and Northern Ireland, Mytilus trossulus from Canada, and Mytilus galloprovincialis from Spain and Italy. Two other reference samples from the Southern Hemisphere were included: M. galloprovincialis from New Zealand and Mytilus chilensis from Chile. Fifty-five SNPs were successfully genotyped, of which 51 were polymorphic. Population genetic analyses using the STRUCTURE program revealed the clustering of eight populations from Argentina (Mytilus platensis) and the clustering of the sample from Ushuaia with M. chilensis from Chile. All individuals in the Puerto Madryn (Argentina) sample were identified as M. platensis × M. galloprovincialis F2 (88.89%) hybrids, except one that was classified as Mediterranean M. galloprovincialis. No F1 hybrids were observed. We demonstrate that M. platensis (or Mytilus edulis platensis) and M. chilensis are distinct native taxa in South America, which indicates that the evolutionary histories of Mytilus taxa along the

  16. Single nucleotide polymorphisms unravel hierarchical divergence and signatures of selection among Alaskan sockeye salmon (Oncorhynchus nerka populations

    Directory of Open Access Journals (Sweden)

    Habicht Christopher


    Full Text Available Abstract Background Disentangling the roles of geography and ecology driving population divergence and distinguishing adaptive from neutral evolution at the molecular level have been common goals among evolutionary and conservation biologists. Using single nucleotide polymorphism (SNP multilocus genotypes for 31 sockeye salmon (Oncorhynchus nerka populations from the Kvichak River, Alaska, we assessed the relative roles of geography (discrete boundaries or continuous distance and ecology (spawning habitat and timing driving genetic divergence in this species at varying spatial scales within the drainage. We also evaluated two outlier detection methods to characterize candidate SNPs responding to environmental selection, emphasizing which mechanism(s may maintain the genetic variation of outlier loci. Results For the entire drainage, Mantel tests suggested a greater role of geographic distance on population divergence than differences in spawn timing when each variable was correlated with pairwise genetic distances. Clustering and hierarchical analyses of molecular variance indicated that the largest genetic differentiation occurred between populations from distinct lakes or subdrainages. Within one population-rich lake, however, Mantel tests suggested a greater role of spawn timing than geographic distance on population divergence when each variable was correlated with pairwise genetic distances. Variable spawn timing among populations was linked to specific spawning habitats as revealed by principal coordinate analyses. We additionally identified two outlier SNPs located in the major histocompatibility complex (MHC class II that appeared robust to violations of demographic assumptions from an initial pool of eight candidates for selection. Conclusions First, our results suggest that geography and ecology have influenced genetic divergence between Alaskan sockeye salmon populations in a hierarchical manner depending on the spatial scale. Second

  17. Single Nucleotide Polymorphism TGFβ1 R25P Correlates with Acute Toxicity during Neoadjuvant Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Smith, J. Joshua [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Wasserman, Isaac [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Icahn School of Medicine at Mount Sinai, New York, New York (United States); Milgrom, Sarah A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Chow, Oliver S.; Chen, Chin-Tung [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Patil, Sujata [Department of Epidemiology and Biostatistics, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Goodman, Karyn A. [Department of Radiation Oncology, Memorial Sloan Kettering Cancer Center, New York, New York (United States); Garcia-Aguilar, Julio, E-mail: [Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, New York (United States)


    Purpose: To validate the finding of an association between single nucleotide polymorphisms (SNPs) and toxicity during chemoradiotherapy (CRT) in rectal cancer patients, in an independent population. Methods and Materials: The cohort consisted of 165 patients who received CRT for rectal cancer from 2006 to 2012. Prospectively recorded toxicity information, graded according to the Common Terminology Criteria for Adverse Events version 3.0, was retrieved from the medical record. Additionally, a subset of 52 patients recorded their gastrointestinal symptoms weekly during CRT, using the 7-item Bowel Problems Scale. Deoxyribonucleic acid was extracted from normal tissue in the proctectomy specimens and screened for 3 SNPs: XRCC1 R399Q, XPD K751Q, and TGFβ1 R25P. Univariable and multivariable logistic regression models were constructed. Results: The median radiation dose was 50.4 Gy, and all patients received concurrent chemotherapy. Toxicities measured by the Common Terminology Criteria for Adverse Events were closely associated with patient-reported outcomes for the patients who completed the 7-item Bowel Problems Scale. Grade ≥3 toxicity occurred during CRT in 14 patients (8%). All 14 patients had either XRCC1 R399Q or TGFβ1 R25P polymorphisms. The TGFβ1 R25P polymorphism was significantly associated with grade ≥3 toxicity (odds ratio [OR] 3.47, P=.04) and, in patients who completed the Bowel Problems Scale, with grade ≥4 toxicity (OR 5.61, P=.02). The latter finding persisted in a multivariable logistic regression model controlling for ethnicity, age, and sex (adjusted OR 1.83, P=.02). Conclusions: We have validated the correlation between the TGFβ1 R25P SNP and acute toxicity during CRT in an independent cohort using both clinician- and patient-reported toxicity. The information from our study could be used as a basis to formulate a prospective trial testing the utility of this SNP as a biomarker of acute toxicity during neoadjuvant treatment in locally

  18. A mixed integer linear programming model to reconstruct phylogenies from single nucleotide polymorphism haplotypes under the maximum parsimony criterion (United States)


    Background Phylogeny estimation from aligned haplotype sequences has attracted more and more attention in the recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from medical research, to drug discovery, to epidemiology, to population dynamics. The literature on molecular phylogenetics proposes a number of criteria for selecting a phylogeny from among plausible alternatives. Usually, such criteria can be expressed by means of objective functions, and the phylogenies that optimize them are referred to as optimal. One of the most important estimation criteria is the parsimony which states that the optimal phylogeny T∗for a set H of n haplotype sequences over a common set of variable loci is the one that satisfies the following requirements: (i) it has the shortest length and (ii) it is such that, for each pair of distinct haplotypes hi,hj∈H, the sum of the edge weights belonging to the path from hi to hj in T∗ is not smaller than the observed number of changes between hi and hj. Finding the most parsimonious phylogeny for H involves solving an optimization problem, called the Most Parsimonious Phylogeny Estimation Problem (MPPEP), which is NP-hard in many of its versions. Results In this article we investigate a recent version of the MPPEP that arises when input data consist of single nucleotide polymorphism haplotypes extracted from a population of individuals on a common genomic region. Specifically, we explore the prospects for improving on the implicit enumeration strategy of implicit enumeration strategy used in previous work using a novel problem formulation and a series of strengthening valid inequalities and preliminary symmetry breaking constraints to more precisely bound the solution space and accelerate implicit enumeration of possible optimal phylogenies. We present the basic formulation and then introduce a series of provable valid constraints to reduce the solution space. We then prove

  19. Imputation Accuracy from Low to Moderate Density Single Nucleotide Polymorphism Chips in a Thai Multibreed Dairy Cattle Population

    Directory of Open Access Journals (Sweden)

    Danai Jattawa


    Full Text Available The objective of this study was to investigate the accuracy of imputation from low density (LDC to moderate density SNP chips (MDC in a Thai Holstein-Other multibreed dairy cattle population. Dairy cattle with complete pedigree information (n = 1,244 from 145 dairy farms were genotyped with GeneSeek GGP20K (n = 570, GGP26K (n = 540 and GGP80K (n = 134 chips. After checking for single nucleotide polymorphism (SNP quality, 17,779 SNP markers in common between the GGP20K, GGP26K, and GGP80K were used to represent MDC. Animals were divided into two groups, a reference group (n = 912 and a test group (n = 332. The SNP markers chosen for the test group were those located in positions corresponding to GeneSeek GGP9K (n = 7,652. The LDC to MDC genotype imputation was carried out using three different software packages, namely Beagle 3.3 (population-based algorithm, FImpute 2.2 (combined family- and population-based algorithms and Findhap 4 (combined family- and population-based algorithms. Imputation accuracies within and across chromosomes were calculated as ratios of correctly imputed SNP markers to overall imputed SNP markers. Imputation accuracy for the three software packages ranged from 76.79% to 93.94%. FImpute had higher imputation accuracy (93.94% than Findhap (84.64% and Beagle (76.79%. Imputation accuracies were similar and consistent across chromosomes for FImpute, but not for Findhap and Beagle. Most chromosomes that showed either high (73% or low (80% imputation accuracies were the same chromosomes that had above and below average linkage disequilibrium (LD; defined here as the correlation between pairs of adjacent SNP within chromosomes less than or equal to 1 Mb apart. Results indicated that FImpute was more suitable than Findhap and Beagle for genotype imputation in this Thai multibreed population. Perhaps additional increments in imputation accuracy could be achieved by increasing the completeness of pedigree information.

  20. A single nucleotide polymorphism uncovers a novel function for the transcription factor Ace2 during Candida albicans hyphal development.

    Directory of Open Access Journals (Sweden)

    Diana M Calderón-Noreña


    Full Text Available Candida albicans is a major invasive fungal pathogen in humans. An important virulence factor is its ability to switch between the yeast and hyphal forms, and these filamentous forms are important in tissue penetration and invasion. A common feature for filamentous growth is the ability to inhibit cell separation after cytokinesis, although it is poorly understood how this process is regulated developmentally. In C. albicans, the formation of filaments during hyphal growth requires changes in septin ring dynamics. In this work, we studied the functional relationship between septins and the transcription factor Ace2, which controls the expression of enzymes that catalyze septum degradation. We found that alternative translation initiation produces two Ace2 isoforms. While full-length Ace2, Ace2L, influences septin dynamics in a transcription-independent manner in hyphal cells but not in yeast cells, the use of methionine-55 as the initiation codon gives rise to Ace2S, which functions as the nuclear transcription factor required for the expression of cell separation genes. Genetic evidence indicates that Ace2L influences the incorporation of the Sep7 septin to hyphal septin rings in order to avoid inappropriate activation of cell separation during filamentous growth. Interestingly, a natural single nucleotide polymorphism (SNP present in the C. albicans WO-1 background and other C. albicans commensal and clinical isolates generates a stop codon in the ninth codon of Ace2L that mimics the phenotype of cells lacking Ace2L. Finally, we report that Ace2L and Ace2S interact with the NDR kinase Cbk1 and that impairing activity of this kinase results in a defect in septin dynamics similar to that of hyphal cells lacking Ace2L. Together, our findings identify Ace2L and the NDR kinase Cbk1 as new elements of the signaling system that modify septin ring dynamics in hyphae to allow cell-chain formation, a feature that appears to have evolved in specific C

  1. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens


    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  2. A single amino acid substitution controls DAF-dependent phenotype of echovirus 11 in rhabdomyosarcoma cells. (United States)

    Novoselov, Alexey V; Rezaykin, Alexey V; Sergeev, Alexander G; Fadeyev, Fedor A; Grigoryeva, Julia V; Sokolova, Zoya I


    Decay accelerating factor (DAF, CD55) is used by DAF-dependent (Daf+) variants of echovirus 11 (EV11) as a primary cellular receptor. The interaction of EV11 with DAF is completely reversible, therefore DAF-dependent variants require an unidentified coreceptor to initiate uncoating. Daf- variants of EV11, which do not interact with DAF, use an alternative primary cellular receptor. The aim of this study was to test the hypothesis whether the coreceptor, which is necessary for the uncoating of DAF-dependent variants, may act as an alternative primary receptor for the Daf- variants of EV11. By using the model of the two closely related daf+ and daf- clones of EV11 in rhabdomyosarcoma (RD) cell line, it was shown that a single amino acid substitution in the capsid protein VP2 could control the expression of the DAF-dependent phenotype. Anti-DAF monoclonal antibody has blocked the infection of RD cells by the DAF-dependent daf+ clone, but not by the daf- clone of EV11. Since the structural proteins of the two clones differed only in the receptor binding site for DAF, the unidentified non-DAF primary receptor for the daf- clone might have the same conformation as the uncoating coreceptor required for the daf+ clone. Despite the difference in primary receptors, both daf+ and daf- clones were equally inhibited by a monoclonal antibody to beta2-microglobulin. The monoclonal antibody B9.12.1 to class I human leukocyte antigen molecules showed no inhibitory effect in regards to either clone. The hypothesis of convergent intracellular traffic of Daf+ and Daf- variants of EV11 is discussed. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Identification of nucleotides in the 5'UTR and amino acids substitutions that are essential for the infectivity of 5'UTR-NS5A recombinant of hepatitis C virus genotype 1b (strain Con1). (United States)

    Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping


    Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  5. Effects of single nucleotide polymorphisms on human N-acetyltransferase 2 structure and dynamics by molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    M Rajasekaran

    Full Text Available BACKGROUND: Arylamine N-acetyltransferase 2 (NAT2 is an important catalytic enzyme that metabolizes the carcinogenic arylamines, hydrazine drugs and chemicals. This enzyme is highly polymorphic in different human populations. Several polymorphisms of NAT2, including the single amino acid substitutions R64Q, I114T, D122N, L137F, Q145P, R197Q, and G286E, are classified as slow acetylators, whereas the wild-type NAT2 is classified as a fast acetylator. The slow acetylators are often associated with drug toxicity and efficacy as well as cancer susceptibility. The biological functions of these 7 mutations have previously been characterized, but the structural basis behind the reduced catalytic activity and reduced protein level is not clear. METHODOLOGY/PRINCIPAL FINDINGS: We performed multiple molecular dynamics simulations of these mutants as well as NAT2 to investigate the structural and dynamical effects throughout the protein structure, specifically the catalytic triad, cofactor binding site, and the substrate binding pocket. None of these mutations induced unfolding; instead, their effects were confined to the inter-domain, domain 3 and 17-residue insert region, where the flexibility was significantly reduced relative to the wild-type. Structural effects of these mutations propagate through space and cause a change in catalytic triad conformation, cofactor binding site, substrate binding pocket size/shape and electrostatic potential. CONCLUSIONS/SIGNIFICANCE: Our results showed that the dynamical properties of all the mutant structures, especially in inter-domain, domain 3 and 17-residue insert region were affected in the same manner. Similarly, the electrostatic potential of all the mutants were altered and also the functionally important regions such as catalytic triad, cofactor binding site, and substrate binding pocket adopted different orientation and/or conformation relative to the wild-type that may affect the functions of the mutants

  6. Definition of novel GP6 polymorphisms and major difference in haplotype frequencies between populations by a combination of in-depth exon resequencing and genotyping with tag single nucleotide polymorphisms. (United States)

    Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H


    Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.

  7. Association of single nucleotide polymorphism at position 45 in adiponectin gene with plasma adiponectin level and insulin resistance in obesity

    International Nuclear Information System (INIS)

    Chen Xiaoyu; Li Xisheng; Lin Xiahong; Gao Hongzhi; Li Qiulan; Zha Jinshun


    Objective: To explore the association of single nucleotide polymorphism at position 45 (SNP45) in adiponectin gene with plasma adiponectin level and insulin resistance in obesity in Quanzhou area of Fujian province. Methods: Two hundred and forty-eight patients with obesity and 225 normal control subjects were enrolled in this study.Fasting insulin (FINS) were measured by radioimmunoassay and fasting plasma glucose (FPG), total cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) were measured by BECKMAN DXC800 biochemistry analyzer. Body mass index (BMI), waist to hip ratio,homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Plasma adiponectin levels were examined by means of enzyme-linked immunosorbentassy. The adiponectin gene SNP45 was identified by PCR-restriction fragment length polymorphism. Results: (1) Frequencies of GG+GT genotype in obesity group and normal control group were 61% and 44% respectively (χ 2 =14.182, P<0.01), and G allele frequencies were 35% and 25% (χ 2 =10.708, P<0.01). (2) In obesity group,the subjects with SNP45 GG+GT genotype had higher TG and LDL-C levels than those with TT genotype (t=2.604, P<0.01; t=5.507, P<0.01), and had lower adiponectin level than those with TT genotype (t=2.275, P<0.05), and had significantly lower HDL-L level than those with TT genotype (t=10.100, P< 0.01). (3) In normal control group,the subjects with SNP45 GG +GT genotype had significantly lower adiponectin,TG,TC levels than those with TT genotype (t=2.510, P<0.05; t=2.922, P<0.01; t=3.272, P< 0.01). (4) Logistic analysis proved that the SNP45 GG+GT genotype in obesity group was associated with decreased risk of plasma adiponectin level (OR=0.810, 95% CI : 0.673-0.975, P<0.05), and with increased risk of HOMA-IR (OR=1.746, 95% CI : 1.060-2.875, P<0.05). The SNP45 GG+GT genotype in normal control group was associated with increased risk of HOMA-IR (OR=3

  8. Novel single-nucleotide polymorphisms in the calsequestrin-1 gene are associated with Graves’ ophthalmopathy and Hashimoto’s thyroiditis

    Directory of Open Access Journals (Sweden)

    Lahooti H


    Full Text Available Hooshang Lahooti,1,2 Daniele Cultrone,1,2 Senarath Edirimanne,1,2 John P Walsh,3,4 Leigh Delbridge,5,6 Patrick Cregan,1,2 Bernard Champion,1,2 Jack R Wall1,21Thyroid Research Laboratory, Sydney Medical School – Nepean Clinical School, The University of Sydney, 2Nepean Blue Mountains Local Health District, Nepean Hospital, Kingswood, NSW, 3Department of Endocrinology and Diabetes, Sir Charles Gairdner Hospital, Nedlands, 4School of Medicine and Pharmacology, The University of Western Australia, Crawley, WA, 5Department of Surgery, Royal North Shore Hospital, 6Sydney Medical School – Northern Clinical School, The University of Sydney, St Leonards, NSW, AustraliaBackground: The eye disorder associated with Graves’ disease, called Graves’ ophthalmopathy (GO, greatly reduces the quality of life in affected patients. Expression of the calsequestrin (CASQ1 protein in thyroid tissue may be the trigger for the development of eye muscle damage in patients with GO. We determined the prevalence of rs74123279, rs3747673, and rs2275703 single-nucleotide polymorphism (SNPs in patients with autoimmune thyroid disorders, GO, Graves’ hyperthyroidism (GH, or Hashimoto’s thyroiditis (HT and control subjects with no personal or family history of autoimmune thyroid disorders. Furthermore, we measured the concentration of the CASQ1 protein in normal and Graves’ thyroid tissue, correlating levels with parameters of the eye signs, CASQ1 antibody levels, and the CASQ1 gene polymorphism rs74123279 and rs2275703.Methods: High-quality genomic DNA was isolated from fresh blood samples, assayed for identification of rs74123279, rs3747673, and rs2275703 SNPs in CASQ1 gene by MassARRAY SNP analysis using iPLEX technology of SEQUENOM.Results: DNA samples from 300 patients and 106 control subjects (100 males, 306 females with GO (n=74, GH (n=130, HT (n=96 and control subjects (n=106 were genotyped for the SNPs rs74123279, rs3747673 (n=405, and rs2275703 (n=407. The

  9. Inhibition of nucleotide excision repair by fludarabine in normal lymphocytes in vitro, measured by the alkaline single cell gel electrophoresis (comet) assay

    Energy Technology Data Exchange (ETDEWEB)

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)


    Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)

  10. Site-selective substitutional doping with atomic precision on stepped Al (111) surface by single-atom manipulation. (United States)

    Chen, Chang; Zhang, Jinhu; Dong, Guofeng; Shao, Hezhu; Ning, Bo-Yuan; Zhao, Li; Ning, Xi-Jing; Zhuang, Jun


    In fabrication of nano- and quantum devices, it is sometimes critical to position individual dopants at certain sites precisely to obtain the specific or enhanced functionalities. With first-principles simulations, we propose a method for substitutional doping of individual atom at a certain position on a stepped metal surface by single-atom manipulation. A selected atom at the step of Al (111) surface could be extracted vertically with an Al trimer-apex tip, and then the dopant atom will be positioned to this site. The details of the entire process including potential energy curves are given, which suggests the reliability of the proposed single-atom doping method.

  11. Contribution of single amino acid and codon substitutions to the production and secretion of a lipase by Bacillus subtilis. (United States)

    Skoczinski, Pia; Volkenborn, Kristina; Fulton, Alexander; Bhadauriya, Anuseema; Nutschel, Christina; Gohlke, Holger; Knapp, Andreas; Jaeger, Karl-Erich


    Bacillus subtilis produces and secretes proteins in amounts of up to 20 g/l under optimal conditions. However, protein production can be challenging if transcription and cotranslational secretion are negatively affected, or the target protein is degraded by extracellular proteases. This study aims at elucidating the influence of a target protein on its own production by a systematic mutational analysis of the homologous B. subtilis model protein lipase A (LipA). We have covered the full natural diversity of single amino acid substitutions at 155 positions of LipA by site saturation mutagenesis excluding only highly conserved residues and qualitatively and quantitatively screened about 30,000 clones for extracellular LipA production. Identified variants with beneficial effects on production were sequenced and analyzed regarding B. subtilis growth behavior, extracellular lipase activity and amount as well as changes in lipase transcript levels. In total, 26 LipA variants were identified showing an up to twofold increase in either amount or activity of extracellular lipase. These variants harbor single amino acid or codon substitutions that did not substantially affect B. subtilis growth. Subsequent exemplary combination of beneficial single amino acid substitutions revealed an additive effect solely at the level of extracellular lipase amount; however, lipase amount and activity could not be increased simultaneously. Single amino acid and codon substitutions can affect LipA secretion and production by B. subtilis. Several codon-related effects were observed that either enhance lipA transcription or promote a more efficient folding of LipA. Single amino acid substitutions could improve LipA production by increasing its secretion or stability in the culture supernatant. Our findings indicate that optimization of the expression system is not sufficient for efficient protein production in B. subtilis. The sequence of the target protein should also be considered as an

  12. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome. (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred


    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  13. Haplotypes of nine single nucleotide polymorphisms on chromosome 19q13.2-3 associated wit