WorldWideScience

Sample records for single multiplex pcr

  1. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  2. Simultaneous detection of five notifiable viral diseases of cattle by single-tube multiplex real-time RT-PCR.

    Science.gov (United States)

    Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2015-06-01

    Multiplexed real-time PCR (qPCR) assays enable the detection of several target genes in a single reaction, which is applicable for simultaneous testing for the most important viral diseases in samples obtained from ruminants with unspecific clinical symptoms. Here, reverse transcription qPCR (RT-qPCR) systems for the detection of bovine viral diarrhoea virus (BVDV) and bluetongue virus (BTV) were combined with an internal control system based on the beta-actin gene. Additionally, a background screening for three further major pathogens of cloven-hoofed animals reportable to the World Organisation for Animal Health, namely foot-and-mouth disease virus, epizootic haemorrhagic disease virus, and Rift Valley fever virus, was integrated using the identical fluorophore for the respective RT-qPCR assays. Every pathogen-specific assay had an analytical sensitivity of at least 100 genome copies per reaction within the multiplex approach, and a series of reference samples and clinical specimens obtained from cattle, but also from small ruminants, were detected reliably. The qPCR systems integrated in the background screening were even not influenced by the simultaneous amplification of very high BVDV and BTV genome copy numbers. The newly developed multiplex qPCR allows the specific and sensitive detection of five of the most important diseases of ruminants and could be used in the context of monitoring programs or for differential diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  4. Flow-through PCR on a 3D qiandu-shaped polydimethylsiloxane (PDMS) microdevice employing a single heater: toward microscale multiplex PCR.

    Science.gov (United States)

    Wu, Wenming; Loan, Kieu The Loan; Lee, Nae Yoon

    2012-05-07

    Consistent temperature control in an on-chip flow-through polymerase chain reaction (PCR) employing two or more heaters is one of the main obstacles for device miniaturization and integration when realizing micro total analysis systems (μTAS), and also leads to operational complexity. In this study, we propose a qiandu (right triangular prism)-shaped polydimethylsiloxane (PDMS) microdevice with serpentine microchannels fabricated on its slanted plane, and apply the device for an on-chip flow-through PCR employing a single heater. The inclined nature of the qiandu-shaped microdevice enables the formation of a surface temperature gradient along the slanted plane of the microdevice in a height-dependent manner by the use of a single heater, and enables liquid to traverse over wide ranges of temperatures, including the three temperature zones--denaturation, annealing, and extension temperatures--required in a typical PCR. The feasibility of the qiandu-shaped PDMS microdevice as a versatile platform for performing a flow-through PCR was examined by employing multiple templates and varying the inclination angle of the device. In addition, the potential of performing a multiplex PCR using a single qiandu-shaped PDMS microdevice was explored. A 409 bp long gene fragment effective as a marker for diagnosing lung cancer and a 230 bp long gene fragment from a plasmid vector were simultaneously amplified in less than 25 min on a single microdevice, paving the way for a microscale, multiplex PCR on a single device employing a single heater.

  5. Comparison of culture, single and multiplex real-time PCR for detection of Sabin poliovirus shedding in recently vaccinated Indian children.

    Science.gov (United States)

    Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep

    2017-08-01

    Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.

  6. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  7. Single-Step Multiplex PCR Assay for Characterization of New World Leishmania Complexes

    Science.gov (United States)

    Harris, Eva; Kropp, Gerald; Belli, Alejandro; Rodriguez, Betzabé; Agabian, Nina

    1998-01-01

    We have developed a PCR assay for one-step differentiation of the three complexes of New World Leishmania (Leishmania braziliensis, Leishmania mexicana, and Leishmania donovani). This multiplex assay is targeted to the spliced leader RNA (mini-exon) gene repeats of these organisms and can detect all three complexes simultaneously, generating differently sized products for each complex. The assay is specific to the Leishmania genus and does not recognize related kinetoplastid protozoa, such as Trypanosoma cruzi, Trypanosoma brucei, and Crithidia fasciculata. It correctly identified Leishmania species with a broad geographic distribution in Central and South America. The sensitivity of the PCR amplification ranged from 1 fg to 10 pg of DNA (0.01 to 100 parasites), depending on the complex detected. Crude extracts of cultured parasites, prepared simply by boiling diluted cultures, served as excellent templates for amplification. Crude preparations of clinical material were also tested. The assay detected L. braziliensis in dermal scrapings from cutaneous leishmanial lesions, Leishmania chagasi in dermal scrapings of atypical cutaneous leishmaniasis, and L. mexicana from lesion aspirates from infected hamsters. We have minimized the material requirements and maximized the simplicity, rapidity, and informative content of this assay to render it suitable for use in laboratories in countries where leishmaniasis is endemic. This assay should be useful for rapid in-country identification of Leishmania parasites, particularly where different Leishmania complexes are found in the same geographical area. PMID:9650950

  8. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  9. Single-step multiplex RT-PCR for simultaneous and colourimetric detection of six RNA viruses in olive trees.

    Science.gov (United States)

    Bertolini, E; Olmos, A; Martínez, M C; Gorris, M T; Cambra, M

    2001-07-01

    A single-step multiplex RT-PCR was developed for the simultaneous and colourimetric detection of six RNA viruses (Cucumber mosaic virus, Cherry leaf roll virus, strawberry latent ringspot virus, Arabis mosaic virus, Olive latent-1 virus and Olive latent-2 virus) which infect olive trees. Six compatible primer set for one-step RT-PCR amplification in a single closed-tube and 3' digoxigenin labelled probes were designed in optimal, specific and conserved regions. The method has been assessed with 195 Spanish field olive trees, suggesting that approximately 1.5% of the tested material was infected by Cucumber mosaic virus and 0.5% by Cherry leaf roll virus. This method saves time and reagent costs compared with monospecific RT-PCR which needs several reactions for the same number of tests. Using colourimetric detection, it is possible to analyse many samples, it increases sensitivity 10-fold, and whilst facilitating the interpretation of results, it avoids the use of gels and the toxic ethidium bromide. The method could be used routinely for sanitary and certification programmes.

  10. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  11. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... (DNA). Multiplex PCR amplification of the DNA was performed with slight modifications of standard PCR conditions. Single-base extension (SBE) was performed using the SNaPshot kit containing fluorescently labeled ddNTPs. The extended primers were detected on an ABI 3100 sequencer. The most important...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  12. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  13. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  14. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...

  15. A modified molecular beacons-based multiplex real-time PCR assay for simultaneous detection of eight foodborne pathogens in a single reaction and its application.

    Science.gov (United States)

    Hu, Qinghua; Lyu, Dongyue; Shi, Xiaolu; Jiang, Yixiang; Lin, Yiman; Li, Yinghui; Qiu, Yaqun; He, Lianhua; Zhang, Ran; Li, Qingge

    2014-03-01

    Foodborne disease outbreaks are often caused by one of the major pathogens. Early identification of the causal pathogen is crucial for disease control and prevention. We describe a real-time polymerase chain reaction (rtPCR) assay that can identify, in a single reaction, up to eight common foodborne bacterial pathogens, including Salmonella enterica subsp. enterica, Listeria monocytogenes, Escherichia coli O157, Vibrio parahaemolyticus, V. vulnificus, Campylobacter jejuni, Enterobacter sakazakii, and Shigella spp. This multiplex rtPCR assay takes advantage of modified molecular beacons and the multicolor combinational probe coding strategy to discriminate each pathogen and the homo-tag assisted non-dimer (HAND) system to prevent dimer formation. The detection limits of the assay ranged from 1.3×10(3) colony-forming units (CFU)/g stool (L. monocytogenes) to 1.6×10(4) CFU/g stool (Shigella spp.). The target genes were 100% specific as assessed on 986 reference strains covering 41 species since no cross-reactions were observed. The assay was applied to the detection of foodborne pathogens in 11,167 clinical samples and the results were compared with culture methods for further validation. The sensitivity and specificity of the rtPCR were 100% and 99%, respectively. When performed in a 96-well rtPCR system, more than 90 samples could be analyzed within 3 h. Given the high accuracy, sensitivity, specificity, and short turn-around time, the established assay could be used for the rapid and reliable identification of the causative pathogens responsible for a certain foodborne disease outbreak and rapid screening of these major foodborne pathogens in laboratory-based surveillance of outpatient clinical samples or even food samples.

  16. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  17. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  18. Clostridium perfringens isolate typing by multiplex PCR

    Directory of Open Access Journals (Sweden)

    MR Ahsani

    2010-01-01

    Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

  19. Application of Multiplex RT-PCR for Detection of Cucurbit-infecting Tobamovirus

    OpenAIRE

    Daryono, Budi Setiadi; Natsuaki, Keiko T.

    2016-01-01

    Cucumber green mottle mosaic virus (CGMMV) and Kyuri green mottle mosaic virus (KGMMV) are seed borne viruses and they are also transmitted mechanically during agricultural practice and through water. Hence, these viruses have potential diseases widely distributed throughout the world. To detect different strains of CGMMV and KGMMV, several specific primers for each virus were designed for single and multiplex RT-PCR. The results of single and multiplex RT-PCR showed that CGMMV was detected i...

  20. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  1. Multiplex polymerase chain reaction (PCR) on a SU-8 chip

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Bang, Dang Duong; Wolff, Anders

    2008-01-01

    the PCR. The chip performs very well with respect to heating and cooling rates with values up to around 40 °C/s and 20 °C/s, respectively, and has low power consumption (0.5–2.5 W depending on temperature). Multiplex DNA amplification by PCR for the detection of Campylobacter at species level...

  2. Detection of gene copy number aberrations in mantle cell lymphoma by a single quantitative multiplex PCR assay: clinicopathological relevance and prognosis value.

    Science.gov (United States)

    Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé

    2009-09-01

    The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.

  3. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  4. A simple procedure eliminating multiple optimization steps required in developing multiplex PCR reactions

    Energy Technology Data Exchange (ETDEWEB)

    Grondin, V.; Roskey, M.; Klinger, K.; Shuber, T. [Integrated Genetics, Framingham, MA (United States)

    1994-09-01

    The PCR technique is one of the most powerful tools in modern molecular genetics and has achieved widespread use in the analysis of genetic diseases. Typically, a region of interest is amplified from genomic DNA or cDNA and examined by various methods of analysis for mutations or polymorphisms. In cases of small genes and transcripts, amplification of single, small regions of DNA are sufficient for analysis. However, when analyzing large genes and transcripts, multiple PCRs may be required to identify the specific mutation or polymorphism of interest. Ever since it has been shown that PCR could simultaneously amplify multiple loci in the human dystrophin gene, multiplex PCR has been established as a general technique. The properities of multiplex PCR make it a useful tool and preferable to simultaneous uniplex PCR in many instances. However, the steps for developing a multiplex PCR can be laborious, with significant difficulty in achieving equimolar amounts of several different amplicons. We have developed a simple method of primer design that has enabled us to eliminate a number of the standard optimization steps required in developing a multiplex PCR. Sequence-specific oligonucleotide pairs were synthesized for the simultaneous amplification of multiple exons within the CFTR gene. A common non-complementary 20 nucleotide sequence was attached to each primer, thus creating a mixture of primer pairs all containing a universal primer sequence. Multiplex PCR reactions were carried out containing target DNA, a mixture of several chimeric primer pairs and primers complementary to only the universal portion of the chimeric primers. Following optimization of conditions for the universal primer, limited optimization was needed for successful multiplex PCR. In contrast, significant optimization of the PCR conditions were needed when pairs of sequence specific primers were used together without the universal sequence.

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Multiplex qPCR for serodetection and serotyping of hepatitis viruses: A brief review

    Science.gov (United States)

    Irshad, Mohammad; Gupta, Priyanka; Mankotia, Dhananjay Singh; Ansari, Mohammad Ahmad

    2016-01-01

    The present review describes the current status of multiplex quantitative real time polymerase chain reaction (qPCR) assays developed and used globally for detection and subtyping of hepatitis viruses in body fluids. Several studies have reported the use of multiplex qPCR for the detection of hepatitis viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), and hepatitis E virus (HEV). In addition, multiplex qPCR has also been developed for genotyping HBV, HCV, and HEV subtypes. Although a single step multiplex qPCR assay for all six hepatitis viruses, i.e., A to G viruses, is not yet reported, it may be available in the near future as the technologies continue to advance. All studies use a conserved region of the viral genome as the basis of amplification and hydrolysis probes as the preferred chemistries for improved detection. Based on a standard plot prepared using varying concentrations of template and the observed threshold cycle value, it is possible to determine the linear dynamic range and to calculate an exact copy number of virus in the specimen. Advantages of multiplex qPCR assay over singleplex or other molecular techniques in samples from patients with co-infection include fast results, low cost, and a single step investigation process. PMID:27239109

  7. A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

    Science.gov (United States)

    Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

    2015-07-07

    Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

  8. Multiplex PCR for identification of Clostridium chauvoei and Clostridium septicum

    OpenAIRE

    Assis, R.A.; Lobato, F.C.F.; Lobato, Z.I.P.; Camargos, M.F.; Nascimento, R.A.P.; Vargas, A.P.C.; Salvarani, F.M.; Uzal, F.A.

    2008-01-01

    Padronizou-se uma técnica de reação em cadeia da polimerase múltipla (PCR multiplex) para detecção de Clostridium chauvoei e Clostridium septicum em culturas puras. Foram utilizados pares de iniciadores para segmentos específicos dos genes que codificam a flagelina de C. chauvoei e a toxina alfa de C. septicum. Para avaliaçã o da PCR multiplex, foram testados 16 isolados clínicos de C. chauvoei e 15 isolados de C. septicum provenientes de ruminantes, quatro sementes vacinais de cada um desses...

  9. Application of Multiplex PCR for Detection and Differentiation of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii.

    Directory of Open Access Journals (Sweden)

    Nozhat Zebardast

    2014-12-01

    Full Text Available Entamoeba moshkovskii and E. dispar are impossible to differentiate microscopically from the pathogenic species E. histolytica. Multiplex polymerase chain reaction (Multiplex PCR is a widespread molecular biology technique for amplification of multiple targets in a single PCR experiment.For detection and differentiation of the three-microscopy indistinguishable Entamoeba species in human, multiplex PCR assay using different DNA extraction methods was studied. A conserved forward primer was derived from the middle of the small-subunit rRNA gene, and reverse primers were designed from signature sequences specific to each of these three Entamoeba species.A 166-bp PCR product with E. histolytica DNA, a 580-bp product with E. moshkovskii DNA and a 752-bp product with E. dispar DNA were generated in a single-round and multiplex PCR reaction.We recommend this PCR assay as an accurate, rapid, and effective diagnostic method for the detection and discrimination of these three Entamoeba species in both routine diagnosis of amoebiasis and epidemiological surveys.

  10. Comparison of multiplex-PCR and antigen detection for differential diagnosis of Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Helena Lúcia Carneiro Santos

    Full Text Available Amebiasis is an infection caused by Entamoeba histolytica. However, differentiation between E. histolytica and Entamoeba dispar, which are morphologically identical species, is essential for treatment decision, precaution of the invasive disease and public health. The purpose of the present study was to evaluate a Multiplex -PCR for detection and differentiation of E. histolytica from E. dispar from fresh stool samples in comparison with the coproantigen commercial ELISA. Microscopic examination of stools using the Coprotest method, detection of stool antigen by enzyme-linked immunosorbent assay kit and a home made Multiplex-PCR, were used for the diagnosis of amoebiasis infection. Analysis of the 127 stools samples by microscopy examination demonstrated that only 27 (21% samples were positive for E. histolytica/E. dispar complex. Among these stool samples, 11 were positive by Multiplex-PCR, with nine presenting the diagnostic fragment characteristic of E. dispar (96 bp and two presenting diagnostic fragment of E. histolytica (132 bp. Among negative samples detected by microscopic examination, three positive samples for E. dispar and one positive for E. histolytica by Multiplex-PCR was observed. This denotes a low sensibility of microscopic examination when a single stool sample is analyzed. Assay for detection of E. histolytica antigen was concordant with multiplex-PCR in relation to E. histolytica. Statistical analysis comparing the sensibility tests was not done because of the low number of E. histolytica cases. The results demonstrate the importance of the specific techniques use for the differentiation between E. histolytica and E. dispar.

  11. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  12. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Mervat Gamal Eldin Mansour

    Multiplex reverse transcription-PCR-enzyme hybridization assay and immunofluorescence antigen detection techniques for the detection of four viral respiratory pathogens (Influenza viruses A & B and Respiratory Syncitial. Viruses A & B) were targeted to evaluate their diagnostic yield for these patients in our study. Among.

  13. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Multiplex reverse transcription-PCR-enzyme hybridization assay and immunofluorescence antigen detection techniques for the detection of four viral respiratory pathogens (Influenza viruses A & B and Respiratory Syncitial Viruses A & B) were targeted to evaluate their diagnostic yield for these patients in our study. Among ...

  14. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    Multiplex polymerase chain reaction (PCR) and fluorescence-based capillary electrophoresis (CE) of blood and tissue samples have been used to distinguish between deer species such as red deer, sika deer, wapiti and reindeer. We constructed 4 species-specific primers by using the D-loop of mitochondrial DNA and ...

  15. multiplex PCR and mutation screening in patients from India with ...

    Indian Academy of Sciences (India)

    We used multiplex PCR followed by sequencing to screen for mutations in the 14 exons of the RPE65 gene in early-childhood-onset autosomal recessive retinitis pigmentosa (arRP) and Leber's congenital amaurosis (LCA) patients. The RPE65 protein is believed to play an important role in the metabolism of vitamin A in ...

  16. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. [Multiplex PCR assay for the detection of Angiostrongylus cantonensis larvae in Pomacea canaliculata].

    Science.gov (United States)

    Wei, Fu-Rong; Liu, He-Xiang; Lv, Shan; Hu, Ling; Zhang, Yi

    2010-10-30

    To establish a multiplex PCR assay for detecting Angiostrongylus cantonensis larvae in Pomacea canaliculata. A pair of specific primers was designed based on the sequences of the small subunit rDNA of A. cantonensis (GenBank jAY295804), in combination with 16s rDNA specific primers of P. canaliculata, a multiplex PCR was developed. The PCR was performed on positive and negative snails, and the amplified products were analyzed by agarose gel electrophoresis and DNA sequencing. DNA template of 200 III stage larvae of A. cantonensis was diluted by negative snail DNA (1200 ng/microl, 120 ng/microl, 12 ng/microl, 1200 pg/microl, 120 pg/microl and 12 pg/microl), to find the minimum detectable level. Single blind method was used to evaluate the accuracy. After being detected by lung microscopy, 172 snails from field were tested by the multiplex PCR to assess the sensitivity and specificity. Agarose gel electrophoresis and DNA sequencing analysis indicated that the target sequences were efficiently amplified by the PCR assay (550 bp for P. canaliculata, 405 bp for A. cantonensis). The minimum detectable level was 120 pg/microl. The coincidence between the two methods stood for 84.3% (145/172), including 45 positives and 100 negatives. 24 snails were PCR positive and microscopy negative, 3 snails were PCR negative and microscopy positive. The sensitivity and specificity of multiplex PCR was 93.8% and 80.6%, respectively. Its positive rate (40.1%, 69/172) was significant higher than that of lung-microscopy (27.9%, 48/172)(chi2 = 14.8, P < 0.01). A multiplex PCR method has been developed for the detection of A. cantonensis larvae in P. canaliculata.

  18. Evaluation of new multiplex PCR primers for the identification ofPlasmodium species found in Sabah, Malaysia.

    Science.gov (United States)

    Stanis, Cheronie Shely; Song, Beng Kah; Chua, Tock Hing; Lau, Yee Ling; Jelip, Jenarun

    2016-01-05

    Malaria is a major public health problem, especially in the Southeast Asia region, caused by 5 species of Plasmodium (P. falciparum, P. vivax, P. malariae, P. ovale, and P. knowlesi). The aim of this study was to compare parasite species identification methods using the new multiplex polymerase chain reaction (PCR) against nested PCR and microscopy. Blood samples on filter papers were subject to conventional PCR methods using primers designed by us in multiplex PCR and previously designed primers of nested PCR. Both sets of results were compared with microscopic identification. Of the 129 samples identified as malaria-positive by microscopy, 15 samples were positive for P. falciparum, 14 for P. vivax, 6 for P. knowlesi, 72 for P. malariae, and 2 for mixed infection of P. falciparum/P. malariae. Both multiplex and nested PCR identified 12 P. falciparum single infections. For P. vivax, 9 were identified by multiplex and 12 by nested PCR. For 72 P. malariae cases, multiplex PCR identified 58 as P. knowlesi and 10 as P. malariae compared to nested PCR, which identified 59 as P. knowlesi and 7 as P. malariae. Multiplex PCR could be used as alternative molecular diagnosis for the identification of all Plasmodium species as it requires a shorter time to screen a large number of samples.

  19. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  20. Molecular Subtyping of Salmonella Typhimurium with Multiplex Oligonucleotide Ligation-PCR (MOL-PCR).

    Science.gov (United States)

    Wuyts, Véronique; Mattheus, Wesley; Roosens, Nancy H C; Marchal, Kathleen; Bertrand, Sophie; De Keersmaecker, Sigrid C J

    2017-01-01

    A multiplex oligonucleotide ligation-PCR (MOL-PCR) assay is a valuable high-throughput technique for the detection of bacteria and viruses, for characterization of pathogens and for diagnosis of genetic diseases, as it allows one to combine different types of molecular markers in a high-throughput multiplex assay. A MOL-PCR assay starts with a multiplex oligonucleotide ligation reaction for detection of the molecular marker, followed by a singleplex PCR for signal amplification and analysis of the MOL-PCR products on a Luminex platform. This last step occurs through a liquid bead suspension array in which the MOL-PCR products are hybridized to MagPlex-TAG beads.In this chapter, we describe the complete procedure for a MOL-PCR assay for subtyping of Salmonella enterica subsp. enterica serovar Typhimurium (S. Typhimurium) and its monophasic variant S. 1,4[5],12:i:- from DNA isolation through heat lysis up to data interpretation through a Gödel Prime Product. The subtyping assay consists of 50 discriminative molecular markers and two internal positive control markers divided over three MOL-PCR assays.

  1. Detection of diarrheagenic Escherichia coli by multiplex PCR

    Directory of Open Access Journals (Sweden)

    A Hegde

    2012-01-01

    Full Text Available Background: Diarrheagenic E.coli (DEC are an important cause of childhood diarrhea.Identification of DEC strains needs to detect factors that determine the virulence of these organisms. There is not much data regarding the importance of DEC as a cause of diarrhea in children in India.The prevalence of DEC in children belowfive years with and without diarrhea was studied using two multiplex PCR assays. Materials and Methods: Two multiplex polymerase chain reaction assays were used to detect genes of five types of DEC.The targets selected for each category were eae and bfpA (bundle-forming pilus forEnteropathogenic E.coli (EPEC, hlyA for Enterohemorrhagic E.coli (EHEC, elt and stla for Enterotoxigenic E.coli (ETEC, CVD432 for Enteroaggregative E.coli (EAEC and ial for Enteroinvasive E.coli (EIEC. Results: In 200 children with diarrhea 52 (26% DEC infections were found. Among 100 controls 8 (8% DEC infections were found. EAEC was the most common DEC by multiplex PCR both in cases (26, 13%and controls (5,5%, followed byEPEC seen in 16% cases and 3% controls. ETEC and EIEC were found in 7 (3.5% and 3 (1.5% of the diarrheal cases. EIEC and ETEC were not detected in the control cases. EHEC was not isolated from either the diarrheal or control cases. Conclusion: DEC strains are a significant cause of diarrhea in children. The two Multiplex PCR assays can be used for the detection of DEC in routine diagnostic laboratories. These assays are specific and sensitive for the rapid detection of DEC. EAEC was the most frequent pathotype in the population under study.

  2. Optimization of ultrahigh-speed multiplex PCR for forensic analysis.

    Science.gov (United States)

    Gibson-Daw, Georgiana; Crenshaw, Karin; McCord, Bruce

    2018-01-01

    In this paper, we demonstrate the design and optimization of an ultrafast PCR amplification technique, used with a seven-locus multiplex that is compatible with conventional capillary electrophoresis systems as well as newer microfluidic chip devices. The procedure involves the use of a high-speed polymerase and a rapid cycling protocol to permit multiplex PCR amplification of forensic short tandem repeat loci in 6.5 min. We describe the selection and optimization of master mix reagents such as enzyme, buffer, MgCl 2 , and dNTPs, as well as primer ratios, total volume, and cycle conditions, in order to get the best profile in the shortest time possible. Sensitivity and reproducibility studies are also described. The amplification process utilizes a small high-speed thermocycler and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The seven loci of the multiplex were taken from conventional STR genotyping kits and selected for their size and lack of overlap. Analysis was performed using conventional capillary electrophoresis and microfluidics with fluorescent detection. Overall, this technique provides a more rapid method for rapid sample screening of suspects and victims. Graphical abstract Rapid amplification of forensic DNA using high speed thermal cycling followed by capillary or microfluidic electrophoresis.

  3. Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

    Science.gov (United States)

    Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

    2011-01-01

    In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

  4. Differential diagnosis of Taenia asiatica using multiplex PCR.

    Science.gov (United States)

    Jeon, Hyeong-Kyu; Chai, Jong-Yil; Kong, Yoon; Waikagul, Jitra; Insisiengmay, Bounnaloth; Rim, Han-Jong; Eom, Keeseon S

    2009-02-01

    Taenia asiatica and T. saginata are frequently confused tapeworms due to their morphological similarities and sympatric distribution in Asian regions. To resolve this problem, a high-resolution multiplex PCR assay was developed to distinguish T. asiatica infections from infection with other human Taenia tapeworms. For molecular characterization, the species specificity of all materials used was confirmed by sequencing of the cox1 gene. Fifty-two samples were analyzed in this study, comprising 20 samples of T. asiatica genomic DNA from China, Korea, and the Philippines; 24 samples of T. saginata from Belgium, Chile, China, Ethiopia, France, Indonesia, Korea, Laos, the Philippines, Poland, Taiwan, Thailand, and Switzerland; and 10 samples of T. solium from Cape Verde, China, Honduras, and Korea. The diagnostic quality of the results obtained using PCR and species-specific primers designed from valine tRNA and NADH genes was equal to that based on the nucleotide sequencing of the cox1 gene. Using oligonucleotide primers Ta4978F, Ts5058F, Tso7421F, and Rev7915, the multiplex PCR assay was useful for the differentially diagnosing T. asiatica, T. saginata, and T. solium based on 706-, 629-, and 474-bp bands.

  5. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  6. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  7. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection ofCylindrocladium scopariumon Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  8. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  9. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  10. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics.

    Science.gov (United States)

    Kim, Hyun-Joong; Ryu, Ji-Oh; Lee, Shin-Young; Kim, Ei-Seul; Kim, Hae-Yeong

    2015-10-26

    The genus Vibrio is clinically significant and major pathogenic Vibrio species causing human Vibrio infections are V. cholerae, V. parahaemolyticus, V. vulnificus, V. alginolyticus and V. mimicus. In this study, we screened for novel genetic markers using comparative genomics and developed a Vibrio multiplex PCR for the reliable diagnosis of the Vibrio genus and the associated major pathogenic Vibrio species. A total of 30 Vibrio genome sequences were subjected to comparative genomics, and specific genes of the Vibrio genus and five major pathogenic Vibrio species were screened. The designed primer sets from the screened genes were evaluated by single PCR using DNAs from various Vibrio spp. and other non-Vibrio bacterial strains. A sextuplet multiplex PCR using six primer sets was developed to enable detection of the Vibrio genus and five pathogenic Vibrio species. The designed primer sets from the screened genes yielded specific diagnostic results for target the Vibrio genus and Vibrio species. The specificity of the developed multiplex PCR was confirmed with various Vibrio and non-Vibrio strains. This Vibrio multiplex PCR was evaluated using 117 Vibrio strains isolated from the south seashore areas in Korea and Vibrio isolates were identified as Vibrio spp., V. parahaemolyticus, V. vulnificus and V. alginolyticus, demonstrating the specificity and discriminative ability of the assay towards Vibrio species. This novel multiplex PCR method could provide reliable and informative identification of the Vibrio genus and major pathogenic Vibrio species in the food safety industry and in early clinical treatment, thereby protecting humans against Vibrio infection.

  11. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  12. Simple and fast multiplex PCR method for detection of species origin in meat products.

    Science.gov (United States)

    Izadpanah, Mehrnaz; Mohebali, Nazanin; Elyasi Gorji, Zahra; Farzaneh, Parvaneh; Vakhshiteh, Faezeh; Shahzadeh Fazeli, Seyed Abolhassan

    2018-02-01

    Identification of animal species is one of the major concerns in food regulatory control and quality assurance system. Different approaches have been used for species identification in animal origin of feedstuff. This study aimed to develop a multiplex PCR approach to detect the origin of meat and meat products. Specific primers were designed based on the conserved region of mitochondrial Cytochrome C Oxidase subunit I ( COX1 ) gene. This method could successfully distinguish the origin of the pig, camel, sheep, donkey, goat, cow, and chicken in one single reaction. Since PCR products derived from each species represent unique molecular weight, the amplified products could be identified by electrophoresis and analyzed based on their size. Due to the synchronized amplification of segments within a single PCR reaction, multiplex PCR is considered to be a simple, fast, and inexpensive technique that can be applied for identification of meat products in food industries. Nowadays, this technique has been considered as a practical method to identify the species origin, which could further applied for animal feedstuffs identification.

  13. Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

    Science.gov (United States)

    Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

    2015-01-01

    Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

  14. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  15. A multiplex PCR assay for the simultaneous identification of three mealybug species (Hemiptera: Pseudococcidae).

    Science.gov (United States)

    Saccaggi, D L; Krüger, K; Pietersen, G

    2008-02-01

    Molecular species identification is becoming more wide-spread in diagnostics and ecological studies, particularly with regard to insects for which morphological identification is difficult or time-consuming. In this study, we describe the development and application of a single-step multiplex PCR for the identification of three mealybug species (Hemiptera: Pseudococcidae) associated with grapevine in South Africa: Planococcus ficus (vine mealybug), Planococcus citri (citrus mealybug) and Pseudococcus longispinus (longtailed mealybug). Mealybugs are pests on many commercial crops, including grapevine, in which they transmit viral diseases. Morphological identification of mealybug species is usually time-consuming, requires a high level of taxonomic expertise and usually only adult females can be identified. The single-step multiplex PCR developed here, based on the mitochondrial cytochrome c oxidase subunit 1 (CO I) gene, is rapid, reliable, sensitive, accurate and simple. The entire identification protocol (including DNA extraction, PCR and electrophoresis) can be completed in approximately four hours. Successful DNA extraction from laboratory and unparasitized field-collected individuals stored in absolute ethanol was 97%. Specimens from which DNA could be extracted were always correctly identified (100% accuracy). The technique developed is simple enough to be implemented in any molecular laboratory. The principles described here can be extended to any organism for which rapid, reliable identification is needed.

  16. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  17. Multiplex RT-PCR for detection and identification of three necroviruses that infect olive trees

    OpenAIRE

    Varanda, Carla; Cardoso, Joana M.S.; Félix, M. Rosário; Oliveira, Solange; Clara, M.Ivone

    2010-01-01

    An optimized multiplex RT-PCR assay was developed to discriminate three necrovirus (Olive latent virus 1 (OLV-1), Tobacco necrosis virus D (TNV-D) and Olive mild mosaic virus (OMMV)) that infect olive trees. An olive orchard consisting of 54 trees of cv. "Galega vulgar" in the south of Portugal was surveyed. dsRNA fraction was used as template and revealed the 3 viruses, singly or in multiple infections, present in 17 out of 54 trees in the orchard. OMMV was the most frequent occurring in 15 ...

  18. Multiplex PCR assay to discriminate four neighbouring species of the Calliptamus genus (Orthoptera: Acrididae) from France.

    Science.gov (United States)

    Blanchet, E; Blondin, L; Gagnaire, P A; Foucart, A; Vassal, J M; Lecoq, M

    2010-12-01

    Definition of the genus Calliptamus (Orthoptera: Acrididae) has generated many taxonomic debates. Even now, the existence of different geographical morphs hinders species determination, particularly as concerns females and larvae. Some of these species are observed in southern France and are recognized as potential pests. To circumvent problems of species identification in ecological surveys, we developed a single multiplex PCR method based on mitochondrial Cytochrome Oxydase I diagnostic polymorphisms to differentiate between the four species, Calliptamus italicus, C. wattenwylianus, C. siciliae and C. barbarus, in southern regions of France.

  19. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  20. Multiplex single particle analysis in microfluidics.

    Science.gov (United States)

    Dannhauser, D; Romeo, G; Causa, F; De Santo, I; Netti, P A

    2014-10-21

    A straightforward way to measure separated micrometric sized particles in microfluidic flow is reported. The light scattering profile (LSP) of each single particle is fully characterized by using a CMOS-camera based small angle light scattering (SALS) apparatus, ranging from 2° up to 30°. To ensure controlled particle passage through the incident laser, a viscoelastic 3D alignment effect by viscoelastic induced particle migration has been implemented in a simple and cost-effective microfluidic device. Different polystyrene particle sizes are measured in microfluidic flows and the obtained scattering signatures are matched with the Lorenz-Mie based scattering theory. The results confirm the possibility of using this apparatus for real multiplex particle analyses in microfluidic particle flows.

  1. A multiplex PCR for the detection of Fasciola hepatica in the intermediate snail host Galba cubensis.

    Science.gov (United States)

    Alba, Annia; Vázquez, Antonio A; Hernández, Hilda; Sánchez, Jorge; Marcet, Ricardo; Figueredo, Mabel; Sarracent, Jorge; Fraga, Jorge

    2015-07-30

    Fasciolosis is a snail-borne trematode infection that has re-emerged as a human disease, and is considered a significant problem for veterinary medicine worldwide. The evaluation of the transmission risk of fasciolosis as well as the efficacy of the strategies for its control could be carried out through epidemiological surveillance of the snails that act as intermediate hosts of the parasites. The present study aimed to develop the first multiplex PCR to detect Fasciola hepatica in Galba cubensis, an important intermediate host of the parasite in the Americas and especially in the Caribbean basin. The multiplex PCR was optimized for the amplification of a 340 bp fragment of the second internal transcribed spacer (ITS-2) of F. hepatica rDNA, while another set of primers was designed and used to amplify a conserved segment of the nuclear 18S rDNA of the snail (451 bp), as an internal control of the reaction. The assay was able to detect up to 100 pg of the parasite even at high concentrations of snail DNA, an analytical sensitivity that allows the detection of less than a single miracidium, which is the minimal biological infestation unit. A controlled laboratory-reared G. cubensis - F. hepatica system was used for the evaluation of the developed multiplex PCR, and 100% sensitivity and specificity was achieved. This assay constitutes a novel, useful and suitable technique for the survey of fasciolosis transmission through one of the main intermediate hosts in the Western hemisphere. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  3. gyrB Multiplex PCR To Differentiate between Acinetobacter calcoaceticus and Acinetobacter Genomic Species 3 ▿

    OpenAIRE

    Higgins, Paul G.; Lehmann, Marlene; Wisplinghoff, Hilmar; Seifert, Harald

    2010-01-01

    A previously established multiplex PCR that identifies to the species level Acinetobacter baumannii and Acinetobacter genomic species 13TU (GS13TU) was expanded to include Acinetobacter calcoaceticus and Acinetobacter genomic species 3.

  4. gyrB Multiplex PCR To Differentiate between Acinetobacter calcoaceticus and Acinetobacter Genomic Species 3 ▿

    Science.gov (United States)

    Higgins, Paul G.; Lehmann, Marlene; Wisplinghoff, Hilmar; Seifert, Harald

    2010-01-01

    A previously established multiplex PCR that identifies to the species level Acinetobacter baumannii and Acinetobacter genomic species 13TU (GS13TU) was expanded to include Acinetobacter calcoaceticus and Acinetobacter genomic species 3. PMID:20881170

  5. gyrB multiplex PCR to differentiate between Acinetobacter calcoaceticus and Acinetobacter genomic species 3.

    Science.gov (United States)

    Higgins, Paul G; Lehmann, Marlene; Wisplinghoff, Hilmar; Seifert, Harald

    2010-12-01

    A previously established multiplex PCR that identifies to the species level Acinetobacter baumannii and Acinetobacter genomic species 13TU (GS13TU) was expanded to include Acinetobacter calcoaceticus and Acinetobacter genomic species 3.

  6. Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping

    Science.gov (United States)

    Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

  7. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  8. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  9. Development of multiplex-PCR assay for rapid detection of Candida spp.

    Directory of Open Access Journals (Sweden)

    Ni Made A. Tarini

    2010-05-01

    Full Text Available Aim Candida spp. infection commonly occur in immunocompromised patients. Biochemical assay for identification of Candida spp. is time-consuming and shows many undetermined results. Specific detection for antibody, antigen and metabolites of Candida spp. had low sensitivity and specificity. In this study, we developed a rapid diagnostic method, Multiplex-PCR, to identify Candida spp.Methods Five Candida spp. isolates were cultured, identifi ed with germ tube and API® 20 C AUX (BioMerieux® SA kit. Furthermore, DNA was purified by QIAamp DNA mini (Qiagen® kit for Multiplex-PCR assay.Results DNA detection limit by Multiplex-PCR assays for C. albicans, C. tropicalis, C. parapsilosis, C. krusei and C. glabrata were 4 pg, 0.98 pg, 0.98 pg, 0.5 pg and 16 pg respectively. This assay was also more sensitive than culture in that Multiplex-PCR could detect 2.6-2.9 x 100 CFU/ml, whereas culture 2.6-2.9 x 102 CFU/ml.Conclusion Multiplex-PCR is much more sensitive than culture and thus, can be recommended as a sensitive and specific assay for identification of Candida spp. (Med J Indones 2010; 19:83-7Keywords: Candida spp., multiplex-PCR

  10. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Science.gov (United States)

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  11. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  12. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification.

    Directory of Open Access Journals (Sweden)

    Junsun Kim

    Full Text Available Real-time PCR, also called quantitative PCR (qPCR, has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN. One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction.

  13. Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed

    Directory of Open Access Journals (Sweden)

    Al-ssum, R. M.

    2010-01-01

    Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.

  14. Use of Multiplex PCR and PCR Restriction Enzyme Analysis for Detection and Exploration of the Variability in the Free-Living Amoeba Naegleria in the Environment

    Science.gov (United States)

    Pélandakis, Michel; Pernin, Pierre

    2002-01-01

    A multiplex PCR was developed to simultaneously detect Naegleria fowleri and other Naegleria species in the environment. Multiplex PCR was also capable of identifying N. fowleri isolates with internal transcribed spacers of different sizes. In addition, restriction fragment length polymorphism analysis of the PCR product distinguished the main thermophilic Naegleria species from the sampling sites. PMID:11916734

  15. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  16. Simultaneous detection and differentiation of Entamoeba histolytica, E. dispar, E. moshkovskii, Giardia lamblia and Cryptosporidium spp. in human fecal samples using multiplex PCR and qPCR-MCA.

    Science.gov (United States)

    Zebardast, Nozhat; Yeganeh, Farshid; Gharavi, Mohammad Javad; Abadi, Alireza; Seyyed Tabaei, Seyyed Javad; Haghighi, Ali

    2016-10-01

    Entamoeba histolytica, Giardia lamblia and Cryptosporidium spp. are common causes of diarrheal and intestinal diseases all over the world. Microscopic methods are useful in the diagnosis of intestinal parasites (IPs), but their sensitivity was assessed approximately 60 percent. Recently, molecular techniques have been used increasingly for the identification and characterization of the parasites. Among those, in this study we have used multiplex PCR and Real-time PCR with melting curve analysis (qPCR-MCA) for simultaneous detection and differentiation of E. histolytica, E. dispar, E. moshkovskii, G. lamblia and Cryptosporidium spp. in human fecal samples. Twenty DNA samples from 12 E. histolytica and 8 E. dispar samples and twenty stool samples confirmed positive for G. lamblia and Cryptosporidium spp. were analyzed. After DNA extraction from the samples, multiplex PCR was done for detection and differentiation of above mentioned parasites. QPCR-MCA was also performed for the detection and differentiation of 11 isolates of above mentioned parasite in a cycle with a time and temperature. Multiplex PCR was able to simultaneous detect and differentiate of above mentioned parasite in a single reaction. QPCR-MCA was able to differentiate genus and species those five protozoa using melting temperature simultaneously at the same time and temperature programs. In total, qPCR-MCA diagnosed 7/11 isolation of E. histolytica, 6/8 isolation of E. dispar, 1/1 E. moshkovskii Laredo, 10/11 G. Lamblia and 6/11 Cryptosporidium spp. Application of multiplex PCR for detection of more than one species in a test in developing countries, at least in reference laboratories has accurate diagnosis and plays a critical role in differentiation of protozoan species. Multiplex PCR assay with a template and multi template had different results and it seems that using a set of primers with one template has higher diagnostic capability in compare with multi template. The results of this study

  17. Simultaneous Detection of Bacteroides forsythus and Prevotella intermedia by 16S rRNA Gene-Directed Multiplex PCR

    Science.gov (United States)

    Conrads, Georg; Flemmig, Thomas F.; Seyfarth, Ilse; Lampert, Friedrich; Lütticken, Rudolf

    1999-01-01

    In a 16S rRNA gene-directed multiplex PCR, Prevotella intermedia- and Bacteroides forsythus-specific reverse primers were combined with a single conserved forward primer. A 660-bp fragment and an 840-bp fragment that were specific for both species could be amplified simultaneously. A total of 152 clinical samples, subgingival plaque and swabs of three different oral mucosae, from 38 periodontitis patients were used for the evaluation. PMID:10203541

  18. Multiplexing 200 spatial modes with a single hologram

    Science.gov (United States)

    Rosales-Guzmán, Carmelo; Bhebhe, Nkosiphile; Mahonisi, Nyiku; Forbes, Andrew

    2017-11-01

    The on-demand tailoring of light's spatial shape is of great relevance in a wide variety of research areas. Computer-controlled devices, such as spatial light modulators (SLMs) or digital micromirror devices, offer a very accurate, flexible and fast holographic means to this end. Remarkably, digital holography affords the simultaneous generation of multiple beams (multiplexing), a tool with numerous applications in many fields. Here, we provide a self-contained tutorial on light beam multiplexing. Through the use of several examples, the readers will be guided step by step in the process of light beam shaping and multiplexing. Additionally, we provide a quantitative analysis on the multiplexing capabilities of SLMs to assess the maximum number of beams that can be multiplexed on a single SLM, showing approximately 200 modes on a single hologram.

  19. A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

    NARCIS (Netherlands)

    Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

    2015-01-01

    A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

  20. Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

    Science.gov (United States)

    Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

  1. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  2. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

    Directory of Open Access Journals (Sweden)

    V Hallur

    2015-01-01

    Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  3. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  4. Rapid detection of carbapenemase genes by multiplex real-time PCR.

    Science.gov (United States)

    Monteiro, Jussimara; Widen, Raymond H; Pignatari, Antonio C C; Kubasek, Carly; Silbert, Suzane

    2012-04-01

    To develop a single multiplex real-time PCR assay to detect six different genetic types of carbapenemases already identified in Enterobacteriaceae (KPC, GES, NDM, IMP, VIM and OXA-48). A total of 58 bacterial isolates were tested. Thirty were previously characterized as resistant to carbapenems and documented by PCR and sequencing analysis to carry the following genes: bla(KPC) type, bla(GES) type, bla(IMP) type, bla(VIM) type, bla(OXA-48) and bla(NDM-1). These positive strains included 21 Enterobacteriaceae, 1 Acinetobacter baumannii and 8 Pseudomonas aeruginosa isolates. The remaining 28 isolates previously tested susceptible to carbapenems and were negative for these genes. Bacterial DNA was extracted using the easyMag extractor (bioMérieux, France). The real-time PCR was performed using the Rotor-Gene 6000 instrument (Corbett Life Science, Australia) and specific primers for each carbapenemase target were designed using the DNAStar software (Madison, WI, USA). Each one of the six carbapenemase genes tested presented a different melting curve after PCR amplification. The melting temperature (T(m)) analysis of the amplicons identified was as follows: bla(IMP) type (T(m) 80.1°C), bla(OXA-48) (T(m) 81.6°C), bla(NDM-1) (T(m) 84°C), bla(GES) type (T(m) 88.6°C), bla(VIM) type (T(m) 90.3°C) and bla(KPC) type (T(m) 91.6°C). No amplification was detected among the negative samples. The results showed 100% concordance with the genotypes previously identified. The new assay was able to detect the presence of six different carbapenemase gene types in a single 3 h PCR.

  5. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Directory of Open Access Journals (Sweden)

    Ghalia Boubaker

    Full Text Available Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10 and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3, E. equinus (G4, E. ortleppi (G5, and E. canadensis (G6-G10. The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR allowing three levels of discrimination: (i Echinococcus genus, (ii E. granulosus complex in common, and (iii the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20 and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13. The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%. Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.

  6. Serotype and mating type characterization of Cryptococcus neoformans by Multiplex PCR Caracterização de sorotipo e "mating type" de Cryptococcus neoformans por PCR Multiplex

    Directory of Open Access Journals (Sweden)

    Vívian Gonçalves Carvalho

    2007-08-01

    Full Text Available Cryptococcus neoformans is an encapsulated yeast, etiological agent of cryptococcosis. The species is commonly associated with pigeon droppings and plant materials. The aim of the present work was to verify the presence of the yeast in pigeon droppings, and to identify the isolates obtained in serotypes and mating types (MAT. Ten samples of pigeon droppings were collected in the rural area of the city of Alfenas, Brazil. Samples were inoculated in agar Niger medium for fungal isolation and 22 isolates with characteristics of C. neoformans were obtained. The serotypes and MAT were determined by multiplex PCR using specific primers. Serotypes were also determined by using the Kit Crypto Check. Among the 22 samples evaluated, eight were identified as C. neoformans by classic identification tests. These samples were characterized as serotype A by the Kit Crypto check and as serotype A MAT alpha by the multiplex PCR. The present study reinforces the evidence that pigeon droppings are a reservoir for C. neoformans and confirms the prevalence of C. neoformans var. grubii (Aalpha among environmental isolates. It also demonstrates that multiplex PCR is an acceptable alternative for serotype analysis because it reduces the costs for each reaction and analyses serotype and MAT simultaneously.Cryptococcus neoformans é levedura encapsulada, agente etiológico da criptococose. As espécies são comumente associadas com fezes de pombos e material vegetal. O objetivo do presente trabalho foi verificar a presença de leveduras em fezes de pombos e identificar os isolados em relação aos sorotipos e "mating types". Dez amostras de fezes de pombos foram coletadas na zona rural da cidade de Alfenas, Brasil. As amostras foram inoculadas em agar Niger e 22 isolados com características de C. neoformans foram obtidos. Os sorotipos e "mating types" foram determinados pela PCR multiplex e os sorotipos foram identificados também pelo Kit Crypto Check. Dentre as 22

  7. Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

    Directory of Open Access Journals (Sweden)

    K. Kurta

    2017-12-01

    Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

  8. Application of a multiplex PCR assay for Campylobacter fetus detection and subspecies differentiation in uncultured samples of aborted bovine fetuses.

    Science.gov (United States)

    Iraola, Gregorio; Hernández, Martín; Calleros, Lucía; Paolicchi, Fernando; Silveyra, Silvia; Velilla, Alejandra; Carretto, Luis; Rodríguez, Eliana; Pérez, Ruben

    2012-12-01

    Campylobacter (C.) fetus (epsilonproteobacteria) is an important veterinary pathogen. This species is currently divided into C. fetus subspecies (subsp.) fetus (Cff) and C. fetus subsp. venerealis (Cfv). Cfv is the causative agent of bovine genital Campylobacteriosis, an infectious disease that leads to severe reproductive problems in cattle worldwide. Cff is a more general pathogen that causes reproductive problems mainly in sheep although cattle can also be affected. Here we describe a multiplex PCR method to detect C. fetus and differentiate between subspecies in a single step. The assay was standardized using cultured strains and successfully used to analyze the abomasal liquid of aborted bovine fetuses without any pre-enrichment step. Results of our assay were completely consistent with those of traditional bacteriological diagnostic methods. Furthermore, the multiplex PCR technique we developed may be easily adopted by any molecular diagnostic laboratory as a complementary tool for detecting C. fetus subspecies and obtaining epidemiological information about abortion events in cattle.

  9. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood.

    Science.gov (United States)

    Innings, Asa; Ullberg, Måns; Johansson, Anders; Rubin, Carl Johan; Noreus, Niklas; Isaksson, Magnus; Herrmann, Björn

    2007-03-01

    We have developed a single-tube multiplex real-time PCR method for the detection of the eight most common Candida species causing septicemia: Candida albicans, C. dubliniensis, C. famata, C. glabrata, C. guilliermondii, C. krusei, C. parapsilosis, and C. tropicalis. The method developed targets the RNase P RNA gene RPR1. Sequences of this gene were determined for seven of the Candida species and showed surprisingly large sequence variation. C. glabrata was found to have a gene that was five times longer gene than those of the other species, and the nucleotide sequence similarity between C. krusei and C. albicans was as low as 55%. The multiplex PCR contained three probes that enabled the specific detection of C. albicans, C. glabrata, and C. krusei and a fourth probe that allowed the general detection of the remaining species. The method was able to detect 1 to 10 genome copies when the detection limit was tested repeatedly for the four species C. albicans, C. glabrata, C. krusei, and C. guilliermondii. No significant difference in the detection limit was seen when the multiplex format was compared with single-species PCR, i.e., two primers and one probe. The method detected eight clinically relevant Candida species and did not react with other tested non-Candida species or human DNA. The assay was applied to 20 blood samples from nine patients and showed a sensitivity similar to that of culture.

  10. A Multiplex PCR for Detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in Clinical Specimens

    National Research Council Canada - National Science Library

    McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D

    2005-01-01

    A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...

  11. Use of multiplex real-time PCR for detection of common diarrhea causing protozoan parasites in Egypt.

    Science.gov (United States)

    Nazeer, John T; El Sayed Khalifa, Khalifa; von Thien, Heidrun; El-Sibaei, Mahmoud Mohamed; Abdel-Hamid, Magda Youssef; Tawfik, Ranya Ayman Samir; Tannich, Egbert

    2013-02-01

    Diarrhea is an important cause of morbidity and mortality, worldwide. Giardia intestinalis, Cryptosporidium spp., and Entamoeba histolytica are the most common diarrhea-causing parasitic protozoa. Diagnosis of these parasites is usually performed by microscopy. However, microscopy lacks sensitivity and specificity. Replacing microscopy with more sensitive and specific nucleic acid based methods is hampered by the higher costs, in particular in developing countries. Multiplexing the detection of more than one parasite in a single test by real-time polymerase chain reaction (PCR) has been found to be very effective and would decrease the cost of the test. In the present study, stool samples collected from 396 Egyptian patients complaining of diarrhea along with 202 faecal samples from healthy controls were examined microscopically by direct smear method and after concentration using formol-ethyl acetate. Frozen portions of the same samples were tested by multiplex real-time for simultaneous detection of E. histolytica, G. intestinalis, and Cryptosporidium spp. The results indicate that among diarrheal patients in Egypt G. intestinalis is the most common protozoan parasite, with prevalence rates of 30.5 and 37.1 %, depending on the method used (microscopy vs. multiplex real-time PCR). Cryptosporidium spp. was detected in 1 % of the diarrheal patients by microscopy and in 3 % by real-time PCR. While E. histolytica/dispar was detected in 10.8 % by microscopy, less than one fifth of them (2 %) were found true positive for Entamoeba dispar by real-time PCR. E. histolytica DNA was not detected in any of the diarrheal patients. In comparison with multiplex real-time PCR, microscopy exhibited many false positive and negative cases with the three parasites giving sensitivities and specificities of 100 and 91 % for E. histolytica/dispar, 57.8 and 85.5 % for G. intestinalis, and 33.3 and 100 % for Cryptosporidium spp.

  12. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  13. Molecular typing of Clostridium perfringens isolated from turkey meat by multiplex PCR.

    Science.gov (United States)

    Erol, I; Goncuoglu, M; Ayaz, N D; Bilir Ormanci, F S; Hildebrandt, G

    2008-07-01

    To determine the presence of toxin genes in 22 Clostridium perfringens isolated from turkey meat samples by molecular typing. For this purpose, alpha (cpa), beta (cpb), beta 2 (cpb2), epsilon (etx), iota (iA) and enterotoxin (cpe) toxin genes were analysed by multiplex PCR. All 22 turkey meat Cl. perfringens isolates were found to carry the cpa, gene but in none of the isolates cpb, etx, iap or cpe genes were detected. Results showed that all isolates represented type A and were cpe negative. Our results indicate that Cl. perfringens type A is the most common type in turkey meat. Also multiplex PCR is effective and rapid method for typing of Cl. perfringens. It is the first study about molecular typing of Cl. perfringens using multiplex PCR in turkey meat samples in Turkey.

  14. Multiplex PCR-based identification of Streptococcus canis, Streptococcus zooepidemicus and Streptococcus dysgalactiae subspecies from dogs.

    Science.gov (United States)

    Moriconi, M; Acke, E; Petrelli, D; Preziuso, S

    2017-02-01

    Streptococcus canis (S. canis), Streptococcus equi subspecies zooepidemicus (S. zooepidemicus) and Streptococcus dysgalactiae subspecies (S. dysgalactiae subspecies) are β-haemolytic Gram positive bacteria infecting animals and humans. S. canis and S. zooepidemicus are considered as two of the major zoonotic species of Streptococcus, while more research is needed on S. dysgalactiae subspecies bacteria. In this work, a multiplex-PCR protocol was tested on strains and clinical samples to detect S. canis, S. dysgalactiae subspecies and S. equi subspecies bacteria in dogs. All strains were correctly identified as S. canis, S. equi subspecies or S. dysgalactiae subspecies by the multiplex-PCR. The main Streptococcus species isolated from symptomatic dogs were confirmed S. canis. The multiplex-PCR protocol described is a rapid, accurate and efficient method for identifying S. canis, S. equi subspecies and S. dysgalactiae subspecies in dogs and could be used for diagnostic purposes and for epidemiological studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  16. Development of a multiplex PCR assay for characterization of embryonic stem cells.

    Science.gov (United States)

    Pal, Rajarshi; Mamidi, Murali Krishna; Das, Anjan Kumar; Rao, Mahendra; Bhonde, Ramesh

    2013-01-01

    Several molecular methods like real-time PCR (Q-PCR), expression sequence tag (EST) scan, microarray and microRNA analysis, and massively parallel signature sequencing (MPSS) have proved to be increasingly sensitive and efficient for monitoring human embryonic stem cell (hESC) differentiation. However, most of these high-throughput tests have a limited use due to high cost, extended turnaround time, and the involvement of highly specialized technical expertise. Hence, there is a need of rapid, cost-effective, robust, yet sensitive method for routine screening of hESCs. A critical requirement in hESC cultures is to maintain a uniform undifferentiated state and to determine their differentiation capacity by showing the expression of germ-layer-specific gene markers. To determine the modulation of gene expression in hESCs during propagation, expansion, and differentiation via embryoid body (EB) formation, we developed a simple, rapid, inexpensive, and definitive multimarker, semiquantitative multiplex RT-PCR (mxPCR) platform technology. Among the 15 gene primers tested, 4 were pluripotent markers comprising of set 1; and 3 lineage-specific markers from each ecto-, meso-, and endoderm layers were combined as sets 2, 3, and 4, respectively. In summary, this study was performed to characterize hESCs on a molecular level and to determine the quality and degree of variability among hESC and their early progenies (EB). This single-reaction mxPCR assay was flexible and, by selecting appropriate reporter genes, can be designed for characterization of different hESC lines during routine maintenance and directed differentiation.

  17. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Science.gov (United States)

    Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2013-01-01

    Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus.

  18. PCR multiplex para identificação de isolados de Clostridium chauvoei e Clostridium septicum

    OpenAIRE

    Assis,R.A.; Lobato,F.C.F.; Lobato,Z.I.P.; Camargos,M.F.; Nascimento,R.A.P.; Vargas,A.P.C.; Salvarani,F.M.; Uzal,F.A.

    2008-01-01

    Padronizou-se uma técnica de reação em cadeia da polimerase múltipla (PCR multiplex) para detecção de Clostridium chauvoei e Clostridium septicum em culturas puras. Foram utilizados pares de iniciadores para segmentos específicos dos genes que codificam a flagelina de C. chauvoei e a toxina alfa de C. septicum. Para avaliaçã o da PCR multiplex, foram testados 16 isolados clínicos de C. chauvoei e 15 isolados de C. septicum provenientes de ruminantes, quatro sementes vacinais de cada um desses...

  19. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  20. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA. PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSA- positive ...

  1. Development of simple multiplex real-time PCR assays for foodborne pathogens detection and identification on LightCycler

    Directory of Open Access Journals (Sweden)

    Avo Karus1

    2017-03-01

    Full Text Available Most acute intestinal diseases are caused by food-borne pathogens. A fast and simple real-time PCR-based procedure for simultaneous detection of food contamination by any of the five food-borne pathogens: Campylobacter jejuni, Mycobacterium bovis, Enterobacter sakazaki, Shigella boydii, Clostridium perfrigens using multiplex EvaGreen real-time PCR for LightCycler was developed and evaluated. Real-time qPCR showed excellent sensitivity. Tm calling and Melting Curve Genotyping (MCG were used for analysis of PCR product melting curves. The Melting Curve Genotyping option showed good performance for discrimination of positive samples containing DNA of single pathogen or pathogen mixtures from negative samples.

  2. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Science.gov (United States)

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  3. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix®RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  4. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  5. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  6. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  7. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    Science.gov (United States)

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  8. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  9. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2017-10-25

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  10. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  11. Identification of Malassezia species from pityriasis versicolor lesions with a new multiplex PCR method.

    Science.gov (United States)

    Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret

    2014-02-01

    Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works

  12. Etiological profile of early neonatal bacterial sepsis by multiplex qPCR.

    Science.gov (United States)

    Silva-Junior, Walter P; Martins, Almir S; Xavier, Paula C N; Appel, Kelly L A; Oliveira Junior, Silvio A; Palhares, Durval B

    2016-12-30

    Given the major impact in terms of morbidity and mortality that episodes of early neonatal sepsis (ENS) have on both newborns and health systems, this study aimed to identify the etiological profile of early neonatal bacterial sepsis by a multiplex quantitative real-time polymerase chain reaction (qPCR). Blood samples from newborns diagnosed with clinical ENS and hospitalized in neonatal intensive care units (NICUs) were collected and analyzed using the multiplex qPCR method to detect Streptococcus agalactiae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterobacter sp., Serratia sp., and Staphylococcus aureus. A universal primer was used in the analysis. A total of 150 neonates with clinical sepsis and 10 newborns as healthy controls were included in the study. The group with clinical sepsis was 100% positive for the presence of bacterial genomic DNA through the universal primer. The control group showed negativity by qPCR. The multiplex qPCR analysis showed that 76% of the samples were positive for Escherichia coli, 34% for Staphylococcus aureus, 13.3% for Streptococcus agalactiae, 7.3% for Pseudomonas aeruginosa, and 0.7% for Enterobacter sp. and Serratia sp. Multiplex qPCR of patients with clinical sepsis matched with 8.1% of the blood samples that tested positive by the microbiological method. Rapid and sensitive detection of the pathogens causing ENS by this new multi-target approach based on multiplex qPCR could potentially excel compared to microbiological methods, with the simple objective of facilitating the progression to a more rapid and specific antimicrobial therapy, avoiding the abuse of antibiotics in NICUs.

  13. Detection of genetically modified crops by combination of multiplex PCR and low-density DNA microarray.

    Science.gov (United States)

    Zhou, Ping-Ping; Zhang, Jian-Zhong; You, Yuan-Hai; Wu, Yong-Ning

    2008-02-01

    To develop a technique for simultaneous detection of various target genes in Roundup Ready soybean by combining multiplex PCR and low-density DNA microarray. Two sets of the multiplex PCR system were used to amplify the target genes in genetically modified (GM) soybean. Seventeen capture probes (PCR products) and 17 pairs of corresponding primers were designed according to the genetic characteristics of Rroundup Ready soybean (GTS40-3-2), maize (Mon810, Nk603, GA21), canola (T45, MS1/RF1), and rice (SCK) in many identified GM crops. All of the probes were categorized and identified as species-specific probes. One negative probe and one positive control probe were used to assess the efficiency of all reactions, and therefore eliminate any false positive and negative results. After multiplex PCR reaction, amplicons were adulterated with Cy5-dUTP and hybridized with DNA microarray. The array was then scanned to display the specific hybridization signals of target genes. The assay was applied to the analysis of sample of certified transgenic soybean (Roundup Ready GTS40-3-2) and canola (MS1/RF1). A combination technique of multiplex PCR and DNA microarray was successfully developed to identify multi-target genes in Roundup Ready soybean and MS1/RF1 canola with a great specificity and reliability. Reliable identification of genetic characteristics of Roundup Ready of GM soybean from genetically modified crops was achieved at 0.5% transgenic events, indicating a high sensitivity. A combination technique of multiplex PCR and low-density DNA microarray can reliably detect and identify the genetically modified crops.

  14. The validation of a 15 STR multiplex PCR for Cannabis species.

    Science.gov (United States)

    Köhnemann, Stephan; Nedele, Johanna; Schwotzer, Daniela; Morzfeld, Julia; Pfeiffer, Heidi

    2012-07-01

    Trade and acquisition of Cannabis drugs are illegal in many countries worldwide; nevertheless, crimes related with these drugs are a major problem for the investigative authorities. With this manuscript, we want to introduce a 15 short tandem repeat (STR) Cannabis marker set that can be amplified in one PCR reaction. This multiplex PCR is specific to Cannabis species and combines highly informative STR markers. The 15 STR multiplex is easy to use and was validated according to common laboratory quality standards. Due to the fact that a lot of Cannabis plants are cultivated by clonal propagation and may show aneuploidy, polyploidy or multiple gene loci, it is not possible to apply biostatistics that follow the Hardy-Weinberg law. However, this multiplex will help the police to trace back trade routes of drug syndicates or dealers and it can help to link Cannabis plants to a crime scene.

  15. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  16. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    We used multiplex PCR followed by sequencing to screen for mutations in the 14 exons of the RPE65 gene in early-childhood-onset autosomal recessive retinitis pigmentosa (arRP) and Leber's congenital amaurosis (LCA) patients. The RPE65 protein is believed to play an important role in the metabolism of vitamin A in ...

  17. Screening for circulating RAS/RAF mutations by multiplex digital PCR

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Jakobsen, Anders

    2016-01-01

    by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...

  18. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    Abstract. We used multiplex PCR followed by sequencing to screen for mutations in the 14 exons of the RPE65 gene in early- childhood-onset autosomal recessive retinitis pigmentosa (arRP) and Leber's congenital amaurosis (LCA) patients. The RPE65 protein is believed to play an important role in the metabolism of ...

  19. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  20. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  1. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products. PMID:26257724

  2. Single universal primer multiplex ligation-dependent probe amplification with sequencing gel electrophoresis analysis.

    Science.gov (United States)

    Shang, Ying; Zhu, Pengyu; Xu, Wentao; Guo, Tianxiao; Tian, Wenying; Luo, Yunbo; Huang, Kunlun

    2013-12-15

    In this study, a novel single universal primer multiplex ligation-dependent probe amplification (SUP-MLPA) technique that uses only one universal primer to perform multiplex polymerase chain reaction (PCR) was developed. Two reversely complementary common sequences were designed on the 5' or 3' end of the ligation probes (LPs), which allowed the ligation products to be amplified through only a single universal primer (SUP). SUP-MLPA products were analyzed on sequencing gel electrophoresis with extraordinary resolution. This method avoided the high expenses associated with capillary electrophoresis, which was the commonly used detection instrument. In comparison with conventional multiplex PCR, which suffers from low sensitivity, nonspecificity, and amplification disparity, SUP-MLPA had higher specificity and sensitivity and a low detection limit of 0.1 ng for detecting single crop species when screening the presence of genetically modified crops. We also studied the effect of different lengths of stuffer sequences on the probes for the first time. Through comparing the results of quantitative PCR, the LPs with different stuffer sequences did not affect the ligation efficiency, which further increased the multiplicity of this assay. The improved SUP-MLPA and sequencing gel electrophoresis method will be useful for food and animal feed identification, bacterial detection, and verification of genetic modification status of crops. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. PCR multiplex para identificação de isolados de Clostridium chauvoei e Clostridium septicum Multiplex PCR for identification of Clostridium chauvoei and Clostridium septicum

    Directory of Open Access Journals (Sweden)

    R.A. Assis

    2008-04-01

    Full Text Available Padronizou-se uma técnica de reação em cadeia da polimerase múltipla (PCR multiplex para detecção de Clostridium chauvoei e Clostridium septicum em culturas puras. Foram utilizados pares de iniciadores para segmentos específicos dos genes que codificam a flagelina de C. chauvoei e a toxina alfa de C. septicum. Para avaliaçã o da PCR multiplex, foram testados 16 isolados clínicos de C. chauvoei e 15 isolados de C. septicum provenientes de ruminantes, quatro sementes vacinais de cada um desses agentes. Amostras de referência de ambos os microrganismos foram usadas como controle. Para avaliar a especificidade, DNAs genômicos dos seguintes microrganismos foram usados: C. sordellii, C. novyi tipo A, C. novyi tipo B, C. perfringens tipo A, C. haemolyticum, C. botulinum tipo D, Pseudomonas aeruginosa, Staphylococcus aureus, Enterobacter aerogenes, Escherichia coli e Salmonella typhimurium. Todos os isolados e sementes vacinais de C. chauvoei e C. septicum foram detectados pela técnica. Não foram observadas reações cruzadas com as outras espécies de clostrídios, outras espécies bacterianas ou entre C. Chauvoei e C. septicum. As menores concentrações de DNA de C. chauvoei e C. septicum detectadas foram 45pg/µl e 30pg/µl, respectivamente. A PCR multiplex pode ser utilizada para a identificação específica de C. chauvoei e C. septicum em culturas puras.Multiplex PCR was optimized to detect Clostridium chauvoei and Clostridium septicum in pure cultures. In each reaction, a pair of primers for a specific segment of the flagellin gene of C. chauvoei and a pair of primers for a specific segment of alpha toxin gene of C. septicum were employed. Reference strains of both microorganisms were used as control. The multiplex PCR was evaluated by testing 16 clinical isolates of C. chauvoei from ruminants, 15 clinical isolates of C. septicum from ruminants and, four vaccine strains of each one of these agents. Reference strains of both

  4. Evaluation of a Multiplex PCR Assay (Bruce-ladder) for Molecular Typing of All Brucella Species, Including the Vaccine Strains▿ †

    Science.gov (United States)

    López-Goñi, I.; García-Yoldi, D.; Marín, C. M.; de Miguel, M. J.; Muñoz, P. M.; Blasco, J. M.; Jacques, I.; Grayon, M.; Cloeckaert, A.; Ferreira, A. C.; Cardoso, R.; Corrêa de Sá, M. I.; Walravens, K.; Albert, D.; Garin-Bastuji, B.

    2008-01-01

    An evaluation of a multiplex PCR assay (Bruce-ladder) was performed in seven laboratories using 625 Brucella strains from different animal and geographical origins. This robust test can differentiate in a single step all of the classical Brucella species, including those found in marine mammals and the S19, RB51, and Rev.1 vaccine strains. PMID:18716225

  5. Development of a multiplex-PCR probe system for the proper identification of Klebsiella variicola.

    Science.gov (United States)

    Garza-Ramos, Ulises; Silva-Sánchez, Jesús; Martínez-Romero, Esperanza; Tinoco, Perla; Pina-Gonzales, Marisol; Barrios, Humberto; Martínez-Barnetche, Jesús; Gómez-Barreto, Rosa Elena; Tellez-Sosa, Juan

    2015-03-13

    Klebsiella variicola was very recently described as a new bacterial species and is very closely related to Klebsiella pneumoniae; in fact, K. variicola isolates were first identified as K. pneumoniae. Therefore, it might be the case that some isolates, which were initially classified as K. pneumoniae, are actually K. variicola. The aim of this study was to devise a multiplex-PCR probe that can differentiate isolates from these sister species. This work describes the development of a multiplex-PCR method to identify K. variicola. This development was based on sequencing a K. variicola clinical isolate (801) and comparing it to other K. variicola and K. pneumoniae genomes. The phylogenetic analysis showed that K. variicola isolates form a monophyletic group that is well differentiated from K. pneumoniae. Notably, the isolate K. pneumoniae 342 and K. pneumoniae KP5-1 might have been misclassified because in our analysis, both clustered with K. variicola isolates rather than with K. pneumoniae. The multiplex-PCR (M-PCR-1 to 3) probe system could identify K. variicola with high accuracy using the shared unique genes of K. variicola and K. pneumoniae genomes, respectively. M-PCR-1 was used to assay a collection of multidrug-resistant (503) and antimicrobial-sensitive (557) K. pneumoniae clinical isolates. We found K. variicola with a prevalence of 2.1% (23/1,060), of them a 56.5% (13/23) of the isolates were multidrug resistant, and 43.5% (10/23) of the isolates were antimicrobial sensitive. The phylogenetic analysis of rpoB of K. variicola-positive isolates identified by multiplex-PCR support the correct identification and differentiation of K. variicola from K. pneumoniae clinical isolates. This multiplex-PCR provides the means to reliably identify and genotype K. variicola. This tool could be very helpful for clinical, epidemiological, and population genetics studies of this species. A low but significant prevalence of K. variicola isolates was found, implying that

  6. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  7. Application of multiplex PCR for Rapid and sensitive detection of human papillomaviruses in cervical cancer.

    Science.gov (United States)

    Zandnia, Fateme; Doosti, Abbas; Mokhtari-Farsani, Abbas; Kardi, Mohammad Taghi; Movafagh, Abolfazl

    2016-01-01

    Reffering to an increase in cervical cancer in the recent years, rapid, sensitive and economical detection of human papillomaviruses (HPVs) as causative agents of cervical cancer is important. The traditional methods for the detection of HPVs in cervical cancer, such as pap smear, suffer from limitation and PCR has a potential to overcome the limitaitons. The purpose of present research work was to identify the five important strains of HPV (16, 18, 31, 33 and 45) simultaneously by Multiplex PCR application. Study was done on 100 cervical lesions of women. DNA was extracted from specimens by a genomic DNA purification kit. A 5-plex PCR was developed for the simultaneous detection of major HPV. Five pair of new primers was designed for detection of HPV 16, 18, 31, 33 and 45 by Multiplex PCR. Among the 100 evaluated samples, 82 were found positive to HPVs. In the meantime the highest rate of infection was for HPV 16. Also 30 of HPV positive samples had infections with two or more HPV types. Multiplex PCR assay used in present study can provide a rapid, sensitive and economical method for detection of viral infections and is applicable to small volumes of vaginal samples.

  8. Optimization of a semi-nested multiplex PCR to identify Plasmodium parasites in wild-caught Anopheles in Bolivia, and its application to field epidemiological studies

    OpenAIRE

    Lardeux, Frédéric; Tejerina, Rosenka; Aliaga, Claudia; Ursic-Bedoya, R.; Lowenberger, C.; Chavez, T.

    2008-01-01

    Without an adequate DNA extraction protocol, the identification of Plasmodium species in whole mosquitoes by PCR is difficult because of the presence of reaction inhibitors from the insects. In this study, eight DNA extraction protocols were tested, from which a chelex-based protocol was selected. Then a semi-nested multiplex PCR technique that detects and distinguishes among the four human Plasmodium species in single mosquitoes and in pools of up to 100 mosquitoes was optimized. The techniq...

  9. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus.

    Science.gov (United States)

    Selim, Abdelfattah M; Elhaig, Mahmoud M; Gaede, Wolfgang

    2014-12-29

    Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR) to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  10. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  11. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  12. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Baker, B R; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; Reid, S M; Ebert, K; Ferris, N P; King, D P

    2007-09-18

    A high-throughput multiplexed assay (Multiplex Version 1.0) was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRTPCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  13. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  14. Enhancement of PCR Detection Limit by Single-Tube Restriction Endonuclease-PCR (RE-PCR).

    Science.gov (United States)

    Datta, Sibnarayan; Budhauliya, Raghvendra; Chatterjee, Soumya; Vanlalhmuaka; Veer, Vijay; Chakravarty, Runu

    2016-06-01

    Polymerase chain reaction (PCR) is widely used in biological research and diagnostics because of its high sensitivity and specificity. However, the sensitivity of PCR is strongly influenced by topological characteristics of the template. Supercoiled templates are known to inhibit PCR, whereas linearized forms of the same supercoiled templates facilitate PCR. This study was conducted to compare the PCR efficiency of circular supercoiled DNA templates to their restriction endonuclease (RE)-mediated linearized forms. Additionally, we also evaluated the possibility of RE digestion of the circular supercoiled templates within the complete PCR buffer. Following a systematic approach, we demonstrated that circular supercoiled templates could be efficiently linearized by RE in the complete PCR buffer itself. This allowed linearization of circular supercoiled templates and their subsequent amplification in the PCR buffer in a single-tube format. Using this extremely simple RE-PCR approach, we documented up to tenfold increases in detection efficiency of PCR with two different circular supercoiled templates of clinical origin, including an international calibration standard. This inexpensive and easy approach to increasing PCR sensitivity can be easily adapted to any standard PCR protocol aimed at amplifying circular supercoiled genomes. Apart from its application in the development of sensitive clinical diagnostic PCR assays for a large number of organisms, this method could also prove to be very useful in simplifying the existing protocols for other applications where pre-PCR restriction digestion is required, such as mutation detection, genotyping, and selective template amplification.

  15. Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

    Science.gov (United States)

    Jahan, F; Shamsuzzaman, S M; Akter, S

    2014-12-01

    Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

  16. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  17. Multiplex PCR for identifying common dust mites species (Dermatophagoides pteronyssinus, Dermatophagoides farinae and Blomia tropicalis).

    Science.gov (United States)

    Thet-Em, Thatsanee; Tungtrongchitr, Anchalee; Tiewcharoen, Supathra; Malainual, Nat

    2012-09-01

    Dust mites are known to be an important source of inhalant allergens causing allergic rhinitis and asthma worldwide. The sizes of dust mite populations in patients' houses are useful to monitor the risk of allergen exposure. However, mite identification using the conventional microscopic technique requires specific expertise and is time consuming; therefore a molecular technique has been developed in order to solve these drawbacks. To develop a multiplex PCR assay for identifying the three common dust mite species in Thailand, namely Dermatophagoides pteronyssinus (Dp), D. farinae (Df) and Blomia tropicalis (Bt), and to evaluate the efficacy of the technique. Pairs of primers were designed and tested in either singleplex PCR or multiplex PCR. The multiplex PCR technique was also optimized in order to obtain specific products. The reaction mixture contained 5 pmole of individual primers, 10 mM dNTP, 5 units Taq DNA polymerase and genomic DNA (gDNA). The reaction was run for 25 cycles at 94 degrees C for 20 seconds, 58 degrees C for 20 seconds and 72 degrees C for 30 seconds. The PCR products were analyzed by 1.5% agarose gel electrophoresis with GelRed fluorescence dye. The optimized multiplex technique was also tested with 30 house dust samples and dust samples spiked with DNA from other insect and mite species. Three PCR products were obtained with the relevant gDNA templates as expected; 143 bp for DF, 221 bp for DP and 318 bp for BT, respectively. The detection limit of the tests was found to be as low 1 ng of gDNA, whereas mixed gDNA species confirmed the 100% specificity of this assay. The total duration from the preparation of the PCR reaction mixture until the analysis by agarose gel electrophoresis was approximately 2 hours. No amplified product was obtained from mites and insects of other species. The multiplex PCR was successfully developed for identifying 3 common dust mite species. This technique can be helpful, not only for non-acarologist personnel

  18. Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

    Science.gov (United States)

    Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

    2015-05-01

    Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  19. Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

    2000-05-05

    Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

  20. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  1. COMPARISION OF THE UTILITY OF CONVENTIONAL CULTURE VERSUS MULTIPLEX PCR IN THE DIAGNOSIS AND MANAGEMENT OF SEPSIS AND MENINGITIS

    Directory of Open Access Journals (Sweden)

    Harish

    2015-11-01

    Full Text Available OBJECTIVE: Sepsis and meningitis are few of the most important causes of morbidity and mortality. Even so, establishing a microbial diagnosis for is still arduous and is often achieved in only half of cases by conventional culture techniques. This study was designed to compare the multiplex PCR method with the traditional culture method in sepsis and meningitis. The other aim was to evaluate the reliability of multiplex PCR method. METHODS: Forty - four patients with symptoms of sepsis and meningitis were included in the study. Both culture and multiplex PCR methods were performed for the isolation of most commonly seen pathogen, from bronchoalveolar lavage (BAL and cerebrospinal fluid (CSF samples. RESULTS: The conventional culture method detected at least one bact erial isolation in 19 patients. Whereas, the number for multiplex PCR was 44 (100%. The pathogens most commonly detected by PCR were Pseudomonas, Candida, S. pneumonia and CMV. In terms of detection of multiple pathogens, multiplex PCR was significantly e fficient than conventional culture (p<0.05. CONCLUSION: The traditional methods, such as culture are often inadequate in detection of the pathogens in sample from patients of sepsis and meningitis. Multiplex PCR assays proved highly sensitive and rapid. Widespread use of PCR methods will not only provide the immediate and appropriate ''agent specific antibiotic treatment'' of sepsis and meningitis, it will also contribute to a reduction in antibiotic resistance

  2. Multiplex real-time PCR for detection of Campylobacter, Salmonella, and Shigella.

    Science.gov (United States)

    Barletta, F; Mercado, E H; Lluque, A; Ruiz, J; Cleary, T G; Ochoa, T J

    2013-09-01

    Infectious diarrhea can be classified based on its clinical presentation as noninflammatory or inflammatory disease. In developing countries, among inflammatory diarrhea cases, Shigella is the most common cause, followed by Campylobacter and Salmonella. Because the time frame in which treatment choices must be made is short and conventional stool cultures lack good sensitivity, there is a need for a rapid, sensitive, and inexpensive detection technique. The purpose of our study was to develop a multiplex real-time PCR procedure to simultaneously identify Campylobacter spp., Salmonella spp., and Shigella spp. Primers were designed to amplify the invA, ipaH, and 16S rRNA genes simultaneously in a single reaction to detect Salmonella, Shigella, and Campylobacter, respectively. Using this approach, we correctly identified 102 of 103 strains of the targeted enteropathogens and 34 of 34 other pathogens. The melting temperatures were 82.96 ± 0.05 °C for invA, 85.56 ± 0.28 °C for ipaH, and 89.21 ± 0.24 °C for 16S rRNA. The limit of accurate quantification for the assay in stool samples was 10(4) CFU g(-1); however, the limit of detection was 10(3) CFU g(-1). This assay is a simple, rapid, inexpensive, and reliable system for the practical detection of these three enteropathogens in clinical specimens.

  3. Methodology of detection Penicillium expansum, Monilia frutigena, Botrytis cinerea and Neofabraea alba using multiplex PCR

    OpenAIRE

    Sumíková, Taťána; Gabrielová, Ludmila; Žabka, Martin

    2011-01-01

    Multiplex PCR for rapid and reliable detection of species causing rotting apples: Penicillium expansum, Monilia fructigena, Botrytis cinerea and Neofabraea alba is described here. Reaction is optimized for using in a common molecular laboratory. Described method allows both detectino of the pathogens from pure mycological cultrures, and their detection directly from the rot apple tissues. Cultivation of the micromycethes on cellophane surface is also described. References for mycological dete...

  4. Detection and identification of Actinobacillus pleuropneumoniae serotypes 1, 2, and 8 by multiplex PCR

    DEFF Research Database (Denmark)

    Schuchert, J.A.; Inzana, T.J.; Angen, Øystein

    2004-01-01

    Multiplex PCR assays were developed to identify Actinobacillus pleuropneumoniae serotypes 1, 2, and 8. Primers designed for the conserved capsular polysaccharide (CP) export region amplified a 489-bp DNA fragment from all serotypes. Primers specific to the CP biosynthesis regions of serotypes 1, 2......, and 8 amplified fragments of 1.6 kb, 1.7 kb, and 970 bp from only their respective serotypes....

  5. Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR

    Science.gov (United States)

    2011-05-01

    Society for Microbiology. All Rights Reserved. Discrimination of Major Capsular Types of Campylobacter jejuni by Multiplex PCR’Vt Frederic Poly...two PCRs with sensitivities and specificities ranging from 90 tn 100% using 244 strains of knnwn Penner type. Campylobacter jejwzi is one of the...2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Discrimination of Major Capsular Types of Campylobacter jejuni

  6. Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans

    Czech Academy of Sciences Publication Activity Database

    Wicht, B.; Yanagida, T.; Scholz, Tomáš; Ito, A.; Jiménez, J. A.; Brabec, Jan

    2010-01-01

    Roč. 48, č. 9 (2010), s. 3111-3116 ISSN 0095-1137 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR EVIDENCE * PACIFIC SALMON * NIHONKAIENSE * Diphyllobothrium * multiplex PCR * the cytochrome c oxidase subunit 1 * mitochondrial DNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 4.220, year: 2010

  7. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  8. Multiplex PCR To Diagnose Bloodstream Infections in Patients Admitted from the Emergency Department with Sepsis ▿

    Science.gov (United States)

    Tsalik, Ephraim L.; Jones, Daphne; Nicholson, Bradly; Waring, Lynette; Liesenfeld, Oliver; Park, Lawrence P.; Glickman, Seth W.; Caram, Lauren B.; Langley, Raymond J.; van Velkinburgh, Jennifer C.; Cairns, Charles B.; Rivers, Emanuel P.; Otero, Ronny M.; Kingsmore, Stephen F.; Lalani, Tahaniyat; Fowler, Vance G.; Woods, Christopher W.

    2010-01-01

    Sepsis is caused by a heterogeneous group of infectious etiologies. Early diagnosis and the provision of appropriate antimicrobial therapy correlate with positive clinical outcomes. Current microbiological techniques are limited in their diagnostic capacities and timeliness. Multiplex PCR has the potential to rapidly identify bloodstream infections and fill this diagnostic gap. We identified patients from two large academic hospital emergency departments with suspected sepsis. The results of a multiplex PCR that could detect 25 bacterial and fungal pathogens were compared to those of blood culture. The results were analyzed with respect to the likelihood of infection, sepsis severity, the site of infection, and the effect of prior antibiotic therapy. We enrolled 306 subjects with suspected sepsis. Of these, 43 were later determined not to have infectious etiologies. Of the remaining 263 subjects, 70% had sepsis, 16% had severe sepsis, and 14% had septic shock. The majority had a definite infection (41.5%) or a probable infection (30.7%). Blood culture and PCR performed similarly with samples from patients with clinically defined infections (areas under the receiver operating characteristic curves, 0.64 and 0.60, respectively). However, blood culture identified more cases of septicemia than PCR among patients with an identified infectious etiology (66 and 46, respectively; P = 0.0004). The two tests performed similarly when the results were stratified by sepsis severity or infection site. Blood culture tended to detect infections more frequently among patients who had previously received antibiotics (P = 0.06). Conversely, PCR identified an additional 24 organisms that blood culture failed to detect. Real-time multiplex PCR has the potential to serve as an adjunct to conventional blood culture, adding diagnostic yield and shortening the time to pathogen identification. PMID:19846634

  9. Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad

    2012-01-01

    Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

  10. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  11. Multiplex PCR to identify macrolide resistance determinants in Mannheimia haemolytica and Pasteurella multocida.

    Science.gov (United States)

    Rose, Simon; Desmolaize, Benoit; Jaju, Puneet; Wilhelm, Cornelia; Warrass, Ralf; Douthwaite, Stephen

    2012-07-01

    The bacterial pathogens Mannheimia haemolytica and Pasteurella multocida are major etiological agents in respiratory tract infections of cattle. Although these infections can generally be successfully treated with veterinary macrolide antibiotics, a few recent isolates have shown resistance to these drugs. Macrolide resistance in members of the family Pasteurellaceae is conferred by combinations of at least three genes: erm(42), which encodes a monomethyltransferase and confers a type I MLS(B) (macrolide, lincosamide, and streptogramin B) phenotype; msr(E), which encodes a macrolide efflux pump; and mph(E), which encodes a macrolide-inactivating phosphotransferase. Here, we describe a multiplex PCR assay that detects the presence of erm(42), msr(E), and mph(E) and differentiates between these genes. In addition, the assay distinguishes P. multocida from M. haemolytica by amplifying distinctive fragments of the 23S rRNA (rrl) genes. One rrl fragment acts as a general indicator of gammaproteobacterial species and confirms whether the PCR assay has functioned as intended on strains that are negative for erm(42), msr(E), and mph(E). The multiplex system has been tested on more than 40 selected isolates of P. multocida and M. haemolytica and correlated with MICs for the veterinary macrolides tulathromycin and tilmicosin, and the newer compounds gamithromycin and tildipirosin. The multiplex PCR system gives a rapid and robustly accurate determination of macrolide resistance genotypes and bacterial genus, matching results from microbiological methods and whole-genome sequencing.

  12. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  13. A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

    Science.gov (United States)

    Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

    2001-02-01

    Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.

  14. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  15. PCR amplification of microsatellites from single cells of Karenia brevis preserved in Lugol's iodine solution.

    Science.gov (United States)

    Henrichs, D W; Renshaw, M A; Santamaria, C A; Richardson, B; Gold, J R; Campbell, L

    2008-01-01

    A simple and effective protocol is described for multiplex polymerase chain reaction (PCR) amplification of single cells of Karenia brevis. The protocol requires minimum processing, avoids additions that might dilute target DNA template, and can be used on cells preserved in Lugol's iodine preservative. Destaining of Lugol's-preserved cells with sodium thiosulfate allowed successful amplification of single-copy, nuclear-encoded microsatellites in single cells of K. brevis that have been preserved for up to 6 years.

  16. Development of a multiplex real-time RT-PCR assay for simultaneous detection of dengue and chikungunya viruses.

    Science.gov (United States)

    Cecilia, D; Kakade, M; Alagarasu, K; Patil, J; Salunke, A; Parashar, D; Shah, P S

    2015-01-01

    Dengue and chikungunya viruses co-circulate and cause infections that start with similar symptoms but progress to radically different outcomes. Therefore, an early diagnostic test that can differentiate between the two is needed. A single-step multiplex real-time RT-PCR assay was developed that can simultaneously detect and quantitate RNA of all dengue virus (DENV) serotypes and chikungunya virus (CHIKV). The sensitivity was 100 % for DENV and 95.8 % for CHIKV, whilst the specificity was 100 % for both viruses when compared with conventional RT-PCR. The detection limit ranged from 1 to 50 plaque-forming units. The assay was successfully used for differential diagnosis of dengue and chikungunya in Pune, where the viruses co-circulate.

  17. One-step multiplex RT-qPCR detects three citrus viroids from different genera in a wide range of hosts.

    Science.gov (United States)

    Osman, Fatima; Dang, Tyler; Bodaghi, Sohrab; Vidalakis, Georgios

    2017-07-01

    A one-step multiplex reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) based on species-specific minor groove binding (MGB) probes, was developed for the simultaneous detection, identification, and quantification of three citrus viroids belonging to different genera. Citrus exocortis viroid (Pospiviroid), Hop stunt viroid (Hostuviroid), and Citrus bark cracking viroid (Cocadviroid) cause a variety of maladies in agriculturally significant crops. Therefore, reliable assays for their detection are essential tools for various government and industry organizations implementing disease management programs. Singleplex qPCR primers and MGB probes were designed individually for the detection of the three targeted viroids, and subsequently combined in a one-step multiplex RT-qPCR reaction. A wide host range of woody plants, including citrus, grapevines, apricots, plums and herbaceous plants such as tomato, cucumber, eggplant and chrysanthemum different world regions were used to validate the assay. Single, double and triple viroid infections were identified in the tested samples. The developed multiplex RT-qPCR assay was compared with a previously reported SYBR Green I RT-qPCR for the universal detection of citrus viroids. Both assays accurately identified all citrus viroid infected samples. The multiplex assay complemented the SYBR Green I universal detection assay by differentiating among citrus viroid species in the positive samples. The developed multiplex RT-qPCR assay has the potential to simultaneously detect each targeted viroid and could be used in high throughput screenings for citrus viroids in field surveys, germplasm banks, nurseries and other viroid disease management programs. Copyright © 2017. Published by Elsevier B.V.

  18. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  19. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  20. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  1. Differential identification of Sporothrix spp. and Leishmania spp. by conventional PCR and qPCR in multiplex format.

    Science.gov (United States)

    Rodríguez-Brito, Sabrina; Camacho, Emma; Mendoza, Mireya; Niño-Vega, Gustavo A

    2015-01-01

    Sporotrichosis and cutaneous leishmaniasis are skin infections with similar clinical manifestations but different treatment methods. The present study aimed to evaluate qPCR and conventional PCR for differential detection of the etiological agents of both infections in multiplex format. Assays were designed using two sets of reported primers: SS1/SS2, designed on the 18S ribosomal RNA gene from Sporothrix spp., and JW11/JW12, designed on the kinetoplast DNA (kDNA) minicircles of Leishmania spp. qPCR detected 200 fg of DNA per reaction for both Sporothrix and Leishmania. Melting curve analysis revealed two distinctive Tm peaks for Sporothrix spp. (85.5°C), and Leishmania spp. (82.6°C). A detection limit of 20 pg was determined for the diagnosis of both with conventional PCR. No other clinically important organisms were detected by either PCR or qPCR. However, a Blast analysis on GenBank databases, using as query the sequence of the PCR fragment obtained with primers SS1/SS2, showed 100% identity to environmental fungi of the Ophiostomales order. Lower percentages of identity (≤80%), with mismatches at primers' sequence regions were obtained for other environmental or clinically important fungi. Proper handling of clinical samples is required to avoid false negatives due to contamination with environmental fungi of the Ophiostomales order. © The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Usefulness of capillary electrophoresis-based multiplex PCR assay for species-specific identification of Candida spp.

    Science.gov (United States)

    Mallus, F; Martis, S; Serra, C; Loi, G; Camboni, T; Manzin, A

    2013-02-15

    The study evaluated the performances of a commercial multiplex PCR assay, the Seegene Seeplex STI Master Panel 3, for Candida spp. identification. Eighty clinical strains of Candida spp. were identified with this system and a homemade multiplex PCR assay. The results were also compared with those obtained with two phenotypic methods. The study provided a preliminary evaluation of a multiplex assay from Seegene that uses capillary electrophoresis as the detection of amplified products. The Seeplex assay was found to be a rapid and useful method for identifying large numbers of yeast isolates in the clinical laboratory context. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

    Directory of Open Access Journals (Sweden)

    Kor-jent van Dijk

    2014-11-01

    Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

  4. A one-step multiplex PCR for acanthamoeba keratitis diagnosis and quality samples control.

    Science.gov (United States)

    Maubon, Danièle; Dubosson, Muriel; Chiquet, Christophe; Yera, Hélène; Brenier-Pinchart, Marie-Pierre; Cornet, Muriel; Savy, Olivier; Renard, Elisabeth; Pelloux, Hervé

    2012-05-14

    As the number of cases of Acanthamoeba spp. keratitis (AK) is constantly growing, new diagnostic tools are needed to confirm and guide ophthalmologists in this clinically problematic diagnosis. Molecular diagnosis is particularly well adapted, although only a few real-time PCR techniques have been described recently. The aim of this study was to develop a new PCR technique for the diagnosis of AK by combining the detection of Acanthamoeba DNA with human DNA, thus allowing an accurate interpretation of the PCR result. Different DNA extraction procedures were compared to ensure an optimized amplification of one Acanthamoeba genome. The analytical parameters of this new multiplex Acanthamoeba beta-globin PCR (MAB-PCR) were evaluated. Fourteen eye drops were tested as potential PCR inhibitors. A prospective series of 28 corneal scrapings was subjected to MAB-PCR. The best extraction procedure associated thermal-shock pretreatment followed by a manual extraction procedure. The MAB-PCR parameters displayed excellent specificity and sensitivity, with a detection of 0.02 genome of Acanthamoeba. No eye drops were total PCR inhibitors. Of 28 corneal scrapings, 18 were considered true negatives. Seven could not be interpreted because of insufficient scraping material. Three were considered true positives: every patient progressed favorably on specific and reliable treatment. The MAB-PCR is a new tool to diagnose AK. It allows rapid diagnosis and prompt treatment of this probably underestimated etiology of infectious keratitis. This optimized real-time PCR outperforms the gold standard for Acanthamoeba keratitis diagnosis and it allows a concomitant evaluation of the quality of the corneal scraping, which is necessary for a precise interpretation of the results.

  5. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Science.gov (United States)

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  6. Genomic Characterization of Flavobacterium psychrophilum Serotypes and Development of a Multiplex PCR-Based Serotyping Scheme

    Directory of Open Access Journals (Sweden)

    Tatiana Rochat

    2017-09-01

    Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.

  7. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Single SQUID frequency-domain multiplexer for large bolometer arrays

    International Nuclear Information System (INIS)

    Yoon, Jongsoo; Clarke, John; Gildemeister, J.M.; Lee, Adrian T.; Myers, M.J.; Skidmore, J.T.; Richards, P.L.; Spieler, H.G.

    2001-01-01

    We describe the development of a frequency-domain superconducting quantum interference device (SQUID) multiplexer which monitors a row of low-temperature sensors simultaneously with a single SQUID. Each sensor is ac biased with a unique frequency and all the sensor currents are added in a superconducting summing loop. A single SQUID measures the current in the summing loop, and the individual signals are lock-in detected after the room temperature SQUID electronics. The current in the summing loop is nulled by feedback to eliminate direct crosstalk. We have built an eight-channel prototype and demonstrated channel separation and signal recovery

  9. Detection of Herpesviridae in whole blood by multiplex PCR DNA-based microarray analysis after hematopoietic stem cell transplantation.

    Science.gov (United States)

    Debaugnies, France; Busson, Laurent; Ferster, Alina; Lewalle, Philippe; Azzi, Nadira; Aoun, Mickael; Verhaegen, Godelieve; Mahadeb, Bhavna; de Marchin, Jérôme; Vandenberg, Olivier; Hallin, Marie

    2014-07-01

    Viral infections are important causes of morbidity and mortality in patients after hematopoietic stem cell transplantation. The monitoring by PCR of Herpesviridae loads in blood samples has become a critical part of posttransplant follow-up, representing mounting costs for the laboratory. In this study, we assessed the clinical performance of the multiplex PCR DNA microarray Clart Entherpex kit for detection of cytomegalovirus (CMV), Epstein-Barr virus (EBV), and human herpesvirus 6 (HHV-6) as a screening test for virological follow-up. Two hundred fifty-five blood samples from 16 transplanted patients, prospectively tested by routine PCR assays, were analyzed by microarray. Routine PCR detected single or multiple viruses in 42% and 10% of the samples, respectively. Microarray detected single or multiple viruses in 34% and 18% of the samples, respectively. Microarray results correlated well with CMV and EBV detections by routine PCR (kappa tests = 0.79 and 0.78, respectively), whereas a weak correlation was observed with HHV-6 (0.43). HHV-7 was also detected in 48 samples by microarray. In conclusion, the microarray is a reliable screening assay for a posttransplant virological follow-up to detect CMV and EBV infections in blood. However, positive samples must be subsequently confirmed and viral loads must be quantified by PCR assays. Limitations were identified regarding HHV-6 detection. Although it is promising, is easy to use as a first-line test, and allows a reduction in the cost of analysis without undue delay in the reporting of the final quantitative result to the clinician, some characteristics of this microarray should be improved, particularly regarding quality control and the targeted virus panel, such that it could then be used as a routine test. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Molecular characterization of the capsular antigens of Pasteurella multocida isolates using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Khalid S. Al-Maary

    2017-02-01

    Full Text Available The use of molecular techniques for detection and characterization of the Pasteurella multocida is very important for rapid and specific detection and characterization of the organism. During the period from 15th February, 2014 to 15th April, 2015, 425 nasopharyngeal swabs and 175 lung and spleen samples were collected and examined by conventional methods, 80 strains (18.82% of P. multocida were isolated from the calves, sheep and goat with respiratory manifestation. Meanwhile, 77 strains (44% were isolated from emergency slaughtered animals. All the recovered strains were positive for specific PCR for detection of P. multocida strains previously identified as P. multocida by standard microbiological techniques. Multiplex PCR for molecular typing of the capsular antigens of the recovered P. multocida revealed positive amplification of 1044 bp fragments specific to the capsular antigen type A with 105 strains (66.88%, and amplification 511 bp fragments of the capsular antigen type E with 52 strain (33.12% and absence of B, D and F antigens. Multiplex PCR for molecular typing of the capsular antigens of P. multocida can be used as a simple, sensitive, rapid, reliable technique instead of the serological techniques for identification of the capsular antigens of P. multocida

  11. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  12. Detection and quantification of Campylobacter jejuni and Campylobacter coli using real-time multiplex PCR.

    Science.gov (United States)

    Toplak, N; Kovač, M; Piskernik, S; Možina, S Smole; Jeršek, B

    2012-04-01

    We describe a real-time quantitative multiplex polymerase chain reaction (qmPCR) assay to identify and discriminate between isolates of Campylobacter jejuni and Campylobacter coli. Two novel sets of primers and hydrolysis probes were designed to amplify the unique DNA sequences within the hipO, ccoN and cadF genes that are specific to Camp. jejuni and Camp. coli. Using the designed optimized qmPCR assay conditions, the amplification efficiency is in range from 108 to 116%. These qmPCR assays are highly specific for Camp. jejuni and Camp. coli, as seen through testing of 40 Campylobacter strains and 17 non-Campylobacter strains. In chicken juice and tap water models spiked with known quantities of Camp. jejuni, qmPCR detected 10(2) -10(3) CFU ml(-1) within 4 h. The qmPCR assays developed in this study provide reliable and simultaneous detection and quantification of Camp. jejuni and Camp. coli, with good amplification reaction parameters. Following further validation, the qmPCR assay reported here has the potential to be applied to various sample types as an alternative and rapid methodology. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  13. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  14. Diagnosis of periprosthetic joint infection using alpha-defensin test or multiplex-PCR: ideal diagnostic test still not found.

    Science.gov (United States)

    Suda, Arnold J; Tinelli, Marco; Beisemann, Nils D; Weil, Yoram; Khoury, Amal; Bischel, Oliver E

    2017-07-01

    Diagnosing periprosthetic infection remains a challenge. Multiplex-PCR and biomarkers such as alpha-defensin are potentially useful and fast methods for detecting periprosthetic infection. This study compared these new methods with clinical assessment, conventional microbiological methods and histo-pathological examination. Twenty-eight consecutive patients with 30 joints and a mean age of 67.7 years (range 39 to 88) with removal of total hip arthroplasty (THA) or total knee replacement (TKR) were included in this study. Patients were classified according to the modified Musculoskeletal Infection Society score (MSIS) for infected joints. Punction fluid and tissue specimens were taken for conventional microbiological examination, alphadefensin test was performed, a synovial membrane specimen was used for multiplex-PCR and histopathological examination was carried out. The alpha-defensin test and multiplex-PCR showed a sensitivity of 76.9 vs. 30.8% and a specificity of 82.4 vs. 100%, respectively. We found a significant difference between the positive and negative results (p = 0.0023). The conventional microbiological methods were not significantly different from the alpha-defensin test (p = 0.244) with a sensitivity of 84.6% and a specificity of 100% but did differ significantly from the multiplex PCR (p = 0.0030). There was a significant difference between modified MSIS classification and multiplex PCR (p = 0.0007). Neither alpha-defensin test nor multiplex-PCR could detect periprosthetic infection immediately and reliably. Multiplex-PCR was suitable for detecting the non-infected but not the truly infected. Alpha-defensin test was helpful but showed no satisfactory results. Conventional microbiological methods remain the most reliable for periprosthetic infection diagnosis.

  15. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    OpenAIRE

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium b...

  16. Multiplex PCR Method for Detection of Three Aeromonas Enterotoxin Genes ▿

    OpenAIRE

    Bin Kingombe, Cesar I.; D'Aoust, Jean-Yves; Huys, Geert; Hofmann, Lisa; Rao, Mary; Kwan, Judy

    2009-01-01

    A novel multiplex PCR method using three sets of specific primers was developed for the detection of the cytotoxic (act), heat-labile (alt), and heat-stable (ast) enterotoxin genes in Aeromonas spp. This assay was used to characterize 35 reference strains as well as 537 food-borne isolates. A total of seven gene pattern combinations were encountered, including act, alt, act/alt, act/alt/ast, act/alt/148-bp amplicon, alt/ast, and alt/148-bp amplicon. The alt gene was detected with 34 reference...

  17. Updated Multiplex PCR for Detection of All Six Plasmid-Mediated qnr Gene Families.

    Science.gov (United States)

    Kraychete, Gabriela Bergiante; Botelho, Larissa Alvarenga Batista; Campana, Eloiza Helena; Picão, Renata Cristina; Bonelli, Raquel Regina

    2016-12-01

    Plasmid-mediated qnr genes have been reported in bacteria worldwide and are widely associated with other relevant determinants of resistance in multiresistance plasmids. Here, we provide an update on a previously described multiplex PCR in order to detect all six qnr families (including qnrA, qnrS, qnrB, qnrC, qnrD, and qnrVC) described until now. The proposed method makes possible the screening of these genes, reducing cost and time, and it may demonstrate an underestimated prevalence of the latest variants described. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Rapid subtyping of tick-borne encephalitis virus isolates using multiplex RT-PCR

    Czech Academy of Sciences Publication Activity Database

    Růžek, Daniel; Šťastná, B.; Kopecký, Jan; Golovljova, I.; Grubhoffer, Libor

    2007-01-01

    Roč. 144, 1/2 (2007), s. 133-137 ISSN 0166-0934 R&D Projects: GA MŠk(CZ) LC06009; GA ČR(CZ) GA524/06/1479 Grant - others:Grantová agentura Jihočeské univerzity(CZ) 44/2006/P-BF; Estonian Science Foundation(EE) 5963; GAMŠk(CZ) FRVŠ 230/2007 Institutional research plan: CEZ:AV0Z60220518 Keywords : tick-borne encephalitis virus * subtyping * multiplex RT-PCR Subject RIV: EE - Microbiology, Virology Impact factor: 1.933, year: 2007

  19. Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of -Thalassemia

    Directory of Open Access Journals (Sweden)

    Raquel M. Fernández

    2013-01-01

    Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.

  20. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients

    OpenAIRE

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; Almeida, Margarete Teresa Gottardo de; Del Negro, Gilda Maria Barbaro

    2014-01-01

    Abstract Background Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection i...

  1. Quantitation of Marek's disease and chicken anemia viruses in organs of experimentally infected chickens and commercial chickens by multiplex real-time PCR.

    Science.gov (United States)

    Davidson, Irit; Raibshtein, I; Al-Touri, A

    2013-06-01

    The worldwide distribution of chicken anemia virus (CAV) and Marek's disease virus (MDV) is well documented. In addition to their economic significance in single- or dual-virus infections, the two viruses can often accompany various other pathogens and affect poultry health either directly, by causing tumors, anemia, and delayed growth, or indirectly, by aggravating other diseases, as a result of their immunosuppressive effects. After a decade of employing the molecular diagnosis of those viruses, which replaced conventional virus isolation, we present the development of a real-time multiplex PCR for the simultaneous detection of both viruses. The real-time PCRs for MDV and for CAV alone are more sensitive than the respective end-point PCRs. In addition, the multiplex real-time shows a similar sensitivity when compared to the single real-time PCR for each virus. The newly developed real-time multiplex PCR is of importance in terms of the diagnosis and detection of low copies of each virus, MDV and CAV in single- and in multiple-virus infections, and its applicability will be further evaluated.

  2. Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

    Science.gov (United States)

    Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

    2017-12-01

    Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

  3. Optimization of a multiplex PCR assay for detecting transgenic soybean components in feed products.

    Science.gov (United States)

    Tian, Fang; Wang, Xiumin; Teng, Da; Yang, Yalin; Guan, Qingfeng; Ao, Changjin; Wang, Jianhua

    2011-11-01

    A multiplex polymerase chain reaction (m-PCR) assay was developed for the simultaneous detection of multiple components of genetically modified (GM) soybean. It uses two sets of primers (I, lectin1/35S/CP4; II, lectin2/35S/CP4) specific for a soybean reference gene, the 35S promoter, and an event-specific gene. Amplified fragments of 118, 414, 195, and 320 bp were easily detected by agarose gel electrophoresis and were positively confirmed by sequencing. Primer set concentrations and annealing temperatures in the m-PCR were optimized. The optimized m-PCR conditions were obtained for primer set I at a ratio of 1:2:3 and a 59.2 °C annealing temperature and set II at the same ratio and 58.6 °C, 60.3 °C, and 61.2 °C annealing temperatures. The sensitivities of the two m-PCR primer sets (I and II) were 0.25% and 0.5%, respectively. The results showed that this m-PCR assay provides rapid, reliable, and effective identification of multiple components of GM soybean in feed.

  4. Validation of multiplex PCR strategy for simultaneous detection and identification of methicillin resistant Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Rallapalli S

    2008-01-01

    Full Text Available Multiplex polymerase chain reaction (PCR strategy is described for rapid identification of clinically relevant methicillin resistant Staphylococcus aureus (MRSA that targets mecA and coag ulase genes. In this study, 150 staphylococcal clinical isolates were used that included 40 isolates of MRSA, 55 isolates of methicillin susceptible S. aureus (MSSA, 44 isolates of methicillin susceptible coag ulase negative Staphylococcus spp. (MS-CoNS and 11 isolates of methicillin resistant coag ulase negative Staphylococcus spp. (MR-CoNS. Out of 55 S. aureus strains, three strains demonstrated mecA gene, which appeared to be oxacillin sensitive by disc diffusion. When (MS-CoNS were evaluated, 10 isolates classified as oxacillin sensitive phenotypically, yielded positive results in PCR method. The results for mecA detection by PCR were more consistent with disk susceptibility tests in case of MRSA (100% and MSSA (95% isolates. In contrast to above results with MRSA and MSSA, mecA detection by PCR in MS-CoNS showed less correlation with disk susceptibility tests (77%. The results for coag detection by PCR were consistent with phenotypic tests in all isolates.

  5. Detection by multiplex PCR of Staphylococcus aureus , S. intermedius and S. hyicus in artificially contaminated milk

    Directory of Open Access Journals (Sweden)

    Eliezer Avila Gandra

    2016-01-01

    Full Text Available ABSTRACT: This research aimed to detect coagulase-positive Staphylococcus (CPS directly in samples of artificially contaminated milk, using multiplex PCR (mPCR. Standard and isolated bacterial strains of S. aureus, S. epidermidis, S. hyicus, S. intermedius, Listeria monocytogenes and Escherichia coli species were used, evaluating the specificity and detection limit of mPCR, for artificially contaminated UHT milk. Primers specific for the nuc gene (NUC1-NUC2 were used for S. aureus, NUC3-NUC4 for S. hyicus and NUC5-NUC6 for S. intermedius. It was possible to detect the three target species by mPCR, directly from bovine whole milk, with adequate specificity and acceptable detention limit for identification of coagulase-positive Staphylococcus (CPS in foods. The specificity was determined by the amplification of species-specific fragments, and the detection limit was assessed by the detection thresholds obtained for the three species (103 CFU mL-1. From these results, the mPCR described, with the proposed set of primers, has the potential for use in precise identification and differentiation between CPSs in milk samples.

  6. Short communication: Detection of stx2 and elt genes in bovine milk by using a multiplex PCR system.

    Science.gov (United States)

    Nandi, R D S; Campos, A C; Puño-Sarmiento, J J; Maluta, R P; Rocha, S P D; Kobayashi, R K T; Nakazato, G

    2017-10-01

    The aim of this study was to detect 2 important toxin genes from diarrheagenic Escherichia coli (DEC) in bovine milk using a new multiplex PCR. To standardize the multiplex PCR, the stx2 and elt genes were investigated for the detection of Shiga toxin-producing Escherichia coli (STEC) and enterotoxigenic E. coli (ETEC), respectively. The DNA template was prepared with a thermal procedure (boiling) and a commercial kit. Samples consisted of UHT and pasteurized milk, both skimmed, and STEC and ETEC were tested in concentrations between 10 1 and 10 9 cfu/mL. With the thermal procedure, the multiplex PCR system detected both pathotypes of E. coli at 10 9 cfu/mL in UHT and pasteurized milk. When the commercial kit was used for template preparation, STEC and ETEC could be detected at concentrations as low as 10 4 cfu/mL in UHT and pasteurized milk. Negative controls (Listeria monocytogenes, Salmonella Typhimurium, Salmonella Enteritidis, and Escherichia coli strain APEC 13) were not amplified with the multiplex PCR. These results indicate that the multiplex PCR was a rapid (less than 6 h) and efficient method to detect STEC and ETEC in milk using different methods for DNA preparation; however, the commercial kit was more sensitive than the thermal procedure. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense.

    Science.gov (United States)

    Janzen, Timothy W; Thomas, Matthew C; Goji, Noriko; Shields, Michael J; Hahn, Kristen R; Amoako, Kingsley K

    2015-02-01

    Bacillus anthracis, the causative agent of anthrax, has the capacity to form highly resilient spores as part of its life cycle. The potential for the dissemination of these spores using food as a vehicle is a huge public health concern and, hence, requires the development of a foodborne bioterrorism response approach. In this work, we address a critical gap in food biodefense by presenting a novel, combined, sequential method involving the use of real-time PCR and pyrosequencing for the rapid, specific detection of B. anthracis spores in three food matrices: milk, apple juice, and bottled water. The food samples were experimentally inoculated with 40 CFU ml(-1), and DNA was extracted from the spores and analyzed after immunomagnetic separation. Applying the combination of multiplex real-time PCR and pyrosequencing, we successfully detected the presence of targets on both of the virulence plasmids and the chromosome. The results showed that DNA amplicons generated from a five-target multiplexed real-time PCR detection using biotin-labeled primers can be used for single-plex pyrosequencing detection. The combined use of multiplexed real-time PCR and pyrosequencing is a novel, rapid detection method for B. anthracis from food and provides a tool for accurate, quantitative identification with potential biodefense applications.

  8. Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays

    Directory of Open Access Journals (Sweden)

    Jenny Kourea-Kremastinou

    2013-03-01

    Full Text Available The investigation of respiratory infections by molecular techniques provides important information about the epidemiology of respiratory disease, especially during the post-vaccination era. The objective of the present study was the detection of bacterial pathogens directly in clinical samples from patients with upper and lower respiratory tract infections using multiplex polymerase chain reaction (PCR assays developed in our laboratory. Clinical samples taken over a three-year period (2007–2009 and obtained from 349 patients (adults (n = 66; children (n = 283 with signs and symptoms of certain upper or lower respiratory tract infections, consisted of: bronchoalveolar lavages (BAL, n = 83, pleural fluids (n = 29, and middle-ear aspirates (n = 237. Overall, 212 samples (61% were confirmed by culture and/or PCR. Among the positive samples, Streptococcus pneumoniae (mainly serotype 3 was predominant (104/212; 49.0%, followed by non-typable Haemophilus influenzae (NTHi 59/212; 27.8% and Streptococcus pyogenes (47/212; 22%. Haemophilus influenzae type b was detected in only three samples. The underlying microbiology of respiratory infections is gradually changing in response to various selective pressures, such as vaccine use and antibiotic consumption. The application of multiplex PCR (mPCR assays is particularly useful since it successfully identified the microorganisms implicated in acute otitis media or lower respiratory tract infections in nearly 75% of patients with a positive result compared to conventional cultures. Non-culture identification of the implicated pneumococcal serotypes is also an important issue for monitoring pneumococcal infections in the era of conjugate pneumococcal vaccines.

  9. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  10. Determination of cis/trans phase of variations in the MC1R gene with allele-specific PCR and single base extension

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Børsting, Claus; Sanchez, Juan J

    2008-01-01

    The MC1R gene encodes a protein with key regulatory functions in the melanin synthesis. A multiplex PCR and a multiplex single base extension protocol were established for genotyping six exonic MC1R variations highly penetrant for red hair (R), four exonic MC1R variations weakly penetrant for red...

  11. Detection of virulence, antibiotic resistance and toxin (VAT) genes in Campylobacter species using newly developed multiplex PCR assays.

    Science.gov (United States)

    Laprade, Natacha; Cloutier, Michel; Lapen, David R; Topp, Edward; Wilkes, Graham; Villemur, Richard; Khan, Izhar U H

    2016-05-01

    Campylobacter species are one of the leading causes of bacterial gastroenteritis in humans worldwide. This twofold study was sought to: i) develop and optimize four single-tube multiplex PCR (mPCR) assays for the detection of six virulence (ciaB, dnaJ, flaA, flaB, pldA and racR), three toxin (cdtA, cdtB and cdtC) and one antibiotic resistance tet(O) genes in thermophilic Campylobacter spp. and ii) apply and evaluate the developed mPCR assays by testing 470 previously identified C. jejuni, C. coli and C. lari isolates from agricultural water. In each mPCR assay, a combination of two or three sets of primer pairs for virulence, antibiotic resistance and toxin (VAT) genes was used and optimized. Assay 1 was developed for the detection of dnaJ, racR and cdtC genes with expected amplification sizes of 720, 584 and 182bp. Assay 2 generated PCR amplicons for tet(O) and cdtA genes of 559 and 370bp. Assay 3 amplified cdtB ciaB, and pldA genes with PCR amplicon sizes of 620, 527 and 385bp. Assay 4 was optimized for flaA and flaB genes that generated PCR amplicons of 855 and 260bp. The primer pairs and optimized PCR protocols did not show interference and/or cross-amplification with each other and generated the expected size of amplification products for each target VAT gene for the C. jejuni ATCC 33291 reference strain. Overall, all ten target VAT genes were detected at a variable frequency in tested isolates of thermophilic Campylobacter spp. where cdtC, flaB, ciaB, cdtB, cdtA and pldA were commonly detected compared to the flaA, racR, dnaJ and tet(O) genes which were detected with less frequency. The developed mPCR assays are simple, rapid, reliable and sensitive tools for simultaneously assessing potential pathogenicity and antibiotic resistance profiling in thermophilic Campylobacter spp. The mPCR assays will be useful in diagnostic and analytical settings for routine screening of VAT characteristics of Campylobacter spp. as well as being applicable in epidemiological

  12. Detection of Gastrointestinal Pathogens from Stool Samples on Hemoccult Cards by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Martin Alberer

    2017-01-01

    Full Text Available Purpose. Up to 30% of international travelers are affected by travelers’ diarrhea (TD. Reliable data on the etiology of TD is lacking. Sufficient laboratory capacity at travel destinations is often unavailable and transporting conventional stool samples to the home country is inconvenient. We evaluated the use of Hemoccult cards for stool sampling combined with a multiplex PCR for the detection of model viral, bacterial, and protozoal TD pathogens. Methods. Following the creation of serial dilutions for each model pathogen, last positive dilution steps (LPDs and thereof calculated last positive sample concentrations (LPCs were compared between conventional stool samples and card samples. Furthermore, card samples were tested after a prolonged time interval simulating storage during a travel duration of up to 6 weeks. Results. The LPDs/LPCs were comparable to testing of conventional stool samples. After storage on Hemoccult cards, the recovery rate was 97.6% for C. jejuni, 100% for E. histolytica, 97.6% for norovirus GI, and 100% for GII. Detection of expected pathogens was possible at weekly intervals up to 42 days. Conclusion. Stool samples on Hemoccult cards stored at room temperature can be used in combination with a multiplex PCR as a reliable tool for testing of TD pathogens.

  13. Screening genetically modified organisms using multiplex-PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Jia; Miao, Haizhen; Wu, Houfei; Huang, Wensheng; Tang, Rong; Qiu, Minyan; Wen, Jianguo; Zhu, Shuifang; Li, Yao

    2006-07-15

    In this research, we developed a multiplex polymerase chain reaction (multiplex-PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a consecutive reaction to detect a genetically modified organism (GMO). There are a total of 20 probes for detecting a GMO in a DNA microarray which can be classified into three categories according to their purpose: the first for screening GMO from un-transgenic plants based on the common elements such as promoter, reporter and terminator genes; the second for specific gene confirmation based on the target gene sequences such as herbicide-resistance or insect-resistance genes; the third for species-specific genes which the sequences are unique for different plant species. To ensure the reliability of this method, different kinds of positive and negative controls were used in DNA microarray. Commercial GM soybean, maize, rapeseed and cotton were identified by means of this method and further confirmed by PCR analysis and sequencing. The results indicate that this method discriminates between the GMOs very quickly and in a cost-saving and more time efficient way. It can detect more than 95% of currently commercial GMO plants and the limits of detection are 0.5% for soybean and 1% for maize. This method is proved to be a new method for routine analysis of GMOs.

  14. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells

    Directory of Open Access Journals (Sweden)

    Spyros Darmanis

    2016-01-01

    Full Text Available Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell’s phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment.

  16. Multiplex PCR and minisequencing of SNPs--a model with 35 Y chromosome SNPs

    DEFF Research Database (Denmark)

    Sanchez, Juan J; Børsting, Claus; Hallenberg, Charlotte

    2003-01-01

    We have developed a robust single nucleotide polymorphism (SNPs) typing assay with co-amplification of 25 DNA-fragments and the detection of 35 human Y chromosome SNPs. The sizes of the PCR products ranged from 79 to 186 base pairs. PCR primers were designed to have a theoretical Tm of 60 +/- 5 d...

  17. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  18. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  19. Multiplex real-time PCR monitoring of intestinal helminths in humans reveals widespread polyparasitism in Northern Samar, the Philippines.

    Science.gov (United States)

    Gordon, Catherine A; McManus, Donald P; Acosta, Luz P; Olveda, Remigio M; Williams, Gail M; Ross, Allen G; Gray, Darren J; Gobert, Geoffrey N

    2015-06-01

    The global socioeconomic importance of helminth parasitic disease is underpinned by the considerable clinical impact on millions of people. While helminth polyparasitism is considered common in the Philippines, little has been done to survey its extent in endemic communities. High morphological similarity of eggs between related species complicates conventional microscopic diagnostic methods which are known to lack sensitivity, particularly in low intensity infections. Multiplex quantitative PCR diagnostic methods can provide rapid, simultaneous identification of multiple helminth species from a single stool sample. We describe a multiplex assay for the differentiation of Ascaris lumbricoides, Necator americanus, Ancylostoma, Taenia saginata and Taenia solium, building on our previously published findings for Schistosoma japonicum. Of 545 human faecal samples examined, 46.6% were positive for at least three different parasite species. High prevalences of S. japonicum (90.64%), A. lumbricoides (58.17%), T. saginata (42.57%) and A. duodenale (48.07%) were recorded. Neither T. solium nor N. americanus were found to be present. The utility of molecular diagnostic methods for monitoring helminth parasite prevalence provides new information on the extent of polyparasitism in the Philippines municipality of Palapag. These methods and findings have potential global implications for the monitoring of neglected tropical diseases and control measures. Copyright © 2015 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  20. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  2. Confirmed identification and toxin profiling of Campylobacter jejuni using a thermostabilized multiplex PCR formulation.

    Science.gov (United States)

    Ramachandran, Nitya; Ramlal, Shylaja; Batra, Harsh Vardhan

    2017-07-01

    Cytolethal distending toxin (CDT) producing Campylobacter jejuni species are one of the leading causes of human gastroenteritis worldwide. The main intent of the study was to develop a multiplex PCR assay for the confirmed identification and toxin profiling of C. jejuni. The genes targeted were rpo B as genus specific, hip O for species; cdt A, cdt B, cdt C encoding respective subunit proteins of CDT with Internal Amplification Control (IAC). To enhance its application as a pre-mixed ready-to-use format, the master mix of developed mPCR was dried by lyophilization and stability was assessed. Thermostabilized reagents showed stability of 1.5 months at room-temperature and upto six months at 4 °C without any loss of functionality. The assay was evaluated on a number of presumptive Campylobacter isolates along with biochemical tests. Results obtained indicated the accurate identification of C. jejuni by developed mPCR format in contrast to misconception associated with biochemical assays. The assay was also tested on spiked samples for its real-time utility. Altogether, the room-temperature storable and ready-to- use mPCR format developed in this study could be preferred for rapid detection and confirmed identification of toxigenic strains of C. jejuni in place of conventional biochemical assays. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  3. Multiplex PCR use for Staphylococcus aureus identification and oxacillin and mupirocin resistance evaluation

    Directory of Open Access Journals (Sweden)

    Alexandre Braoios

    2010-06-01

    Full Text Available

    Oxacillin-resistant Staphylococcus aureus represents a serious problem in hospitals worldwide, increasing infected patients’ mortality and morbidity and raising treatment costs and internment time. In this study, the results of using the Multiplex PCR technique to amplify fragments of the genes femA (specific-species, mecA (oxacillin resistance and ileS-2 (mupirocin resistance were compared with those of tests conventionally used to identify S. aureus isolates and ascertain their resistance to drugs. Fifty S. aureus strains were isolated from patients receiving treatment at UNOESTE University Hospital in Presidente Prudente, SP, Brazil. The 686 bp fragment corresponding to the gene femA was amplified and detected in all the isolates. On the other hand, the 310 bp fragment corresponding to the mecA gene was amplified in 29 (58% of the isolates. All of the isolates showed sensitivity to mupirocin in the agar diffusion test, which was corroborated by the lack of any amplicon of the 456 bp fragment corresponding to the ileS-2 gene, in the PCR bands. The conventional tests to identify S. aureus and detect resistance to oxacillin and mupirocin showed 100% agreement with the PCR Multiplex results. The use of techniques for rapid and accurate identification of bacteria and assessment of their resistance may be valuable in the control of infection by resistant strains, allowing the rapid isolation and treatment of an infected patient. However, the results demonstrate that traditional phenotypic tests are also reliable, though they take more time. Keywords: PCR Multiplex. Oxacillin-resistant. Mupirocin. Staphylococcus aureus. RESUMO Utilização de PCR-multiplex para identificação de Staphylococcus aureus e avaliação da resistência à oxacilina e mupirocina Staphylococcus aureus resistente à oxacilina representa um problema grave em hospitais de todo o mundo, aumentando a morbidade e mortalidade de pacientes infectados e

  4. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection.

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-14

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  5. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  6. Multiplexed and Sensitive DNA Methylation Testing Using Methylation-Sensitive Restriction Enzymes "MSRE-qPCR".

    Science.gov (United States)

    Beikircher, Gabriel; Pulverer, Walter; Hofner, Manuela; Noehammer, Christa; Weinhaeusel, Andreas

    2018-01-01

    DNA methylation is a chemically stable key-player in epigenetics. In the vertebrate genome the 5-methyl cytosine (5mC) has been found almost exclusively in the CpG dinucleotide context. CpG dinucleotides are enriched in CpG islands very frequently located within or close to gene promoters. Analyses of DNA methylation changes in human diagnostics have been conducted classically using methylation-sensitive restriction enzymes (MSRE). Since the discovery of bisulfite conversion-based sequencing and PCR assays, MSRE-based PCR assays have been less frequently used, although especially in the field of cancer epigenetics MSRE-based genome-wide discovery and targeted screening applications have been and are still performed successfully. Even though epigenome-wide discovery of altered DNA methylation patterns has found its way into various fields of human disease and molecular genetics research, the validation of findings upon discovery is still a bottleneck. Usually several multiples of 10 up to 100 candidate biomarkers from discovery have to be confirmed or are of interest for further work. In particular, bisulfite PCR assays are often limited in the number of candidates which can be analyzed, due to their low multiplexing capability, especially, if only small amounts of DNA are available from for example clinical specimens. In clinical research and diagnostics a similar situation arises for the analyses of cell-free DNA (cfDNA) in body fluids or circulating tumor cells (CTCs). Although tissue- or disease- (e.g., cancer) specific DNA methylation patterns can be deduced very efficiently in a genome-wide manner if around 100 ng of DNA are available, confirming these candidates and selecting target-sequences for studying methylation changes in liquid biopsies using cfDNA or CTCs remains a big challenge. Along these lines we have developed MSRE-qPCR and introduce here method details, which have been found very suitable for the efficient confirmation and testing of DNA

  7. Group-specific multiplex PCR detection systems for the identification of flying insect prey.

    Directory of Open Access Journals (Sweden)

    Daniela Sint

    Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

  8. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  9. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  10. Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

    OpenAIRE

    Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

    2011-01-01

    Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

  11. Multiplex Tandem PCR: a Novel Platform for Rapid Detection and Identification of Fungal Pathogens from Blood Culture Specimens▿

    OpenAIRE

    Lau, Anna; Sorrell, Tania C.; Chen, Sharon; Stanley, Keith; Iredell, Jonathan; Halliday, Catriona

    2008-01-01

    We describe the first development and evaluation of a rapid multiplex tandem PCR (MT-PCR) assay for the detection and identification of fungi directly from blood culture specimens that have been flagged as positive. The assay uses a short-cycle multiplex amplification, followed by 12 simultaneous PCRs which target the fungal internal transcribed spacer 1 (ITS1) and ITS2 region, elongation factor 1-α (EF1-α), and β-tubulin genes to identify 11 fungal pathogens: Candida albicans, Candida dublin...

  12. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  13. Laser capture microdissection and multiplex-tandem PCR analysis of proximal tubular epithelial cell signaling in human kidney disease.

    Directory of Open Access Journals (Sweden)

    Ray Wilkinson

    Full Text Available Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD but emerging evidence is now linking many forms of acute kidney disease (AKD with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate "real time" gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue.

  14. Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

    DEFF Research Database (Denmark)

    Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

    2009-01-01

    (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...

  15. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  18. Usefulness of multiplex PCR in the diagnosis of genital tuberculosis in females with infertility.

    Science.gov (United States)

    Sankar, M M; Kumar, P; Munawwar, A; Kumar, M; Singh, J; Singh, A; Parashar, D; Malhotra, N; Duttagupta, S; Singh, S

    2013-03-01

    The purpose of this investigation was to evaluate the usefulness of multiplex polymerase chain reaction (m-PCR) in detecting uterine tuberculosis in women with infertility. In a prospective study, endometrial curetting from 620 females with infertility were investigated using laparoscopy, hysteroscopy, histopathology, smear microscopy, mycobacterial culture in BACTEC MGIT™ 960, and in-house m-PCR. The mean age of the women was 29.75 ± 4.66 years. The majority (596) sought medical attention for infertility; of them, 455 (76.34 %) presented with primary and 141 (23.65 %) with secondary infertility. A total of 158 (25.48 %) women were diagnosed as having uterine tuberculosis by at least one of the diagnostic methods. Among them, laparoscopy was positive in 46 (29.11 %), hysteroscopy in 77 (48.73 %), histopathology in only 8 (5.06 %), smear for acid fast bacilli in 4 (2.53 %), and liquid culture in 24 (15.18 %) patients. The in-house m-PCR was positive in 135 (85.44 %) women. Of these, 129 (95.55 %) samples were positive for Mycobacterium tuberculosis, while 6 (4.44 %) were positive for non-tuberculous mycobacterial DNA. Of the 129 M. tuberculosis PCR-positive women, 112 received anti-tubercular treatment and 23 of these conceived and fell pregnant after the completion of treatment. For the diagnosis of uterine tuberculosis, m-PCR was found to be the most efficient diagnostic tool compared to the other methods.

  19. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  20. Establishment of Multiplex Solid-Phase Strip PCR Test for Detection of 24 Ocular Infectious Disease Pathogens.

    Science.gov (United States)

    Nakano, Satoko; Sugita, Sunao; Tomaru, Yasuhiro; Hono, Ayumi; Nakamuro, Takako; Kubota, Toshiaki; Takase, Hiroshi; Mochizuki, Manabu; Takahashi, Masayo; Shimizu, Norio

    2017-03-01

    To establish and evaluate a new multiplex solid-phase strip polymerase chain reaction (strip PCR) for concurrent detection of common ocular infectious disease pathogens. A new multiplex strip PCR was established to detect 24 common ocular infectious disease pathogens: herpes simplex virus (HSV) 1, HSV2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus (HHV) 6, HHV7, HHV8, human T-cell lymphotropic virus (HTLV)-1, adenovirus, Mycobacterium tuberculosis, Treponema pallidum, Propionibacterium acnes (P. acnes), bacterial 16S ribosomal RNA (rRNA), Candida species (Candida sp.), C. glabrata, C. krusei, Aspergillus, Fusarium, fungal 28S rRNA, Toxoplasma (T. gondii), Toxocara, Chlamydia trachomatis (C. trachomatis), and Acanthamoeba. Strip PCR was tested with a negative control (distilled water) and standard positive control DNA. Cutoffs of quantification cycle (Cq) values were determined with noninfectious ocular samples to avoid false-positives caused by contamination with P. acnes, bacterial 16S, and fungal 28S from reagents and ocular surfaces. A pilot study to evaluate the strip PCR was performed using infectious ocular samples (aqueous humor, vitreous, cornea, and tears) by strip PCR and previously developed capillary-type multiplex PCR and quantitative real-time PCR (qPCR). Strip PCR was verified with negative and positive controls. Strip PCR rapidly detected HSV1, HSV2, VZV, EBV, CMV, HHV6, HHV7, HTLV-1, adenovirus, P. acnes, bacterial 16S, Candida sp., C. glabrata, Aspergillus, fungal 28S, T. gondii, C. trachomatis, and Acanthamoeba in patient samples. The sensitivity was comparable to that of qPCR. Our novel strip PCR assay is a simple, rapid, and high-sensitivity method for detecting ocular infectious disease pathogens.

  1. Detection of pathogenic strains by multiplex PCR and antimicrobial sensitivity of Escherichia coli isolated from piglets

    OpenAIRE

    Macêdo, N.R.; Menezes, C.P.L.; Lage, A.P.; Ristow, L.E.; Reis, A.; Guedes, R.M.C.

    2007-01-01

    Avaliou-se a freqüência dos genes de fímbrias (K88, K99, 987P, F18 e F41) e toxinas (LT, Stb, StaP e Stx2e) de cepas de E. coli isoladas de leitões com diarréia usando a técnica de PCR multiplex com primers específicos para esses genes, e estudou-se o padrão de sensibilidade das cepas patogênicas pelo método de difusão em disco ao florfenicol, ceftiofur sódico, colistina, fosfomicina, neomicina, norfloxacina, sulfa + trimetoprim, doxiciclina, tetraciclina e lincomicina. Foram utilizadas 144 a...

  2. Multiplex PCR To Identify Macrolide Resistance Determinants in Mannheimia haemolytica and Pasteurella multocida

    DEFF Research Database (Denmark)

    Rose, Simon; Desmolaize, Benoit; Jaju, Puneet

    2012-01-01

    The bacterial pathogens Mannheimia haemolytica and Pasteurella multocida are major etiological agents in respiratory tract infections of cattle. Although these infections can generally be successfully treated with veterinary macrolide antibiotics, a few recent isolates have shown resistance...... to these drugs. Macrolide resistance in members of the family Pasteurellaceae is conferred by combinations of at least three genes: erm(42), which encodes a monomethyltransferase and confers a type I MLS(B) (macrolide, lincosamide, and streptogramin B) phenotype; msr(E), which encodes a macrolide efflux pump...... fragments of the 23S rRNA (rrl) genes. One rrl fragment acts as a general indicator of gammaproteobacterial species and confirms whether the PCR assay has functioned as intended on strains that are negative for erm(42), msr(E), and mph(E). The multiplex system has been tested on more than 40 selected...

  3. Detection and identification of food-borne pathogens of the genera Campylobacter, Arcobacter and Helicobacter by multiplex PCR in poultry and poultry products.

    Science.gov (United States)

    Neubauer, C; Hess, M

    2006-10-01

    The objective of this study was to develop a multiplex polymerase chain reaction (PCR) to detect and differentiate food-borne pathogens of the three genera Campylobacter, Arcobacter and Helicobacter in a single step procedure. One common reverse primer and three genus-specific forward primers were designed by hybridizing to the 16S rRNA of selected reference strains. Besides the species with significance as food-borne pathogens isolated from poultry meat--Campylobacter jejuni, Campylobacter coli, Arcobacter butzleri and Helicobacter pullorum--several other members of these genera were tested to determine the specificity of the designed multiplex PCR. In total, 20 ATCC and NCTC reference strains of Campyobacter, Arcobacter and Helicobacter were used to evaluate the PCR. Specific amplificates were obtained from all thermophilic species of Campylobacter as well as from species of Arcobacter and Helicobacter. No amplification product was obtained from the non-thermophilic Campylobacter, C. hyointestinalis and C. fetus. Furthermore, a total of 43 field strains of the three genera isolated from poultry, pigs, cattle and humans were investigated using this PCR. To confirm the classification of 10 H. pullorum strains the 16S rRNAs were sequenced. The developed PCR is a helpful diagnostic tool to detect and differentiate Campylobacter, Arcobacter and Helicobacter isolated from poultry and poultry products.

  4. High throughput multiplex real time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants

    OpenAIRE

    Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.

    2016-01-01

    Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...

  5. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  6. A one-step real-time multiplex PCR for screening Y-chromosomal microdeletions without downstream amplicon size analysis.

    Directory of Open Access Journals (Sweden)

    Viviana Kozina

    Full Text Available BACKGROUND: Y-chromosomal microdeletions (YCMD are one of the major genetic causes for non-obstructive azoospermia. Genetic testing for YCMD by multiplex polymerase chain reaction (PCR is an established method for quick and robust screening of deletions in the AZF regions of the Y-chromosome. Multiplex PCRs have the advantage of including a control gene in every reaction and significantly reducing the number of reactions needed to screen the relevant genomic markers. PRINCIPAL FINDINGS: The widely established "EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions (2004" were used as a basis for designing a real-time multiplex PCR system, in which the YCMD can simply be identified by their melting points. For this reason, some AZF primers were substituted by primers for regions in their genomic proximity, and the ZFX/ZFY control primer was exchanged by the AMELX/AMELY control primer. Furthermore, we substituted the classical SybrGreen I dye by the novel and high-performing DNA-binding dye EvaGreen™ and put substantial effort in titrating the primer combinations in respect to optimal melting peak separation and peak size. SIGNIFICANCE: With these changes, we were able to develop a platform-independent and robust real-time based multiplex PCR, which makes the need for amplicon identification by electrophoretic sizing expendable. By using an open-source system for real-time PCR analysis, we further demonstrate the applicability of automated melting point and YCMD detection.

  7. Rapid detection and differentiation of Listeria monocytogenes and Listeria species in deli meats by a new multiplex PCR method

    Science.gov (United States)

    Listeria monocytogenes is an important foodborne pathogen. To effectively control this pathogen, it is necessary to have a method that can detect and differentiate L. monocytogenes from other Listeria species in food, environmental, and clinical samples. A new multiplex PCR method using new primers ...

  8. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA...

  9. Evaluation of a modular multiplex-PCR methicillin-resistant Staphylococcus aureus detection assay adapted for mecC detection

    NARCIS (Netherlands)

    Becker, Karsten; Larsen, Anders R; Skov, Robert L; Paterson, Gavin K; Holmes, Mark A; Sabat, Artur J; Friedrich, Alexander W; Köck, Robin; Peters, Georg; Kriegeskorte, André

    A mecC (mecA(LGA251))-adapted multiplex PCR-based methicillin-resistant Staphylococcus aureus (MRSA) detection assay was evaluated using an international, spa-typed Staphylococcus aureus collection comprising 51 mecC-positive MRSA, 240 mecA-positive MRSA, and 50 mecA-and mecC-negative

  10. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    Science.gov (United States)

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  11. Development of a multiplex real-time PCR to quantify aflatoxin, ochratoxin A and patulin producing molds in foods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Andrade, María J; Córdoba, Juan J

    2012-04-02

    A multiplex real-time PCR (qPCR) method to quantify aflatoxin, ochratoxin A (OTA) and patulin producing molds in foods was developed. For this, the primer pairs F/R-omt, F/R-npstr and F/R-idhtrb and the TaqMan probes, OMTprobe, NPSprobe and IDHprobe targeting the omt-1, otanpsPN and idh genes involved in aflatoxin, OTA and patulin biosynthesis, respectively, were used. The functionality of the developed qPCR method was demonstrated by the high linear relationship of the standard curves constructed with the omt-1, otanpsPN and idh gene copies and threshold cycle (Ct) values for the respective producing molds tested to quantify aflatoxin, OTA and patulin producing molds. The ability of the optimized qPCR protocol to quantify producing molds was evaluated in different artificially inoculated foods (fruits, nuts, cereals and dry-ripened meat and cheese products). Efficiency values ranged from 81 to 110% in all inoculated foods. The detection limit was between 3 and 1logcfu/g for aflatoxin, OTA and patulin producing molds. The developed multiplex qPCR was shown be an appropriate tool for sensitive quantification of growth of toxigenic fungi in foods throughout the incubation time. Thus, the multiplex qPCR is a useful, rapid and efficient method to quantify simultaneously aflatoxin, OTA and patulin producing molds in food products. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples.

    Science.gov (United States)

    Yuan, Yanfang; Xu, Wentao; Zhai, Zhifang; Shi, Hui; Luo, Yunbo; Chen, Zhuojun; Huang, Kunlun

    2009-10-01

    Escherichia coli, Listeria monocytogenes, and Salmonella spp. are 3 kinds of the most important food-borne human pathogens. Traditional microbiological analysis is labor-intensive, time-consuming, and easily contaminated, thus producing false positive signals; it also involves much subjectivity judgments. Multiplex-PCR could be applied to detect multiple target organisms simultaneously to save time and labor, but there is always disproportionate amplification resulting from the disparity of different primers. To gain a rapid and sensitive method, a universal primer-multiplex PCR system (UP-M-PCR) was developed and applied for simultaneous detection of the 3 organisms. This method simplified traditional multiplex-PCR reaction system and overcame its amplification disparities among different primers; moreover, it got a high specificity and sensitivity (85, 155, and 104 copies/reaction for E. coli O157, L. monocytogenes, and Salmonella spp., respectively). Compared with the time-consuming and laborious microbiological analysis, UP-M-PCR had a lower risk of cross-contamination without inoculation and incubation. Test results for 36 food samples showed that UP-M-PCR method got a relative accuracy of 91.77% when compared with traditional microbiological analysis. It could serve as a rapid screening method for pathogen detection and could detect target genes even in dead pathogenic cells. In addition, it has the potential to be performed in an automation mode and might find broader application in simultaneous detection of other multiple pathogens.

  13. Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Alireza Talebi

    2011-09-01

    Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.

  14. Molecular detection of human Plasmodium species in Sabah using PlasmoNex™ multiplex PCR and hydrolysis probes real-time PCR.

    Science.gov (United States)

    Lee, Ping Chin; Chong, Eric Tzyy Jiann; Anderios, Fread; Al Lim, Yvonne; Chew, Ching Hoong; Chua, Kek Heng

    2015-01-28

    Malaria is a vector borne-parasitic disease transmitted through the bite of the infective female Anopheles mosquitoes. Five Plasmodium species have been recognized by World Health Organization (WHO) as the causative agents of human malaria. Generally, microscopic examination is the gold standard for routine malaria diagnosis. However, molecular PCR assays in many cases have shown improvement on the sensitivity and specificity over microscopic or other immunochromatographic assays. The present study attempts to screen 207 suspected malaria samples from patients seeking treatment in clinics around Sabah state, Malaysia, using two panels of multiplex PCRs, conventional PCR system (PlasmoNex™) and real-time PCR based on hydrolysis probe technology. Discordance results between two PCR assays were further confirmed by sequencing using 18S ssu rRNA species-specific primers. Of the 207 malaria samples, Plasmodium knowlesi (73.4% vs 72.0%) was the most prevalent species based on two PCR assays, followed by Plasmodium falciparum (15.9% vs 17.9%), and Plasmodium vivax (9.7% vs 7.7%), respectively. Neither Plasmodium malariae nor Plasmodium ovale was detected in this study. Nine discrepant species identification based on both the PCR assays were further confirmed through DNA sequencing. Species-specific real-time PCR only accurately diagnosed 198 of 207 (95.7%) malaria samples up to species level in contrast to PlasmoNex™ assay which had 100% sensitivity and specificity based on sequencing results. Multiplex PCR accelerate the speed in the diagnosis of malaria. The PlasmoNex™ PCR assay seems to be more accurate than real-time PCR in the speciation of all five human malaria parasites. The present study also showed a significant increase of the potential fatal P. knowlesi infection in Sabah state as revealed by molecular PCR assays.

  15. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  16. Reliable detection and identification of genetically modified maize, soybean, and canola by multiplex PCR analysis.

    Science.gov (United States)

    James, Delano; Schmidt, Anna-Mary; Wall, Erika; Green, Margaret; Masri, Saad

    2003-09-24

    Multiplex PCR procedures were developed for simultaneously detecting multiple target sequences in genetically modified (GM) soybean (Roundup Ready), maize (event 176, Bt11, Mon810, T14/25), and canola (GT73, HCN92/28, MS8/RF3, Oxy 235). Internal control targets (invertase gene in corn, lectin and beta-actin genes in soybean, and cruciferin gene in canola) were included as appropriate to assess the efficiency of all reactions, thereby eliminating any false negatives. Primer combinations that allowed the identification of specific lines were used. In one system of identification, simultaneous amplification profiling (SAP), rather than target specific detection, was used for the identification of four GM maize lines. SAP is simple and has the potential to identify both approved and nonapproved GM lines. The template concentration was identified as a critical factor affecting efficient multiplex PCRs. In canola, 75 ng of DNA template was more effective than 50 ng of DNA for the simultaneous amplification of all targets in a reaction volume of 25 microL. Reliable identification of GM canola was achieved at a DNA concentration of 3 ng/microL, and at 0.1% for GM soybean, indicating high levels of sensitivity. Nonspecific amplification was utilized in this study as a tool for specific and reliable identification of one line of GM maize. The primer cry1A 4-3' (antisense primer) recognizes two sites on the DNA template extracted from GM transgenic maize containing event 176 (European corn borer resistant), resulting in the amplification of products of 152 bp (expected) and 485 bp (unexpected). The latter fragment was sequenced and confirmed to be Cry1A specific. The systems described herein represent simple, accurate, and sensitive GMO detection methods in which only one reaction is necessary to detect multiple GM target sequences that can be reliably used for the identification of specific lines of GMOs.

  17. A multiplex PCR protocol for rapid identification of Candida glabrata and its phylogenetically related species Candida nivariensis and Candida bracarensis.

    Science.gov (United States)

    Romeo, Orazio; Scordino, Fabio; Pernice, Ida; Lo Passo, Carla; Criseo, Giuseppe

    2009-10-01

    We have developed a multiplex PCR protocol for the detection of Candida glabrata and its closely related species Candida nivariensis and Candida bracarensis. The method uses four PCR primers, targeting the ITS1 region and the 5.8S ribosomal RNA gene. The combination of these primers yielded unique results to all Candida species tested. The PCR assay we developed was found to be a rapid, specific and easy to perform method and it will be useful for characterizing large numbers of isolates for epidemiological studies.

  18. A lab-on-a-chip system integrating tissue sample preparation and multiplex RT-qPCR for gene expression analysis in point-of-care hepatotoxicity assessment.

    Science.gov (United States)

    Lim, Geok Soon; Chang, Joseph S; Lei, Zhang; Wu, Ruige; Wang, Zhiping; Cui, Kemi; Wong, Stephen

    2015-10-21

    A truly practical lab-on-a-chip (LOC) system for point-of-care testing (POCT) hepatotoxicity assessment necessitates the embodiment of full-automation, ease-of-use and "sample-in-answer-out" diagnostic capabilities. To date, the reported microfluidic devices for POCT hepatotoxicity assessment remain rudimentary as they largely embody only semi-quantitative or single sample/gene detection capabilities. In this paper, we describe, for the first time, an integrated LOC system that is somewhat close to a practical POCT hepatotoxicity assessment device - it embodies both tissue sample preparation and multiplex real-time RT-PCR. It features semi-automation, is relatively easy to use, and has "sample-in-answer-out" capabilities for multiplex gene expression analysis. Our tissue sample preparation module incorporating both a microhomogenizer and surface-treated paramagnetic microbeads yielded high purity mRNA extracts, considerably better than manual means of extraction. A primer preloading surface treatment procedure and the single-loading inlet on our multiplex real-time RT-PCR module simplify off-chip handling procedures for ease-of-use. To demonstrate the efficacy of our LOC system for POCT hepatotoxicity assessment, we perform a preclinical animal study with the administration of cyclophosphamide, followed by gene expression analysis of two critical protein biomarkers for liver function tests, aspartate transaminase (AST) and alanine transaminase (ALT). Our experimental results depict normalized fold changes of 1.62 and 1.31 for AST and ALT, respectively, illustrating up-regulations in their expression levels and hence validating their selection as critical genes of interest. In short, we illustrate the feasibility of multiplex gene expression analysis in an integrated LOC system as a viable POCT means for hepatotoxicity assessment.

  19. Interlaboratory transfer of a PCR multiplex method for simultaneous detection of four genetically modified maize lines: Bt11, MON810, T25, and GA21.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Zhang, David; Esteve, Teresa; Pla, Maria; Prat, Salomé

    2005-05-04

    The number of cultured hectares and commercialized genetically modified organisms (GMOs) has increased exponentially in the past 9 years. Governments in many countries have established a policy of labeling all food and feed containing or produced by GMOs. Consequently, versatile, laboratory-transferable GMO detection methods are in increasing demand. Here, we describe a qualitative PCR-based multiplex method for simultaneous detection and identification of four genetically modified maize lines: Bt11, MON810, T25, and GA21. The described system is based on the use of five primers directed to specific sequences in these insertion events. Primers were used in a single optimized multiplex PCR reaction, and sequences of the amplified fragments are reported. The assay allows amplification of the MON810 event from the 35S promoter to the hsp intron yielding a 468 bp amplicon. Amplification of the Bt11 and T25 events from the 35S promoter to the PAT gene yielded two different amplicons of 280 and 177 bp, respectively, whereas amplification of the 5' flanking region of the GA21 gave rise to an amplicon of 72 bp. These fragments are clearly distinguishable in agarose gels and have been reproduced successfully in a different laboratory. Hence, the proposed method comprises a rapid, simple, reliable, and sensitive (down to 0.05%) PCR-based assay, suitable for detection of these four GM maize lines in a single reaction.

  20. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  1. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae.

    Science.gov (United States)

    Settypalli, Tirumala Bharani Kumar; Lamien, Charles Euloge; Spergser, Joachim; Lelenta, Mamadou; Wade, Abel; Gelaye, Esayas; Loitsch, Angelika; Minoungou, Germaine; Thiaucourt, Francois; Diallo, Adama

    2016-01-01

    Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in 17 samples

  2. One-Step Multiplex RT-qPCR Assay for the detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

    International Nuclear Information System (INIS)

    Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.

    2016-01-01

    Full text: Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%–4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  3. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

    Directory of Open Access Journals (Sweden)

    Tirumala Bharani Kumar Settypalli

    Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  4. ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.

    Science.gov (United States)

    Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R

    2018-03-09

    Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.

  5. SNaPaer: a practical single nucleotide polymorphism multiplex assay for genotyping of Pseudomonas aeruginosa.

    Science.gov (United States)

    Eusebio, Nadia; Pinheiro, Tiago; Amorim, Adelina A; Gamboa, Fernanda; Saraiva, Lucília; Gusmão, Leonor; Amorim, António; Araujo, Ricardo

    2013-01-01

    Multilocus sequence typing (MLST) represents the gold standard genotyping method in studies concerning microbial population structure, being particularly helpful in the detection of clonal relatedness. However, its applicability on large-scale genotyping is limited due to the high cost and time spent on the task. The selection of the most informative nucleotide positions simplifies genomic characterization of bacteria. A simple and informative multiplex, SNaPaer assay, was developed and genotyping of Pseudomonas aeruginosa was obtained after a single reaction of multiplex PCR amplification and mini-sequencing. This cost-effective technique allowed the analysis of a Portuguese set of isolates (n = 111) collected from three distinct hospitals and the genotyping data could be obtained in less than six hours. Point mutations were shown to be the most frequent event responsible for diversification of the Portuguese population sample. The Portuguese isolates corroborated the epidemic hypothesis for P. aeruginosa population. SNaPaer genotyping assay provided a discriminatory power of 0.9993 for P. aeruginosa, by testing in silico several hundreds of MLST profiles available online. The newly proposed assay targets less than 0.01% of the total MLST length and guarantees reproducibility, unambiguous analysis and the possibility of comparing and transferring data between different laboratories. The plasticity of the method still supports the addition of extra molecular markers targeting specific purposes/populations. SNaPaer can be of great value to clinical laboratories by facilitating routine genotyping of P. aeruginosa.

  6. Epidemiological survey on Mycoplasma gallisepticum and M. synoviae by multiplex PCR in commercial poultry Investigação epidemiológica de Mycoplasma gallisepticum e M. synoviae por PCR Multiplex em estabelecimentos comerciais de aves

    Directory of Open Access Journals (Sweden)

    Marcos Roberto Buim

    2009-07-01

    Full Text Available Mycoplasmas are important avian pathogens, which cause respiratory and joint diseases that result in large economic losses in Brazilian and world-wide poultry industry. This investigation regarding the main species of mycoplasmas, Mycoplasma gallisepticum (MG and M. synoviae (MS, responsible for the above mentioned conditions, was carried out through PCR Multiplex analysis. One thousand and forty-six (1,046 samples of tracheal swabs and piped embryos were collected from 33 farms with laying hens, breeders, broilers or hatchery, located in the Brazilian states of São Paulo, Paraná and Pernambuco, where respiratory problems or drops in egg production had occurred. The MG and MS prevalence on the farms was 72.7%. These results indicated (1 high dissemination of mycoplasmas in the evaluated farms, with predominance of MS, either as single infectious agent or associated with other mycoplasmas in 20 farms (60.6%, and (2 an increase of MS and decrease of MG infection in Brazilian commercial poultry.Os Micoplasmas são importantes patógenos aviários que causam doenças respiratórias e de articulações que resultam em grandes perdas econômicas para a indústria avícola brasileira e mundial. O estudo das principais espécies de Mycoplasma, Mycoplasma gallisepticum (MG e M. synoviae (MS, responsáveis pelas doenças mencionadas acima, foram analisadas pela técnica de PCR Multiplex. Foram colhidas 1046 amostras de suabe traqueal e embriões bicados de 33 estabelecimentos de aves de postura, matrizes, frangos de corte e um incubatório, localizados nos Estados brasileiros de São Paulo, Paraná e Pernambuco, as quais apresentavam problemas respiratórios ou queda na produção de ovos. A prevalência de MS e MG nas granjas foi de 72,7%. Os resultados indicaram uma alta disseminação de Mycoplasma nas granjas avaliadas, com predominância de MS, como um único agente infeccioso ou associado com outros micoplasmas em 20 granjas (60,6%. Assim, este

  7. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial.

    Directory of Open Access Journals (Sweden)

    Stacey Llewellyn

    2016-01-01

    Full Text Available Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy.Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples and Cambodia (213 samples. DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%. Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections.Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and Giardia compared to microscopy, especially in samples

  8. A multiplex restriction enzyme-PCR for unequivocal identification and differentiation of Trichostrongylus species in human samples.

    Science.gov (United States)

    Mizani, Azadeh; Gill, Pooria; Daryani, Ahmad; Sarvi, Shahabeddin; Amouei, Afsaneh; Katrimi, Ali Bakooie; Soleymani, Eissa; Mirshafiee, Siavash; Gholami, Sara; Hosseini, Seyed Abdollah; Gholami, Shirzad; Rahimi, Mohammad-Taghi; Hashemi-Soteh, Mohammad Bagher; Sharif, Mehdi

    2017-09-01

    Trichostrongylus species remain one of the major health challenges in the tropical and summer rainfall regions worldwide. Identification of strongylid species diagnostic methods is vital for obtaining a deep understanding of the epidemiology, population biology, anthelmintic treatment efficacy, and drug resistance in order to design effective parasite control strategies. We evaluated a multiplex RE-PCR for the diagnosis of key Trichostrongylus spp. Genomic DNA amplification of Trichostrongylus colubriformis, Trichostrongylus axei and Trichostrongylus vitrinus was achieved as standard sample using specific primers located in the second internal transcribed spacer (ITSII) of nuclear ribosomal DNA (rDNA). The mentioned method was based on isolation of Trichostrongylus ova from human fecal samples using Willis method, the extraction of ova genomic DNA samples, followed by rDNA ITSII PCR and one-step multiplex RE-PCR using three restriction enzymes of HinfI, DraI, and MseI. The multiplex RE-PCR technique provides a useful tool for discriminating all Trichostrongylus spp., being useful for diagnostic, epidemiological, ecological studies, and control programs. This method is rapid, especially when numerous restriction enzymes are required for species differentiation or identification. Copyright © 2017. Published by Elsevier B.V.

  9. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique.

    Science.gov (United States)

    Ertas, Nurhan; Gonulalan, Zafer; Yildirim, Yeliz; Kum, Erhan

    2010-08-15

    The aim of this study was to investigate the presence of Staphylococcus aureus (S. aureus) and staphylococcal enterotoxins (SEs) genes in sheep cheese and dairy dessert samples by multiplex PCR (mPCR) technique. A total of 150 samples were analyzed consisting of 50 dairy dessert samples and 100 sheep cheese. Coagulase positive staphylococci (CPS) were found in 86 (57.3%) out of 150 analyzed samples. S. aureus were isolated from 60 (60%), 26 (52%) of sheep cheese and from of dairy desserts, respectively. Five suspected colonies were tested from each sheep cheese and dairy dessert samples for phenotypic and genotypic characterizations. A total of 430 isolates from the 86 positive samples were investigated in this study. Eighty (18.6%) isolates were characterized as S. aureus. The enterotoxin genes (sea, seb, sec, sed) were found in 13 (3.02%) out of 80 isolates. From cheese isolates, sea, seb and sed were detected in 5 (1.6%), 2 (0.6%), 1 (0.3%), respectively. From dairy dessert isolates, sea, sec and sed were detected in 3 (2.3%), 1 (0.76%), 1 (0.76%), respectively. The presence of SEs was identified in 12 (2.8%) out of 80 isolates by using ELISA technique. It was determined that these SEs had a distribution of 7 (1.6%) SEA, 2 (0.46%) SEB, 1 (0.23%) SEC, and 2 (0.46%) SED. SEs were found in 7 (2.3%) cheese and 5 (3.8%) dairy dessert isolates. In conclusion, S.aureus and their SEs were found to be present in sheep cheese and dairy desserts in this study. It is emphasized that the presence of S. aureus and their SEs genes in sheep cheese and dairy desserts may be regarded as a potential risk for human health. Copyright 2010 Elsevier B.V. All rights reserved.

  10. A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

    Science.gov (United States)

    Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

    2018-04-01

    Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

  11. Detection of Human Bocavirus DNA by Multiplex PCR Analysis: Postmortem Case Report

    Directory of Open Access Journals (Sweden)

    Nihan Ziyade

    2015-06-01

    Full Text Available Background: Human bocavirus (HBoV is a virus belonging to the Parvoviridae family, which has been newly discovered to be associated with respiratory tract infections in children. There are many reports worldwide on the endemicity of this virus. Since it is relatively new, it is not routinely detected in clinical laboratory investigations. Case Report: We demonstrated that HBoV infection caused the death of a 5-month-old girl with a history of high fever and wheezing. Human bocavirus (HBoV 1/2/3/4 was found in a nasopharyngeal swab, paraffin-embedded lung tissue and stool samples by multiplex PCR methods using postmortem microbiological analysis. Conclusion: This case suggests that lower respiratory tract infections due to HBoV may cause severe and life-threatening diseases. Postmortem microbiology is useful in both clinical and forensic autopsies, and allows a suspected infection to be confirmed. To our knowledge, this report is the first document of a HBoV postmortem case in Turkey.

  12. Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.

    Science.gov (United States)

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-12-01

    Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.

  13. DNAemia detection by multiplex PCR and biomarkers for infection in systemic inflammatory response syndrome patients.

    Directory of Open Access Journals (Sweden)

    Catherine Fitting

    Full Text Available Fast and reliable assays to precisely define the nature of the infectious agents causing sepsis are eagerly anticipated. New molecular biology techniques are now available to define the presence of bacterial or fungal DNA within the bloodstream of sepsis patients. We have used a new technique (VYOO® that allows the enrichment of microbial DNA before a multiplex polymerase chain reaction (PCR for pathogen detection provided by SIRS-Lab (Jena, Germany. We analyzed 72 sepsis patients and 14 non-infectious systemic inflammatory response syndrome (SIRS patients. Among the sepsis patients, 20 had a positive blood culture and 35 had a positive microbiology in other biological samples. Of these, 51.4% were positive using the VYOO® test. Among the sepsis patients with a negative microbiology and the non-infectious SIRS, 29.4% and 14.2% were positive with the VYOO® test, respectively. The concordance in bacterial identification between microbiology and the VYOO® test was 46.2%. This study demonstrates that these new technologies offer great hopes, but improvements are still needed.

  14. A Two-Tube Multiplex Reverse Transcription PCR Assay for Simultaneous Detection of Viral and Bacterial Pathogens of Infectious Diarrhea

    Directory of Open Access Journals (Sweden)

    Ji Wang

    2014-01-01

    Full Text Available Diarrhea caused by viral and bacterial infections is a major health problem in developing countries. The purpose of this study is to develop a two-tube multiplex PCR assay using automatic electrophoresis for simultaneous detection of 13 diarrhea-causative viruses or bacteria, with an intended application in provincial Centers for Diseases Control and Prevention, China. The assay was designed to detect rotavirus A, norovirus genogroups GI and GII, human astrovirus, enteric adenoviruses, and human bocavirus (tube 1, and Salmonella, Vibrio parahaemolyticus, diarrheagenic Escherichia coli, Campylobacter jejuni, Shigella, Yersinia, and Vibrio cholera (tube 2. The analytical specificity was examined with positive controls for each pathogen. The analytical sensitivity was evaluated by performing the assay on serial tenfold dilutions of in vitro transcribed RNA, recombinant plasmids, or bacterial culture. A total of 122 stool samples were tested by this two-tube assay and the results were compared with those obtained from reference methods. The two-tube assay achieved a sensitivity of 20–200 copies for a single virus and 102-103 CFU/mL for bacteria. The clinical performance demonstrated that the two-tube assay had comparable sensitivity and specificity to those of reference methods. In conclusion, the two-tube assay is a rapid, cost-effective, sensitive, specific, and high throughput method for the simultaneous detection of enteric bacteria and virus.

  15. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  16. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  17. Development of Multiplex-Mismatch Amplification Mutation-PCR Assay for Simultaneous Detection of Campylobacter jejuni and Mutation in gyrA Gene Related to Fluoroquinolone Resistance.

    Science.gov (United States)

    Cui, Mingquan; Wu, Chenbin; Zhang, Peng; Wu, Congming

    2016-11-01

    Campylobacter jejuni, a foodborne pathogen, is the major cause of enteritis in humans worldwide, however, its increasing resistance to fluoroquinolones reported recently is of a major concern. In the present study, multiplex-mismatch amplification mutation assay-polymerase chain reaction (MMAMA-PCR) was developed for the first time with the aim to quickly identify C. jejuni and to detect the single nucleotide mutation (C-257 to T) frequently observed in gyrA gene, associated with the acquisition of resistance to fluoroquinolones. In this assay, mismatch amplification mutation primers for the detection of gyrA mutation in C. jejuni were coupled with primers for the hip gene encoding for hippuricase and 16S rRNA gene of C. jejuni, respectively, in the multiplex PCR assay. The specificity and accuracy of this method were analyzed by the use of 78 C. jejuni strains with previously confirmed resistance phenotypes and the mutation (C-257 to T) in gyrA gene, as well as 107 clinical isolates of various bacterial species, including 29 C. jejuni isolates. This study indicates that MMAMA-PCR is a promising assay for the rapid identification of C. jejuni with a specific mutation in gyrA gene, responsible for the resistance to fluoroquinolones.

  18. Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7, and Salmonella serotypes in water samples.

    Science.gov (United States)

    Park, Si Hong; Hanning, Irene; Jarquin, Robin; Moore, Philip; Donoghue, Dan J; Donoghue, Ann M; Ricke, Steven C

    2011-03-01

    Three pathogens, Campylobacter, Salmonella, and Shiga-toxin-producing Escherichia coli, are leading causes of bacterial gastroenteritis in the United States and worldwide. Although these three bacteria are typically considered food-borne pathogens, outbreaks have been reported due to contaminated drinking water and irrigation water. The aim of this research was to develop two types of PCR assays that could detect and quantify three pathogens, Campylobacter spp., E. coli O157:H7, and Salmonella spp., in watershed samples. In conventional PCR, three target strains were detected by multiplex PCR (m-PCR) using each specific primer pair simultaneously. Under optimized m-PCR conditions, the assay produced a 90-bp product for Campylobacter jejuni, a 150-bp product for E. coli O157:H7, and a 262-bp product for Salmonella Typhimurium, and the limitation of detection was approximately 700 copies for all three bacteria. In addition, real-time PCR was performed to quantify the three pathogens using SYBR green fluorescence. The assay was designed so that each target had a different melting temperature [C. jejuni (80.1 °C), E. coli O157:H7 (83.3 °C), and S. Typhimurium (85.9 °C)]. Therefore, this system could quantify and distinguish three pathogens simultaneously in a single reaction. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  19. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

    Directory of Open Access Journals (Sweden)

    Rahimi M.T.

    2016-09-01

    Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

  1. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved...... by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization......Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens...

  2. Dual priming oligonucleotide (DPO)-based multiplex PCR assay for specific detection of four diarrhoeagenic Escherichia coli in food.

    Science.gov (United States)

    Xu, Y-G; Liu, Z-M; Guan, X-T; Cui, L-C; Li, S-L

    2015-08-01

    In this study, a dual priming oligonucleotide (DPO)-based multiplex PCR assay was developed for the specific detection of four foodborne diarrhoeagenic Escherichia coli (DEC) in food, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC) O157:H7 and enteroinvasive E. coli (EIEC). Species-specific DPO primers were designed based on rfbE, LT, ipaH and bfpA genes for EHEC O157:H7, ETEC, EIEC and EPEC respectively. Our optimized DPO-based multiplex PCR assay was able to simultaneously detect these DEC from pure cultures, spiked food or environmental sample with an analytical detection limit of E. coli in food. © 2015 The Society for Applied Microbiology.

  3. Minimal Residual Disease Monitoring of Acute Myeloid Leukemia by Massively Multiplex Digital PCR in Patients with NPM1 Mutations.

    Science.gov (United States)

    Mencia-Trinchant, Nuria; Hu, Yang; Alas, Maria Antonina; Ali, Fatima; Wouters, Bas J; Lee, Sangmin; Ritchie, Ellen K; Desai, Pinkal; Guzman, Monica L; Roboz, Gail J; Hassane, Duane C

    2017-07-01

    The presence of minimal residual disease (MRD) is widely recognized as a powerful predictor of therapeutic outcome in acute myeloid leukemia (AML), but methods of measurement and quantification of MRD in AML are not yet standardized in clinical practice. There is an urgent, unmet need for robust and sensitive assays that can be readily adopted as real-time tools for disease monitoring. NPM1 frameshift mutations are an established MRD marker present in half of patients with cytogenetically normal AML. However, detection is complicated by the existence of hundreds of potential frameshift insertions, clonal heterogeneity, and absence of sequence information when the NPM1 mutation is identified using capillary electrophoresis. Thus, some patients are ineligible for NPM1 MRD monitoring. Furthermore, a subset of patients with NPM1-mutated AML will have false-negative MRD results because of clonal evolution. To simplify and improve MRD testing for NPM1, we present a novel digital PCR technique composed of massively multiplex pools of insertion-specific primers that selectively detect mutated but not wild-type NPM1. By measuring reaction end points using digital PCR technology, the resulting single assay enables sensitive and specific quantification of most NPM1 exon 12 mutations in a manner that is robust to clonal heterogeneity, does not require NPM1 sequence information, and obviates the need for maintenance of hundreds of type-specific assays and associated plasmid standards. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  4. Development and validation of two SYBR green PCR assays and a multiplex real-time PCR for the detection of Shiga toxin-producing Escherichia coli in meat.

    Science.gov (United States)

    Brusa, Victoria; Galli, Lucía; Linares, Luciano H; Ortega, Emanuel E; Lirón, Juan P; Leotta, Gerardo A

    2015-12-01

    Shiga toxin-producing Escherichia coli (STEC) are recognized as food-borne pathogens. We developed and validated two SYBR green PCR (SYBR-PCR) and a real-time multiplex PCR (RT-PCR) to detect stx1 and stx2 genes in meat samples, and compared these techniques in ground beef samples from retail stores. One set of primers and one hydrolysis probe were designed for each stx gene. For RT-PCR, an internal amplification control (IAC) was used. All PCR intra-laboratory validations were performed using pure strains and artificially contaminated ground beef samples. A total of 50 STEC and 30 non-STEC strains were used. Naturally contaminated ground beef samples (n=103) were obtained from retail stores and screened with SYBR-PCR and RT-PCR, and stx-positive samples were processed for STEC isolation. In the intra-laboratory validation, each PCR obtained a 1×10(2) CFU mL(-1) limit of detection and 100% inclusivity and exclusivity. The same results were obtained when different laboratory analysts in alternate days performed the assay. The level of agreement obtained with SYBR-PCR and RT-PCR was kappa=0.758 and 0.801 (P<0.001) for stx1 and stx2 gene detection, respectively. Two PCR strategies were developed and validated, and excellent performance with artificially contaminated ground beef samples was obtained. However, the efforts made to isolate STEC from retail store samples were not enough. Only 11 STEC strains were isolated from 35 stx-positive ground beef samples identically detected by all PCRs. The combination of molecular approaches based on the identification of a virulence genotypic profile of STEC must be considered to improve isolation. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A One-Step Real-Time Multiplex PCR for Screening Y-Chromosomal Microdeletions without Downstream Amplicon Size Analysis

    Science.gov (United States)

    Kozina, Viviana; Cappallo-Obermann, Heike; Gromoll, Jörg; Spiess, Andrej-Nikolai

    2011-01-01

    Backgound Y-chromosomal microdeletions (YCMD) are one of the major genetic causes for non-obstructive azoospermia. Genetic testing for YCMD by multiplex polymerase chain reaction (PCR) is an established method for quick and robust screening of deletions in the AZF regions of the Y-chromosome. Multiplex PCRs have the advantage of including a control gene in every reaction and significantly reducing the number of reactions needed to screen the relevant genomic markers. Principal Findings The widely established “EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions (2004)” were used as a basis for designing a real-time multiplex PCR system, in which the YCMD can simply be identified by their melting points. For this reason, some AZF primers were substituted by primers for regions in their genomic proximity, and the ZFX/ZFY control primer was exchanged by the AMELX/AMELY control primer. Furthermore, we substituted the classical SybrGreen I dye by the novel and high-performing DNA-binding dye EvaGreen™ and put substantial effort in titrating the primer combinations in respect to optimal melting peak separation and peak size. Significance With these changes, we were able to develop a platform-independent and robust real-time based multiplex PCR, which makes the need for amplicon identification by electrophoretic sizing expendable. By using an open-source system for real-time PCR analysis, we further demonstrate the applicability of automated melting point and YCMD detection. PMID:21887237

  6. Multiplex RT-PCR Assay for Detection of Common Fusion Transcripts in Acute Lymphoblastic Leukemia and Chronic Myeloid Leukemia Cases.

    Science.gov (United States)

    Limsuwanachot, Nittaya; Siriboonpiputtana, Teerapong; Karntisawiwat, Kanlaya; Chareonsirisuthigul, Takol; Chuncharunee, Suporn; Rerkamnuaychoke, Budsaba

    2016-01-01

    Acute lymphoblastic leukemia (ALL) is a heterogeneous disease which requires a risk-stratified approach for appropriate treatment. Specific chromosomal translocations within leukemic blasts are important prognostic factors that allow identification of relevant subgroups. In this study, we developed a multiplex RT-PCR assay for detection of the 4 most frequent translocations in ALL (BCR-ABL, TEL-AML1, MLL-AF4, and E2A- PBX1). A total of 214 diagnosed ALL samples from both adult and pediatric ALL and 14 cases of CML patients (154 bone marrow and 74 peripheral blood samples) were assessed for specific chromosomal translocations by cytogenetic and multiplex RT-PCR assays. The results showed that 46 cases of ALL and CML (20.2%) contained the fusion transcripts. Within the positive ALL patients, the most prevalent cryptic translocation observed was mBCR-ABL (p190) at 8.41%. In addition, other genetic rearrangements detected by the multiplex PCR were 4.21% TEL-AML1 and 2.34% E2A-PBX1, whereas MLL-AF4 exhibited negative results in all tested samples. Moreover, MBCR-ABL was detected in all 14 CML samples. In 16 samples of normal karyotype ALL (n=9), ALL with no cytogentic result (n=4) and CML with no Philadelphia chromosome (n=3), fusion transcripts were detected. Multiplex RT-PCR provides a rapid, simple and highly sensitive method to detect fusion transcripts for prognostic and risk stratification of ALL and CML patients.

  7. Diagnostic Performance of a Multiplex PCR assay for meningitis in an HIV-infected population in Uganda

    OpenAIRE

    Rhein, Joshua; Bahr, Nathan C; Hemmert, Andrew C; Cloud, Joann L; Bellamkonda, Satya; Oswald, Cody; Lo, Eric; Nabeta, Henry; Kiggundu, Reuben; Akampurira, Andrew; Musubire, Abdu; Williams, Darlisha; Meya, David B; Boulware, David R

    2015-01-01

    Meningitis remains a worldwide problem, and rapid diagnosis is essential to optimize survival. We evaluated the utility of a multiplex PCR test in differentiating possible etiologies of meningitis. Cerebrospinal fluid (CSF) from 69 HIV-infected Ugandan adults with meningitis was collected at diagnosis (n=51) and among persons with cryptococcal meningitis during therapeutic lumbar punctures (n=68). Cryopreserved CSF specimens were analyzed with BioFire FilmArray? Meningitis/Encephalitis panel,...

  8. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....

  9. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics

    OpenAIRE

    Kim, Hyun-Joong; Ryu, Ji-Oh; Lee, Shin-Young; Kim, Ei-Seul; Kim, Hae-Yeong

    2015-01-01

    Background The genus Vibrio is clinically significant and major pathogenic Vibrio species causing human Vibrio infections are V. cholerae, V. parahaemolyticus, V. vulnificus, V. alginolyticus and V. mimicus. In this study, we screened for novel genetic markers using comparative genomics and developed a Vibrio multiplex PCR for the reliable diagnosis of the Vibrio genus and the associated major pathogenic Vibrio species. Methods A total of 30 Vibrio genome sequences were subjected to comparati...

  10. A one-step multiplex PCR to identify Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae in the clinical routine.

    Science.gov (United States)

    Fonseca, Erica Lourenço; Ramos, Nilceia da Veiga; Andrade, Bruno G Nascimento; Morais, Lena L C S; Marin, Michel F Abanto; Vicente, Ana Carolina P

    2017-04-01

    Klebsiella pneumoniae, Klebsiella variicola and Klebsiella quasipneumoniae are difficult to differentiate phenotypically, leading to misinterpretation of their infection prevalence. We propose a multiplex PCR for bla SHV , bla LEN and bla OKP and their flanking gene (deoR). Since this scheme focuses only on chromosomal genes, it will be feasible for Klebsiella identification in the clinical routine. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A novel multiplex PCR for molecular characterization of methicillin resistant Staphylococcus aureus recovered from Jeddah, Kingdom of Saudi Arabia

    Directory of Open Access Journals (Sweden)

    IMI Moussa

    2012-01-01

    Full Text Available Background: Molecular characterization of staphylococcal cassette chromosome mec (SCCmec types of methicillin-resistant Staphylococcus aureus (MRSA is very essential for studying the epidemiology of MRSA. Objectives: This study reports two multiplex PCR for molecular typing of MRSA collected from Jeddah, Kingdom of Saudi Arabia. Materials and Methods: A total of 101 clinical isolates of strains were collected from major hospital laboratories and public health centres, Jeddah, Kingdom of Saudi Arabia during the period from August 2009 to May 2011. All the strains were tested phenotypically by conventional methods and genotypically by a novel multiplex PCR targeting at the same time S. aureus 16S rRNA, Panton - valentine leucocidin (PVL and mecA resistance genes. All the strains were tested also by multiplex PCR for typing of SCC mec types. Results: All the 101 strains previously identified phenotypically as S. aureus with bacteriological examination were positive for amplification of 756 base pair fragments specific for 16S rRNA of S. aureus. Moreover, all the strains were positive for amplification of 1339 base pair fragments specific for mecA gene, while only 38 strains (37.6% showed positive amplification of 433 base pair fragments specific for PVL gene. The most predominant SCC mec type among the examined isolates is type V 43 (42.5 followed by SCCmec type III 39 (38.6%. Conclusion: The newly modified multiplex PCR is rapid and sensitive method for detection of MRSA. Moreover, the most predominant SCC mec type among the examined isolates from Jeddah, King Saudi Arabia is type V (42.5%, followed by Type III (38.6%.

  12. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Science.gov (United States)

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  13. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  14. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    Science.gov (United States)

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  15. Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

    DEFF Research Database (Denmark)

    Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

    2007-01-01

    , multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

  16. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  17. Development of a Multiplex PCR for Discrimination of the TLC:RS1:CTX array of Vibrio cholerae Wave 3 El Tor Strains.

    Science.gov (United States)

    Kim, Eun Jin; Yu, Hyun Jin; Nair, G Balakrish; Kim, Dong Wook

    2016-12-28

    Vibrio cholerae O1 serogroup Wave 3 El Tor strains are presently prevalent worldwide. The Wave 3 El Tor strains contain a TLC:RS1:CTX array on chromosome 1, and no element is integrated on chromosome 2. A multiplex PCR optimized to identify the TLC:RS1:CTX array of Wave 3 strains has been developed in this study. By using eight primers, the multiplex PCR can identify the characteristic CTX and RS1 array of Wave 3 strains from various arrays of strains belonging to other Waves. The four amplified DNA fragments of Wave 3 strains have been cloned in a vector, which could be used as a positive control for the multiplex PCR. This multiplex PCR and the positive control set could be useful tools for rapid recognition of Wave 3 El Tor strains.

  18. Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

    Science.gov (United States)

    Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

    2009-07-01

    The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

  19. Identification of Mycobacterium bovis Isolates by a multiplex PCR Identificação de colônias isoladas de Mycobacterium bovis por PCR múltipla

    Directory of Open Access Journals (Sweden)

    Eduardo Eustáquio de Souza Figueiredo

    2009-06-01

    Full Text Available Isolates from suggestive bovine tuberculosis lesions were tested by a multiplex polymerase chain reaction (m-PCR targeting for RvD1Rv2031c and IS6110 sequences, specific for M. bovis and Mycobacterium tuberculosis complex respectively. The m-PCR successfully identified as M. bovis 88.24% of the isolates.Colônias isoladas a partir de lesões sugestivas de tuberculose bovina foram testadas pela reação múltipla em cadeia da polimerase, usando oligonucleotídeos direcionados para as seqüências genômicas RvD1Rv2031c e IS6110, específicas para M. bovis e para o complexo Mycobacterium tuberculosis, respectivamente. A m-PCR identificou, com sucesso, 88,24% das colônias isoladas como M. bovis.

  20. A multiplex real-time PCR for the detection and differentiation of Campylobacter phages.

    Directory of Open Access Journals (Sweden)

    Claudia Jäckel

    Full Text Available Campylobacter jejuni and C. coli are important food-borne pathogens that are widespread in animal husbandry. To combat Campylobacter along the food chain, the application of lytic phages has been shown to be a promising tool. Campylobacter phages are currently classified into three groups, of which group II and group III phages are the most common. Members of each group are closely related, whereas the two groups share only little DNA similarity. Moreover, while group III phages are specific for C. jejuni, group II phages additionally infect C. coli. Phage cocktails intended to be used for applications should be composed of various phages that differ in their host range and growth kinetics. The isolation of phages is generally performed by plaque assays. This approach has the limitation that phages are merely identified by their lytic activity on certain indicator strains and that relatively high numbers of phages must be present in a tested sample. Therefore, a more sensitive molecular detection system would be beneficial, which allows a pre-screening of samples and the quick detection and discrimination of group II and group III phages. New phages can then be isolated by use of indicator strains that may be different from those typically applied. On the basis of available Campylobacter phage genome sequences, we developed a multiplex PCR system for group II and group III phages selecting the tail tube gene and the gene for the base plate wedge, respectively, as target. Phages of both groups could be identified with primers deduced from the putative tail fiber gene. Efficient release of phage DNA from capsids was achieved by an extended heat treatment or digestion of phage particles with proteinase K/SDS yielding a detection limit of 1 pfu/ml. Individual detection of group II phages, group III phages and of both groups was studied with artificially contaminated chicken skin. To recover phages that had strongly adhered to the skin, stomaching

  1. A multiplex real-time PCR for the detection and differentiation of Campylobacter phages.

    Science.gov (United States)

    Jäckel, Claudia; Hammerl, Jens A; Rau, Jörg; Hertwig, Stefan

    2017-01-01

    Campylobacter jejuni and C. coli are important food-borne pathogens that are widespread in animal husbandry. To combat Campylobacter along the food chain, the application of lytic phages has been shown to be a promising tool. Campylobacter phages are currently classified into three groups, of which group II and group III phages are the most common. Members of each group are closely related, whereas the two groups share only little DNA similarity. Moreover, while group III phages are specific for C. jejuni, group II phages additionally infect C. coli. Phage cocktails intended to be used for applications should be composed of various phages that differ in their host range and growth kinetics. The isolation of phages is generally performed by plaque assays. This approach has the limitation that phages are merely identified by their lytic activity on certain indicator strains and that relatively high numbers of phages must be present in a tested sample. Therefore, a more sensitive molecular detection system would be beneficial, which allows a pre-screening of samples and the quick detection and discrimination of group II and group III phages. New phages can then be isolated by use of indicator strains that may be different from those typically applied. On the basis of available Campylobacter phage genome sequences, we developed a multiplex PCR system for group II and group III phages selecting the tail tube gene and the gene for the base plate wedge, respectively, as target. Phages of both groups could be identified with primers deduced from the putative tail fiber gene. Efficient release of phage DNA from capsids was achieved by an extended heat treatment or digestion of phage particles with proteinase K/SDS yielding a detection limit of 1 pfu/ml. Individual detection of group II phages, group III phages and of both groups was studied with artificially contaminated chicken skin. To recover phages that had strongly adhered to the skin, stomaching was the most efficient

  2. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

    2010-12-03

    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

  3. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina

    2010-12-01

    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

  4. Synthetic internal control sequences to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

    Science.gov (United States)

    Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...

  5. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  6. Multiplex PCR screening detects small p53 deletions and insertions in human ovarian cancer cell lines.

    Science.gov (United States)

    Runnebaum, I B; Tong, X W; Moebus, V; Heilmann, V; Kieback, D G; Kreienberg, R

    1994-06-01

    Mutations at the p53 tumor suppressor gene locus are a frequent genetic alteration associated with human ovarian carcinoma. Little information exists regarding whether mutational events occur other than point mutations and large deletions, causing loss of heterozygosity. Small intragenic deletions and insertions in the p53 gene have been observed in various human neoplasias. We developed a multiplex polymerase chain reaction (MPCR) screening assay to amplify the complete p53 coding region from genomic DNA in a single step. Deletions and/or insertions were found in six out of 11 newly established ovarian carcinoma cell lines. MPCR detected deletions as small as 2 bp, as confirmed by nucleotide sequence analysis. Most of the observed alterations (6/7) were homozygous or hemizygous. Structural aberrations of the p53 gene possibly leading to loss of p53 cell cycle control may be a consequence of a slipped-mispairing mechanism in rapid DNA replication during repetitious ovulation and wound repair of ovarian epithelial cells. MPCR may be a valuable tool for screening for possible p53 deletion and insertion mutations not only in ovarian cancer but also in other malignancies.

  7. Multiplex tandem PCR: a novel platform for rapid detection and identification of fungal pathogens from blood culture specimens.

    Science.gov (United States)

    Lau, Anna; Sorrell, Tania C; Chen, Sharon; Stanley, Keith; Iredell, Jonathan; Halliday, Catriona

    2008-09-01

    We describe the first development and evaluation of a rapid multiplex tandem PCR (MT-PCR) assay for the detection and identification of fungi directly from blood culture specimens that have been flagged as positive. The assay uses a short-cycle multiplex amplification, followed by 12 simultaneous PCRs which target the fungal internal transcribed spacer 1 (ITS1) and ITS2 region, elongation factor 1-alpha (EF1-alpha), and beta-tubulin genes to identify 11 fungal pathogens: Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida krusei, Candida parapsilosis complex, Candida tropicalis, Cryptococcus neoformans complex, Fusarium solani, Fusarium species, and Scedosporium prolificans. The presence or absence of a fungal target was confirmed by melting curve analysis. Identification by MT-PCR correlated with culture-based identification for 44 (100%) patients. No cross-reactivity was detected in 200 blood culture specimens that contained bacteria or in 30 blood cultures without microorganisms. Fungi were correctly identified in five specimens with bacterial coinfection and in blood culture samples that were seeded with a mixture of yeast cells. The MT-PCR assay was able to provide rapid (detection and identification of fungal pathogens directly from blood culture specimens.

  8. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  9. Usefulness of Multiplex Real-Time PCR for Simultaneous Pathogen Detection and Resistance Profiling of Staphylococcal Bacteremia

    Directory of Open Access Journals (Sweden)

    Yousun Chung

    2016-01-01

    Full Text Available Staphylococci are the leading cause of nosocomial blood stream infections. Fast and accurate identification of staphylococci and confirmation of their methicillin resistance are crucial for immediate treatment with effective antibiotics. A multiplex real-time PCR assay that targets mecA, femA specific for S. aureus, femA specific for S. epidermidis, 16S rRNA for universal bacteria, and 16S rRNA specific for staphylococci was developed and evaluated with 290 clinical blood culture samples containing Gram-positive cocci in clusters (GPCC. For the 262 blood cultures identified to the species level with the MicroScan WalkAway system (Siemens Healthcare Diagnostics, USA, the direct real-time PCR assay of positive blood cultures showed very good agreement for the categorization of staphylococci into methicillin-resistant S. aureus (MRSA, methicillin-susceptible S. aureus (MSSA, methicillin-resistant S. epidermidis (MRSE, methicillin-susceptible S. epidermidis (MSSE, methicillin-resistant non-S. epidermidis CoNS (MRCoNS, and methicillin-susceptible non-S. epidermidis CoNS (MSCoNS (κ=0.9313. The direct multiplex real-time PCR assay of positive blood cultures containing GPCC can provide essential information at the critical point of infection with a turnaround time of no more than 4 h. Further studies should evaluate the clinical outcome of using this rapid real-time PCR assay in glycopeptide antibiotic therapy in clinical settings.

  10. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    Directory of Open Access Journals (Sweden)

    Hirohito Ogawa

    Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  11. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting chrysanthemum.

    Science.gov (United States)

    Zhao, Xiting; Liu, Xingliang; Ge, Beibei; Li, Mingjun; Hong, Bo

    2015-05-01

    Pathogens causing significant economic losses in chrysanthemum include tomato aspermy virus (TAV), chrysanthemum virus B (CVB), cucumber mosaic virus (CMV), tobacco mosaic virus (TMV), potato virus Y (PVY), chrysanthemum stunt viroid (CSVd) and chrysanthemum chlorotic mottle viroid (CChMVd). A multiplex reverse transcription polymerase chain reaction (RT-PCR) method, using specific primer sets for each virus or viroid, was developed for simultaneous detection and differentiation of TAV, CVB, CMV, TMV, PVY, CChMVd, and CSVd. The RT-PCR method was validated by testing chrysanthemum samples collected from different regions of China. In this study, CVB, TAV, TMV, PVY, CSVd, CMV, and CChMVd were detected, respectively, in 24.7 %, 17.5 %, 4.4 %, 4.4 %, 2.9 %, 2.5 %, and 1.5 % of the samples tested. These results indicate that CVB and TAV (24.7 % and 17.5 %) are common, whereas CMV, TMV, CChMVd, CSVd, and PVY (all below 5 %) are less frequently encountered. This new multiplex RT-PCR method has potential to be used routinely in large-scale virus and viroid surveys.

  13. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  14. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  15. Differentiation of Campylobacter jejuni and Campylobacter coli Using Multiplex-PCR and High Resolution Melt Curve Analysis.

    Directory of Open Access Journals (Sweden)

    Banya Banowary

    Full Text Available Campylobacter spp. are important causes of bacterial gastroenteritis in humans in developed countries. Among Campylobacter spp. Campylobacter jejuni (C. jejuni and C. coli are the most common causes of human infection. In this study, a multiplex PCR (mPCR and high resolution melt (HRM curve analysis were optimized for simultaneous detection and differentiation of C. jejuni and C. coli isolates. A segment of the hippuricase gene (hipO of C. jejuni and putative aspartokinase (asp gene of C. coli were amplified from 26 Campylobacter isolates and amplicons were subjected to HRM curve analysis. The mPCR-HRM was able to differentiate between C. jejuni and C. coli species. All DNA amplicons generated by mPCR were sequenced. Analysis of the nucleotide sequences from each isolate revealed that the HRM curves were correlated with the nucleotide sequences of the amplicons. Minor variation in melting point temperatures of C. coli or C. jejuni isolates was also observed and enabled some intraspecies differentiation between C. coli and/or C. jejuni isolates. The potential of PCR-HRM curve analysis for the detection and speciation of Campylobacter in additional human clinical specimens and chicken swab samples was also confirmed. The sensitivity and specificity of the test were found to be 100% and 92%, respectively. The results indicated that mPCR followed by HRM curve analysis provides a rapid (8 hours technique for differentiation between C. jejuni and C. coli isolates.

  16. Differentiation of Campylobacter jejuni and Campylobacter coli Using Multiplex-PCR and High Resolution Melt Curve Analysis.

    Science.gov (United States)

    Banowary, Banya; Dang, Van Tuan; Sarker, Subir; Connolly, Joanne H; Chenu, Jeremy; Groves, Peter; Ayton, Michelle; Raidal, Shane; Devi, Aruna; Vanniasinkam, Thiru; Ghorashi, Seyed A

    2015-01-01

    Campylobacter spp. are important causes of bacterial gastroenteritis in humans in developed countries. Among Campylobacter spp. Campylobacter jejuni (C. jejuni) and C. coli are the most common causes of human infection. In this study, a multiplex PCR (mPCR) and high resolution melt (HRM) curve analysis were optimized for simultaneous detection and differentiation of C. jejuni and C. coli isolates. A segment of the hippuricase gene (hipO) of C. jejuni and putative aspartokinase (asp) gene of C. coli were amplified from 26 Campylobacter isolates and amplicons were subjected to HRM curve analysis. The mPCR-HRM was able to differentiate between C. jejuni and C. coli species. All DNA amplicons generated by mPCR were sequenced. Analysis of the nucleotide sequences from each isolate revealed that the HRM curves were correlated with the nucleotide sequences of the amplicons. Minor variation in melting point temperatures of C. coli or C. jejuni isolates was also observed and enabled some intraspecies differentiation between C. coli and/or C. jejuni isolates. The potential of PCR-HRM curve analysis for the detection and speciation of Campylobacter in additional human clinical specimens and chicken swab samples was also confirmed. The sensitivity and specificity of the test were found to be 100% and 92%, respectively. The results indicated that mPCR followed by HRM curve analysis provides a rapid (8 hours) technique for differentiation between C. jejuni and C. coli isolates.

  17. Identification of genomic differences between Campylobacter jejuni subsp. jejuni and C. jejuni subsp. doylei at the nap locus leads to the development of a C. jejuni subspeciation multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Heath Sekou

    2007-02-01

    Full Text Available Abstract Background The human bacterial pathogen Campylobacter jejuni contains two subspecies: C. jejuni subsp. jejuni (Cjj and C. jejuni subsp. doylei (Cjd. Although Cjd strains are isolated infrequently in many parts of the world, they are obtained primarily from human clinical samples and result in an unusual clinical symptomatology in that, in addition to gastroenteritis, they are associated often with bacteremia. In this study, we describe a novel multiplex PCR method, based on the nitrate reductase (nap locus, that can be used to unambiguously subspeciate C. jejuni isolates. Results Internal and flanking napA and napB primer sets were designed, based on existing C. jejuni and Campylobacter coli genome sequences to create two multiplex PCR primer sets, nap mpx1 and nap mpx2. Genomic DNA from 161 C. jejuni subsp. jejuni (Cjj and 27 C. jejuni subsp. doylei (Cjd strains were amplified with these multiplex primer sets. The Cjd strains could be distinguished clearly from the Cjj strains using either nap mpx1 or mpx2. In addition, combination of either nap multiplex method with an existing lpxA speciation multiplex method resulted in the unambiguous and simultaneous speciation and subspeciation of the thermophilic Campylobacters. The Cjd nap amplicons were also sequenced: all Cjd strains tested contained identical 2761 bp deletions in napA and several Cjd strains contained deletions in napB. Conclusion The nap multiplex PCR primer sets are robust and give a 100% discrimination of C. jejuni subspecies. The ability to rapidly subspeciate C. jejuni as well as speciate thermophilic Campylobacter species, most of which are pathogenic in humans, in a single amplification will be of value to clinical laboratories in strain identification and the determination of the environmental source of campylobacterioses caused by Cjd. Finally, the sequences of the Cjd napA and napB loci suggest that Cjd strains arose from a common ancestor, providing clues as to

  18. Estudio mediante PCR múltiple de serotipos de Listeria monocytogenes aislados en Argentina Study by multiplex PCR of Listeria monocytogenes serotypes isolated in Argentine

    Directory of Open Access Journals (Sweden)

    R. Callejo

    2008-06-01

    Full Text Available Se comparó una PCR múltiple recientemente validada para la caracterización de serotipos de Listeria monocytogenes con el método tradicional de serotipificación. Se estudiaron 342 aislamientos de origen humano, alimentario, veterinario y ambiental obtenidos durante el período 1992-2005. La concordancia entre ambos métodos para los serotipos 1/2a, 1/2b y 1/2c fue del 100%, y para el serotipo 4b fue del 98%. La serotipificación constituye una herramienta importante como primer nivel de diferenciación de cepas de L. monocytogenes para llevar a cabo la vigilancia epidemiológica y, sobre todo, el estudio de brotes. La PCR múltiple es una técnica alternativa rápida, de bajo costo y fácilmente adaptable en laboratorios de bacteriología clínica y bromatología.A multiplex PCR assay, recently validated to characterize the serotypes of Listeria monocytogenes was evaluated in comparison to conventional serotyping. Three hundred forty two L. monocytogenes strains isolated from human, food, animal and environmental sources during the 1992-2005 period were assayed. The concordance between the two methods for serotypes 1/2a, 1/2b and 1/2c was 100%, whereas for serotype 4b it was 98%. Serotyping is a useful tool for first line strain differentiation during epidemiological surveillance and outbreaks. The multiplex PCR assay offers a fast and low-cost alternative, which is easily adaptable to clinical bacteriology and bromatology laboratories.

  19. Multiplex RT-PCR and indirect immunofluorescence assays for detection and subtyping of human influenza virus in Tunisia.

    Science.gov (United States)

    Ben M'hadheb, Manel; Harrabi, Myriam; Souii, Amira; Jrad-Battikh, Nadia; Gharbi, Jawhar

    2015-03-01

    Influenza viruses are negative stranded segmented RNA viruses belonging to Orthomyxoviridae family. They are classified into three types A, B, and C. Type A influenza viruses are classified into subtypes according to the antigenic characters of the surface glycoproteins: hemagglutinin (H) and neuraminidase (N). The aim of the present study is to develop a fast and reliable multiplex RT-PCR technique for detecting simultaneously the subtypes A/H1N1 and A/H3N2 of influenza virus. Our study included 398 patients (mean age 30.33 ± 19.92 years) with flu or flu-like syndromes, consulting physicians affiliated with collaborating teams. A multiplex RT-PCR detecting A/H1N1 and A/H3N2 influenza viruses and an examination by indirect immunofluorescence (IFI) were performed. In the optimized conditions, we diagnosed by IFI a viral infection in 90 patients (22.6 %): 85 cases of influenza type A, four cases of influenza type B, and only one case of coinfection with types A and B. An evaluation of the technique was performed on 19 clinical specimens positive in IFI, and we detected eight cases of A/H3N2, five cases of A/H1N1, one case of influenza virus type A which is not an H1N1 nor H3N2, and five negative cases. Multiplex RT-PCR is a sensitive technique allowing an effective and fast diagnosis of respiratory infections caused by influenza viruses in which the optimization often collides with problems of sensibility.

  20. Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

    Directory of Open Access Journals (Sweden)

    Chang Chieh-Ting

    2008-06-01

    Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

  1. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  2. Multiplex real-time PCR using SYBR® GreenER™ for the detection of DNA allergens in food.

    Science.gov (United States)

    Pafundo, Simona; Gullì, Mariolina; Marmiroli, Nelson

    2010-03-01

    We describe the development of a six-target real-time multiplex PCR assay with the SYBR® GreenER™ fluorescent dye, targeted to genes encoding for allergenic proteins commonly present in many processed food products (patent application pending). The assay was successfully trialled on reconstructed food matrices and on a range of commercial foodstuffs, and is proposed as a ready-to-use analytical tool for food manufacturers to detect the presence or confirm the absence of sequences encoding for important allergenic proteins of plant origin.

  3. A simplified multiplex PCR-based typing method for common Salmonella enterica serovars supported by online server-based detection system

    Directory of Open Access Journals (Sweden)

    Probodh Borah

    2017-01-01

    Interpretation & conclusions: The multiplex PCR assay resulted in specific binary codes for isolates from each of the 31 Salmonella serovars tested. The online server allowed the user to compare obtained PCR results with stored previous patterns. Simplicity, speed and cost-effectiveness make this tool useful for quick outbreak management.

  4. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

    Science.gov (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

    1996-06-01

    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  5. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  6. A cytolethal distending toxin gene-based multiplex PCR assay for detection of Campylobacter spp. in stool specimens and comparison with culture method.

    Science.gov (United States)

    Shiramaru, Sachi; Asakura, Masahiro; Inoue, Haruna; Nagita, Akira; Matsuhisa, Akio; Yamasaki, Shinji

    2012-07-01

    In this study, we evaluated the applicability of cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR for the direct detection and identification of Campylobacter jejuni, C. coli and C. fetus from stool specimens of patients with gastroenteritis in comparison to culture methods. A total of 711 stool specimens were examined for the isolation or detection of campylobacters by using Skirrow's selective agar culture plates, a filtration method and the multiplex PCR assay. Forty-one and 36 C. jejuni strains were isolated by culture and filtration methods, respectively. In addition, 2 and 3 C. coli strains were isolated by Skirrow and the filtration methods, respectively. However, when the multiplex PCR was employed, the cdtB genes of C. jejuni and C. coli were detected in 45 and 4 stool samples, respectively, and 9 C. jejuni PCR-positive samples by multiplex PCR were negative by culture method. Sequence analysis of the PCR products obtained from 8 stool specimens from which campylobacters were not isolated by culture method but the sequences exactly matched with that of the cdtB gene of C. jejuni strain 81-176. None of the remaining stool samples which were culture negative for campylobacters produced any amplicon. Stool samples were defined as Campylobacter-positive if detected by any method. The sensitivity of the multiplex PCR was 83%, which was higher than Skirrow (74%) and filtration method (66%). These data indicate that cdtB gene-based multiplex PCR is a rapid and more sensitive method to identify the most important species of Campylobacter for human diseases. (248).

  7. Examining Sources of Error in PCR by Single-Molecule Sequencing

    Science.gov (United States)

    Potapov, Vladimir

    2017-01-01

    Next-generation sequencing technology has enabled the detection of rare genetic or somatic mutations and contributed to our understanding of disease progression and evolution. However, many next-generation sequencing technologies first rely on DNA amplification, via the Polymerase Chain Reaction (PCR), as part of sample preparation workflows. Mistakes made during PCR appear in sequencing data and contribute to false mutations that can ultimately confound genetic analysis. In this report, a single-molecule sequencing assay was used to comprehensively catalog the different types of errors introduced during PCR, including polymerase misincorporation, structure-induced template-switching, PCR-mediated recombination and DNA damage. In addition to well-characterized polymerase base substitution errors, other sources of error were found to be equally prevalent. PCR-mediated recombination by Taq polymerase was observed at the single-molecule level, and surprisingly found to occur as frequently as polymerase base substitution errors, suggesting it may be an underappreciated source of error for multiplex amplification reactions. Inverted repeat structural elements in lacZ caused polymerase template-switching between the top and bottom strands during replication and the frequency of these events were measured for different polymerases. For very accurate polymerases, DNA damage introduced during temperature cycling, and not polymerase base substitution errors, appeared to be the major contributor toward mutations occurring in amplification products. In total, we analyzed PCR products at the single-molecule level and present here a more complete picture of the types of mistakes that occur during DNA amplification. PMID:28060945

  8. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Directory of Open Access Journals (Sweden)

    Cengiz Ikten

    Full Text Available Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.. Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  9. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Science.gov (United States)

    Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent

    2016-01-01

    Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  10. Multiplex PCR for the assignment of some major branches of the Y ...

    Indian Academy of Sciences (India)

    Unknown

    interface (http://grup.cribi.unipd.it/cgi-bin/mateo/vpcr2.cgi). Testing how many matches there are in the human ge- nome for every pair of primers used in the multiplex, we obtained the values listed in table 1. These results could suggest the need for a higher concentration required by the. YAP and 12f2 primers; however, ...

  11. Multiplex PCR, amplicon size and hybridization efficiency on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez, Juan J; Morling, Niels

    2004-01-01

    . Hybridization to individual amplicons in multiplexes was less efficient suggesting that intramolecular and intermolecular interactions may block access to the target sequence on the NanoChip array. We observed a high risk of contamination with amplicons shorter than 60 bp and therefore, we recommend the use...

  12. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    Infectious bursal disease virus (IBDV) is a major cause of disease problems in the poultry industry and vaccination has therefore been applied intensively to control the infection. The classical methods of detection and characterization of IBDV are by the use of immunodiffusion test...... and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...... vaccine strain widely used in the European poultry industry. The method, which is highly specific, fast and inexpensive, can be applied in all laboratories with basal PCR capabilities and equipment....

  13. Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

    Science.gov (United States)

    Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

    2017-08-01

    A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. On-chip Mode Multiplexer Based on a Single Grating Coupler

    DEFF Research Database (Denmark)

    Ding, Yunhong; Ou, Haiyan; Xu, Jing

    2012-01-01

    A two-mode multiplexer based on a single grating coupler is proposed and demonstrated on a silicon chip. The LP01 and LP11 modes of a few-mode fiber are excited from TE0 and TE1 silicon waveguide modes.......A two-mode multiplexer based on a single grating coupler is proposed and demonstrated on a silicon chip. The LP01 and LP11 modes of a few-mode fiber are excited from TE0 and TE1 silicon waveguide modes....

  15. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  16. Evaluation of a Multiplex PCR Assay for the Identification of Salmonella Serovars Enteritidis and Typhimurium Using Retail and Abattoir Samples.

    Science.gov (United States)

    Ogunremi, Dele; Nadin-Davis, Susan; Dupras, Andrée Ann; Márquez, Imelda Gálvan; Omidi, Katayoun; Pope, Louise; Devenish, John; Burke, Teresa; Allain, Ray; Leclair, Daniel

    2017-02-01

    A multiplex PCR was developed to identify the two most common serovars of Salmonella causing foodborne illness in Canada, namely, serovars Enteritidis and Typhimurium. The PCR was designed to amplify DNA fragments from four Salmonella genes, namely, invA gene (211-bp fragment), iroB gene (309-bp fragment), Typhimurium STM 4497 (523-bp fragment), and Enteritidis SE147228 (612-bp fragment). In addition, a 1,026-bp ribosomal DNA (rDNA) fragment universally present in bacterial species was included in the assay as an internal control fragment. The detection rate of the PCR was 100% among Salmonella Enteritidis (n = 92) and Salmonella Typhimurium (n = 33) isolates. All tested Salmonella isolates (n = 194) were successfully identified based on the amplification of at least one Salmonella -specific DNA fragment. None of the four Salmonella DNA amplicons were detected in any of the non- Salmonella isolates (n = 126), indicating an exclusivity rate of 100%. When applied to crude extracts of 2,001 field isolates of Salmonella obtained during the course of a national microbiological baseline study in broiler chickens and chicken products sampled from abattoir and retail outlets, 163 isolates, or 8.1%, tested positive for Salmonella Enteritidis and another 80 isolates, or 4.0%, tested as Salmonella Typhimurium. All isolates identified by serological testing as Salmonella Enteritidis in the microbiological study were also identified by using the multiplex PCR. The new test can be used to identify or confirm pure isolates of the two serovars and is also amenable for integration into existing culture procedures for accurate detection of Salmonella colonies.

  17. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  18. Multiplex Real-Time PCR Assay Using TaqMan Probes for the Identification of Trypanosoma cruzi DTUs in Biological and Clinical Samples

    Science.gov (United States)

    Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.

    2015-01-01

    Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316

  19. "GenderPlex" a PCR multiplex for reliable gender determination of degraded human DNA samples and complex gender constellations.

    Science.gov (United States)

    Esteve Codina, Anna; Niederstätter, Harald; Parson, Walther

    2009-11-01

    The amelogenin test integrated in most commercial polymerase chain reaction (PCR) multiplex kits is routinely used in the forensic field for gender determination of DNA samples. It has been demonstrated that this test is not entirely reliable. Males with deletions in the homologous amelogenin part on the Y chromosome (AMELY) were erroneously typed as females due to lack of Y-specific amelogenin amplification. Also, primer binding site mutations that result in a failure to amplify the AMELY or the X-chromosomal part (AMELX) have been observed. For clarification of such phenomena, a new PCR multiplex (GenderPlex) is presented, co-amplifying two different regions of the amelogenin gene (55/58 and 106/112 bp for the AMELX and AMELY alleles, respectively), a 93-bp sequence stretch of the SRY gene and four mini-X-STR loci DXS7424, DXS8378, DXS6803 and GATA172D05 (maximum product size less than 140 bp). This strategy helps with the evaluation of samples for the presence of amelogenin-based primer site mutations and confirms a male genotype by the absence of heterozygote X-STR alleles and the presence of an SRY-related peak. The short amplicon sizes of all involved loci proved to be beneficial in a study on artificially degraded DNA. Furthermore, we demonstrate by means of sensitivity, human specificity and mixture studies that the multiplex is suitable for investigations in the forensic scene. Finally, the performance of the GenderPlex was evaluated on a west Eurasian population sample from Austria comprising 166 male and 104 female individuals.

  20. A new multiplex PCR assay to distinguish among three cryptic Galba species, intermediate hosts of Fasciola hepatica.

    Science.gov (United States)

    Alda, Pilar; Lounnas, Manon; Vázquez, Antonio Alejandro; Ayaqui, Rolando; Calvopiña, Manuel; Celi-Erazo, Maritza; Dillon, Robert T; Jarne, Philippe; Loker, Eric S; Muñiz Pareja, Flavia Caroll; Muzzio-Aroca, Jenny; Nárvaez, Alberto Orlando; Noya, Oscar; Robles, Luiggi Martini; Rodríguez-Hidalgo, Richar; Uribe, Nelson; David, Patrice; Pointier, Jean-Pierre; Hurtrez-Boussès, Sylvie

    2018-02-15

    A molecular tool described here allows in one step for specific discrimination among three cryptic freshwater snail species (genus Galba) involved in fasciolosis transmission, a worldwide infectious disease of humans and livestock. The multiplex PCR approach taken targets for each species a distinctive, known microsatellite locus which is amplified using specific primers designed to generate an amplicon of a distinctive size that can be readily separated from the amplicons of the other two species on an agarose gel. In this way, the three Galba species (G. cubensis, G. schirazensis, and G. truncatula) can be differentiated from one another, including even if DNA from all three were present in the same reaction. The accuracy of this new molecular tool was tested and validated by comparing multiplex PCR results with species identification based on sequences at mitochondrial and nuclear markers. This new method is accurate, inexpensive, simple, rapid, and can be adapted to handle large sample sizes. It will be helpful for monitoring invasion of Galba species and for developing strategies to limit the snail species involved in the emergence or re-emergence of fasciolosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Simultaneous detection of cow and buffalo species in milk from China, India, and Pakistan using multiplex real-time PCR.

    Science.gov (United States)

    Cottenet, G; Blancpain, C; Golay, P-A

    2011-08-01

    Asian countries are major producers of cow and buffalo milk. For quality and authenticity purposes, a multiplex real-time PCR assay was developed to specifically and simultaneously detect DNA from these 2 bovine species. Targeting the cytochrome b gene of mitochondrial DNA, common PCR primers amplified a 105-bp fragment, and 2 fluorescent probes specific to either cow or buffalo were designed for their identification. Specificity was successfully tested on 6 other species, including sheep and goat, and sensitivity reached 1% of cow DNA in buffalo DNA and vice versa. As an evaluation, the method was tested using 119 freeze-dried Asian milk samples from regional industrial milk facilities. Although these samples did not cover the entire Asian zone, the multiplex assay indicated that approximately 20% of the samples (mainly from India) showed high levels of cross-contamination of cow milk by buffalo milk, and vice versa. Fast, sensitive, and straightforward, this method is fit-for-purpose for the authenticity control of Asian milk. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Multiplex PCR-based simultaneous amplification of selectable marker and reporter genes for the screening of genetically modified crops.

    Science.gov (United States)

    Randhawa, Gurinder Jit; Chhabra, Rashmi; Singh, Monika

    2009-06-24

    The development and commercialization of genetically modified (GM) crops with enhanced insect and herbicide resistance, abiotic stress tolerance, and improved nutritional quality has expanded dramatically. Notwithstanding the huge potential benefits of GM crops, the perceived environmental risks associated with these crops need to be addressed in proper perspective. One critical concern is the adventitious presence or unintentional mixing of GM seed in non-GM seed lots, which can seriously affect the global seed market. It would therefore be necessary though a challenging task to develop reliable, efficient, and economical assays for GM detection, identification, and quantification in non-GM seed lots. This can be systematically undertaken by preliminary screening for control elements and selectable or scorable (reporter) marker genes. In this study, simplex and multiplex polymerase chain reaction (PCR) assays individually as well as simultaneously amplifying the commonly used selectable marker genes, i.e., aadA, bar, hpt, nptII, pat encoding, respectively, for aminoglycoside-3'-adenyltransferase, Streptococcus viridochromogenes phosphinothricin-N-acetyltransferase, hygromycin phosphotransferase, neomycin phosphotransferase, Streptococcus hygroscopicus phosphinothricin-N-acetyltransferase, and a reporter gene uidA encoding beta-d-glucuronidase, were developed as a reliable tool for qualitative screening of GM crops. The efficiency of the assays was also standardized in the test samples prepared by artificial mixing of transgenic seed samples in different proportions. The developed multiplex PCR assays will be useful in verifying the GM status of a sample irrespective of the crop and GM trait.

  3. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  4. High throughput multiplex-PCR for direct detection and diagnosis of dermatophyte species, Candida albicans and Candida parapsilosis in clinical specimen.

    Science.gov (United States)

    Vahidnia, Ali; Bekers, Wouter; Bliekendaal, Harry; Spaargaren, Joke

    2015-06-01

    We have developed and validated a multiplex-PCR method for detection of dermatophyte spp., Candida albicans and parapsilosis for routine diagnostics. Our m-PCR showed excellent concordance with culture results in 475 clinical samples. Through the rapid diagnosis by our m-PCR, clinicians are able to initiate adequate antimycotic therapy much earlier. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    Directory of Open Access Journals (Sweden)

    K P Dinoop

    2016-01-01

    Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  6. Comparison of whole blood, serum, and plasma for early detection of candidemia by multiplex-tandem PCR.

    Science.gov (United States)

    Lau, Anna; Halliday, Catriona; Chen, Sharon C-A; Playford, E Geoffrey; Stanley, Keith; Sorrell, Tania C

    2010-03-01

    We applied multiplex-tandem PCR (MT-PCR) to 255 EDTA whole-blood specimens, 29 serum specimens, and 24 plasma specimens from 109 patients with Candida bloodstream infection (candidemia) to determine whether a diagnosis could be expedited in comparison with the time to diagnosis by the use of standard blood culture. Overall, the MT-PCR performed better than blood culture with DNA extracted from whole blood from 52/74 (70%) patients, accelerating the time to detection (blood culture flagging) and determination of the pathogenic species (by use of the API 32C system [bioMérieux, Marcy l'Etoile, France]) by up to 4 days (mean, 2.2 days; range, 0.5 to 8 days). Candida DNA was detected more often in serum (71%) and plasma (75%) than in whole blood (54%), although relatively small numbers of serum and plasma specimens were tested. The sensitivity, specificity, positive predictive value, and negative predictive value of the assay with whole blood were 75%, 97%, 95%, and 85%, respectively. Fungal DNA was not detected by MT-PCR in 6/24 (25%) whole-blood samples drawn simultaneously with the positive blood culture sample. MT-PCR performed better with whole-blood specimens stored at -20 degrees C (75%) and when DNA was extracted within 1 week of sampling (66%). The molecular and culture identification results correlated for 61 of 66 patients (92%); one discrepant result was due to misidentification by culture. All but one sample from 53 patients who were at high risk of candidemia but did not have proven disease were negative by MT-PCR. The results demonstrate the good potential of MT-PCR to detect candidemia, to provide Candida species identification prior to blood culture positivity, and to provide improved sensitivity when applied to with serum and plasma specimens.

  7. Optimization of a semi-nested multiplex PCR to identify Plasmodium parasites in wild-caught Anopheles in Bolivia, and its application to field epidemiological studies.

    Science.gov (United States)

    Lardeux, Frédéric; Tejerina, Rosenka; Aliaga, Claudia; Ursic-Bedoya, Raul; Lowenberger, Carl; Chavez, Tamara

    2008-05-01

    Without an adequate DNA extraction protocol, the identification of Plasmodium species in whole mosquitoes by PCR is difficult because of the presence of reaction inhibitors from the insects. In this study, eight DNA extraction protocols were tested, from which a chelex-based protocol was selected. Then a semi-nested multiplex PCR technique that detects and distinguishes among the four human Plasmodium species in single mosquitoes and in pools of up to 100 mosquitoes was optimized. The technique was used to detect P. vivax in wild-caught Anopheles pseudopunctipennis from a village in the Andean valleys of Bolivia in May 2003. The prevalence of infection was 0.9%. This is the first direct evidence of P. vivax transmission by this vector in this country. The extraction and PCR technique presented here can be useful to: (1) estimate Plasmodium prevalence in Anopheles populations in low prevalence areas where large numbers of individual mosquitoes would need to be processed to obtain a reliable estimate; (2) incriminate Anopheles species as malaria vectors; (3) identify all the circulating Plasmodium species in vectors from an area; (4) detect mixed infections in mosquitoes; and (5) detect mosquitoes with low-level parasite infections.

  8. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    Science.gov (United States)

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  9. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Simultaneous detection and differentiation of four closely related sweet potato potyviruses by a multiplex one-step RT-PCR.

    Science.gov (United States)

    Li, Fan; Zuo, Ruijuan; Abad, Jorge; Xu, Donglin; Bao, Gaili; Li, Ruhui

    2012-12-01

    Four closely related potyviruses, Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG) and/or Sweet potato virus 2 (SPV2), are involved in sweet potato virus disease complexes worldwide. Identification and detection of these viruses are complicated by high similarity among their genomic sequences, frequent occurrence as mixed infections and low titer in many sweet potato cultivars. A one-tube multiplex reverse transcription-PCR (mRT-PCR) assay was developed for simultaneous detection and differentiation of SPFMV, SPVC, SPVG and SPV2. Four specific forward primers unique to each virus and one reverse primer based on the region conserved in all four viruses were selected and used in the assay. The mRT-PCR assay was optimized for primer concentration and cycling conditions. It was tested using sweet potato plants infected naturally with one to four target viruses and then evaluated using field samples collected from southwestern China. The mRT-PCR assay is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in sweet potato. This assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Published by Elsevier B.V.

  11. Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias.

    Science.gov (United States)

    Asano, S; Matsushita, Y; Hirayama, Y; Naka, T

    2015-08-01

    Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that infect cultivated dahlias. Prior to this investigation, no multiplex RT-PCR assay for the detection of dahlia virus and viroid infections existed. In this study, we report the development of a multiplex RT-PCR that simultaneously detects TSWV, DMV and CSVd infections in dahlias. In addition, a simple RT-PCR method that does not require RNA extraction, microtissue direct RT-PCR, could be used to prepare samples for analysis by this multiplex RT-PCR. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions, and CSVd in the Hokkaido region. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in dahlia. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions and CSVd in the Hokkaido region. © 2015 The Society for Applied Microbiology.

  12. Evaluation of a PCR multiplex for detection and differentiation of Mycoplasma synoviae, M. gallisepticum, and M. gallisepticum strain F-vaccine

    Directory of Open Access Journals (Sweden)

    Elena Mettifogo

    2015-01-01

    Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.

  13. Multiplex PMA-qPCR Assay with Internal Amplification Control for Simultaneous Detection of Viable Legionella pneumophila, Salmonella typhimurium, and Staphylococcus aureus in Environmental Waters.

    Science.gov (United States)

    Li, Haiyan; Xin, Hongyi; Li, Sam Fong Yau

    2015-12-15

    Pathogenic microorganisms are responsible for many infectious diseases, and pathogen monitoring is important and necessary for water quality control. This study for the first time explored a multiplex quantitative real-time PCR (qPCR) technique combined with propidium monoazide (PMA) to simultaneously detect viable Legionella pneumophila, Salmonella typhimurium, and Staphylococcus aureus in one reaction from water samples. Sodium lauroyl sarcosinate (sarkosyl) was applied to enhance the dead bacterial permeability of PMA. The sensitivity of the multiplex PMA-qPCR assay achieved two colony-forming units (CFU) per reaction for L. pneumophila and three CFU per reaction for S. typhimurium and S. aureus. No PCR products were amplified from all nontarget control samples. Significantly, with comparable specificity and sensitivity, this newly invented multiplex PMA-qPCR assay took a much shorter time than did conventional culture assays when testing water samples with spiked bacteria and simulated environmental water treatment. The viable multiplex PMA-qPCR assay was further successfully applied to pathogen detection from rivers, canals, and tap water samples after simple water pretreatment.

  14. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the visual cycle and mutations identified in the .... temp., 94°C time, 45 sec. Annealing. Extension. Multiplex group. Exons. Product size (bp). Cycles. Temp. Time. Cycles. Temp. Time. Cycles. I. 1. 244. 35. 54°C. 60 sec. 35. 72°C. 90 sec.

  15. Multiplex Ultrasensitive Genotyping of Patients with Non-Small Cell Lung Cancer for Epidermal Growth Factor Receptor (EGFR Mutations by Means of Picodroplet Digital PCR

    Directory of Open Access Journals (Sweden)

    Masaru Watanabe

    2017-07-01

    Full Text Available Epidermal growth factor receptor (EGFR mutations have been used as the strongest predictor of effectiveness of treatment with EGFR tyrosine kinase inhibitors (TKIs. Three most common EGFR mutations (L858R, exon 19 deletion, and T790M are known to be major selection markers for EGFR-TKIs therapy. Here, we developed a multiplex picodroplet digital PCR (ddPCR assay to detect 3 common EGFR mutations in 1 reaction. Serial-dilution experiments with genomic DNA harboring EGFR mutations revealed linear performance, with analytical sensitivity ~0.01% for each mutation. All 33 EGFR-activating mutations detected in formalin-fixed paraffin-embedded (FFPE tissue samples by the conventional method were also detected by this multiplex assay. Owing to the higher sensitivity, an additional mutation (T790M; including an ultra-low-level mutation, <0.1% was detected in the same reaction. Regression analysis of the duplex assay and multiplex assay showed a correlation coefficient (R2 of 0.9986 for L858R, 0.9844 for an exon 19 deletion, and 0.9959 for T790M. Using ddPCR, we designed a multiplex ultrasensitive genotyping platform for 3 common EGFR mutations. Results of this proof-of-principle study on clinical samples indicate clinical utility of multiplex ddPCR for screening for multiple EGFR mutations concurrently with an ultra-rare pretreatment mutation (T790M.

  16. Rapid detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in food, using multiplex real-time PCR.

    Science.gov (United States)

    Mayr, A M; Lick, S; Bauer, J; Thärigen, D; Busch, U; Huber, I

    2010-02-01

    A multiplex real-time PCR assay based on four differently labeled TaqMan probes for detection and differentiation of the thermophilic Campylobacter species C. jejuni, C. coli, and C. lari was established and validated in food products. This assay combines two previously published PCR assays for C. jejuni and C. coli with a newly developed detection assay for C. lari and an internal amplification control system. The selectivity of the method was determined by analyzing 70 Campylobacter strains and 43 strains of other bacteria. The sensitivity was 50 fg of C. jejuni and C. lari DNA and 500 fg of C. coli DNA per PCR. It was possible to detect 1 to 10 CFU/25 g of food before preenrichment of all three species. More than 400 samples of various foods (poultry, seafood, and meat) were analyzed after 48 h of preenrichment parallel to the conventional diagnostic method of culture and biochemical identification. Using the established real-time PCR assay, 55.4% of the samples were recognized as positive for thermophilic Campylobacter species, whereas with the conventional method only 40.3% of the samples were positive. The real-time PCR assay also detected contaminations with two different Campylobacter species in 32.6% of the analyzed poultry samples, a finding of epidemiological interest. Compared with the original PCR method, which was established for the differentiation of bacterial isolates of C. jejuni and C. coli, this new method also detects and distinguishes C. lari, was validated as an analytical tool for food analysis, and provides reliable and extensive results within 2 days.

  17. Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array

    NARCIS (Netherlands)

    Zetsche, Bernd; Heidenreich, Matthias; Mohanraju, Prarthana; Fedorova, Iana; Kneppers, Jeroen; Degennaro, Ellen M.; Winblad, Nerges; Choudhury, Sourav R.; Abudayyeh, Omar O.; Wu, Wen Y.; Oost, van der John

    2017-01-01

    Targeting of multiple genomic loci with Cas9 is limited by the need for multiple or large expression constructs. Here we show that the ability of Cpf1 to process its own CRISPR RNA (crRNA) can be used to simplify multiplexed genome editing. Using a single customized CRISPR array, we edit up to

  18. Simultaneous detection and quantitation of Chikungunya, dengue and West Nile viruses by multiplex RT-PCR assays and dengue virus typing using high resolution melting.

    Science.gov (United States)

    Naze, F; Le Roux, K; Schuffenecker, I; Zeller, H; Staikowsky, F; Grivard, P; Michault, A; Laurent, P

    2009-12-01

    Chikungunya (CHIKV), Dengue (DENV) and West Nile (WNV) viruses are arthropod-borne viruses that are able to emerge or re-emerge in many regions due to climatic changes and increase in travel. Since these viruses produce similar clinical signs it is important for physicians and epidemiologists to differentiate them rapidly. A molecular method was developed for their detection and quantitation in plasma samples and a DENV typing technique were developed. The method consisted in performing two multiplex real-time one-step RT-PCR assays, to detect and quantify the three viruses. Both assays were conducted in a single run, from a single RNA extract containing a unique coextracted and coamplified composite internal control. The quantitation results were close to the best detection thresholds obtained with simplex RT-PCR techniques. The differentiation of DENV types was performed using a High Resolution Melting technique. The assays enable the early diagnosis of the three arboviruses during viremia, including cases of coinfection. The method is rapid, specific and highly sensitive with a potential for clinical diagnosis and epidemiological surveillance. A DENV positive sample can be typed conveniently using the High Resolution Melting technique using the same apparatus.

  19. Wavevector multiplexed atomic quantum memory via spatially-resolved single-photon detection.

    Science.gov (United States)

    Parniak, Michał; Dąbrowski, Michał; Mazelanik, Mateusz; Leszczyński, Adam; Lipka, Michał; Wasilewski, Wojciech

    2017-12-15

    Parallelized quantum information processing requires tailored quantum memories to simultaneously handle multiple photons. The spatial degree of freedom is a promising candidate to facilitate such photonic multiplexing. Using a single-photon resolving camera, we demonstrate a wavevector multiplexed quantum memory based on a cold atomic ensemble. Observation of nonclassical correlations between Raman scattered photons is confirmed by an average value of the second-order correlation function [Formula: see text] in 665 separated modes simultaneously. The proposed protocol utilizing the multimode memory along with the camera will facilitate generation of multi-photon states, which are a necessity in quantum-enhanced sensing technologies and as an input to photonic quantum circuits.

  20. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  1. Development and assessment of multiplex high resolution melting assay as a tool for rapid single-tube identification of five Brucella species.

    Science.gov (United States)

    Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M

    2014-12-11

    The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.

  2. Isolation, identification and differentiation of Campylobacter spp. using multiplex PCR assay from goats in Khartoum State, Sudan.

    Science.gov (United States)

    Elbrissi, Atif; Sabeil, Y A; Khalifa, Khalda A; Enan, Khalid; Khair, Osama M; El Hussein, A M

    2017-03-01

    The aim of this study was to identify and characterize thermophilic Campylobacter species in faecal samples from goats in Khartoum State, Sudan, by application of multiplex polymerase chain reaction. Campylobacteriosis is a zoonotic disease of global concern, and the organisms can be transmitted to human via food, water and through contact with farm animals and pets. There are five clinically related Campylobacter species: Campylobacter jejuni (C. jejuni). Campylobacter coli, Campylobacter lari, Campylobacter upsaliensis and Campylobacter fetus. Conventional cultural methods to diagnose campylobacteriosis are tedious and time consuming. Wide ranges of genes have been reported to be used for PCR-based identification of Campylobacter spp. We used a multiplex PCR assay to simultaneously detect genes from the major five clinically significant Campylobacter spp. The genes selected were hipO (hippuricase) and 23S rRNA from glyA (serine hydroxymethyl transferase) from each of C. jejuni. C. coli, C. lari, and C. upsaliensis; and sapB2 (surface layer protein) from C. fetus subsp. fetus. The assay was used to identify Campylobacter isolates recovered from 336 cultured faecal samples from goats in three localities in Khartoum State. C. coli was the most predominant isolate (234; 69.6%), followed by C. jejuni (19; 5.7%), C. upsaliensis (13; 3.9%), C. fetus subsp. fetus (7; 2.1%) and C. lari (6; 1.8%). Twenty-nine goats showed mixed infection with Campylobacter spp., 21 of which harbored two Campylobacter spp., while eight animals were infected with three species. Ten out of twelve goats that displayed diarrhea harbored C. coli only. C. coli, C. jejuni and C. upsaliensis showed significant variation with localities. The prevalence of C. coli was significantly higher (87; 25.9%) in goats from Omdurman, whereas C. jejuni and C. upsaliensis were significantly higher (11; 3.3%, 9; 2.7%) in goats from Khartoum. The multiplex PCR assay was found to be rapid and easy to perform and

  3. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  4. Conventional versus molecular tests (Multiplex PCR and PCR mecA gene for detection of methicillin resistant Staphylococcus aureus Testes convencionais versus moleculares (Multiplex PCR e PCR gene mecA na detecção de Staphylococcus aureus resistente a meticilina

    Directory of Open Access Journals (Sweden)

    Rosineide Marques Ribas

    2003-11-01

    Full Text Available In this study, for detection of methicillin-resistant S. aureus (MRSA, a mecA multiplex PCR-based amplification was compared with the 1 µg oxacillin disk diffusion test, detection of minimal inhibitory concentration (MIC, and screening in agar with 4% NaCl and 6 µg/mL oxacillin. Among 24 isolates obtained from blood, mecA gene was detected in only 16 (66.7% isolates by multiplex PCR. The MIC test showed a range of resistance to oxacillin from 0.19 to 512 µg/mL, among these isolates. Data obtained by screening and dilution tests showed that sensitivity to methicillin was 80.0% and 72.8%, respectively, when compared with the presence of mecA gene (multiplex. All isolates, including the negatives, when revaluated for mecA gene by PCR were positive. beta-lactamase production was positive for 20/25 isolates (80.0%. About ¼ of patients died dispite most of them (83.3% were adequately treated. The simultaneous identification of the bacteria and determination of this susceptibility to antibiotics are necessary for the choice of empiric antibiotic therapy in suspected staphylococcal sepse, but is important to considering the sensibility, specificity and validation of the available kits.Nesse estudo, para detecção de S. aureus resistente à meticilina (MRSA, a amplificação do gene mecA baseada no multiplex PCR foi comparada com os testes de difusão com disco para 1 µg/mL de oxacilina, detecção da concentração inibitória mínima (CIM, meio de triagem com 4% de NaCl e 6 µg/mL de oxacilina. Na investigação de 24 isolados obtidos de sangue, o genótipo mecA foi detectado em apenas 16 (66,7% dos isolados pelo multiplex PCR. A CIM apresentou valores variando de 0,19 a 512 µg/mL entre os isolados de MRSA. Os dados obtidos pelos testes de triagem e diluição em ágar apresentaram sensibilidades de 80,0% e 72,8% respectivamente, quando comparados com a presença do gene mecA (multiplex. Todos os isolados, incluindo os negativos, quando

  5. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...

  6. Detection of Mycobacterium chelonae, Mycobacterium abscessus Group, and Mycobacterium fortuitum Complex by a Multiplex Real-Time PCR Directly from Clinical Samples Using the BD MAX System.

    Science.gov (United States)

    Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond

    2017-03-01

    A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  7. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Objectives: Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. Methods: We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. Results: We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. Conclusions: These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures. PMID:29142545

  8. Development of a novel multiplex PCR assay to detect functional subtypes of KIR3DL1 alleles.

    Directory of Open Access Journals (Sweden)

    Jeanette E Boudreau

    Full Text Available Among NK cell receptor-ligand partnerships, KIR3DL1 and HLA-Bw4 demonstrate the greatest diversity; permutations of their allelic combinations titrate NK reactivity. Balancing selection has maintained distinct subtypes of KIR3DL1 alleles in global populations, implying that each may provide unique fitness advantages and variably influence disease processes. Though approaches exist for determining HLA-B allotypes, practical methods for identifying KIR3DL1 alleles are lacking. We have developed a PCR-based approach that identifies functional subtypes of KIR3DL1 alleles; it is suitable for research and may have clinical application. Six allele subsets were identified based on expression characteristics of the eleven most common KIR3DL1 alleles represented in reported populations. The remaining 62 low-frequency alleles were distributed into these groups based on sequence homology to coding regions. Subtype-specific SNPs were found in exons 3, 4, and 7, and used as priming sites for five multiplex PCR reactions. Genomic DNA derived from 175 unrelated donors and 52 related individuals from 6 families demonstrated >99.5% concordance between sequence-based typing and our novel approach. Finally, PCR-based typing accurately predicted NK phenotypes obtained by flow cytometry after staining with DX9 and Z27 monoclonal antibodies. This novel approach facilitates high-throughput analysis of KIR3DL1 allotypes to enable a broader understanding of KIR3DL1 and HLA-Bw4 interaction in health and disease.

  9. Development of a novel multiplex PCR assay to detect functional subtypes of KIR3DL1 alleles.

    Science.gov (United States)

    Boudreau, Jeanette E; Le Luduec, Jean-Benoît; Hsu, Katharine C

    2014-01-01

    Among NK cell receptor-ligand partnerships, KIR3DL1 and HLA-Bw4 demonstrate the greatest diversity; permutations of their allelic combinations titrate NK reactivity. Balancing selection has maintained distinct subtypes of KIR3DL1 alleles in global populations, implying that each may provide unique fitness advantages and variably influence disease processes. Though approaches exist for determining HLA-B allotypes, practical methods for identifying KIR3DL1 alleles are lacking. We have developed a PCR-based approach that identifies functional subtypes of KIR3DL1 alleles; it is suitable for research and may have clinical application. Six allele subsets were identified based on expression characteristics of the eleven most common KIR3DL1 alleles represented in reported populations. The remaining 62 low-frequency alleles were distributed into these groups based on sequence homology to coding regions. Subtype-specific SNPs were found in exons 3, 4, and 7, and used as priming sites for five multiplex PCR reactions. Genomic DNA derived from 175 unrelated donors and 52 related individuals from 6 families demonstrated >99.5% concordance between sequence-based typing and our novel approach. Finally, PCR-based typing accurately predicted NK phenotypes obtained by flow cytometry after staining with DX9 and Z27 monoclonal antibodies. This novel approach facilitates high-throughput analysis of KIR3DL1 allotypes to enable a broader understanding of KIR3DL1 and HLA-Bw4 interaction in health and disease.

  10. Evidence of presence of Mycobacterium tuberculosis in bovine tissue samples by multiplex PCR: possible relevance to reverse zoonosis.

    Science.gov (United States)

    Mittal, M; Chakravarti, S; Sharma, V; Sanjeeth, B S; Churamani, C P; Kanwar, N S

    2014-04-01

    Bovine tuberculosis, caused by Mycobacterium bovis, remains one of the most important zoonotic health concerns worldwide. The transmission of Mycobacterium tuberculosis from humans to animals also occurs especially in countries where there is close interaction of humans with the animals. In the present study, thirty bovine lung tissue autopsy samples from an organized dairy farm located in North India were screened for the presence of Mycobacterium tuberculosis complex by smear microscopy, histopathological findings and PCR. Differential diagnosis of M. tuberculosis and M. bovis was made based on the deletion of mce-3 operon in M. bovis. The present study found eight of these samples positive for M. tuberculosis by multiplex PCR. Sequencing was performed on two PCR-positive representative samples and on annotation, and BLAST analysis confirmed the presence of gene fragment specific to Mycobacterium tuberculosis. The presence of M. tuberculosis in all the positive samples raises the possibility of human-to-cattle transmission and possible adaptation of this organism in bovine tissues. This study accentuates the importance of screening and differential diagnosis of Mycobacterium tuberculosis complex in humans and livestock for adopting effective TB control and eradication programmes. © 2014 Blackwell Verlag GmbH.

  11. Impact of Early Detection of Respiratory Viruses by Multiplex PCR Assay on Clinical Outcomes in Adult Patients.

    Science.gov (United States)

    Rappo, Urania; Schuetz, Audrey N; Jenkins, Stephen G; Calfee, David P; Walsh, Thomas J; Wells, Martin T; Hollenberg, James P; Glesby, Marshall J

    2016-08-01

    Rapid and definitive diagnosis of viral respiratory infections is imperative in patient triage and management. We compared the outcomes for adult patients with positive tests for respiratory viruses at a tertiary care center across two consecutive influenza seasons (winters of 2010-2011 and 2012). Infections were diagnosed by conventional methods in the first season and by multiplex PCR (FilmArray) in the second season. FilmArray decreased the time to diagnosis of influenza compared to conventional methods (median turnaround times of 1.7 h versus 7.7 h, respectively; P = 0.015); FilmArray also decreased the time to diagnosis of non-influenza viruses (1.5 h versus 13.5 h, respectively; P < 0.0001). Multivariate logistic regression found that a diagnosis of influenza by FilmArray was associated with significantly lower odds ratios (ORs) for admission (P = 0.046), length of stay (P = 0.040), duration of antimicrobial use (P = 0.032), and number of chest radiographs (P = 0.005), when controlling for potential confounders. We conclude that the rapid turnaround time, multiplex nature of the test (allowing simultaneous detection of an array of viruses), and superior sensitivity of FilmArray may improve the evaluation and management of patients suspected of having respiratory virus infections. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number).

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-05-01

    To analyse molecular detection of coliforms and shorten the time of PCR. Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  13. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  14. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  15. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...... in 171 (8%) and 66(3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus...... and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause...

  16. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    Infectious bursal disease virus (IBDV) is a major cause of disease problems in the poultry industry and vaccination has therefore been applied intensively to control the infection. The classical methods of detection and characterization of IBDV are by the use of immunodiffusion test and histopath......Infectious bursal disease virus (IBDV) is a major cause of disease problems in the poultry industry and vaccination has therefore been applied intensively to control the infection. The classical methods of detection and characterization of IBDV are by the use of immunodiffusion test...... and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  17. A multiplex TaqMan qPCR assay for sensitive and rapid detection of phytoplasmas infecting Rubus species.

    Directory of Open Access Journals (Sweden)

    Holger Linck

    Full Text Available Rubus stunt is an economically important disease in the production of raspberries, blackberries, and loganberries. A fast, sensitive, and reliable diagnosis of phytoplasmas, the causal agent of the disease, is of prime importance to stop its spread by vegetative propagation and by insect vectors. Therefore, multiplex qPCR assays using TaqMan probes with different kinds of fluorophores in one reaction were developed, allowing the detection of phytoplasmas in general as well as a more specific detection of phytoplasmas belonging to group 16SrV and host DNA (either plant or insect. This assay now provides a practical tool for the screening of motherplants and monitoring the presence and distribution of phytoplasmas in Rubus plants of different geographic origins, cultivars, and cultivation systems, as well as in putative insect vectors like leafhoppers.

  18. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  19. Development of a qualitative, multiplex real-time PCR kit for screening of genetically modified organisms (GMOs).

    Science.gov (United States)

    Dörries, Hans-Henno; Remus, Ivonne; Grönewald, Astrid; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2010-03-01

    The number of commercially available genetically modified organisms (GMOs) and therefore the diversity of possible target sequences for molecular detection techniques are constantly increasing. As a result, GMO laboratories and the food production industry currently are forced to apply many different methods to reliably test raw material and complex processed food products. Screening methods have become more and more relevant to minimize the analytical effort and to make a preselection for further analysis (e.g., specific identification or quantification of the GMO). A multiplex real-time PCR kit was developed to detect the 35S promoter of the cauliflower mosaic virus, the terminator of the nopaline synthase gene of Agrobacterium tumefaciens, the 35S promoter from the figwort mosaic virus, and the bar gene of the soil bacterium Streptomyces hygroscopicus as the most widely used sequences in GMOs. The kit contains a second assay for the detection of plant-derived DNA to control the quality of the often processed and refined sample material. Additionally, the plant-specific assay comprises a homologous internal amplification control for inhibition control. The determined limits of detection for the five assays were 10 target copies/reaction. No amplification products were observed with DNAs of 26 bacterial species, 25 yeasts, 13 molds, and 41 not genetically modified plants. The specificity of the assays was further demonstrated to be 100% by the specific amplification of DNA derived from reference material from 22 genetically modified crops. The applicability of the kit in routine laboratory use was verified by testing of 50 spiked and unspiked food products. The herein described kit represents a simple and sensitive GMO screening method for the reliable detection of multiple GMO-specific target sequences in a multiplex real-time PCR reaction.

  20. Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

    Science.gov (United States)

    Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

    2017-06-01

    Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Analytical performance of a multiplex Real-Time PCR assay using TaqMan probes for quantification of Trypanosoma cruzi satellite DNA in blood samples.

    Directory of Open Access Journals (Sweden)

    Tomas Duffy

    Full Text Available BACKGROUND: The analytical validation of sensitive, accurate and standardized Real-Time PCR methods for Trypanosoma cruzi quantification is crucial to provide a reliable laboratory tool for diagnosis of recent infections as well as for monitoring treatment efficacy. METHODS/PRINCIPAL FINDINGS: We have standardized and validated a multiplex Real-Time quantitative PCR assay (qPCR based on TaqMan technology, aiming to quantify T. cruzi satellite DNA as well as an internal amplification control (IAC in a single-tube reaction. IAC amplification allows rule out false negative PCR results due to inhibitory substances or loss of DNA during sample processing. The assay has a limit of detection (LOD of 0.70 parasite equivalents/mL and a limit of quantification (LOQ of 1.53 parasite equivalents/mL starting from non-boiled Guanidine EDTA blood spiked with T. cruzi CL-Brener stock. The method was evaluated with blood samples collected from Chagas disease patients experiencing different clinical stages and epidemiological scenarios: 1- Sixteen Venezuelan patients from an outbreak of oral transmission, 2- Sixty three Bolivian patients suffering chronic Chagas disease, 3- Thirty four Argentinean cases with chronic Chagas disease, 4- Twenty seven newborns to seropositive mothers, 5- A seronegative receptor who got infected after transplantation with a cadaveric kidney explanted from an infected subject. CONCLUSIONS/SIGNIFICANCE: The performing parameters of this assay encourage its application to early assessment of T. cruzi infection in cases in which serological methods are not informative, such as recent infections by oral contamination or congenital transmission or after transplantation with organs from seropositive donors, as well as for monitoring Chagas disease patients under etiological treatment.

  2. Rapid detection of blaVIM-1-37 and blaKPC1/2-12 alleles from clinical samples by multiplex PCR-based assays.

    Science.gov (United States)

    Frasson, Ilaria; Biasolo, Maria Angela; Bartolini, Andrea; Cavallaro, Antonietta; Richter, Sara N; Palù, Giorgio

    2013-07-01

    VIM and KPC are two major families of carbapenemases involved in nosocomial outbreaks of multidrug-resistant Gram-negative bacilli. To rapidly detect bla(VIM)- and bla(KPC)-encoding strains, three multiplex PCR-based methods were designed and validated: (i) a real-time PCR to detect all reported VIM alleles, namely bla(VIM-1-19, 23-37); (ii) a real-time PCR to identify bla(VIM)-type and bla(KPC) carbapenemases in an ultrarapid single reaction; and (iii) a standard PCR to amplify and sequence all VIM alleles. All three methods detected 33 VIM-positive samples among 107 Gram-negative isolates with imipenem and meropenem minimum inhibitory concentrations ≥1 mg/L. The three methods displayed 100% sensitivity, specificity and concordance. Sequencing of the bla(VIM) amplicons revealed that 30 samples encoded bla(VIM-1) and 3 samples encoded bla(VIM-2). The real-time assay, optimised for the simultaneous detection of bla(VIM) and bla(KPC), identified 3 and 12 isolates positive for both bla(VIM)/bla(KPC) and for bla(KPC), respectively. The analytical sensitivity of the real-time assays was linear over 6 log dilutions, with a reproducible detection limit of 1 CFU. No cross-reactivity was detected. The developed assays provide powerful tools for rapid identification of VIM and KPC carbapenemase producers, therefore contributing to the prevention and containment of resistance dissemination. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  3. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection

    DEFF Research Database (Denmark)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi

    2016-01-01

    technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP......-PCR directly on top of the SAF microlens array. Attribute to the high fluorescence collection efficiency of the SAF microlens array, the SP-PCR assay on the LOC platform demonstrated a high sensitivity of 1.6 copies/µL, comparable to off-chip detection using conventional laser scanner. The combination of SP......-PCR and SAF microlens array allows for on-chip highly sensitive and multiplexed pathogen detection with low-cost and compact optical components. The LOC platform would be widely used as a high-throughput biosensor to analyze food, clinical and environmental samples....

  4. A Cytolethal Distending Toxin Gene-Based Multiplex PCR Assay for Campylobacter jejuni, C. fetus, C. coli, C. upsaliensis, C. hyointestinalis, and C. lari.

    Science.gov (United States)

    Kamei, Kazumasa; Kawabata, Hiroki; Asakura, Masahiro; Samosornsuk, Worada; Hinenoya, Atsushi; Nakagawa, Shinsaku; Yamasaki, Shinji

    2016-05-20

    In this study, we devised a multiplex PCR assay based on the gene of cytolethal distending toxin (cdt) B subunit to simultaneously detect and discriminate Campylobacter jejuni, C. fetus, C. coli, C. upsaliensis, C. hyointestinalis, and C. lari. Species-specific PCR products were successfully obtained from all 38 C. jejuni, 12 C. fetus, 39 C. coli, 22 C. upsaliensis, 24 C. hyointestinalis, and 7 C. lari strains tested. On the other hand, no specific PCR products were obtained from other campylobacters and bacterial species tested (41 strains in total). The proposed multiplex PCR assay is a valuable tool for detection and descrimination of 6 major Campylobacter species, that are associated with gastrointestinal diseases in humans.

  5. Single SQUID multiplexer for arrays of voltage-biased superconducting bolometers

    International Nuclear Information System (INIS)

    Yoon, Jongsoo; Clarke, John; Gildemeister, J.M.; Lee, Adrian T.; Myers, M.J.; Richards, P.L.; Skidmore, J.T.; Spieler, H.G.

    2001-01-01

    We describe a frequency domain superconducting quantum interference device (SQUID) multiplexer which monitors a row of low-temperature sensors simultaneously with a single SQUID. Each sensor is ac biased with a unique frequency and all the sensor currents are added in a superconducting summing loop. A single SQUID measures the current in the summing loop, and the individual signals are lock-in detected after the room temperature SQUID electronics. The current in the summing loop is nulled by feedback to eliminate direct crosstalk. In order to avoid the accumulation of Johnson noise in the summing loop, a tuned bandpass filter is inserted in series with each sensor. For a 32-channel multiplexer for Voltage-biased Superconducting Bolometer (VSB) with a time constant(approx)1msec, we estimate that bias frequencies in the range from(approx)500kHz to(approx)600kHz are practical. The major limitation of our multiplexing scheme is in the slew rate of a readout SQUID. We discuss a ''carrier nulling'' technique which could be used to increase the number of sensors in a row or to multiplex faster bolometers by reducing the required slew rate for a readout SQUID

  6. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from diarrheal patients in Japan.

    Science.gov (United States)

    Kabir, S M Lutful; Kikuchi, Ken; Asakura, Masahiro; Shiramaru, Sachi; Tsuruoka, Naoki; Goto, Aeko; Hinenoya, Atsushi; Yamasaki, Shinji

    2011-01-01

    We have developed a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, C. coli, and C. fetus. The applicability of this assay was evaluated with 325 Campylobacter strains isolated from diarrheal patients in Japan and the results were compared with those obtained by other genetic methods, including hipO gene detection and 16S rRNA gene sequencing. Of the 325 strains analyzed, 314 and 11 were identified as C. jejuni and C. coli, respectively, by combination of hipO gene detection and 16S rRNA gene sequencing. When the multiplex PCR assay was employed, 309, 310, and 314 strains were identified as C. jejuni on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Similarly, 11, 11, and 10 strains were identified as C. coli on the basis of cdtA, cdtB, and cdtC gene-specific primers, respectively. Sequence analysis of the cdt gene region of 6 strains (5 C. jejuni and 1 C. coli) which did not yield specific PCR products in any of the cdt gene-based multiplex PCR assays revealed deletions or mutations of the cdt genes. Pulsed-field gel electrophoresis indicated that C. jejuni and C. coli strains were genetically diverse. Taken together, these findings suggest that the cdtC gene-based multiplex PCR seems to be a particularly simple and rapid method for differentiating between species of Campylobacter strains, such as C. jejuni and C. coli. However, combination of these multiplex PCR assays will allow more accurate identification.

  7. Within-herd prevalence thresholds for herd-level detection of mastitis pathogens using multiplex real-time PCR in bulk tank milk samples.

    Science.gov (United States)

    Soltau, J B; Einax, E; Klengel, K; Katholm, J; Failing, K; Wehrend, A; Donat, K

    2017-10-01

    The objective of the study was to assess the value of quantitative multiplex real-time PCR examination of bulk tank milk samples for bovine mastitis pathogens as a tool for herd level diagnosis. Using a logistic regression model, this study is aimed at calculating the threshold level of the apparent within-herd prevalence as determined by quarter milk sample cultivation of all lactating cows, thus allowing the detection of a herd positive for a specific pathogen within certain probability levels. A total of 6,335 quarter milk samples were collected and cultured from 1,615 cows on 51 farms in Germany. Bulk tank milk samples were taken from each farm and tested by bacterial culture as well as the commercial PCR assay Mastit 4A (DNA Diagnostic A/S, Risskov, Denmark) identifying Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus agalactiae, and Streptococcus uberis. In addition, PCR was performed on pooled herd milk samples containing milk aliquots from all lactating cows in each of the 51 herds. Only 1 out of the 51 herds was found PCR positive for Streptococcus agalactiae in bulk tank and pooled herd milk samples, and cultured quarter milk samples. Spearman's rank correlations between the cycle threshold value of bulk tank milk PCR and the apparent within-herd prevalence were calculated in regard to Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus uberis. For these pathogens, significant correlations were found. If 1 bulk tank milk sample per herd was tested, the estimated within-herd prevalence thresholds for 90% probability of detection were 27.6% for Staphylococcus aureus, 9.2% for Streptococcus dysgalactiae, and 13.8% for Streptococcus uberis on the cow level. On the quarter level, the within-herd prevalence had to be at least 32.6% for Staphylococcus aureus, 1.7% for Streptococcus dysgalactiae, and 4.3% for Streptococcus uberis to detect a herd as positive using a single bulk milk sample. The results indicate that mastitis

  8. Polysilicon nanogap lab-on-chip facilitates multiplex analyses with single analyte.

    Science.gov (United States)

    Balakrishnan, Sharma Rao; Hashim, U; Gopinath, Subash C B; Poopalan, P; Ramayya, H R; Veeradasan, P; Haarindraprasad, R; Ruslinda, A R

    2016-10-15

    Rationally designed biosensing system supports multiplex analyses is warranted for medical diagnosis to determine the level of analyte interaction. The chemically functionalized novel multi-electrode polysilicon nanogap (PSNG) lab-on-chip is designed in this study, facilitates multiplex analyses for a single analyte. On the fabricated 69nm PSNG, biocompatibility and structural characteristics were verified for the efficient binding of Human Chorionic Gonadotropin (hCG). With the assistance of microfluidics, hCG sample was delivered via single-injection to 3-Aminopropyl(triethoxy)silane (APTES) and Glycidoxypropyl(trimethoxy)silane (GPMS) modified PSNG electrodes and the transduced signal was used to investigate the dielectric mechanisms for multiplex analyses. The results from amperometric response and impedance measurement delivered the scale of interaction between anti-hCG antibody and hCG that exhibited 6.5 times higher sensitivity for the chemical linker, APTES than GPMS. Under optimized experimental conditions, APTES and GPMS modified immunosensor has a limit of detection as 0.56mIU/ml and 2.93mIU/ml (at S/N=3), with dissociation constants (Kd) of 5.65±2.5mIU/ml and 7.28±2.6mIU/ml, respectively. These results suggest that multiplex analysis of single target could enhance the accuracy of detection and reliable for real-time comparative analyses. The designed PSNG is simple, feasible, requires low sample consumption and could be applied for any given multiplex analyses. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  10. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  11. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

    DEFF Research Database (Denmark)

    Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

    2018-01-01

    Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

  12. Detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in clinical stool samples by using multiplex real-time PCR after automated DNA isolation

    NARCIS (Netherlands)

    Van Lint, P; Rossen, J W; Vermeiren, S; Ver Elst, K; Weekx, S; Van Schaeren, J; Jeurissen, A

    2013-01-01

    Diagnosis of intestinal parasites in stool samples is generally still carried out by microscopy; however, this technique is known to suffer from a low sensitivity and is unable to discriminate between certain protozoa. In order to overcome these limitations, a real-time multiplex PCR was evaluated

  13. Simultaneous detection of virulence factors from a colony in diarrheagenic Escherichia coli by a multiplex PCR assay with Alexa Fluor-labeled primers.

    Science.gov (United States)

    Kuwayama, Masaru; Shigemoto, Naoki; Oohara, Sachiko; Tanizawa, Yukie; Yamada, Hiroko; Takeda, Yoshihiro; Matsuo, Takeshi; Fukuda, Shinji

    2011-07-01

    We have developed simultaneous detection of eight genes associated with the five categories of diarrheagenic Escherichia coli by the multiplex PCR assay with Alexa Fluor-labeled primers. This assay can easily distinguish eight genes based on the size and color of amplified products without gel staining. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Single-mode multicore fiber for dense space division multiplexing

    DEFF Research Database (Denmark)

    Sasaki, Yusuke; Amma, Yoshimichi; Takenaga, Katsuhiro

    2016-01-01

    Single-mode multicore fiber (SM-MCF) is attractive for high-capacity transmission. Our fabricated SM-MCFs achieve high core count and low crosstalk with a cladding diameter of 230 µm. Characteristics of fan-in/fan-out for the SM-MCFs are also investigated....

  15. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  16. A Multiplexed, Probe-Based Quantitative PCR Assay for DNA of Phytophthora sojae

    Science.gov (United States)

    Phytophthora sojae (Kaufm. & Gerd.) causes seed rot, pre- and post-emergence damping off, and sometimes foliar blight in soybean (Glycine max). Crop loss may approach 100% with susceptible cultivars. We report here the development of a unique quantitative PCR assay specific to DNA of P. sojae, and a...

  17. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  18. Development of a Multiplex Real-Time PCR for Determination of Apricot in Marzipan Using the Plexor System.

    Science.gov (United States)

    Schelm, Stefanie; Haase, Ilka; Fischer, Christin; Fischer, Markus

    2017-01-18

    Marzipan is a confectionary which is mostly offered in form of filled chocolate, pralines, or pure. According to the German guidelines for oil seeds only almonds, sugar and water are admitted ingredients of marzipan. A product very similar in taste is persipan which is used in the confectionary industry because of its stronger flavor. For persipan production almonds are replaced by debittered apricot or peach kernels. To guarantee high quality products for consumers, German raw paste producers have agreed a limit of apricot kernels in marzipan raw paste of 0.5%. Different DNA-based methods for quantitation of persipan contaminations in marzipan are already published. To increase the detection specificity compared to published intercalation dye-based assays, the present work demonstrate the utilization of a multiplex real-time PCR based on the Plexor technology. Thus, the present work enables the detection of at least 0.1% apricot DNA in almond DNA or less. By analyzing DNA mixtures, the theoretical limit of quantification of the duplex PCR for the quantitation of persipan raw paste DNA in marzipan raw paste DNA was determined as 0.05%.

  19. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao

    2007-07-11

    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes.

  20. madSTORM: a superresolution technique for large-scale multiplexing at single-molecule accuracy

    Science.gov (United States)

    Yi, Jason; Manna, Asit; Barr, Valarie A.; Hong, Jennifer; Neuman, Keir C.; Samelson, Lawrence E.

    2016-01-01

    Investigation of heterogeneous cellular structures using single-molecule localization microscopy has been limited by poorly defined localization accuracy and inadequate multiplexing capacity. Using fluorescent nanodiamonds as fiducial markers, we define and achieve localization precision required for single-molecule accuracy in dSTORM images. Coupled with this advance, our new multiplexing strategy, madSTORM, allows accurate targeting of multiple molecules using sequential binding and elution of fluorescent antibodies. madSTORM is used on an activated T-cell to localize 25 epitopes, 14 of which are on components of the same multimolecular T-cell receptor complex. We obtain an average localization precision of 2.6 nm, alignment error of 2.0 nm, and molecules within structures. Probing the molecular topology of complex signaling cascades and other heterogeneous networks is feasible with madSTORM. PMID:27708141

  1. Comparison between Conventional OCDMA and Subcarrier Multiplexing SAC OCDMA System Based on Single Photodiode Detection

    OpenAIRE

    Ahmad N. A. A; Junita M. N; Aljunid Syed Alwi; Che Beson Mohd Rashidi; Endut Rosdisham

    2017-01-01

    This paper demonstrates the comparison between conventional OCDMA system and subcarrier multiplexing (SCM) SAC-OCDMA system by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. From this analysis, the performance of SCM OCDMA network could be improved by using lower data rates and higher received...

  2. Single bovine sperm sex typing by amelogenin nested PCR.

    Science.gov (United States)

    Colley, A; Buhr, M; Golovan, S P

    2008-10-01

    Sex-sorted bovine semen has become a valuable tool in animal production for sex preselection. Development of novel sperm sexing technologies, or evaluation of the quality of existing methods, often requires a single-sperm, sex-typing method that is reliable and easy to perform. In the present study, we report the development, validation, and application of a simple, reliable, and cost-effective method for single-sperm sex typing using nested polymerase chain reaction (PCR), based on the amelogenin gene. Several hundred single sperm were isolated using a simple manual technique, or a high-speed flow-sorter, and were successfully sex-typed using the amelogenin nested PCR. Based on the pooled results of individual sperm, there was no significant difference in the semen sex ratio of unsorted (44.6% X-sperm and 55.4% Y-sperm) or X/Y-sorted semen (91.4% X-sperm and 94.0% Y-sperm), as compared to the expected ratio in unsorted semen or the post-sorting reanalysis data, respectively. The amelogenin single-sperm sexing method was an adaptable, accurate, and reliable tool for single-sperm sex typing.

  3. Ion Source Multiplexing on a Single Mass Spectrometer.

    Science.gov (United States)

    Kostyukevich, Yury; Nikolaev, Eugene

    2018-03-06

    We present the simple approach for the combination of different ion sources on a single mass spectrometer without any interference between them. Each ion source can be positioned as far as 1 m from the mass spectrometer; ions are transported by the means of flexible copper tubes, which are connected, to the separate inlet capillaries. Special valves enable switching channels on and off. Using this approach, we successfully combined native electrospray ionization (ESI), regular ESI, β-electrons ionization, and atmospheric pressure photoionization (APPI) of thermally desorbed vapors of petroleum on a single mass spectrometer. In addition, separate channels allow infusing internal calibration mixture or performing ion molecular reactions in one channel and using the other as a reference. Using this idea, we have developed an original sequential window acquisition of all theoretical mass spectra (SWATH MS) approach in which peptide ions are transported in different channels, one of which is heated to high temperature so that ions are thermally fragmented, and the other channel ensures the presence of nonfragmented ions in the spectrum. Also, we demonstrated the possibility to perform gas phase H/D exchange reaction in one channel and using another as reference. Use of valves makes it possible to exclude any interference between them. Thus, we have demonstrated the possibility to create a multichannel system in which ions would be transported through several inlet tubes in which different ion molecular reactions such as Paternò-Büchi, ozonation, or H/D exchange will occur. Comparison of mass spectra recorded when different channels are open will provide structural and chemical information about unknown species.

  4. Development of a multiplex PCR test for identification of Actinobacillus pleuropneumoniae serovars 1, 7, and 12

    DEFF Research Database (Denmark)

    Angen, Øystein; Ahrens, Peter; Jessing, Stine Graakjær

    2008-01-01

    A PCR assay for simultaneous species identification and separation of Actinobacillus pleuropneumoniae serovars 1, 7 and 12 was developed. Primers specific for genes involved in biosynthesis of the capsular polysaccharides (cps genes) of serovars 1, 7,and 12 were combined with a species-specific PCR...... serotyping methods. Among eight serologically cross-reacting strains designated K1:O7, seven isolates produced amplicons of similar sizes as serovar 1 and one isolate produced amplicons of similar sizes as serovar 7. The species specificity of the assay was evaluated using a collection of 126 strains...... produced an amplicon identical to the cps gene of serovar 7, whereas one isolate produced an amplicon identical to the cps gene of serovar 1. In addition, four isolates of Actinobacillus genomospecies 1 tested positive for the omlA gene but negative for the cps genes. The test represents a convenient...

  5. Simple and highly discriminatory VNTR-based multiplex PCR for tracing sources of Aspergillus flavus isolates.

    Directory of Open Access Journals (Sweden)

    Dong Ying Wang

    Full Text Available Aspergillus flavus is second only to A. fumigatus in causing invasive aspergillosis and it is the major agent responsible for fungal sinusitis, keratitis and endophthalmitis in many countries in the Middle East, Africa and Southeast Asia. Despite the growing challenge due to A. flavus, data on the molecular epidemiology of this fungus remain scarce. The objective of the present study was to develop a new typing method based on the detection of VNTR (Variable number tandem repeat markers. Eight VNTR markers located on 6 different chromosomes (1, 2, 3, 5, 7 and 8 of A. flavus were selected, combined by pairs for multiplex amplifications and tested on 30 unrelated isolates and six reference strains. The Simpson index for individual markers ranged from 0.398 to 0.818. A combined loci index calculated with all the markers yielded an index of 0.998. The MLVA (Multiple Locus VNTR Analysis technique proved to be specific and reproducible. In a second time, a total of 55 isolates from Chinese avian farms and from a Tunisian hospital have been evaluated. One major cluster of genotypes could be defined by using the graphing algorithm termed Minimum Spanning Tree. This cluster comprised most of the isolates collected in an avian farm in southern China. The MLVA technique should be considered as an excellent and cost-effective typing method that could be used in many laboratories without the need for sophisticated equipment.

  6. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  7. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  8. Multiplex PCR system for the rapid diagnosis of respiratory virus infection: systematic review and meta-analysis.

    Science.gov (United States)

    Huang, H-S; Tsai, C-L; Chang, J; Hsu, T-C; Lin, S; Lee, C-C

    2017-12-05

    To provide a summary of evidence for the diagnostic accuracies of three multiplex PCR systems (mPCRs)-BioFire FilmArray RP (FilmArray), Nanosphere Verigene RV+ test (Verigene RV+) and Hologic Gen-Probe Prodesse assays-on the detection of viral respiratory infections. A comprehensive search up to 1 July 2017 was conducted on Medline and Embase for studies that utilized FilmArray, Verigene RV+ and Prodesse for diagnosis of viral respiratory infections. A summary of diagnostic accuracies for the following five viruses were calculated: influenza A virus (FluA), influenza B virus, respiratory syncytial virus, human metapneumovirus and adenovirus. Hierarchical summary receiver operating curves were used for estimating the viral detection performance per assay. Twenty studies of 5510 patient samples were eligible for analysis. Multiplex PCRs demonstrated high diagnostic accuracy, with area under the receiver operating characteristic curve (AUROC) equal to or more than 0.98 for all the above viruses except for adenovirus (AUROC 0.89). FilmArray, Verigene RV+ and ProFlu+ (the only Prodesse assay with enough data) demonstrated a summary sensitivity for FluA of 0.911 (95% confidence interval, 0.848-0.949), 0.949 (95% confidence interval, 0.882-0.979) and 0.954 (95% confidence interval, 0.871-0.985), respectively. The three mPCRs were comparable in terms of detection of FluA. Point estimates calculated from eligible studies showed that the three mPCRs (FilmArray, Verigene RV+ and ProFlu+) are highly accurate and may provide important diagnostic information for early identification of respiratory virus infections. In patients with low pretest probability for FluA, these three mPCRs can predict a low possibility of infection and may justify withholding empirical antiviral treatments. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  9. Membranes on nanopores for multiplexed single-transporter analyses

    International Nuclear Information System (INIS)

    Urban, Michael; Tampé, Robert

    2016-01-01

    The study of membrane proteins as prime drug targets has led to intensified efforts to characterize their structure and function. With regards to the structural analysis of membrane proteins, there have been considerable technological innovations in cryo-EM and X-ray crystallography, but advancements in the elucidation of membrane protein function, especially on a single-molecule level, have been struggling to bridge from basic science to high-throughput applications. There is a need for advanced biosensor platforms allowing membrane protein-mediated transport and potential suppressor libraries to be characterized. Membrane proteins facilitating the translocation of non-electrogenic substrates particularly suffer from a lack of such techniques to date. Here, we summarize recent developments in the field of membrane protein analysis, with a special focus on micro- and nanostructured platforms for purpose of high-throughput screening using fluorescent read-out systems. Additionally, their use as novel biosensor platforms to elucidate non-electrogenic substrate translocation is described. This overview contains 82 references. (author)

  10. Multiplex Nested Reverse Transcription-Polymerase Chain Reaction in a Single Tube for Sensitive and Simultaneous Detection of Four RNA Viruses and Pseudomonas savastanoi pv. savastanoi in Olive Trees.

    Science.gov (United States)

    Bertolini, Edson; Olmos, Antonio; López, María M; Cambra, Mariano

    2003-03-01

    ABSTRACT A multiplex nested reverse transcription-polymerase chain reaction (RT-PCR) in a single closed tube was developed for the simultaneous detection of four RNA viruses: Cucumber mosaic virus, Cherry leaf roll virus, Strawberry latent ringspot virus, and Arabis mosaic virus, and the bacterium Pseudomonas savastanoi pv. savastanoi. The method enabled, for the first time, the sensitive and simultaneous detection of RNA and DNA targets from plant viruses and a bacterium, saving time, decreasing risks of contamination, and reducing costs compared with conventional monospecific nested amplifications. The method was successfully coupled with colorimetric detection of amplicons using specific oligoprobes to simplify routine detection. Two hundred forty-five olive trees from 15 different cultivars were analyzed by multiplex RT-nested PCR coupled with colorimetric detection. Multiplex nested RT-PCR for viral detection increased the identification of positive trees by 8.1%. An uneven distribution of the viruses was observed in the infected trees. The bacterium was detected in 28.7% of the analyzed trees by the developed multiplex nested method and by a nested PCR previously developed. This powerful methodology could be applied to other models for the detection of several pathogens in a single assay.

  11. Development of multiplex real-time PCR assays for identification of members of the Anopheles funestus species group

    Directory of Open Access Journals (Sweden)

    Field Linda M

    2009-12-01

    Full Text Available Abstract Background The malaria vector and non-vector species of the Anopheles funestus group are morphologically very similar and accurate identification is required as part of effective control strategies. In the past, this has relied on morphological and cytogenetic methods but these have been largely superseded by a robust allele-specific PCR (AS-PCR. One disadvantage of AS-PCR is the requirement for post-PCR processing by gel electrophoresis of PCR products. In this study, three new high-throughput 'closed-tube' assays were developed and compared with the previously described AS-PCR technique. Methods Protocols for three fluorescence-based assays based on Melt Curve Analysis (MCA, High Resolution Melt (HRM and TaqMan SNP genotyping were developed to detect and discriminate Anopheles parensis, Anopheles leesoni, Anopheles vaneedeni, Anopheles rivulorum and An. funestus s.s. The sensitivity and specificity of these assays were compared with the widely used AS-PCR in a blind trial using DNA extracted from wild-caught mosquitoes. Results The TaqMan assay proved to be the most sensitive and specific of the three new assays. The MCA and HRM assays initially gave promising results, but were more sensitive to both DNA quality and quantity and consequently showed a higher rate of incorrect identifications. Conclusion The TaqMan assay proved to be the most robust of the three protocols tested in this study. This assay very effectively identified all five members of the An. funestus group using fluorescently-labeled probes with distinct emission and excitation spectra allowing their independent detection in a single reaction. This method is at least as sensitive and specific as the gold standard AS-PCR approach and because it has no requirement for post-PCR processing is simpler and more rapid to run. The one disadvantage of the TaqMan assay is the cost of this assay, both in terms of initial capital outlay and running cost per sample, which is higher

  12. Simulation Performance of Multiple-Input Multiple-Output Systems Employing Single-Carrier Modulation and Orthogonal Frequency Division Multiplexing

    National Research Council Canada - National Science Library

    Saglam, Halil D

    2004-01-01

    ...) systems utilizing Alamouti-based space-time block coding (STBC) technique. The MIMO communication systems using STBC technique employing both single-carrier modulation and orthogonal frequency division multiplexing (OFDM...

  13. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  14. Primers with 5' flaps improve the efficiency and sensitivity of multiplex PCR assays for the detection of Salmonella and Escherichia coli O157:H7.

    Science.gov (United States)

    Timmons, Chris; Dobhal, Shefali; Fletcher, Jacqueline; Ma, Li Maria

    2013-04-01

    Foodborne illnesses caused by Salmonella enterica and Escherichia coli O157:H7 are worldwide health concerns. Rapid, sensitive, and robust detection of these pathogens in foods and in clinical and environmental samples is essential for routine food quality testing, effective surveillance, and outbreak investigations. The aim of this study was to evaluate the effect on PCR sensitivity of adding a short, AT-rich overhanging nucleotide sequence (flap) to the 5' end of PCR primers specific for the detection of Salmonella and E. coli O157:H7. Primers targeting the invA gene of Salmonella and the rfbE gene of E. coli O157:H7 were synthesized with or without a 12-bp, AT-rich 5' flap (5'-AATAAATCATAA-3'). Singleplex PCR, multiplex PCR, and real-time PCR sensitivity assays were conducted using purified bacterial genomic DNA and crude cell lysates of bacterial cells. The effect of background flora on detection was evaluated by spiking tomato and jalapeno pepper surface washes with E. coli O157:H7 and Salmonella Saintpaul. When targeting individual pathogens, end-point PCR assays using flap-amended primers were more efficient than nonamended primers, with 20.4 and 23.5% increases in amplicon yield for Salmonella and E. coli O157:H7, respectively. In multiplex PCR assays, a 10- to 100-fold increase in detection sensitivity was observed when the primer flap sequence was incorporated. This improvement in both singleplex and multiplex PCR efficiency and sensitivity can lead to improved Salmonella and E. coli O157:H7 detection.

  15. Evaluation of the Roche LightMix®Gastro Parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

    Science.gov (United States)

    Friesen, Johannes; Fuhrmann, Jörg; Kietzmann, Heike; Tannich, Egbert; Müller, Michael; Ignatius, Ralf

    2018-03-23

    Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix ® Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystis hominis, and Dientamoeba fragilis with routine laboratory procedures. Stool specimens (n=1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen ® enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analyzed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; P PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analyzed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018. Published by Elsevier Ltd.

  16. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection.

    Science.gov (United States)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi; Wolff, Anders; Bang, Dang Duong

    2017-04-15

    Solid-phase PCR (SP-PCR) has become increasingly popular for molecular diagnosis and there have been a few attempts to incorporate SP-PCR into lab-on-a-chip (LOC) devices. However, their applicability for on-line diagnosis is hindered by the lack of sensitive and portable on-chip optical detection technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP-PCR directly on top of the SAF microlens array. Attribute to the high fluorescence collection efficiency of the SAF microlens array, the SP-PCR assay on the LOC platform demonstrated a high sensitivity of 1.6 copies/µL, comparable to off-chip detection using conventional laser scanner. The combination of SP-PCR and SAF microlens array allows for on-chip highly sensitive and multiplexed pathogen detection with low-cost and compact optical components. The LOC platform would be widely used as a high-throughput biosensor to analyze food, clinical and environmental samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  18. A new multiplexing single molecule technique for measuring restriction enzyme activity

    Science.gov (United States)

    Harbottle, Allison; Cavanaugh, Jillian; Gordon, Wendy; Loparo, Joseph; Price, Allen

    2012-02-01

    We present a new multiplexing single molecule method for observing the cleavage of DNAs by restriction enzymes. DNAs are attached to a surface at one end using a biotin-streptavidin link and to a micro bead at the other end via a digoxigenin-antidigoxigenin link. The DNAs are stretched by applying a flow. After introduction of the restriction enzyme, the exact time of cleavage of individual DNAs is recorded with video microscopy. We can image hundreds to thousands of DNAs in a single experiment. We are using our technique to search for the signature of facilitated diffusion in the measured rate dependence on ionic strength.

  19. Rapid Detection of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Fresh Chicken Meat and By-Products in Bangkok, Thailand, Using Modified Multiplex PCR.

    Science.gov (United States)

    Saiyudthong, S; Phusri, K; Buates, S

    2015-07-01

    A multiplex PCR assay for simultaneous detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari was developed and validated to assess the occurrence of these bacteria in fresh chicken meat and by-products in Bangkok, Thailand, by using a new combination of four previously published PCR primers for C. jejuni, C. coli, C. lari, and a universal 16S rDNA gene as an internal control. The specificity was determined by using 13 strains of other bacteria. With pure culture DNA, the detection limit was 0.017 ng/PCR for C. jejuni and C. coli and was 0.016 ng/PCR for C. lari. It can detect 10 CFU of C. jejuni, C. coli, and C. lari in 2 g of chicken meat within a 16-h enrichment time. Our multiplex PCR assay was applied for identification of Campylobacter spp. in 122 supermarket samples and 108 fresh market samples. Of the 230 samples evaluated by multiplex PCR, 54.0, 3.3, and 10.7% of supermarket samples were positive for C. jejuni, C. coli, and mixed C. jejuni and C. coli, respectively, and 56.5 and 33.3% of fresh market samples were positive for C. jejuni and mixed C. jejuni and C. coli, respectively. No sample was positive for C. lari. Fresh market samples had significantly higher C. jejuni and C. coli contamination than those from supermarkets (relative risk: 1.3; P = 0.0001). Compared with the culture method (a gold standard), the sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of multiplex PCR were 97.7, 86.8, 96.1, 92.0, and 95.2%, respectively. No significant difference was observed between results from two methods (P = 0.55). Therefore, the established multiplex PCR was not only rapid and easy to perform but had a high sensitivity and specificity to distinguish between C. jejuni, C. coli, and C. lari, even in samples containing mixed contamination. Our study indicated that fresh chicken meat and by-products from fresh markets were significantly less hygienic than those

  20. Improving preimplantation genetic diagnosis for Fragile X syndrome: two new powerful single-round multiplex indirect and direct tests.

    Science.gov (United States)

    Kieffer, Emmanuelle; Nicod, Jean-Christophe; Gardes, Nathalie; Kastner, Claire; Becker, Nicolas; Celebi, Catherine; Pirrello, Olivier; Rongières, Catherine; Koscinski, Isabelle; Gosset, Philippe; Moutou, Céline

    2016-02-01

    Fragile X syndrome (FraX) is caused by the expansion of an unstable CGG repeat located in the Fragile X mental retardation 1 gene (FMR1) gene. Preimplantation genetic diagnosis (PGD) can be proposed to couples at risk of transmitting the disease, that is, when the female carries a premutation or a full mutation. We describe two new single-cell, single-round multiplex PCR for indirect and direct diagnosis of FraX on biopsied embryos. These tests include five unpublished, highly heterozygous simple sequence repeats, and the co-amplification of non-expanded CGG repeats for the direct test. Heterozygosity of the new markers ranged from 69 to 81%. The mean rate of non-informative marker included in the tests was low (26% and 23% for the new indirect and direct tests, respectively). This strategy allows offering a PGD for FraX to 96% of couples requesting it in our centre. A conclusive genotype was obtained in all cells with a rate of cells presenting an allele dropout ranging from 17% for the indirect test to 26% for the direct test. The new indirect test was applied for eight PGD cycles: 32 embryos were analysed, 9 were transferred and 3 healthy babies were born. By multiplexing these highly informative markers, robustness of the diagnosis is improved and the loss of potentially healthy embryos (because they are non-diagnosed or misdiagnosed) is limited. This may increase the chances of success of couples requesting a PGD for FraX, in particular, when premature ovarian insufficiency in premutated women leads to a reduced number of embryos available for analysis.

  1. Application of multiplex PCR assay based on uidR and fliCH7 genes for detection of Escherichia coli O157:H7 in milk.

    Science.gov (United States)

    Kumar, Ashwani; Grover, Sunita; Kumar Batish, Virender

    2013-01-01

    A highly sensitive and specific multiplex PCR assay has been developed to detect the presence of Escherichia coli O157:H7 from naturally contaminated raw milk samples within 10 h. The primers explored in the assay were targeted against the uidR gene specific for all types of E. coli and the fliCH7 gene specific for the h7 flagellar antigen of E. coli O157:H7. The multiplex PCR assay developed was found to be highly specific as it produced PCR products of 152 bp (E. coli specific) and 625 bp (E. coli O157:H7 specific). The assay was tested for its specificity against different serotypes of E. coli as well as other pathogenic strains like Salmonella, Shigella, Klebsiella, Enterobacter, Staphylococcus aureus, Lactobacillus and Lactococcus etc. When this multiplex PCR assay was directly applied to 24 raw milk samples collected from different sources, E. coli O157:H7 could be detected in one of the milk samples without 4 h enrichment in CT-SMAC broth and three samples after 4 h enrichment in CT-SMAC broth. However, all the pasteurized milk samples gave a negative signal for this organism.

  2. Multiplex PCR and Next Generation Sequencing for the Non-Invasive Detection of Bladder Cancer.

    Directory of Open Access Journals (Sweden)

    Douglas G Ward

    Full Text Available Highly sensitive and specific urine-based tests to detect either primary or recurrent bladder cancer have proved elusive to date. Our ever increasing knowledge of the genomic aberrations in bladder cancer should enable the development of such tests based on urinary DNA.DNA was extracted from urine cell pellets and PCR used to amplify the regions of the TERT promoter and coding regions of FGFR3, PIK3CA, TP53, HRAS, KDM6A and RXRA which are frequently mutated in bladder cancer. The PCR products were barcoded, pooled and paired-end 2 x 250 bp sequencing performed on an Illumina MiSeq. Urinary DNA was analysed from 20 non-cancer controls, 120 primary bladder cancer patients (41 pTa, 40 pT1, 39 pT2+ and 91 bladder cancer patients post-TURBT (89 cancer-free.Despite the small quantities of DNA extracted from some urine cell pellets, 96% of the samples yielded mean read depths >500. Analysing only previously reported point mutations, TERT mutations were found in 55% of patients with bladder cancer (independent of stage, FGFR3 mutations in 30% of patients with bladder cancer, PIK3CA in 14% and TP53 mutations in 12% of patients with bladder cancer. Overall, these previously reported bladder cancer mutations were detected in 86 out of 122 bladder cancer patients (70% sensitivity and in only 3 out of 109 patients with no detectable bladder cancer (97% specificity.This simple, cost-effective approach could be used for the non-invasive surveillance of patients with non-muscle-invasive bladder cancers harbouring these mutations. The method has a low DNA input requirement and can detect low levels of mutant DNA in a large excess of normal DNA. These genes represent a minimal biomarker panel to which extra markers could be added to develop a highly sensitive diagnostic test for bladder cancer.

  3. Validation of a multiplex qPCR assay for the identification and quantification of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis: In vitro and subgingival plaque samples.

    Science.gov (United States)

    Marin, M J; Ambrosio, N; Herrera, D; Sanz, M; Figuero, E

    2018-04-01

    To validate a multiplex qPCR (m-qPCR) assay for the simultaneous identification and quantification of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis in subgingival samples. In vitro samples: DNA combinations of A. actinomycetemcomitans and P. gingivalis in similar or different concentrations were prepared. qPCR and m-qPCR were performed using the same primers and hydrolysis probes specific for 16SrRNA genes. Results were analyzed using intra-class (ICCs) and Lin's correlation coefficients (r) based on quantification cycle (Cq) values. Subgingival plaque samples: a cross-sectional study analyzing subgingival plaque samples harvested from periodontally-healthy and chronic periodontitis patients. Samples were processed by either qPCR or m-qPCR targeting both bacteria. Sensitivity, specificity, predictive values and Lińs correlation coefficients (r) were calculated using CFU/mL as primary outcome. In vitro samples: m-qPCR yielded a good reproducibility (coefficients of variation around 1% and ICCs > 0.99) for both bacterial species. m-qPCR achieved detection limits and specificity similar to qPCR. An excellent concordance (r = 0.99) was observed between m-qPCR and qPCR for A. actinomycetemcomitans and P. gingivalis without statistical significant differences between both methods Subgingival plaque samples: a high sensitivity (above 80%) and specificity (100%) was obtained with the m-qPCR for both bacteria. The m-qPCR yielded a good concordance in Cq values, showing a good level of agreement between qPCR and m-qPCR. The tested m-qPCR method was successful in the simultaneous quantification of A. actinomycetemcomitans and P. gingivalis, with a high degree of sensitivity and specificity on subgingival plaque samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. A simplified multiplex PCR-based typing method for commonSalmonella entericaserovars supported by online server-based detection system.

    Science.gov (United States)

    Borah, Probodh; Porwollik, Steffen; Desai, Prerak; Nayak, Prakash; Borah, Partha Pratim; Cheng, Pui; McClelland, Michael

    2017-08-01

    A rapid and simple alternative method is needed to replace the laborious, time-consuming Salmonella serotyping. The objective of the present study was to improve and simplify a previously reported multiplex polymerase chain reaction (PCR)-based method and to create an online server to enable rapid determination of serovars. A method of multiplex PCR-based genome typing (MPGT) was standardized using 59 Salmonella isolates of 31 serovars. Several previously reported primers were modified to obtain a more accurate performance. The screen was separated into four different multiplex reactions distinguishable on standard electrophoresis. A blind study was subsequently performed with 81 isolates of 10 serovars most prevalent in India. Whole genome information from 440 Salmonella isolates was used to confirm the usefulness of this method and concurrence of in silico predictions and PCR results were investigated. A public server (http://www.mpgt-salmonella.res.in) was established for data storage and determination of closest previously observed Salmonella isolates based on obtained MPGT patterns. The 16 target genes amplified showed variability in their presence in strains from different serotypes. Hence, identical amplification patterns suggested genetic relatedness of strains and usually identical serological behaviour. The observed absence/presence patterns of genes were converted to an MPGT code. Altogether, 83 different codes were predicted in silico based on the whole genome information of 440 strains. Results confirmed that major serovars usually displayed unique MPGT codes. The multiplex PCR assay resulted in specific binary codes for isolates from each of the 31 Salmonella serovars tested. The online server allowed the user to compare obtained PCR results with stored previous patterns. Simplicity, speed and cost-effectiveness make this tool useful for quick outbreak management.

  5. [Genotypic survey of Plasmodium falciparum based on the msp1, msp2 and glurp genes by multiplex PCR].

    Science.gov (United States)

    Barrera, Sandra Milena; Pérez, Manuel Alberto; Knudson, Angélica; Nicholls, Rubén Santiago; Guerra, Angela Patricia

    2010-01-01

    The genetic diversity of Plasmodium falciparum has been one of the major obstacles for the success of anti-malaria drug therapy. It provides the parasite an ability to evade the host's immune response by generating changes in its antigenic composition and resistance to antimalarial drugs. The genetic diversity of P.falciparum was characterized in 4 Colombian localities through the analysis of polymorphic genes. Eighty-one samples were obtained from patients with uncomplicated P. falciparum malaria and screened for polymorphic variants of msp1, msp2 (merozoite surface proteins) and glurp (glutamate-rich protein) with a multiplex PCR assay. The geographic regions sampled were Tierralta (Córdoba), in northwestern Colombia and in the Orinoco river watershed of eastern Colombia--Inírida (Guainía), La Carpa (Guaviare), and Casuarito (Vichada). The MAD20 variant was detected in all samples analyzed for the msp1 gene. For the msp2 gene, the IC allelic family was found in 96.3% of the samples as compared to 4.9% of the samples with the FC family. Both families showed size polymorphism with bands between 467 and 513 basepairs (bp) for IC and 286 and 300 bp for FC. PCR products of differing sizes were detected for the glurp gene and grouped into 5 size classes: I (600-699 bp) 2.5%, II (700-799 bp) 19.8%, III (800-899 bp) 72.8%, IV (900-999 bp) 1.2% and V (1000-1099 bp) 3.7%. The msp1 molecular marker did not provide information for differentiating P. falciparum parasite populations. The msp2 gene was more suitable for studying the genetic diversity, however, further studies are required to identify polymorphisms within the two allelic families. The glurp gene showed a great genetic diversity of circulating P. falciparum populations, and suggested that this gene may be useful for distinguishing between recrudescence and reinfection.

  6. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3.

    Science.gov (United States)

    Thonur, Leenadevi; Maley, Madeleine; Gilray, Janice; Crook, Tara; Laming, Ellie; Turnbull, Dylan; Nath, Mintu; Willoughby, Kim

    2012-03-28

    Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD) is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR) to detect the viruses commonly implicated in BRD. A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV), bovine herpes virus type 1 (BoHV-1) and bovine parainfluenza virus type 3 (BPI3 i & ii) nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI) and/or indirect fluorescent antibody test (IFAT). The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA), minor groove binding (MGB) and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  7. Diagnostic Performance of a Multiplex PCR assay for meningitis in an HIV-infected population in Uganda

    Science.gov (United States)

    Rhein, Joshua; Bahr, Nathan C; Hemmert, Andrew C; Cloud, Joann L; Bellamkonda, Satya; Oswald, Cody; Lo, Eric; Nabeta, Henry; Kiggundu, Reuben; Akampurira, Andrew; Musubire, Abdu; Williams, Darlisha; Meya, David B; Boulware, David R

    2015-01-01

    Meningitis remains a worldwide problem, and rapid diagnosis is essential to optimize survival. We evaluated the utility of a multiplex PCR test in differentiating possible etiologies of meningitis. Cerebrospinal fluid (CSF) from 69 HIV-infected Ugandan adults with meningitis was collected at diagnosis (n=51) and among persons with cryptococcal meningitis during therapeutic lumbar punctures (n=68). Cryopreserved CSF specimens were analyzed with BioFire FilmArray® Meningitis/Encephalitis panel, which targets 17 pathogens. The panel detected Cryptococcus in the CSF of patients diagnosed with a first-episode of cryptococcal meningitis by fungal culture with 100% sensitivity and specificity, and differentiated between fungal relapse and paradoxical immune reconstitution inflammatory syndrome in recurrent episodes. A negative FilmArray result was predictive of CSF sterility on follow-up lumbar punctures for cryptococcal meningitis. EBV was frequently detected in this immunosuppressed population (n=45). Other pathogens detected included: CMV (n=2), VZV (n=2), HHV-6 (n=1), and Streptococcus pneumoniae (n=1). The FilmArray Meningitis/Encephalitis panel offers a promising platform for rapid meningitis diagnosis. PMID:26711635

  8. An integrated microfluidic device utilizing dielectrophoresis and multiplex array PCR for point-of-care detection of pathogens.

    Science.gov (United States)

    Cai, Dongyang; Xiao, Meng; Xu, Peng; Xu, Ying-Chun; Du, Wenbin

    2014-10-21

    The early identification of causative pathogens in clinical specimens that require no cultivation is essential for directing evidence-based antimicrobial treatments in resource limited settings. Here, we describe an integrated microfluidic device for the rapid identification of pathogens in complex physiological matrices such as blood. The device was designed and fabricated using SlipChip technologies, which integrated four channels processing independent samples and identifying up to twenty different pathogens. Briefly, diluted whole human blood samples were directly injected into the device for analysis. The pathogens were extracted from the blood by dielectrophoresis, retained in an array of grooves, and identified by multiplex array PCR in nanoliter volumes with end-point fluorescence detection. The universality of the dielectrophoretic separation of pathogens from physiological fluids was evaluated with a panel of clinical isolates covering predominant bacterial and fungal species. Using this system, we simultaneously identified Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli O157:H7 within 3 h. In addition to the prompt diagnosis of bloodstream infections, this method may also be utilized for differentiating microorganisms in contaminated water and environmental samples.

  9. Multiplex real-time PCR probe-based for identification of strains producing: OXA48, VIM, KPC and NDM.

    Science.gov (United States)

    Favaro, Marco; Sarti, Mario; Fontana, Carla

    2014-11-01

    The spread of multi-resistant enterobacteria, particularly carbapenem-resistant Enterobacteriaceae (CRE), in both community and hospital settings is a global problem. The phenotypic identification of CRE is complex, occasionally inconclusive and time consuming. However, commercially available molecular assays are very expensive, and many do not allow the simultaneous identification of all genetic markers of resistance that have been recognised in CRE (bla KPC, bla OXA-48, bla VIM and bla NDM). The aim of the present study is to describe a new test: a multiplex real time PCR probe-based assay designed for the simultaneous detection of KPC, OXA-48, VIM and NDM in a short time (no longer than 90 min from the extraction of DNA to detection). Our assay correctly identified 63 CRE isolates and all standard reference strains tested, in agreement with and extending the results of phenotypic identification tests; additionally, a KPC-VIM co-expressing Enterobacter aerogenes isolate was identified using the new assay, whereas traditional methods failed to detect it. The assay was also able to correctly detect 28 CRE-producers from 50 positive blood cultures, again detecting, in four specimens, the presence of CRE co-expressing KPC and VIM, which were only partially identified by traditional methods. Finally, when used directly on rectal swabs, the assay enabled the identification of CRE-carrier patients, for whom isolation is mandatory in a hospital setting.

  10. Evaluation of a real-time multiplex PCR for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./EIEC, and Yersinia enterocolitica in fecal samples.

    Science.gov (United States)

    Van Lint, P; De Witte, E; De Henau, H; De Muynck, A; Verstraeten, L; Van Herendael, B; Weekx, S

    2015-03-01

    Conventional diagnosis of infectious diarrhea caused by bacteria is time-consuming, labor-intensive, and has a suboptimal sensitivity. We have therefore developed a multiplex real-time polymerase chain reaction (PCR) for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./enteroinvasive Escherichia coli (EIEC), and Yersinia enterocolitica in fecal samples. No cross reactivity between the different pathogens was observed, and the multiplex setup of the assay did not have an impact on the sensitivity of the PCR. The analytical sensitivity was 87 CFU/mL for C. jejuni, 61 CFU/mL for Shigella spp./EIEC, 5,528 CFU/mL for Salmonella spp., and 1,306 CFU/mL for Y. enterocolitica. An extensive validation of the assay was performed by testing 1,687 patient samples by both PCR and with conventional techniques. The use of PCR increased the overall clinical sensitivity from 78 to 100 % (p PCR, compared with 99.9 % for conventional culture. The novel PCR assay allows for rapid, sensitive, inexpensive, and high-throughput testing of the most common bacterial causes of gastroenteritis.

  11. A Multiplex PCR assay to differentiate between dog and red fox.

    Science.gov (United States)

    Weissenberger, M; Reichert, W; Mattern, R

    2011-11-01

    Foxes are frequently the cause of car accidents in Baden-Württemberg (BW, Germany). The domestic dog (Canis familiaris) is in close relation to the red fox (Vulpes vulpes) and the silver fox which is a coat colour variant of the red fox. As insurance claims that involve accidents with animals require authentication, we analyzed frequency distribution and allele sizes in two canine microsatellite loci in 26 dogs (different breeds) and 19 red foxes of the region of BW, Germany. Moreover, sequencing analysis was performed. Red foxes exhibited only 1 allele at each microsatellite locus, whereas in dog 7 alleles at the CPH4 locus and 6 alleles at the CPH12 locus were detected. Sequences of PCR products from the two species revealed several differences between dogs and foxes. We established a sequenced allelic ladder and give population data from dogs and red foxes from the region of BW, Germany. Using microsatellite polymorphisms is efficient in differentiating between dogs and foxes in forensic casework. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  12. A Rapid Multiplex Real-Time PCR High-Resolution Melt Curve Assay for the Simultaneous Detection of Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus in Food.

    Science.gov (United States)

    Forghani, Fereidoun; Wei, Shuai; Oh, Deog-Hwan

    2016-05-01

    Three important foodborne pathogens, Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus, are of great concern for food safety. They may also coexist in food matrices and, in the case of B. cereus and S. aureus, the resulting illnesses can resemble each other owing to similar symptoms. Therefore, their simultaneous detection may have advantages in terms of cost savings and rapidity. Given this context, a rapid multiplex real-time PCR high-resolution melt curve assay for the simultaneous detection of these three pathogens in food was developed. The assay successfully detected B. cereus (gyrB), L. monocytogenes (hly), and S. aureus (nuc) in a single reaction, and the average melting temperatures were 76.23, 80.19, and 74.01°C, respectively. The application of SYTO9 dye and a slow melt curve analysis ramp rate (0.1°C/s) enabled the production of sharp, high-resolution melt curve peaks that were easily distinguishable from each other. The detection limit in food (milk, rice, and lettuce) was 3.7 × 10(3) CFU/g without an enrichment step and 3.7 × 10(1) CFU/g following the 10-h enrichment. Hence, the assay developed here is specific and sensitive, providing an efficient tool for implementation in food for the simultaneous detection of B. cereus, L. monocytogenes, and S. aureus .

  13. An experimental study for rapid detection and quantification of endodontic microbiota following photo-activated disinfection via new multiplex real-time PCR assay.

    Science.gov (United States)

    Pourhajibagher, Maryam; Raoofian, Reza; Ghorbanzadeh, Roghayeh; Bahador, Abbas

    2018-03-01

    The infected root canal system harbors one of the highest accumulations of polymicrobial infections. Since the eradication of endopathogenic microbiota is a major goal in endodontic infection therapy, photo-activated disinfection (PAD) can be used as an alternative therapeutic method in endodontic treatment. Compared to cultivation-based approaches, molecular techniques are more reliable for identifying microbial agents associated with endodontic infections. The purpose of this study was to evaluate the ability of designed multiplex real-time PCR protocol for the rapid detection and quantification of six common microorganisms involved in endodontic infection before and after the PAD. Samples were taken from the root canals of 50 patients with primary and secondary/persistent endodontic infections using sterile paper points. PAD with toluidine blue O (TBO) plus diode laser was performed on root canals. Resampling was then performed, and the samples were transferred to transport medium. Then, six target microorganisms were detected using multiplex real-time PCR before and after the PAD. Veillonella parvula was found using multiplex real-time PCR to have the highest frequency among samples collected before the PAD (29.4%), followed by Porphyromonas gingivalis (23.1%), Aggregatibacter actinomycetemcomitans (13.6%), Actinomyces naeslundii (13.0%), Enterococcus faecalis (11.5%), and Lactobacillus rhamnosus (9.4%). After TBO-mediated PAD, P. gingivalis strains, the most resistance microorganisms, were recovered in 41.7% of the samples using molecular approach (P > 0.05). As the results shown, multiplex real-time PCR as an accurate detection approach with high-throughput and TBO-mediated PAD as an efficient antimicrobial strategy due to the significant reduction of the endopathogenic count can be used for detection and treatment of microbiota involved in infected root canals, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Identification of Campylobacter jejuni and determination of point mutations associated with macrolide resistance using a multiplex TaqMan MGB real-time PCR.

    Science.gov (United States)

    Hao, H; Liu, J; Kuang, X; Dai, M; Cheng, G; Wang, X; Peng, D; Huang, L; Ahmad, I; Ren, N; Liu, Z; Wang, Y; Yuan, Z

    2015-06-01

    The aim of the study was to develop a multiplex real-time PCR method to identify Campylobacter jejuni containing mutations commonly associated with macrolide resistance. A multiplex fluorescence real-time PCR assay was developed based on TaqMan minor groove binder (MGB) probes. The VS1-MGB probe was designed based on the VS1 gene and was used to identify Camp. jejuni. The 23S rDNA-MGB probe was designed to distinguish macrolide resistance mutations in 23S rDNA, while 57D-MGB and 74D-MGB were designed to detect resistance mutations in ribosomal protein L4. The specificity and accuracy of our method were identical to the conventional biochemical tests, mapA PCR, minimum inhibitory concentration (MIC) determination and DNA sequencing. The linear detection limit of the method was 0·03 ng genomic DNA and three colony formation unit (CFU) per reaction. In 6 of 18 cases, the nature of Erythromycin resistance could be correctly determined from natural isolates; absence of the tested mutations was demonstrated in the remaining four resistant isolates. A multiplex TaqMan MGB real-time PCR assay with high specificity and accuracy was developed to simultaneously identify Camp. jejuni and detect the gene mutations associated with macrolide resistance. This multiplex method can potentially simplify the identification of Camp. jejuni and determine macrolide resistance due to mutations in 23S rDNA or ribosomal protein L4. This method has a potential for application in different research areas and molecular surveillance. © 2015 The Society for Applied Microbiology.

  15. Simple multiplex PCR assays to detect common pathogens and associated genes encoding for acquired extended spectrum betalactamases (ESBL) or carbapenemases from surgical site specimens in Vietnam.

    Science.gov (United States)

    Trung, Ngo Tat; Hien, Tran Thi Thu; Huyen, Tran Thi Thanh; Quyen, Dao Thanh; Binh, Mai Thanh; Hoan, Phan Quoc; Meyer, Christian G; Velavan, Thirumalaisamy P; Song, Le Huu

    2015-04-12

    Surgical site infection (SSI) is common in Vietnamese post-operative patients. It contributes to increased morbidity, mortality, hospitalization time and health care expenditure. Bacterial culture is considered the gold standard procedure to identify SSI pathogens and antibiotic resistant properties; however, it can detect microbes that can readily grow and is time-consuming. We propose optimized multiplex PCR assays to diagnose the most relevant microbes and associated genes encoding for acquired extended spectrum betalactamases (ESBL) or carbapenemases from Vietnamese patients with SSI in a hospital setting in Hanoi. Ninety-one patients (n = 91) were collected in order to identify microbial pathogens and associated genes encoding for acquired extended spectrum betalactamases (ESBL) or carbapenemases by both conventional bacterial culture and in-house multiplex PCR assays. The novel in-house multiplex PCR assays are comparable to the bacterial culture approach in screening for common pathogens causing SSI and for relevant genotypes conferring betalactam/carbapenem resistance for bacteria. This is the first report of Turkey-specific ESBL gene (PER-1) and two Oxacilinase families (Oxa23 and Oxa 58) in Vietnam.

  16. [Multiplex PCR strategy for the simultaneous identification of Staphylococcus aureus and detection of staphylococcal enterotoxins in isolates from food poisoning outbreaks].

    Science.gov (United States)

    Brizzio, Aníbal A; Tedeschi, Fabián A; Zalazar, Fabián E

    2013-01-01

    Staphylococcal food poisoning is the most frequent type of food poisoning around the world. Staphylococcus aureus enterotoxins cause significant loss of water in the intestinal lumen, followed by vomiting and diarrhea. To report a fast, reliable and inexpensive strategy based on multiplex PCR for the simultaneous identification of S. aureus and detection of five classical S. aureus enterotoxin genes ( sea, seb, sec, sed, see ) in Staphylococcus spp. strains isolated from food poisoning outbreaks. We analyzed isolates from 12 food poisoning outbreaks occurred in Santa Fe province (Argentina). Isolation and phenotypic characterization were carried out by standard procedures. Genotypic analysis was performed by multiplex PCR, using primers for nuc , sea-see and 16S rRNA genes simultaneously. Of all the strains tested, 58% were found to carry toxigenic genes. Sea and seb toxins were found at the same percentage (29%) while sec, sed and see genes were found in a lower and identical proportion (14%). We did not find more than one different type of S. aureus enterotoxin in the isolates analyzed. The multiplex PCR strategy designed in this work has enabled us to identify strains of S. aureus and detect -at the same time- their enterotoxigenic ability. At present, our efforts are devoted to the detection of genes encoding enterotoxins other than the classical ones, in order to know their impact on staphylococcal food poisoning, as well as to investigate their relevance to our country's public health.

  17. Molecular characterization of Rhodococcus equi Isolates of horse breeding farms from an endemic region in South of Brazil by multiplex PCR

    Science.gov (United States)

    Krewer, Cristina da Costa; Spricigo, Dênis Augusto; de Avila Botton, Sônia; da Costa, Mateus Matiuzzi; Schrank, Irene; de Vargas, Agueda Castagna

    2008-01-01

    Rhodococcus equi is a gram-positive coco-bacillus and an intracellular opportunistic pathogen which causes pneumonia in foals. It is widely detected in environment and has been isolated from several sources, as soil, feces and gut from health and sick foals. The goal of this study was to characterize the epidemiological status (endemic, sporadic or no infection) of horse breeding farms from Bage County in South of Brazil, using a multiplex PCR. One hundred and eighteen R. equi isolates were identified by biochemical tests and submitted to a specie-specific and vapA multiplex PCR. These isolates were obtained from: three farms where the R. equi infection has been noticed, two farms where the disease has been not reported and one farm where the disease is frequent. All clinical isolates from horse breeding farms where the disease is endemic and/or sporadic were vapA-positive. None environmental isolates were vapA-positive. In three horse breeding farms with sporadic R. equi infection, 11.54% of the isolates from adult horse feces were vapA-positive. The multiplex PCR technique has proven to be effective for the molecular and epidemiological characterization of the R. equi isolates in horse breeding farms. An important finding in this study was the isolation of vapApositive R. equi from adult horse feces, which is an evidence for other routes of dissemination of this pathogen in the farms. PMID:24031201

  18. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Science.gov (United States)

    Ahmad, N. A. A.; Junita, M. N.; Aljunid, S. A.; Rashidi, C. B. M.; Endut, R.

    2017-11-01

    This paper analyzes the performance of subcarrier multiplexing (SCM) of spectral amplitude coding optical code multiple access (SAC-OCDMA) by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  19. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Directory of Open Access Journals (Sweden)

    Ahmad N. A. A

    2017-01-01

    Full Text Available This paper analyzes the performance of subcarrier multiplexing (SCM of spectral amplitude coding optical code multiple access (SAC-OCDMA by applying Recursive Combinatorial (RC code based on single photodiode detection (SPD. SPD is used in the receiver part to reduce the effect of multiple access interference (MAI which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  20. Development and evaluation of a multiplex real-time PCR assay for the detection and differentiation of Moraxella bovis, Moraxella bovoculi and Moraxella ovis in pure culture isolates and lacrimal swabs collected from conventionally raised cattle.

    Science.gov (United States)

    Shen, H G; Gould, S; Kinyon, J; Opriessnig, T; O'Connor, A M

    2011-11-01

    To develop a multiplex real-time PCR assay for the detection and differentiation of Moraxella bovis (M. bovis), M. bovoculi and M. ovis. The multiplex real-time PCR assay was validated on three reference strains, 57 pure culture isolates and 45 lacrimal swab samples. All reference strains were identified correctly with no cross-reactions between species. Sequencing of 53 of the 57 culture isolates confirmed the results obtained with the multiplex real-time PCR, and the assay had 96·5% (55/57) concordance with a Moraxella spp. multiplex conventional PCR assay on the isolates. Among the lacrimal swab samples, the concordance between the multiplex real-time PCR and culture was 86·7% (39/45) for M. bovoculi and 75·6% (34/45) for M. bovis. The multiplex real-time PCR assay is specific and sensitive and can be used directly on lacrimal swab samples. The lack of a rapid, specific and sensitive detection method is a barrier for determining the roles of M. bovis, M. bovoculi and M. ovis in infectious bovine keratoconjunctivitis cases, and the developed PCR assay will contribute to improved understanding of the epidemiology and pathogenesis of these three Moraxella species. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  1. High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants.

    Science.gov (United States)

    Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N

    2016-05-01

    To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.

  2. On-chip single photon filtering and multiplexing in hybrid quantum photonic circuits.

    Science.gov (United States)

    Elshaari, Ali W; Zadeh, Iman Esmaeil; Fognini, Andreas; Reimer, Michael E; Dalacu, Dan; Poole, Philip J; Zwiller, Val; Jöns, Klaus D

    2017-08-30

    Quantum light plays a pivotal role in modern science and future photonic applications. Since the advent of integrated quantum nanophotonics different material platforms based on III-V nanostructures-, colour centers-, and nonlinear waveguides as on-chip light sources have been investigated. Each platform has unique advantages and limitations; however, all implementations face major challenges with filtering of individual quantum states, scalable integration, deterministic multiplexing of selected quantum emitters, and on-chip excitation suppression. Here we overcome all of these challenges with a hybrid and scalable approach, where single III-V quantum emitters are positioned and deterministically integrated in a complementary metal-oxide-semiconductor-compatible photonic circuit. We demonstrate reconfigurable on-chip single-photon filtering and wavelength division multiplexing with a foot print one million times smaller than similar table-top approaches, while offering excitation suppression of more than 95 dB and efficient routing of single photons over a bandwidth of 40 nm. Our work marks an important step to harvest quantum optical technologies' full potential.Combining different integration platforms on the same chip is currently one of the main challenges for quantum technologies. Here, Elshaari et al. show III-V Quantum Dots embedded in nanowires operating in a CMOS compatible circuit, with controlled on-chip filtering and tunable routing.

  3. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  4. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  5. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  6. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  7. Interleaved single-carrier frequency-division multiplexing for optical interconnects.

    Science.gov (United States)

    Zhou, Ji; Qiao, Yaojun; Yu, Jianjun; Shi, Jianyang; Cheng, Qixiang; Tang, Xizi; Guo, Mengqi

    2017-05-01

    In this paper, we propose a real-valued interleaved single-carrier frequency-division multiplexing (I-SC-FDM) scheme for intensity-modulation and direct-detection optical interconnects. By simplifying the encoding structure, the computational complexity can be reduced from Nlog2N complex multiplications to N complex multiplications. At the complementary cumulative distribution function of 10-2, a reduction of 10 dB and 7.5 dB for the peak-to-average power ratio (PAPR) of the I-SC-FDM is achieved than that of orthogonal frequency-division multiplexing modulated with QPSK and 16QAM, respectively, when the subcarrier number is set to 4096. We experimentally demonstrate the I-SC-FDM scheme for optical interconnects with data rates of 12 Gbit/s, 24 Gbit/s and 128 Gbit/s transmitted over 22.5-km, 22.5-km and 2.4-km standard single mode fiber, respectively. The I-SC-FDM scheme shows great potential for cost-sensitive and power-sensitive optical interconnects owing to its low computational complexity and low PAPR.

  8. Reconfigurable digital receiver for 8PSK subcarrier multiplexed and 16QAM single carrier phase‐modulated radio over fiber links

    DEFF Research Database (Denmark)

    Guerrero Gonzalez, Neil; Zibar, Darko; Yu, Xianbin

    2011-01-01

    A reconfigurable digital receiver based on the k‐means algorithm is proposed for phase‐modulated subcarrier multiplexed (SCM) and quadrature amplitude‐modulated single carrier, phase‐modulated radio‐over‐fiber links. We report successful demodulation after 40 km single mode fiber transmission...

  9. Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Zhang, Kunyan; McClure, Jo-Ann; Elsayed, Sameer; Louie, Thomas; Conly, John M.

    2005-01-01

    Staphylococcal cassette chromosome mec (SCCmec) typing is essential for understanding the molecular epidemiology of methicillin-resistant Staphylococcus aureus (MRSA). SCCmec elements are currently classified into types I to V based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to their junkyard region DNA segments. Previously described traditional SCCmec PCR typing schemes require multiple primer sets and PCR experiments, while a previously published multiplex PCR assay is limited in its ability to detect recently discovered types and subtypes such as SCCmec type V and subtypes IVa, b, c, and d. We designed new sets of SCCmec type- and subtype-unique and specific primers and developed a novel multiplex PCR assay allowing for concomitant detection of the methicillin resistance (mecA gene) (also serving as an internal control) to facilitate detection and classification of all currently described SCCmec types and subtypes I, II, III, IVa, b, c, d, and V. Our assay demonstrated 100% sensitivity and specificity in accurately characterizing 54 MRSA strains belonging to the various known SCCmec types and subtypes, when compared with previously described typing methods. Further application of our assay in 453 randomly selected local clinical isolates confirmed its feasibility and practicality. This novel assay offers a rapid, simple, and feasible method for SCCmec typing of MRSA, and may serve as a useful tool for clinicians and epidemiologists in their efforts to prevent and control infections caused by this organism. PMID:16207957

  10. A TaqMan-Based Multiplex qPCR Assay and DNA Extraction Method for Phylotype IIB Sequevars 1&2 (Select Agent Strains of Ralstonia solanacearum.

    Directory of Open Access Journals (Sweden)

    Michael J Stulberg

    Full Text Available Ralstonia solanacearum race 3 biovar 2 strains belonging to phylotype IIB, sequevars 1 and 2 (IIB-1&2 cause brown rot of potato in temperate climates, and are quarantined pathogens in Canada and Europe. Since these strains are not established in the U.S. and because of their potential risk to the potato industry, the U.S. government has listed them as select agents. Cultivated geraniums are also a host and have the potential to spread the pathogen through trade, and its extracts strongly inhibits DNA-based detection methods. We designed four primer and probe sets for an improved qPCR method that targets stable regions of DNA. RsSA1 and RsSA2 recognize IIB-1&2 strains, RsII recognizes the current phylotype II (the newly proposed R. solanacearum species strains (and a non-plant associated R. mannitolilytica, and Cox1 recognizes eight plant species including major hosts of R. solanacearum such as potato, tomato and cultivated geranium as an internal plant control. We multiplexed the RsSA2 with the RsII and Cox1 sets to provide two layers of detection of a positive IIB-1&2 sample, and to validate plant extracts and qPCR reactions. The TaqMan-based uniplex and multiplex qPCR assays correctly identified 34 IIB-1&2 and 52 phylotype II strains out of 90 R. solanacearum species complex strains. Additionally, the multiplex qPCR assay was validated successfully using 169 artificially inoculated symptomatic and asymptomatic plant samples from multiple plant hosts including geranium. Furthermore, we developed an extraction buffer that allowed for a quick and easy DNA extraction from infected plants including geranium for detection of R. solanacearum by qPCR. Our multiplex qPCR assay, especially when coupled with the quick extraction buffer method, allows for quick, easy and reliable detection and differentiation of the IIB-1&2 strains of R. solanacearum.

  11. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC.

    Directory of Open Access Journals (Sweden)

    Zachary F Phillips

    Full Text Available We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification-an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC, is a single-shot variant of Differential Phase Contrast (DPC, which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps for various in vitro cell samples and c. elegans in a micro-fluidic channel.

  12. Toward photostable multiplex analyte detection on a single mode planar optical waveguide

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini [Los Alamos National Laboratory; Xei, Hongshi [Los Alamos National Laboratory; Anderson, Aaron S [Los Alamos National Laboratory; Grace, Wynne K [Los Alamos National Laboratory; Martinez, Jennifer S [NON LANL; Swanson, Basil [Los Alamos National Laboratory

    2009-01-01

    We have developed a waveguide-based optical biosensor for the sensitive and specific detection of biomarkers associated with disease. Our technology combines the superior optical properties of single-mode planar waveguides, the robust nature of functionalized self-assembled monolayer sensing films and the specificity of fluorescence sandwich immunoassays to detect biomarkers in complex biological samples such as serum, urine and sputum. We have previously reported the adaptation of our technology to the detection of biomarkers associated with breast cancer and anthrax. However, these approaches primarily used phospholipid bilayers as the functional film and organic dyes (ex: AlexaFluors) as the fluorescence reporter. Organic dyes are easily photodegraded and are not amenable to multiplexing because of their narrow Stokes' shift. Here we have developed strategies for conjugation of the detector antibodies with quantum dots for use in a multiplex detection platform. We have previously evaluated dihydroxylipoic acid quantum dots for the detection of a breast cancer biomarker. In this manuscript, we investigate the detection of the Bacillus anthracis protective antigen using antibodies conjugated with polymer-coated quantum dots. Kinetics of binding on the waveguide-based biosensor is reported. We compare the sensitivity of quantum dot labeled antibodies to those labeled with AlexaFluor and demonstrate the photostability of the former in our assay platform. In addition, we compare sulfydryl labeling of the antibody in the hinge region to that of nonspecific amine labeling. This is but the first step in developing a multiplex assay for such biomarkers on our waveguide platform.

  13. Molecular identification of Pseudoplatystoma sp. fish fillets by Multiplex PCR / Identificação molecular de filés de peixe Pseudoplatystoma sp. por PCR-Multiplex

    Directory of Open Access Journals (Sweden)

    Cátia Maria de Oliveira Lobo

    2014-08-01

    Full Text Available Nuclear and mitochondrial genes were used as molecular markers for verifying the iden-tity of fish fillets marketed as pintado (Pseudoplatystoma corruscans. Based on THE polymorphisms of nuclear DNA (RAG2, globin, and EF1 genes and mitochondrial regions (16S, we examined whether the fillets originated from inbred species of pintado or from hybrids derived from crosses between cachara (P. reticulatum and pintado. Nuclear genes from both species were detected in the analyzed fillets (n = 29. This clearly iden-tified these fish as interspecific hybrids (or F1/first filial generation of the type “cacha-pinta,” resulting from a cross between female cachara and male pintado. These results demonstrate that monitoring fish fillet trading is crucial for detecting discrepancies between the marketed species and related information declared on the label. Species that are frequently hybridized, such as pintado and cachara, require special attention. -------------------------------------------------------------------- Marcadores moleculares (PCR-Multiplex de genes nucleares e mitocondriais foram uti-lizados para verificar a identidade molecular de filés de peixe comercializados como pintado (Pseudoplatystoma corruscans com base em polimorfismos de regiões do DNA nuclear (genes RAG2, globina e EF1 e mitocondriais (16S para verificar se os filés per-tenciam a espécie pura de pintado ou se eram híbridos derivados do cruzamento entre cachara (Pseudoplatystoma reticulatum e pintado (Pseudoplatystoma corruscans. Os filés analisados (n = 29 apresentaram genes nucleares de ambas espécies P. corruscans e P. reticulatum, e desta forma, foram identificados como híbridos interespecíficos ou F1 (primeira geração filial do tipo “cachapinta” resultante do cruzamento entre uma fêmea de cachara e um macho de pintado. Estes resultados mostram que o monitora-mento da comercialização de filés de peixe é fundamental para identificar situações onde

  14. Multiplex PCR for species-level identification of Bacillus anthracis and detection of pXO1, pXO2, and related plasmids.

    Science.gov (United States)

    Riojas, Marco A; Kiss, Katalin; McKee, Marian L; Hazbón, Manzour Hernando

    2015-01-01

    The Bacillus anthracis virulence plasmids pXO1 and pXO2 have critical implications for biosafety and select agent status. The proper identification and characterization of B. anthracis and its plasmid profile is important to the biodefense research community. Multiplex PCR was used to simultaneously detect a B. anthracis-specific chromosomal mutation, 4 targets distributed across pXO1, 3 targets distributed across pXO2, and highly conserved regions of the 16S gene, allowing an internal positive control for each sample. The multiplex PCR can produce as many as 9 easily separable and distinguishable amplicons, ranging in size from 188 to 555 bp. The PCR results were used to characterize DNA samples extracted from B. anthracis, other Bacillus species, and other bacterial species from many different genera. With the exception of 2 novel putative plasmids discovered, testing against inclusion and extensive exclusion panels showed 100% correlation to previously published and expected results. Upon testing 29 previously unpublished B. anthracis strains, 10 (34.5%) were pXO1(+)/pXO2(+), 9 (31.0%) were pXO1(+)/pXO2(-), 7 (24.1%) were pXO1(-)/pXO2(+), and 3 (10.3%) were pXO1(-)/pXO2(-). The present work presents a novel 9-target multiplex PCR assay capable of species-level identification of B. anthracis via a unique chromosomal marker and the detection of pXO1 and pXO2 via multiply redundant targets on each.

  15. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  16. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

    Directory of Open Access Journals (Sweden)

    Thonur Leenadevi

    2012-03-01

    Full Text Available Abstract Background Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR to detect the viruses commonly implicated in BRD. Results A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV, bovine herpes virus type 1 (BoHV-1 and bovine parainfluenza virus type 3 (BPI3 i & ii nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI and/or indirect fluorescent antibody test (IFAT. Conclusions The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA, minor groove binding (MGB and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  17. Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

    Science.gov (United States)

    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

    2013-08-01

    Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

  18. Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay.

    Science.gov (United States)

    Lan, Pingxiu; Li, Fan; Abad, Jorge; Pu, Lingling; Li, Ruhui

    2018-02-01

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China. showed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Copyright © 2017. Published by Elsevier B.V.

  19. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  20. Investigation of Clinical Relevance of Bacterial Colonization in Patients With Suspected Viral Respiratory Tract Infection By Using Multiplex PCR Method

    Directory of Open Access Journals (Sweden)

    Vedat Turhan

    2013-02-01

    Full Text Available Numerous viral and bacterial pathogens have been reported causing acute respiratory tract infection (ARTI. Nasopharyngeal swab (NPS specimens from 351 patients (278 children, 73 adults with suspected upper and lower ARTI were submitted during the study period from Jan. 2005 to Dec. 2006. Organism-specific nucleic acids were detected using TemPlex technology (ResPlex I and II, Genaco Biomedical Products, Huntsville, AL. Amplified products were identified using a suspension array for multiplex detection performed on a Luminex 100 instrument (Luminex, Austin, TX. A total of 221 viral and bacterial respiratory agents were detected in 148 patients (135 [48.5%] of the 278 children and 13 [17.8%] of the 73 adults with suspected ARTI. A single respiratory pathogen was detected in 89 patients [25.35%], whereas mixed infection with two or three pathogens was found in 59 [16.8%] of 351 suspected patients. S. pneumonia was the most frequently isolated strain (54 [15.3%] of 351 patients, followed by H. influenzae (37 [10.5%], rhinoviruses (35 [9.9%], influenza A virus (23 [6.5%], enteroviruses (19 [5.4%], hMPV (14 [3.9%], PIV-1 (12 [3.4%], PIV-3 (11 [3.1%], RSV (10 [2.8%], and influenza B virus (6 [1.7%]. Mixed infections were more frequent in children (56 [20.1%] of 278 than adult patients (3 [4.1%] of 73 patients. The detection rate of the bacteria peaked in the spring season (37 [40.6%] of 91 bacteria, followed by winter (24 infections, autumn (18 infections and summer (12 infections. The prevalence of co-infection is ~40%, finding a much higher incidence of co-infection with more than one agent than that reported previously. [Dis Mol Med 2013; 1(1.000: 2-7

  1. Identification of the capsule type of Pasteurella multocida isolates from cases of fowl cholera by multiplex PCR and comparison with phenotypic methods

    Directory of Open Access Journals (Sweden)

    TQ Furian

    2014-06-01

    Full Text Available The ability of Pasteurella multocida to invade and multiply in its host is enhanced by the presence of the capsule, one of the most important virulence factors for this bacterium. Capsular typing methods are often used in epidemiological and pathogenesis studies of this agent. Five different serogroups have been identified based on serological typing. However, such tests are laborious, and agglutination of homologous antiserum may fail. The aim of this study was to develop a multiplex PCR protocol for the identification of the hyaD-hyaC and dcbF genes specific to serogroups A and D, respectively, and to compare these results with those of phenotypic tests for 54 strains isolated from fowl cholera cases in southern Brazil. The kappa coefficient and chisquare statistics were calculated to assess the agreement between the diagnostic methods and to determine the significance of the results, respectively. The multiplex PCR was able to detect the evaluated genes. Forty-nine strains (90.74% were classified into serogroup A, and only two isolates (3.7% were not identified as belonging to any of the serogroups analyzed. In contrast, with the phenotypic tests, only 41 strains (75.93% were classified into serogroup A and 11 samples (20.37% were unidentifiable. Of the strains analyzed, 70.37% were classified into the same serogroup (A by both methods, and the kappa coefficient (k = 0.017 indicated poor agreement between the tests. Thus, multiplex PCR is an alternative for P. multocida capsular typing, as it allows the simultaneous and rapid detection of genes and also provides a greater strain-typing capacity.

  2. [Molecular biological sepsis diagnostic using multiplex PCR in surgical intensive care as suitable alternative to conventional microbial culture - a representative overview].

    Science.gov (United States)

    Lodes, U; Lippert, H; Meyer, F

    2011-04-01

    Sepsis causes a substantial rate of morbidity and mortality in intensive care patients, which is, in particular, triggered by an inadequate antimicrobial treatment from the beginning. Conventional microbiological standard procedures cannot provide valuable information on bacterial or fungal species of sepsis-relevant microbes within the first hours of a developing sepsis. However, multiplex PCR (PCR-M) focussing on the spectrum of the most relevant sepsis-associated microbes can considerably shorten the time period; the analytical tests have been standardised and, subsequently, inaugurated into clinical practice; they also have thus been available since 2005. Interestingly, in the surgical field an appropriate summary and concluding recommendation have been lacking so far. AIM, MATERIAL AND METHODS: A compact short overview based on a characteristic selection of relevant references from the literature is given on the commercially available sepsis-associated multiplex-PCR methods, reflecting critically the time point of inauguration, clinical value and future perspectives including our own experiences from clinical practice and medical studies. Multiplex PCR in adult sepsis patients yielded in a range from 13.7 to 39.9 % of positive findings, whereas conventional blood cultures only range from 8 to 29.9 %. From 8 to 16.9 % of all investigations performed prompted us to a change of the antimicrobial treatment by using a positive PCR-M finding. A prospective study (end-point, reduction of sepsis-associated mortality) has not yet been initiated. Positive PCR-M findings correlate with an increased morbidity and mortality as well as clinical and laboratory sepsis parameters. Recent studies have aimed for a comparison of PCR-M on sepsis-associated microbes with regard to specificity and sensitivity with the current "gold standard", conventional blood culture. A few studies wrongly claimed to compare the methods because of the difference in the procedures; in addition

  3. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods.

    Science.gov (United States)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke; Palsbøll, Per J

    2012-09-06

    Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent critique for being too error-prone and yielding unreliable results. This critique coincides with an increasing awareness of the potentials and limitations of the qPCR technique in general and the proposal of a general set of guidelines (MIQE) for standardization of experimental, analytical, and reporting steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. Performance differed substantially among assays and only one assay was found useful for telomere length estimation in humpback whales. The most notable factors causing these inter-assay differences were primer design and choice of using singleplex or multiplex assays. Inferred amplification efficiencies differed by up to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control. Moreover, we show that the qPCR method for telomere length estimation can be highly precise and accurate, and thus suitable for telomere measurement in non-model species, if effort is devoted to optimization at all experimental and analytical steps. We conclude by highlighting a set of quality controls which may serve for further standardization of the qPCR method for telomere length estimation, and discuss some of the factors that may cause variation in qPCR experiments.

  4. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    Directory of Open Access Journals (Sweden)

    Olsen Morten

    2012-09-01

    Full Text Available Abstract Background Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent critique for being too error-prone and yielding unreliable results. This critique coincides with an increasing awareness of the potentials and limitations of the qPCR technique in general and the proposal of a general set of guidelines (MIQE for standardization of experimental, analytical, and reporting steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. Results Performance differed substantially among assays and only one assay was found useful for telomere length estimation in humpback whales. The most notable factors causing these inter-assay differences were primer design and choice of using singleplex or multiplex assays. Inferred amplification efficiencies differed by up to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. Conclusion Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control. Moreover, we show that the qPCR method for telomere length estimation can be highly precise and accurate, and thus suitable for telomere measurement in non-model species, if effort is devoted to optimization at all experimental and analytical steps. We conclude by highlighting a set of quality controls which may serve for further standardization of the qPCR method for telomere length estimation, and discuss some of the factors that may cause

  5. Comparison of multiplex real-time PCR and PCR-reverse blot hybridization assay for the direct and rapid detection of bacteria and antibiotic resistance determinants in positive culture bottles.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Seoyong; Kim, Jungho; Park, Soon Deok; Kim, Hyo Youl; Uh, Young; Lee, Hyeyoung

    2016-09-01

    The aim of this study was to evaluate the performance of a commercially available multiplex real-time PCR assay and a PCR-reverse blot hybridization assay (PCR-REBA) for the rapid detection of bacteria and identification of antibiotic resistance genes directly from blood culture bottles and to compare the results of these molecular assays with conventional culture methods. The molecular diagnostic methods were used to evaluate 593 blood culture bottles from patients with bloodstream infections. The detection positivity of multiplex real-time PCR assay for Gram-positive bacteria, Gram-negative bacteria and Candida spp. was equivalent to PCR-REBA as 99.6 %, 99.1 % and 100 %, respectively. Using conventional bacterial cultures as the gold standard, the sensitivity, specificity, positive predictive value and negative predictive value of these two molecular methods were 99.5 % [95 % confidence interval (CI), 0.980-1.000; PPCR assay targeting the mecA gene to detect methicillin resistance was lower than that of the PCR-REBA method, detecting an overall positivity of 98.4 % (n=182; 95 % CI, 0.964-1.000; P<0.009) and 99.5 % (n=184; 95 % CI, 0.985-1.000; P<0.0001), respectively. The entire two methods take about 3 h, while results from culture can take up to 48-72 h. Therefore, the use of these two molecular methods was rapid and reliable for the characterization of causative pathogens in bloodstream infections.

  6. Rapid genetic typing of diarrheagenic Escherichia coli using a two-tube modified molecular beacon based multiplex real-time PCR assay and its clinical application.

    Science.gov (United States)

    Chen, Qingliang; Shi, Xiaolu; Li, Yinghui; Jiang, Yixiang; Lin, Yiman; Qiu, Yaqun; Li, Qingge; Hu, Qinghua

    2014-07-15

    Diarrheagenic Escherichia coli (DEC), including Enterotoxigenic E.coli (ETEC), Enteroaggregative E.coli (EAEC), Enteropathogenic E.coli (EPEC), Enterohemolysin E.coli (EHEC) and Enteroinvasive E.coli (EIEC) causes diarrhea or hemolytic uremic syndromes among infants and travelers around the world. A rapid, reliable and repeatable method is urgent for identifying DEC so as to provide the reference for responding to diarrheal disease outbreak and the treatment of the diarrheal patients associated with DEC. In this study, specific primers and modified molecular beacon probes of nine specific virulence genes, whose 5'end were added with homo tail sequence, were designed; and a two-tube modified molecular beacon based multiplex real-time PCR (rtPCR) assay for the identification of five Escherichia coli pathotypes, including ETEC, EAEC, EPEC, EHEC and EIEC was developed and optimized. Totally 102 bacterial strains, including 52 reference bacterial strains and 50 clinical strains were detected to confirm whether the target genes selected were specific. Then detection limits of the assay were tested. Lastly, the assay was applied to the detection of 11860 clinical samples to evaluate the specificity and sensitivity of the developed assay compared with the conventional PCR. The target genes were 100% specific as assessed on 102 bacterial strains since no cross-reactions were observed. The detection limits ranged from 88 CFU/mL (EHEC) to 880 CFU/mL (EPEC). Compared with the conventional PCR, the specificity and sensitivity of the multiplex rtPCR was 100% and over 99%, respectively. The coefficient of variation (CV) for each target gene ranged from 0.45% to 1.53%. 171 positive clinical samples were mostly identified as ETEC (n = 111, 64.9%) and EPEC (n = 38, 22.2%), which were the dominating pathotypes of DEC strains. The developed multiplex rtPCR assay for the identification of DEC was high sensitive and specific and could be applied to the rapid identification of

  7. Evaluation of Curetis Unyvero, a multiplex PCR-based testing system, for rapid detection of bacteria and antibiotic resistance and impact of the assay on management of severe nosocomial pneumonia.

    Science.gov (United States)

    Jamal, Wafaa; Al Roomi, Ebtehal; AbdulAziz, Lubna R; Rotimi, Vincent O

    2014-07-01

    Health care-associated pneumonia due to multidrug-resistant organisms represents a major therapeutic challenge. Unfortunately, treatment is dependent on empirical therapy, which often leads to improper and inadequate antimicrobial therapy. A rapid multiplex PCR-based Unyvero pneumonia application (UPA) assay that assists in timely decision-making has recently become available. In this study, we evaluated the performance of UPA in detecting etiological pathogens and resistance markers in patients with nosocomial pneumonia (NP). The impact of this assay on the management of severe nosocomial pneumonia was also assessed. Appropriate specimens were processed by UPA according to the manufacturer's protocol in parallel with conventional culture methods. Of the 56 patients recruited into the study, 49 (87.5%) were evaluable. Of these, 27 (55.1%) and 4 (8.2%) harbored multiple bacteria by the PCR assay and conventional culture, respectively. A single pathogen was detected in 8 (16.3%) and 4 (8.2%) patients, respectively. Thirteen different genes were detected from 38 patients, including the ermB gene (40.8%), the blaOXA-51-like gene (28.6%), the sul1 (28.6%) and int1 (20.4%) integrase genes, and the mecA and blaCTX-M genes (12.3% each). The time from sample testing to results was 4 h versus 48 to 96 h by UPA and culture, respectively. Initial empirical treatment was changed within 5 to 6 h in 33 (67.3%) patients based on the availability of UPA results. Thirty (62.2%) of the patients improved clinically. A total of 3 (6.1%) patients died, mainly from their comorbidities. These data demonstrate the potential of a multiplex PCR-based assay for accurate and timely detection of etiological agents of NP, multidrug-resistant (MDR) organisms, and resistance markers, which can guide clinicians in making early antibiotic adjustments. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe.

    Directory of Open Access Journals (Sweden)

    Ke Feng

    Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

  9. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  10. Development of a rapid multiplex PCR assay to genotype Pasteurella multocida strains by use of the lipopolysaccharide outer core biosynthesis locus.

    Science.gov (United States)

    Harper, Marina; John, Marietta; Turni, Conny; Edmunds, Mark; St Michael, Frank; Adler, Ben; Blackall, P J; Cox, Andrew D; Boyce, John D

    2015-02-01

    Pasteurella multocida is a Gram-negative bacterial pathogen that is the causative agent of a wide range of diseases in many animal species, including humans. A widely used method for differentiation of P. multocida strains involves the Heddleston serotyping scheme. This scheme was developed in the early 1970s and classifies P. multocida strains into 16 somatic or lipopolysaccharide (LPS) serovars using an agar gel diffusion precipitin test. However, this gel diffusion assay is problematic, with difficulties reported in accuracy, reproducibility, and the sourcing of quality serovar-specific antisera. Using our knowledge of the genetics of LPS biosynthesis in P. multocida, we have developed a multiplex PCR (mPCR) that is able to differentiate strains based on the genetic organization of the LPS outer core biosynthesis loci. The accuracy of the LPS-mPCR was compared with classical Heddleston serotyping using LPS compositional data as the "gold standard." The LPS-mPCR correctly typed 57 of 58 isolates; Heddleston serotyping was able to correctly and unambiguously type only 20 of the 58 isolates. We conclude that our LPS-mPCR is a highly accurate LPS genotyping method that should replace the Heddleston serotyping scheme for the classification of P. multocida strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacteria and Viruses in Pepper and Tomato Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.

  12. Identification of an isogenic semidwarf rice cultivar carrying the Green Revolution sd1 gene by multiplex codominant ASP-PCR and SSR markers.

    Science.gov (United States)

    Naito, Yoshiki; Tomita, Motonori

    2013-08-01

    The rice cultivar Hikarishinseiki, a semidwarf isogenotype of Koshihikari carrying the Green Revolution sd1 gene, is increasingly grown in both Japan and the United States. Here, we report DNA diagnosis for Hikarishinseiki targeting its Jukkoku-type sd1 locus, which codes for a defective gibberellin 20-oxidase, with a 1 bp substitution in exon 1 (Jukkoku-type GA20ox-2 mutant allele: Jukkoku_GA20ox-2). An allele-specific primer (ASP)-polymerase chain reaction (PCR) with primers SD1F3 and SD1JR gave a PCR product specific to Jukkoku_GA20ox-2. In addition, ASP-PCR with primers SD1F3 and SD1NRM (which contains a mismatch at the third nucleotide from the 3'-terminus of SD1NR) gave a PCR product specific to non-Jukkoku_GA20ox-2. Multiplex ASP-PCR using SD1F3, VIC dye-labeled SD1JR, and FAM dye-labeled SD1NRM enabled simultaneous codominant detection of Jukkoku_GA20ox-2 and non-Jukkoku_GA20ox-2 among 188 cultivars. Also, Hikarishinseiki is identifiable by RM253 polymorphism from 11 cultivars carrying Jukkoku_GA20ox-2. Taken together, our results establish a methodology for distinguishing Hikarishinseiki.

  13. Multiplex single nucleotide polymorphism (SNP) assay for detection of soybean mosaic virus resistance genes in soybean.

    Science.gov (United States)

    Shi, Ainong; Chen, Pengyin; Vierling, Richard; Zheng, Cuming; Li, Dexiao; Dong, Dekun; Shakiba, Ehsan; Cervantez, Innan

    2011-02-01

    Soybean mosaic virus (SMV) is one of the most destructive viral diseases in soybean (Glycine max). Three independent loci for SMV resistance have been identified in soybean germplasm. The use of genetic resistance is the most effective method of controlling this disease. Marker assisted selection (MAS) has become very important and useful in the effort of selecting genes for SMV resistance. Single nucleotide polymorphism (SNP), because of its abundance and high-throughput potential, is a powerful tool in genome mapping, association studies, diversity analysis, and tagging of important genes in plant genomics. In this study, a 10 SNPs plus one insert/deletion (InDel) multiplex assay was developed for SMV resistance: two SNPs were developed from the candidate gene 3gG2 at Rsv1 locus, two SNPs selected from the clone N11PF linked to Rsv1, one 'BARC' SNP screened from soybean chromosome 13 [linkage group (LG) F] near Rsv1, two 'BARC' SNPs from probe A519 linked to Rsv3, one 'BARC' SNP from chromosome 14 (LG B2) near Rsv3, and two 'BARC' SNPs from chromosome 2 (LG D1b) near Rsv4, plus one InDel marker from expressed sequence tag (EST) AW307114 linked to Rsv4. This 11 SNP/InDel multiplex assay showed polymorphism among 47 diverse soybean germplasm, indicating this assay can be used to investigate the mode of inheritance in a SMV resistant soybean line carrying Rsv1, Rsv3, and/or Rsv4 through a segregating population with phenotypic data, and to select a specific gene or pyramid two or three genes for SMV resistance through MAS in soybean breeding program. The presence of two SMV resistance genes (Rsv1 and Rsv3) in J05 soybean was confirmed by the SNP assay.

  14. Ultra-sensitive Single Fluorescence-labeled Probe-mediated SUP-M-ddPCR for High-throughput GMO Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-04-13

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous genes (35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD) and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1 % and 0.01 %, respectively, with a relative standard deviation (RSD) <25 %. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  15. Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

    Science.gov (United States)

    Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

    2017-08-01

    We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  16. An Investigation of Toxic Shock Syndrome Toxin-1 Gene in Methicillin-Resistant Clinical Strains of Staphylococcus aureus using Multiplex PCR Method

    Directory of Open Access Journals (Sweden)

    mohammad bokaiean

    2017-03-01

    Full Text Available Background and Objectives: Toxins produced by the bacteria are one of the most common cases, which can, together with other bacterial pathogens, cause or aggravate the disease. One of the diseases caused by bacterial toxins, is toxic shock syndrome. The tst gene encodes this toxin that can be easily transferred between different strains of Staphylococcus aureus. In this study, toxic shock syndrome toxin-1 gene was investigated in methicillin-resistant clinical strains of Staphylococcus aureus using multiplex PCR method. Methods: This study is a cross-sectional study, during a 9 month period, 470 samples were collected from patients hospitalized in different wards of treatment centers of Zahedan University of Medical Sciences in 2015. Phenotypic method was used for isolation and initial screening. Oxacillin and Cefoxitin discs were used. After isolation of resistant strains, femA and mecA genes and tst gene were investigated using phenotypic method and multiplex PCR method, respectively. Results: Of 170 clinical isolates of Staphylococcus aureus, 93 isolates were phenotypically methicillin-resistant, among which 89 isolates had mecA gene and 14 isolates had tst gene. Conclusion: The results indicated that the prevalence of methicillin-resistant strains and the strains carrying causative gene for TSST1, is high in Zahedan. Also, circulation of these isolates can lead to much more severe effects in individuals with weak immune system.

  17. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order...... 45 to 80 bp. The density of the primer on the surface was found to be important for the S/N ratio of the SP-PCR, and the optimal S/N was obtained with a density of 1.49 × 1011 molecules/mm2. In addition, the use of solid support primers with a short overhang at the 5' end would help improve the S....../N ratio of the SP-PCR. With optimized conditions, SP-PCR can achieve amplification efficiency comparable to conventional PCR, with a limit of detection of 1.5 copies/μl (37.5 copies/reaction). These improvements will pave the way for wider applications of SP-PCR in various fields such as clinical...

  18. Dual-priming oligonucleotide-based multiplex PCR using tissue samples from the rapid urease test kit for the detection of Helicobacter pylori in bleeding peptic ulcers.

    Science.gov (United States)

    Chung, Woo Chul; Jeon, Eun Jung; Oh, Jung Hwan; Park, Jae Myung; Kim, Tae Ho; Cheung, Dae Young; Kim, Byung Wook; Kim, Sung Soo; Kim, Jin Il

    2016-08-01

    In patients with peptic ulcer bleeding (PUB), diagnostic tests for Helicobacter pylori (H. pylori) infection have low sensitivity. The aim of our study was to investigate the diagnostic yield of dual-priming oligonucleotide-based multiplex (DPO)-PCR using tissue samples from the rapid urease test (RUT, CLO(®)test) kit in patients with PUB. We prospectively enrolled patients with PUB. During second-look endoscopy, gastric biopsy specimens for histology and RUT were obtained from a total of 170 patients. DPO-PCR tests were performed on tissue samples obtained from the CLO(®)test kit. If testing for H. pylori was negative, endoscopy with re-biopsy was performed 8 weeks after the bleeding episode. H. pylori-associated bleeding was confirmed in 64.1% (109/170) of the patients. At the bleeding episode, the diagnostic sensitivities of RUT, histology, and DPO-PCR test were 47.7% (52/109), 71.6% (78/109) and 97.2% (106/109), respectively (p<0.01). The specificity of the DPO-PCR test was 91.8% (56/61). The positive predictive value (PPV) of the DPO-PCR test was 95.5% (106/111), and its negative predictive value (NPV) was 94.9% (56/59). In patients with PUB, the DPO-PCR test could be a useful diagnostic tool for H. pylori infection. Particularly given a negative RUT result, subsequent DPO-PCR testing of tissue samples from the CLO(®)test kit could be of considerable benefit. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  19. Development of a multiplex PCR assay for detection of Shiga toxin-producing Escherichia coli, enterohemorrhagic E. coli, and ent