WorldWideScience

Sample records for single leaf rust

  1. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  2. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  3. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  4. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  5. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  6. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  7. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  8. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  9. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  10. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  11. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  12. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  13. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  14. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  15. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  16. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  17. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  18. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  19. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  20. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

    2007-01-01

    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  1. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  2. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  4. Genetic differentiation of the wheat leaf rust fungus Puccinia triticina in Pakistan and genetic relationship to other worldwide populations

    Science.gov (United States)

    Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...

  5. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  6. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  7. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  8. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  9. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  10. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  12. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  13. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  14. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  15. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  16. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  17. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  18. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  19. First report of leaf rust of blueberry caused by Thekopsora minima in Mexico

    Science.gov (United States)

    Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. As the area under blueberry cultivation increases, new diseases causing severe losses are appearing. Leaf rust is one of the most destructive diseases of blueberry in Mexico. Sori on t...

  20. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  1. Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants

    Science.gov (United States)

    Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe

    2005-10-01

    In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.

  2. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

  3. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  4. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

  5. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  6. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  7. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    OpenAIRE

    B. M. R. Melo; F. B. S. Botelho; J. S. M. Silva; D. F. F. Lima; E. R. Moreira

    2018-01-01

    The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Ru...

  8. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  9. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  10. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  11. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  12. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  13. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  14. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  15. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  17. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  18. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  19. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  20. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  1. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  2. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    Directory of Open Access Journals (Sweden)

    B. M. R. Melo

    2018-04-01

    Full Text Available The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Rubi. A sample for a rust and a coffee leaf miner, in addition to the middle and upper third of the plants, totaling 42 plants in the study area. At the same sampling point, perform soil analysis to correlate nutrients as studied variables. The Pearson correlation of the biotic variables was performed with a precipitation and fertility, a rate of 1 and 5% probability. It was verified that the rust cycle alternated its incidence for the same period in different years and the miner showed behavior coincident to the driest periods of the year. Data not available on precipitation data and number of mines. These diseases had no significant correlation with the fertility parameter. The coffee leaf miner yielded higher rates of occurrence in June and December of 2014. It was concluded that the percentage of coffee leaf miner was higher in the months with lower rainfall indices or no longer summer period; What is it you want to know about the one-time development that may have been influenced by the nearby woods under study and the rust alternated the peaks of occurrence for the two autumners, correlating with a precipitation.

  3. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  4. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens.

    Science.gov (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng

    2015-07-01

    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  5. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Science.gov (United States)

    2011-01-01

    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  6. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  7. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  8. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)

    M. SERENIUS

    2008-12-01

    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  9. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  10. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  11. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  12. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  13. Modelling coffee leaf rust risk in Colombia with climate reanalysis data.

    Science.gov (United States)

    Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J

    2016-12-05

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.

  14. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  15. Protection of wheat against leaf and stem rust and powdery mildew diseases by inhibition of polyamine metabolism

    Science.gov (United States)

    Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.

    1987-01-01

    In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.

  16. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis.

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix . It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23-18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.

  17. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  18. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  19. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  20. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  1. The estimation of rust disease of daylily leaf images with GLCM based different classification methods

    OpenAIRE

    ÖZERDEM, Mehmet Siraç; ACAR, Emrullah

    2011-01-01

    Crop diseases can affect yield and/or quality of the harvested commodity. This can influence profitability and raise the risks of farming. When the diseases are estimated early, the yield will increase by taking measures thanks to farmers. The rust disease is one of the most major crop diseases that affect crop yield. Rust disease can be defined as a fungus; it makes the crops weak by blocking food to the roots and leaves. It is named “rust” disease, since the spots on the leaves look like gr...

  2. Smallholder Food and Water Security in the Face of Climatic Stress and the Coffee Leaf Rust: Lessons from Nicaragua

    Science.gov (United States)

    Stewart, I. T.; Bacon, C. M.; Sundstrom, W.

    2015-12-01

    Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.

  3. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  4. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  5. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  6. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  7. Identification of isoforms of microRNAs in wheat (Triticum aestivum L. and their role in leaf rust pathogenesis

    Directory of Open Access Journals (Sweden)

    Summi Dutta

    2017-10-01

    Full Text Available Bread wheat, a type of grass under genus Triticum and species aestivum covers the largest land area when production of cereal crops is considered. Being an allohexaploid (2n=6x=42; AABBDD, its genome is contributed by three progenitors and is evolutionarily rich. Rust in leaves, caused by Puccinia triticina, severely affects grain quality. MicroRNAs are considered as major components of gene silencing and so have deep role to play during stress. Post transcriptional modification of miRNAs which generates isomiRNAs significantly affects target specificity especially when the modification occurs in 5′end. A total of four small RNA libraries were prepared through next-generation Illumina sequencing techniques from leaves of two wheat Near Isogenic Lines (NILs, HD2329 (susceptible and HD2329 + LR24 (resistant. Prior to this, one set of the two NILs was mock inoculated and considered as control (with sRNA library code named SM-mi and RM-mi while other was treated with urediniospores of leaf rust fungus (with sRNA library code named SPI-mi and RPI-mi. Clean reads in all four libraries were previously used for prediction of 559 novel miRNAs and in the current study it was used to detect isoforms of these miRNAs. A total of 237 isoforms were detected for 41 miRNAs. These isoforms included both 5′ and 3′ modifications of miRNAs. There were 27 miRNAs with 5′ modifications and five miRNAs with 3′ modifications while nine miRNAs showed both types of modifications.

  8. Temporal Gene Expression Profiling of the Wheat Leaf Rust Pathosystem Using cDNA Microarray Reveals Differences in Compatible and Incompatible Defence Pathways

    OpenAIRE

    Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie

    2007-01-01

    In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...

  9. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust.

    Science.gov (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja

    2018-02-01

    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  10. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  11. QTL mapping provides evidence for lack of association of the avoidance of leaf rust in Hordeum chilense with stomata density

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.

    2003-01-01

    In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of

  12. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  13. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  15. Impact of Regionally Distinct Agroecosystem Communities on the Potential for Autonomous Control of the Coffee Leaf Rust.

    Science.gov (United States)

    Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John

    2016-12-01

    Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  17. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  18. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

  19. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  20. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  1. Overview of the functional virulent genome of the coffee leaf rust pathogen Hemileia vastatrix with an emphasis on early stages of infection

    Directory of Open Access Journals (Sweden)

    Pedro eTalhinhas

    2014-03-01

    Full Text Available Hemileia vastatrix is the causal agent of coffee leaf rust, the most important disease of coffee (Coffea arabica. In this work, a 454-pyrosequencing transcriptome analysis of H. vastatrix germinating urediniospores (gU and appressoria (Ap was performed and compared to previously published in planta haustoria-rich (H data. A total of 9234 transcripts were identified and annotated. Ca. 50% of these transcripts showed no significant homology to international databases. Only 784 sequences were shared by the three conditions, and 75% were exclusive of either gU (2146, Ap (1479 or H (3270. Relative transcript abundance and RT-qPCR analyses for a selection of genes indicated a particularly active metabolism, translational activity and production of new structures in the appressoria and intense signalling, transport, secretory activity and cellular multiplication in the germinating urediniospores, suggesting the onset of a plant-fungus dialogue as early as at the germ tube stage. Gene expression related to the production of carbohydrate-active enzymes and accumulation of glycerol in germinating urediniospores and appressoria suggests that combined lytic and physical mechanisms are involved in appressoria-mediated penetration. Besides contributing to the characterisation of molecular processes leading to appressoria-mediated infection by rust fungi, these results point towards the identification of new H. vastatrix candidate virulence factors, with 516 genes predicted to encode secreted proteins.

  2. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  3. Flutuação populacional do bicho-mineiro em cultivares de café arábica resistentes à ferrugem Fluctuation of leaf miner population in resistant arabica coffee cultivars to leaf rust

    Directory of Open Access Journals (Sweden)

    Celso Henrique Costa Conceição

    2005-01-01

    Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi

  4. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  5. Seismic retrofit system for single leaf masonry buildings in Groningen

    NARCIS (Netherlands)

    Türkmen, Ö.S.; Vermeltfoort, A.T.; Martens, D.R.W.

    2016-01-01

    Due to recent seismic activity in the Netherlands, the demand of adequate strengthening and retrofitting techniques increased, especially for single leaf masonry. Two Dutch companies founded in the re-gion have initiated an experimental program to study the applicability of existing stand-alone

  6. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  7. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  8. Bioprospecting endophytic bacteria for biological control of coffee leaf rust Bioprospecção de bactérias endofíticas como agentes de biocontrole da ferrugem do cafeeiro

    Directory of Open Access Journals (Sweden)

    Humberto Franco Shiomi

    2006-02-01

    Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea

  9. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

    2001-01-01

    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  10. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  11. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  12. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  13. Aegilops tauschii Accessions with Geographically Diverse Origin Show Differences in Chromosome Organization and Polymorphism of Molecular Markers Linked to Leaf Rust and Powdery Mildew Resistance Genes.

    Science.gov (United States)

    Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina

    2017-01-01

    Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae

  14. Genetic variability among the brown rust resistant and susceptible genotypes of sugarcane by RAPD technique

    Science.gov (United States)

    Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...

  15. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  16. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  17. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  18. Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region

    OpenAIRE

    AY, Hasan

    2013-01-01

    This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...

  19. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  20. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  1. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  2. Morphology and AFLP markers suggest three Hordeum chilense ecotypes that differ in avoidance to rust fungi

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.

    2001-01-01

    In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the

  3. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  4. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    Science.gov (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  5. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  6. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  7. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  8. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea.

    Science.gov (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan

    2016-12-01

    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  9. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  10. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  11. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  12. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  13. Natural selection maintains a single-locus leaf shape cline in Ivyleaf morning glory, Ipomoea hederacea.

    Science.gov (United States)

    Campitelli, Brandon E; Stinchcombe, John R

    2013-02-01

    Clines in phenotypic traits with an underlying genetic basis potentially implicate natural selection. However, neutral evolutionary processes such as random colonization, spatially restricted gene flow, and genetic drift could also result in similar spatial patterns, especially for single-locus traits because of their susceptibility to stochastic events. One way to distinguish between adaptive and neutral mechanisms is to compare the focal trait to neutral genetic loci to determine whether neutral loci demonstrate clinal variation (consistent with a neutral cline), or not. Ivyleaf morning glory, Ipomoea hederacea, exhibits a latitudinal cline for a Mendelian leaf shape polymorphism in eastern North America, such that lobed genotypes dominate northern populations and heart-shaped genotypes are restricted to southern populations. Here, we evaluate potential evolutionary mechanisms for this cline by first determining the allele frequencies at the leaf shape locus for 77 populations distributed throughout I. hederacea's range and then comparing the geographical pattern at this locus to neutral amplified fragment length polymorphism (AFLP) loci. We detected both significant clinal variation and high genetic differentiation at the leaf shape locus across all populations. In contrast, 99% of the putatively neutral loci do not display clinal variation, and I. hederacea populations show very little overall genetic differentiation, suggesting that there is a moderate level of gene flow. In addition, the leaf shape locus was identified as a major F(ST) outlier experiencing divergent selection, relative to all the AFLP loci. Together, these data strongly suggest that the cline in leaf shape is being maintained by spatially varying natural selection. © 2012 Blackwell Publishing Ltd.

  14. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  15. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  16. Commandra Blister Rust

    Science.gov (United States)

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  17. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  18. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    ://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...

  19. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  20. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  1. Genetic and environmental variation in rust frequency on mature mountain birch trees

    Energy Technology Data Exchange (ETDEWEB)

    Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)

    2000-07-01

    This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.

  2. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  3. Prescreening slash pine and Cronartium pedigrees for evaluation of complementary gene action in fusiform rust disease.

    Science.gov (United States)

    H.E. Stelzer; Robert L. Doudrick; Thomas L. Kubisiak; C. Dana Nelson

    1999-01-01

    Single-urediniospore cultures of the fusiform rust fungus were used to inoculate seedlings from 10 full-sib families of a five-parent slash pine diallel at two different times in 1994. The presence or absence of fusiform rust galls was recorded for each inoculated seedling at 9 months postinoculation, and percent infection levels for each family-inoculum-time...

  4. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  5. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  6. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  7. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. The measurement of the transmission loss of single leaf walls and panels by an impulse method

    Science.gov (United States)

    Balilah, Y. A.; Gibbs, B. M.

    1988-06-01

    The standard methods of measurement and rating of sound insulation of panels and walls are generally time-consuming and require expensive and often bulky equipment. In addition, the methods establish only that there has been failure to comply with insulation requirements without indicating the mode of failure. An impulse technique is proposed for the measurement of walls and partitions in situ. The method requires the digital capture of a short duration signal generated by a loudspeaker, and the isolation of the direct component from other reflected and scattered components by time-of-flight methods and windowing. The signal, when transferred from the time to frequency domain by means of fast Fourier transforms, can yield the sound insulation of a partition expressed as a transfer function. Experimental problems in the use of this technique, including those resulting from sphericity of the incident wave front and concentric bending excitation of the partition, are identified and methods proposed for their elimination. Most of the results presented are of single leaf panels subjected to sound at normal incidence, although some measurements were undertaken at oblique incidence. The range of surface densities considered was 7-500 kg/m 2, the highest value corresponding to a brick and plaster wall of thickness 285 mm. Measurement is compared with theoretical prediction, at one-third octave intervals in a frequency range of 100-5000 Hz, or as a continuous function of frequency with a typical resolution of 12·5 Hz. The dynamic range of the measurement equipment sets an upper limit to the measurable transmission loss. For the equipment eventually employed this was represented by a random incidence value of 50 dB.

  9. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao

    2008-01-01

    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  10. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.

    Science.gov (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A

    2017-07-01

    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  11. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  12. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.

    Science.gov (United States)

    Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G

    2016-01-01

    Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.

  13. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  14. Comparison of Single and Multi-Scale Method for Leaf and Wood Points Classification from Terrestrial Laser Scanning Data

    Science.gov (United States)

    Wei, Hongqiang; Zhou, Guiyun; Zhou, Junjie

    2018-04-01

    The classification of leaf and wood points is an essential preprocessing step for extracting inventory measurements and canopy characterization of trees from the terrestrial laser scanning (TLS) data. The geometry-based approach is one of the widely used classification method. In the geometry-based method, it is common practice to extract salient features at one single scale before the features are used for classification. It remains unclear how different scale(s) used affect the classification accuracy and efficiency. To assess the scale effect on the classification accuracy and efficiency, we extracted the single-scale and multi-scale salient features from the point clouds of two oak trees of different sizes and conducted the classification on leaf and wood. Our experimental results show that the balanced accuracy of the multi-scale method is higher than the average balanced accuracy of the single-scale method by about 10 % for both trees. The average speed-up ratio of single scale classifiers over multi-scale classifier for each tree is higher than 30.

  15. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  16. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  17. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  18. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  19. Rusted Designs: The New Apron

    OpenAIRE

    Swindells, Steve; Burcikova, Mila

    2013-01-01

    Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...

  20. Fusiform Rust of Southern Pines

    Science.gov (United States)

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  1. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.

    2008-01-01

    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  2. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  3. Protective single/combined treatment with betel leaf and turmeric against methyl (acetoxymethyl) nitrosamine-induced hamster oral carcinogenesis.

    Science.gov (United States)

    Azuine, M A; Bhide, S V

    1992-05-28

    The inhibitory effect of oral administration of betel-leaf extract (BLE) and 2 of its constituents, beta-carotene and alpha-tocopherol, as single agents or in combination with dietary turmeric on methyl(acetoxymethyl)nitrosamine (DMN-OAC)-induced oral carcinogenesis in Syrian hamsters was studied. DMN-OAC was administered twice monthly for 6 months. The chemopreventive effect of BLE or its constituents with turmeric was determined by comparing tumor incidence observed in treated groups with that seen in control animals. The apparent site-specific chemopreventive effect of BLE or its constituents was demonstrated by inhibition of tumor incidence, reduction of tumor burden, extension of the tumor latency period and regression of established, frank tumors. The inhibitory effect of BLE or its constituents combined with turmeric was higher than that of the individual constituents. The study suggests that BLE could be developed as a potential chemopreventive agent for human oral cancer.

  4. ‘Inverted Y’ field radiotherapy planning with multi-leaf collimator: A single isocentric technique using multiple fields

    Directory of Open Access Journals (Sweden)

    Puja Sahai

    2015-01-01

    Full Text Available The purpose of our study is to describe a planning technique using multi-leaf collimator and asymmetric fields for irradiating an ‘inverted Y’ shaped geometry in a patient with testicular seminoma. The entire target area covering the para-aortic, pelvic, and inguinal nodal regions was split into three fields. Single isocenter half-beam block technique was employed. The fields were planned with antero-posterior and postero-anterior portals with a differential weightage. The dose was prescribed at the respective reference points of the fields. A uniform dose distribution for the entire portal was achieved without any under- or over-dosing at the field junctions.  

  5. Multiple genotypes within aecial clusters in Puccinia graminis and Puccinia coronata: improved understanding of the biology of cereal rust fungi.

    Science.gov (United States)

    Berlin, Anna; Samils, Berit; Andersson, Björn

    2017-01-01

    Cereal rust fungi ( Puccinia spp.) are among the most economically important plant pathogens. These fungi have a complex life cycle, including five spore stages and two hosts. They infect one grass host on which they reproduce clonally and cause the cereal rust diseases, while the alternate host is required for sexual reproduction. Although previous studies clearly demonstrate the importance of the alternate host in creating genetic diversity in cereal rust fungi, little is known about the amount of novel genotypes created in each successful completion of a sexual reproduction event. In this study, single sequence repeat markers were used to study the genotypic diversity within aecial clusters by genotyping individual aecial cups. Two common cereal rusts, Puccinia graminis causing stem rust and Puccinia coronata the causal agent of crown rust were investigated. We showed that under natural conditions, a single aecial cluster usually include several genotypes, either because a single pycnial cluster is fertilized by several different pycniospores, or because aecia within the cluster are derived from more than one fertilized adjoining pycnial cluster, or a combination of both. Our results imply that although sexual events in cereal rust fungi in most regions of the world are relatively rare, the events that occur may still significantly contribute to the genetic variation within the pathogen populations.

  6. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  7. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  8. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  9. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  10. Derivation of host and pathogen genotypes in the fusiform rust pathosystem on slash pine using a complimentary genetics model and diallel data

    Science.gov (United States)

    H.E. Stelzel; Robert L. Doudrick; Thomas L. Kubisiak

    1997-01-01

    Seedlings from 20, full-sib families five-parent slash pine diallel were inoculated using two, single urediniospore-derived cultures of the fusiform rust fungus on two different dates during the 1994 growing season. Presence or absence of fusiform rust galls was recorded for each inoculated seedling at nine months post-inoculation and percent infection levels for each...

  11. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Science.gov (United States)

    Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio

    2016-01-01

    Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  12. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Emanuela Ventrella

    Full Text Available Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  13. The forced sound transmission of finite single leaf walls using a variational technique.

    Science.gov (United States)

    Brunskog, Jonas

    2012-09-01

    The single wall is the simplest element of concern in building acoustics, but there still remain some open questions regarding the sound insulation of this simple case. The two main reasons for this are the effects on the excitation and sound radiation of the wall when it has a finite size, and the fact that the wave field in the wall is consisting of two types of waves, namely forced waves due to the exciting acoustic field, and free bending waves due to reflections in the boundary. The aim of the present paper is to derive simple analytical formulas for the forced part of the airborne sound insulation of a single homogeneous wall of finite size, using a variational technique based on the integral-differential equation of the fluid loaded wall. The so derived formulas are valid in the entire audible frequency range. The results are compared with full numerical calculations, measurements and alternative theory, with reasonable agreement.

  14. The forced sound transmission of finite single leaf walls using a variational technique

    DEFF Research Database (Denmark)

    Brunskog, Jonas

    2012-01-01

    The single wall is the simplest element of concern in building acoustics, but there still remain some open questions regarding the sound insulation of this simple case. The two main reasons for this are the effects on the excitation and sound radiation of the wall when it has a finite size......, and the fact that the wave field in the wall is consisting of two types of waves, namely forced waves due to the exciting acoustic field, and free bending waves due to reflections in the boundary. The aim of the present paper is to derive simple analytical formulas for the forced part of the airborne sound...... insulation of a single homogeneous wall of finite size, using a variational technique based on the integral-differential equation of the fluid loaded wall. The so derived formulas are valid in the entire audible frequency range. The results are compared with full numerical calculations, measurements...

  15. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  16. Historic Rust College: Fulfilling a Mission.

    Science.gov (United States)

    Hoffman, Carl

    1989-01-01

    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  17. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  18. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures.

    Science.gov (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel

    2015-11-01

    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  19. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  20. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.

    2005-01-01

    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  1. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  2. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    Science.gov (United States)

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  3. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Generation means and variance analyses were performed for the estimation of ... population falls into clearly defined and easily recogni- zable categories by ... additive x dominance and dominance x dominance gene effects.

  4. Single-leaf partial meniscectomy in extensive horizontal tears of the discoid lateral meniscus: Does decreased peripheral meniscal thickness affect outcomes? (Mean four-year follow-up).

    Science.gov (United States)

    Lee, Se-Won; Chun, Yong-Min; Choi, Chong-Hyuk; Kim, Sung-Jae; Jung, Min; Han, Joon-Woo; Kim, Sung-Hwan

    2016-06-01

    To evaluate whether single-leaf partial meniscectomy in horizontal tears along the entire discoid lateral meniscus has any advantages in clinical and radiological results compared with other meniscectomies in discoid lateral meniscus. A total of 145 patients with a horizontal tear pattern in symptomatic lateral discoid meniscus were retrospectively reviewed. Twenty-seven patients had undergone full-extent single-leaf partial meniscectomy (group A), 60 had undergone conventional partial meniscectomy (saucerization) maintaining peripheral meniscal height (group B), and 58 patients had undergone total meniscectomy (group C). Each patient was evaluated with the Lysholm knee score, International Knee Documentation Committee (IKDC) subjective grading, and modified Kellgren-Lawrence grade in plain radiography at their last follow-up. Group C had inferior functional results to groups A and B on the Lysholm knee score and IKDC subjective score. There was no significant difference between groups A and B. Group C fared significantly worse than groups A and B (p=0.003, pmeniscus tears, the full-extent single-leaf partial meniscectomy group had no adverse results compared with the total meniscectomy group and was not significantly different compared to the conventional partial meniscectomy group. Cohort study. Level III, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  6. Risk assessment with current deployment strategies for fusiform rust-resistant loblolly and slash pines

    Science.gov (United States)

    Floyd Bridgwater; Tom Kubisiak; Tom Byram; Steve Mckeand

    2004-01-01

    In the southeastern USA, fusiform rust resistant loblolly and slash pines may be deployed as 1) ulked seed orchard mixes. 2) half-sibling (sib) family mixtures. 3) single half-sib families. 4) full-sib cross seeds or as 6) clones of individual genotypes. These deployment types are respectively greater genetic gains from higher selection intensity. Currently, bulked...

  7. SU-E-T-428: Dosimetric Impact of Multileaf Collimator Leaf Width On Single and multiple Isocenter Stereotactic IMRT Treatment Plans for multiple Brain Tumors

    International Nuclear Information System (INIS)

    Giem, J; Algan, O; Ahmad, S; Ali, I; Young, J; Hossain, S

    2014-01-01

    Purpose: To assess the impacts that multileaf collimator (MLC) leaf width has on the dose conformity and normal brain tissue doses of single and multiple isocenter stereotactic IMRT (SRT) plans for multiple intracranial tumors. Methods: Fourteen patients with 2–3 targets were studied retrospectively. Patients treated with multiple isocenter treatment plans using 9 to 12 non-coplanar beams per lesion underwent repeat planning using single isocenter and 10 to 12 non-coplanar beams with 2.5mm, 3mm and 5mm MLC leaf widths. Brainlab iPlan treatment planning system for delivery with the 2.5mm MLC served as reference. Identical contour sets and dose-volume constraints were applied. The prescribed dose to each target was 25 Gy to be delivered over 5 fractions with a minimum of 99% dose to cover ≥ 95% of the target volume. Results: The lesions and normal brains ranged in size from 0.11 to 51.67cc (median, 2.75cc) and 1090 to 1641cc (median, 1401cc), respectively. The Paddick conformity index for single and multiple isocenter (2.5mm vs. 3mm and 5mm MLCs) was (0.79±0.08 vs. 0.79±0.07 and 0.77±0.08) and (0.79±0.09 vs. 0.77±0.09 and 0.76±0.08), respectively. The average normal brain volumes receiving 15 Gy for single and multiple isocenter (2.5mm vs. 3mm and 5mm MLCs) were (3.65% vs. 3.95% and 4.09%) and (2.89% vs. 2.91% and 2.92%), respectively. Conclusion: The average dose conformity observed for the different leaf width for single and multiple isocenter plans were similar, throughout. However, the average normal brain volumes receiving 2.5 to 15 Gy were consistently lower for the 2.5mm MLC leaf width, especially for single isocenter plans. The clinical consequences of these integral normal brain tissue doses are still unknown, but employing the use of the 2.5mm MLC option is desirable at sparing normal brain tissue for both single and multiple isocenter cases

  8. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  9. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  10. Frequency of comandra blister rust infection episodes on lodgepole pine

    Science.gov (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor

    2002-01-01

    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  11. Inheritance of resistance to orange rust in sugarcane

    Science.gov (United States)

    Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...

  12. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  13. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  14. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  15. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  16. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  17. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.

    Science.gov (United States)

    Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J

    2017-10-05

    Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.

  18. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  19. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  20. Application of quantitative variables in the sampling method to evaluate the sugarcane rust brown

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2017-01-01

    Full Text Available To develop a system that increase the precision in the resistance evaluations to sugarcane brown rust disease through the use of the quantitative sampling, six cultivars of differential behavior versus the disease (PR980, My5514, Ja60-5, C334-64, C323-68 and B4362 were studied. A random block experimental design with three replications was used in a heavy infections conditions obtained from the cultivar highly susceptible B4362. The evaluations were done at three and five months of age, in the three-thirds: bottom, half and top of the +1, +3 and +5 sugarcane plant leaves of 10 plants for replica. The variable total leaf area affected of the leaf and in each third was analyzed. In 2 cm2 were observed the long and wide of the biggest and more frequent pustule, the total of pustule and the area of the biggest and more frequent pustule, and the area percentage occupied by the most frequent pustule by each cm2 were determined. Variance analysis and Tukey tests as well as confidence intervals analysis to determine the coefficient to use as constant of the pustule width, due to the little variation of this parameter were realized. The +3 leaf represented the half infection of the incidence of the brown rust, constituting for it the most appropriate to carry out the observations and the half third. An equation was also obtained to calculate the area occupied by pustules with a high level of confidence.

  1. An overview of sugarcane brown rust in Cuba

    Directory of Open Access Journals (Sweden)

    María La O

    Full Text Available ABSTRACT: Multiple pathogens affect sugarcane, among them Puccinia melanocephala, the causal agent of brown rust. This disease was first reported in Cuba in 1979 when it was responsible for a severe attack on the main sugarcane variety B4362. The aims of the present study were to give an overview of sugarcane brown rust in Cuba and show the current disease situation in the country. A retrospective analysis regard to sugarcane cultivar composition resistant to brown rust in Cuba was carried out. In addition 154 genotypes, including the most used progenitors in the breeding program and commercial varieties were evaluated under natural infection conditions. The identity of P. melanocephala was verified by Polymerase Chain Reaction (PCR and by sequencing the ITS1 region. After the introduction of P. melanocephala into Cuba, the susceptible variety, B4362, was replaced by Ja60-5 which remained resistant until 1998. Since 2002, a varietal policy supported by a governmental resolution establishing that any single cultivar cannot occupy more than 20 % of the production area for each production company, local area and province, has been applied. Out of the genotypes evaluated, 49 showed resistance to the disease and 35 intermediate behavior, while 39 were susceptible and 31, highly susceptible. P. melanocephala was detected by PCR in all symptomatic samples and its identify confirmed by sequencing the ITS1 region. The adopted measurement together with permanent phytosanitary monitoring and commercial release of resistant or intermediate cultivars succeeded in avoiding any new epidemic. Inoculum pressure was reduced, even on susceptible and highly susceptible varieties since, by resolution, they cannot occupy more than 10 % of the planted area.

  2. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...

  3. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...

  4. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...

  5. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.

    2016-01-01

    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  6. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.).

    Science.gov (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H

    2015-06-01

    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  7. Major transcriptome reprogramming underlies floral mimicry induced by the rust fungus Puccinia monoica in Boechera stricta.

    Directory of Open Access Journals (Sweden)

    Liliana M Cano

    Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.

  8. FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME

    Directory of Open Access Journals (Sweden)

    RAFAEL MENEZES SILVA DE FREITAS

    2016-01-01

    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  9. Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust

    Directory of Open Access Journals (Sweden)

    M. Jiriaie

    2017-01-01

    -levels (non-inoculated seeds and inoculated seed and wheat cultivars in three levels, Chamran (bread wheat, Dena and Behrang (durum wheat varieties. In this experiment evaluated, to yellow rust disease, the intensity of infection, the average coefficient of infection, type of infection and area under disease progress curve (AUDPC. Infection type and disease severity were also recorded at flag leaf stage using modified Cobb’s scale. First symptoms of yellow rust were observed in middle January of 2013. Analysis of variance was performed using PROC ANOVA of SAS (version 9.1.3, 2004The comparison of the means was done by Duncan test at a probability level of 5 percent. Results and Discussion: Survey on the resistance to yellow rust in wheat cultivars treated with Mycorrhiza and Azospirillum showed that seed inoculation with Azospirillum traits reduced between 10 percent to 13 percent and the use strains of Mycorrhiza fungi intensity of infection 45-51 percent, the average coefficient of infection and AUDPC 74-85 percent respectively for G. intraradices and G. mosseae strains have been reduced compared with control and Chamran cultivar between 40-70 percent showed more Sensitivity to disease from durum varieties. Generally, the lowest of infection intensity (18.33 was obtained from inoculation of C.V Dena seeds with Azospirillum and G. mosseae strain. According to the result, we found yellow rust in all experiment field also the incidence varied between 10-70 percent. Therefore, it is concluded that, given the climatic conditions favorable to the spread of yellow rust, the incidence of yellow rust in the region that have a high degree of pathogenicity. In general the results of this test, mycorrhiza application has a significant role in enhancing wheat resistance to yellow rust. The seed inoculation with Azospirillum although did not have significant role in disease control, but increased at an acceptable level resistance to wheat rust. But the important point was the combined

  10. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.

    1989-01-01

    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  11. Progresso temporal da ferrugem e redução sobre a área foliar e os componentes do rendimento de grãos em soja Temporal progress of rust and reduced leaf area and yield components in soybean grain

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-04-01

    em experimento de campo com 64 parcelas (2.7 x 5 m da cultivar Glycine max L. (Nidera 5909 RG, estabelecida em 05/12/09. Para gerar gradientes de doença utilizaram-se dois fungicidas (tebuconazol e epoxiconazol + piraclostrobina, em uma, duas ou três aplicações em estádios fonológicos diferentes. A doença foi quantificada por número de lesões e urédias, posteriormente convertido para severidade (%. Quantificou-se também o índice de área foliar ao final do enchimento de grãos e os componentes do rendimento após a colheita. A severidade média final da ferrugem superou 50%. As diferenças em severidade entre os estratos da planta foram influenciadas pela quantidade inicial de doença, uma vez que as taxas de progresso, determinadas pelos modelos logístico e de Gompertz, foram semelhantes entre os estratos (0.13 a 0.14 para o logístico e 0.10 a 0.11 para Gompertz. O índice de área foliar (IAF foi de apenas 1.96 nas plantas não tratadas, contra 4.40 no tratamento com quatro aplicações de epoxiconazol + piraclostrobina. Programas de controle iniciados em estádio fonológico V9, com duas ou três aplicações, diferiram da testemunha em IAF. O número de legumes e grãos por planta, assim como grãos por legume não variaram entre os tratamentos. Só houve diferença no peso de grãos do estrato superior, quando os fungicidas foram aplicados duas ou três vezes a partir de estádio fonológico V9.The harvest of the year 2009-10 of soybean crop in Southern Brazil occurred under higher intensity of soybean rust (Phakopsora pachyrhizi Sydow y Sydow, which allowed studies on disease progress and crop reduction. A field experiment with 64 plots (2.7 x 5 m of the cultivar Glycine max L. (Nidera 5909 RG sown on 5/Dec/2009 was used for the evaluations. Disease gradients were obtained by spraying the fungicides tebuconazol or epoxiconazol + pyraclostrobin once, twice or three times, at different plant growth stages. Disease progress was assessed as number of

  12. Ultrastructure of the Rust Fungus Puccinia miscanthi in the Teliospore Stage Interacting with the Biofuel Plant Miscanthus sinensis

    Directory of Open Access Journals (Sweden)

    Ki Woo Kim

    2015-09-01

    Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.

  13. The relationship between powdery mildew (Sphaerotheca fuliginea) resistance and leaf chlorosis sensitivity in cucumber (Cucumis sativus) studied in single seed descent lines

    NARCIS (Netherlands)

    Zijlstra, S.; Jansen, R.C.; Groot, S.P.C.

    1995-01-01

    The genetic relation between powdery mildew resistance and sensitivity for leaf chlorosis of glasshouse cucumber was investigated. The powdery mildew resistant, leaf chlorosis sensitive hybrid variety 'Profito' was crossed with the powdery mildew susceptible, non chlorosis sensitive hybrid variety

  14. Effect of Puccinia silphii on Yield Components and Leaf Physiology in Silphium integrifolium: Lessons for the Domestication of a Perennial Oilseed Crop

    Directory of Open Access Journals (Sweden)

    M. Kathryn Turner

    2018-03-01

    Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.

  15. Effect of solar radiation on severity of soybean rust.

    Science.gov (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J

    2012-08-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  16. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  17. Waste management regroups units into Rust International

    International Nuclear Information System (INIS)

    Kirschner, E.

    1992-01-01

    Three Waste Management (Oak Brook, IL) subsidiaries have proposed merging units from Chemical Waste Management (CWM) and Wheelabrator Technologies with the Brand Companies (Park Ridge, IL). Waste Management says the new company, to be called Rust International, will become one of the US's largest environmental consulting and infrastructure organizations and will include design and construction services. Waste Management expects the merged company's 1993 revenues to reach $1.8 billion. It will be based in Birmingham, AL and have 12,000 employees

  18. Tolerance of Loblolly Pines to Fusiform Rust

    Science.gov (United States)

    Charles H. Walkinshaw; James P. Barnett

    1995-01-01

    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  19. Single pot synthesized gold nanoparticles using Hippophae rhamnoides leaf and berry extract showed shape-dependent differential nanobiotechnological applications.

    Science.gov (United States)

    Sharma, Bhavana; Deswal, Renu

    2018-04-04

    A facile one-pot green synthesis of gold nanoparticles (AuNPs) with different geometries was achieved using an underutilized Himalayan bioresource Hippophae rhamnoides. Aqueous leaf (LE) and berry extracts (BE) showed rapid synthesis of monodispersed spherical LEAuNPs (27 ± 3.2 nm) and anisotropic BEAuNPs (55 ± 4.5 nm) within 2 and 15 min, respectively. The Fourier-transform infrared (FTIR) spectroscopy showed involvement of polyphenolics/flavonoids in AuNPs reduction. LE AuNPs (IC 50 49 µg) exhibited higher antioxidant potential than BE AuNPs (IC 50 57 µg). Both BE nanotriangles and LE nanospheres exhibited cytotoxicity against Jurkat cell lines. These nanocatalysts also exhibited effective (80-99%) reductive degradation of structurally different carcinogenic azo dyes. Kinetic studies revealed that BE nanotriangles exhibited higher catalytic efficiency (14-67%) than LE nanospheres suggesting shape-dependent regulation of biological activities. The gas chromatography-mass spectrometry (GC-MS) analysis confirmed conversion of toxic methyl orange dye to non-toxic intermediates. Probable degradation mechanism involving adsorption and catalytic reduction of azo bonds was proposed. The present synthesis protocol provided a facile and energy saving procedure for rapid synthesis of highly stable nanoparticles with significant antioxidant and anticancer potential. This is the first report of H. rhamnoides-mediated green synthesis of multipurpose AuNPs as antioxidant, anticancer and nanocatalytic agents for treatment of dye contaminated waste water and future therapeutic applications.

  20. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio

    2018-03-01

    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  1. Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust

    International Nuclear Information System (INIS)

    Batta, Y.A.

    2007-01-01

    The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)

  2. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  3. Interacting genes in the pine-fusiform rust forest pathosystem

    Science.gov (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li

    2005-01-01

    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  4. White pines, blister rust, and management in the Southwest

    Science.gov (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler

    2009-01-01

    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  5. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  6. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  7. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  8. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  9. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  10. SU-F-T-629: Effect of Multi-Leaf Collimator (MLC) Width On Plan Quality of Single-Isocenter VMAT Intracranial Stereotactic Radiosurgery for Multiple Metastases

    International Nuclear Information System (INIS)

    Kraus, J; Thomas, E; Wu, X; Fiveash, J; Popple, R

    2016-01-01

    Purpose: Single-isocenter VMAT has been shown able to create high quality plans for complex intracranial multiple metastasis SRS cases. Linacs capable of the technique are typically outfitted with an MLC that consists of a combination of 5 mm and 10 mm leaves (standard) or 2.5 mm and 5 mm leaves (high-definition). In this study, we test the hypothesis that thinner collimator leaves are associated with improved plan quality. Methods: Ten multiple metastasis cases were identified and planned for VMAT SRS using a 10 MV flattening filter free beam. Plans were created for a standard (std) and a high-definition (HD) MLC. Published values for leaf transmission factor and dosimetric leaf gap were utilized. All other parameters were invariant. Conformity (plan and individual target), moderate isodose spill (V50%), and low isodose spill (mean brain dose) were selected for analysis. Results: Compared to standard MLC, HD-MLC improved overall plan conformity (median: Paddick CI-HD = 0.83, Paddick CI-std = 0.79; p = 0.004 and median: RTOG CI-HD =1.18, RTOG CI-std =1.24; p = 0.01 ), improved individual lesion conformity (median: Paddick CI-HD,i =0.77, Paddick CI-std,i =0.72; p < 0.001 and median: RTOG CI-HD,i = 1.28, RTOG CI-std,i =1.35; p < 0.001), improved moderate isodose spill (median: V50%-HD = 37.0 cc, V50%-std = 45.7 cc; p = 0.002), and improved low dose spill (median: dmean-HD = 2.90 Gy, dmean-std = 3.19 Gy; p = 0.002). Conclusion: For the single-isocenter VMAT SRS of multiple metastasis plans examined, use of HD-MLC modestly improved conformity, moderate isodose, and low isodose spill compared to standard MLC. However, in all cases we were able to generate clinically acceptable plans with the standard MLC. More work is need to further quantify the difference in cases with higher numbers of small targets and to better understand any potential clinical significance. This research was supported in part by Varian Medical Systems.

  11. SU-F-T-629: Effect of Multi-Leaf Collimator (MLC) Width On Plan Quality of Single-Isocenter VMAT Intracranial Stereotactic Radiosurgery for Multiple Metastases

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, J; Thomas, E; Wu, X; Fiveash, J; Popple, R [University Alabama Birmingham, Birmingham, AL (United States)

    2016-06-15

    Purpose: Single-isocenter VMAT has been shown able to create high quality plans for complex intracranial multiple metastasis SRS cases. Linacs capable of the technique are typically outfitted with an MLC that consists of a combination of 5 mm and 10 mm leaves (standard) or 2.5 mm and 5 mm leaves (high-definition). In this study, we test the hypothesis that thinner collimator leaves are associated with improved plan quality. Methods: Ten multiple metastasis cases were identified and planned for VMAT SRS using a 10 MV flattening filter free beam. Plans were created for a standard (std) and a high-definition (HD) MLC. Published values for leaf transmission factor and dosimetric leaf gap were utilized. All other parameters were invariant. Conformity (plan and individual target), moderate isodose spill (V50%), and low isodose spill (mean brain dose) were selected for analysis. Results: Compared to standard MLC, HD-MLC improved overall plan conformity (median: Paddick CI-HD = 0.83, Paddick CI-std = 0.79; p = 0.004 and median: RTOG CI-HD =1.18, RTOG CI-std =1.24; p = 0.01 ), improved individual lesion conformity (median: Paddick CI-HD,i =0.77, Paddick CI-std,i =0.72; p < 0.001 and median: RTOG CI-HD,i = 1.28, RTOG CI-std,i =1.35; p < 0.001), improved moderate isodose spill (median: V50%-HD = 37.0 cc, V50%-std = 45.7 cc; p = 0.002), and improved low dose spill (median: dmean-HD = 2.90 Gy, dmean-std = 3.19 Gy; p = 0.002). Conclusion: For the single-isocenter VMAT SRS of multiple metastasis plans examined, use of HD-MLC modestly improved conformity, moderate isodose, and low isodose spill compared to standard MLC. However, in all cases we were able to generate clinically acceptable plans with the standard MLC. More work is need to further quantify the difference in cases with higher numbers of small targets and to better understand any potential clinical significance. This research was supported in part by Varian Medical Systems.

  12. Effects of Nitrogen Addition on Leaf Decomposition of Single-Species and Litter Mixture in Pinus tabulaeformis Forests

    Directory of Open Access Journals (Sweden)

    Jinsong Wang

    2015-12-01

    Full Text Available The litter decomposition process is closely correlated with nutrient cycling and the maintenance of soil fertility in the forest ecosystem. In particular, the intense environmental concern about atmospheric nitrogen (N deposition requires a better understanding of its influence on the litter decomposition process. This study examines the responses of single-species litter and litter mixture decomposition processes to N addition in Chinese pine (Pinus tabulaeformis Carr. ecosystems. Chinese pine litter, Mongolian oak (Quercus mongolica Fisch. ex Ledeb. litter, and a pine–oak mixture were selected from a plantation and a natural forest of Chinese pine. Four N addition treatments, i.e., control (N0: 0 kg N ha−1·year−1, low-N (N1: 5 kg N ha−1·year−1, medium-N (N2: 10 kg N ha−1·year−1, and high-N (N3: 15 kg N ha−1·year−1, were applied starting May 2010. In the plantation, N addition significantly stimulated the decomposition of the Chinese pine litter. In the natural forest, N addition had variable effects on the decomposition of single-species litter and the litter mixture. A stimulatory effect of the high-N treatment on the Chinese pine litter decomposition could be attributed to a decrease in the substrate C:N ratio. However, an opposite effect was found for the Mongolian oak litter decomposition. The stimulating effect of N addition on the Chinese pine litter may offset the suppressive effect on the Mongolian oak litter, resulting in a neutral effect on the litter mixture. These results suggest that the different responses in decomposition of single-species litter and the litter mixture to N addition are mainly attributed to litter chemical composition. Further investigations are required to characterize the effect of long-term high-level N addition on the litter decomposition as N deposition is likely to increase rapidly in the region where this study was conducted.

  13. Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods

    International Nuclear Information System (INIS)

    Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.

    2013-01-01

    Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)

  14. Physical water treatment against calcification and rust

    International Nuclear Information System (INIS)

    Burger, A.

    1995-01-01

    In contrast to Germany, where the installation of small-sized, decentralised plants is still prefered, water supply companies in countries such as Denmark have already for some time successfully been using physical water treatment systems. Although the health and environmental benefits of this non-chemical method of water treatment are undisputed and its proper application is also economically beneficial, there is still a widerspread lack of information as to where such plants can be used. Consequently, older methods are often resorted to combatting calcification and rust. (orig.) [de

  15. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.

    Science.gov (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang

    2018-01-01

    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  16. Relationship between sugarcane rust severity and soil properties in louisiana.

    Science.gov (United States)

    Johnson, Richard M; Grisham, Michael P; Richard, Edward P

    2007-06-01

    ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.

  17. Host jumps shaped the diversity of extant rust fungi (Pucciniales).

    Science.gov (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2016-02-01

    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  19. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  20. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India.

    Science.gov (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu

    2016-06-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  1. Proposal and reclassification of standards for resistance studies of brown rust sugarcane

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2017-10-01

    Full Text Available In Cuba, the methodology used for sugarcane brown rust resistance evaluation has limited patterning, which makes it difficult to adequately handle cultivars in the intermediate categories of reaction, provided that from an agro-productive point of view they are interest. Six known reaction patterns and 11 commercial cultivars were studied. The variables, length, amount and percentage of leaf area occupied by pustules were recorded, as well as the length of the major pustule. The application and interpretation of statistical methods allowed to ratify as highly resistant PR980, resistant Ja64-11 and as susceptible My5514. The cultivars SP70-1284 (moderately resistant, C88-380 (moderately susceptible and C323-68 (susceptible are included as new standards. They are reclassified to C334-64 (moderately susceptible, Ja60-5 and B4362 (highly susceptible.

  2. Orange rust in sugarcane: molecular identification in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Carla Vanessa Borges Castro

    2013-09-01

    Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.

  3. Rust types from JSON samples - Approximating type providers with procedural macros in Rust

    OpenAIRE

    Vesteraas, Erik Andreas

    2017-01-01

    When programmers access external data in a statically typed programming language, they are often faced with a dilemma between convenient and type-safe access to the data. In the programming language F#, a concept called type providers has been proposed as a solution to this problem by having compiler support for libraries with the capability to generate types at compile time. This thesis presents "json_typegen", a project which aims to show the feasibility of similar solutions in the Rust pro...

  4. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  5. Two distinct classes of QTL determine rust resistance in sorghum.

    Science.gov (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David

    2014-12-31

    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  6. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  7. Characterization and comparative analysis of the genome of Puccinia sorghi Schwein, the causal agent of maize common rust.

    Science.gov (United States)

    Rochi, Lucia; Diéguez, María José; Burguener, Germán; Darino, Martín Alejandro; Pergolesi, María Fernanda; Ingala, Lorena Romina; Cuyeu, Alba Romina; Turjanski, Adrián; Kreff, Enrique Domingo; Sacco, Francisco

    2018-03-01

    Rust fungi are one of the most devastating pathogens of crop plants. The biotrophic fungus Puccinia sorghi Schwein (Ps) is responsible for maize common rust, an endemic disease of maize (Zea mays L.) in Argentina that causes significant yield losses in corn production. In spite of this, the Ps genomic sequence was not available. We used Illumina sequencing to rapidly produce the 99.6Mbdraft genome sequence of Ps race RO10H11247, derived from a single-uredinial isolate from infected maize leaves collected in the Argentine Corn Belt Region during 2010. High quality reads were obtained from 200bppaired-end and 5000bpmate-paired libraries and assembled in 15,722 scaffolds. A pipeline which combined an ab initio program with homology-based models and homology to in planta enriched ESTs from four cereal pathogenic fungus (the three sequenced wheat rusts and Ustilago maydis) was used to identify 21,087 putative coding sequences, of which 1599 might be part of the Ps RO10H11247 secretome. Among the 458 highly conserved protein families from the euKaryotic Orthologous Groups (KOG) that occur in a wide range of eukaryotic organisms, 97.5% have at least one member with high homology in the Ps assembly (TBlastN, E-value⩽e-10) covering more than 50% of the length of the KOG protein. Comparative studies with the three sequenced wheat rust fungus, and microsynteny analysis involving Puccinia striiformis f. sp. tritici (Pst, wheat stripe rust fungus), support the quality achieved. The results presented here show the effectiveness of the Illumina strategy for sequencing dikaryotic genomes of non-model organisms and provides reliable DNA sequence information for genomic studies, including pathogenic mechanisms of this maize fungus and molecular marker design. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    International Nuclear Information System (INIS)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.

    2003-01-01

    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  9. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  10. Rust fungi on some poaceous weeds of wheat crops in Pakistan

    OpenAIRE

    NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI

    2013-01-01

    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  11. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula

    OpenAIRE

    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas

    2011-01-01

    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  12. White pine blister rust in northern ldaho and western Montana: alternatives for integrated management

    Science.gov (United States)

    Susan K. Hagle; Geral I. McDonald; Eugene A. Norby

    1989-01-01

    This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...

  13. Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17

    Science.gov (United States)

    Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane

    2001-01-01

    Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...

  14. Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars

    Science.gov (United States)

    Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...

  15. DIVERSITY OF PUCCINIA KUEHNII AND P. MELANOCEPHALA CAUSING RUST DISEASES ON BRAZILIAN SUGARCANE

    Science.gov (United States)

    Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...

  16. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  17. Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).

    Science.gov (United States)

    Hernádez, José R; Aime, M Catherine; Newbry, Brad

    2004-07-01

    A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.

  18. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  19. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    Science.gov (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  20. Breeding wheat mutant Longfu 03D51 with resisting stem rust and genetic analyzation of resisting disease and RAPD maker

    International Nuclear Information System (INIS)

    Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun

    2007-01-01

    Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)

  1. Painting rusted steel: The role of aluminum phosphosilicate

    International Nuclear Information System (INIS)

    Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.

    2013-01-01

    Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer

  2. Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS.

    Science.gov (United States)

    Lopez-Vera, Eric E; Nelson, Sarah; Singh, Ravi P; Basnet, Bhoja R; Haley, Scott D; Bhavani, Sridhar; Huerta-Espino, Julio; Xoconostle-Cazares, Beatriz G; Ruiz-Medrano, Roberto; Rouse, Matthew N; Singh, Sukhwinder

    2014-01-01

    Identified SSR markers ( Xcfd49 and Xbarc183 ) linked with stem rust resistance for efficient use in marker-assisted selection and stacking of resistance genes in wheat breeding programs. More than 80 % of the worldwide wheat (Triticum aestivum L.) area is currently sown with varieties susceptible to the Ug99 race group of stem rust fungus. However, wheat lines Niini, Tinkio, Coni, Pfunye, Blouk, and Ripper have demonstrated Ug99 resistance at the seedling and adult plant stages. We mapped stem rust resistance in populations derived from crosses of a susceptible parent with each of the resistant lines. The segregation of resistance in each population indicated the presence of a single gene. The resistance gene in Niini mapped to short arm of chromosome 6D and was flanked by SSR markers Xcfd49 at distances of 3.9 cM proximal and Xbarc183 8.4 cM distal, respectively. The chromosome location of this resistance was validated in three other populations: PBW343/Coni, PBW343/Tinkio, and Cacuke/Pfunye. Resistance initially postulated to be conferred by the SrTmp gene in Blouk and Ripper was also linked to Xcfd49 and Xbarc183 on 6DS, but it was mapped proximal to Xbarc183 at a similar position to previously mapped genes Sr42 and SrCad. Based on the variation in diagnostic marker alleles, it is possible that Niini and Pfunye may carry different resistance genes/alleles. Further studies are needed to determine the allelic relationships between various genes located on chromosome arm 6DS. Our results provide valuable molecular marker and genetic information for developing Ug99 resistant wheat varieties in diverse germplasm and using these markers to tag the resistance genes in wheat breeding.

  3. Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

    Science.gov (United States)

    Kaurilind, Eve; Brosché, Mikael

    2017-01-01

    Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

  4. Weather and Climate Indicators for Coffee Rust Disease

    Science.gov (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  5. Utilization of the cropgro-soybean model to estimate yield loss caused by Asian rust in cultivars with different cycle

    Directory of Open Access Journals (Sweden)

    Rafael de Ávila Rodrigues

    2012-01-01

    Full Text Available In recent years, crop models have increasingly been used to simulate agricultural features. The DSSAT (Decision Support System for Agrotechnology Transfer is an important tool in modeling growth; however, one of its limitations is related to the unaccounted-for effect of diseases. Therefore, the goals of this study were to calibrate and validate the CSM CROPGRO-Soybean for the soybean cultivars M-SOY 6101 and MG/BR 46 (Conquista, analyze the performance and the effect of Asian soybean rust on these cultivars under the environmental conditions of Viçosa, Minas Gerais, Brazil. The experimental data for the evaluation, testing, and adjustment of the genetic coefficients for the cultivars, M-SOY 6101 and MG/BR 46 (Conquista, were obtained during the 2006/2007, 2007/2008 and 2009/2010 growing seasons. GLUE (Generalized Likelihood Uncertainty Estimation was used for the estimation of the genetic coefficients, and pedotransfer functions have been utilized to estimate the physical characteristics of the soil. For all of the sowing dates, the early season cultivar, M-SOY 6101, exhibited a lower variance in yield, which represents more stability with regard to the interannual climate variability, i.e., the farmers who use this cultivar will have in 50% of the crop years analyzed, a higher yield than a late-season cultivar. The MG/BR 46 (Conquista cultivar demonstrated a greater probability of obtaining higher yield in years with favorable weather conditions. However, in the presence of the Asian soybean rust, yield is heavily affected. The early cultivar, M-SOY 6101, showed a lower risk of being affected by the rust and consequently exhibited less yield loss considering the scenario D90 (condensation on the leaf surface occurs when the relative humidity is greater than or equal to 90%, for a sowing date of November 14.

  6. Grain yield losses in yellow-rusted durum wheat estimated using digital and conventional parameters under field conditions

    Directory of Open Access Journals (Sweden)

    Omar Vergara-Diaz

    2015-06-01

    Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.

  7. Induced mutations for rust resistance in bread wheat

    International Nuclear Information System (INIS)

    Sawhney, R.N.

    1989-01-01

    Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)

  8. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  9. Evaluation of the phenotype variability and early selection to rust of the sugar cane (Puccinia melanocephala H. & P. Syd in plants generated from irradiated callus from the variaty of sugar cane ´SP 70-1284´.

    Directory of Open Access Journals (Sweden)

    Apolonio Valdez Balero

    2004-10-01

    Full Text Available It was evaluated the variability fenotípic in early phases of selection from plants regenerated of the mutagenic treatment with dose of 30 Gy of radiations Gamma (source 60Co applicated to calluses in growth of the donating ´SP 70-1284´ tolerant to the rust disease of the sugarcane Puccinia melanocephala. The main changes the plants obtained in vitro, consinted in the height, the color, habit of growth, length and width of the leaf, as well as in the affectation for the rust disease. 14.28% of the changes all fenotipic was observed in plantín, and in the shoot the plants presented 10.99% of changes all fenotipic. In the vegetative multiplication one (MV1 three possible mutants were selected with smaller affectation in front rust disease of the sugarcan, resistance character to the rust disease efficiency of the tissue culture and the mutations induction with the dose of 30 Gy were of a mutant for each 1 525 plants evaluated in early phase of selection. Key words: variation fenotipic, selection early, mutagenesis

  10. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Ephemeroptera, Plecoptera and Trichoptera (Insecta) Abundance, Diversity and Role in Leaf Litter Breakdown in Tropical Headwater River.

    Science.gov (United States)

    Ab Hamid, Suhaila; Md Rawi, Che Salmah

    2017-07-01

    Leaf litter decomposition in a tropical stream was examined in two types of leaf packs; single species leaf packs of Pometia pinnata and two species leaf packs of equal combination of Pometia pinnata and Dolichandrone spathacea leaves. Both leaf packs were immersed in a river and weekly examined for remains of decomposed leaves and presence of EPT. In the control leaf packs, leaves in the two species leaf packs treatments decomposed within 35 days, faster than in single species leaf packs which decomposed after 42 days. In the presence of EPT, the leaf breakdown took 28 days in two species and 35 days for single species leaf packs. Higher abundance of EPT was observed in single species leaf packs but its diversity was higher in two species leaf packs. Litter breakdown in the stream was faster in the presence of EPT and softer leaves of D. spathacea with higher nitrogen content underwent faster decomposition and sustained higher numbers of EPT.

  12. Why do leaf-tying caterpillars abandon their leaf ties?

    Directory of Open Access Journals (Sweden)

    Michelle Sliwinski

    2013-09-01

    Full Text Available Leaf-tying caterpillars act as ecosystem engineers by building shelters between overlapping leaves, which are inhabited by other arthropods. Leaf-tiers have been observed to leave their ties and create new shelters (and thus additional microhabitats, but the ecological factors affecting shelter fidelity are poorly known. For this study, we explored the effects of resource limitation and occupant density on shelter fidelity and assessed the consequences of shelter abandonment. We first quantified the area of leaf material required for a caterpillar to fully develop for two of the most common leaf-tiers that feed on white oak, Quercus alba. On average, Psilocorsis spp. caterpillars consumed 21.65 ± 0.67 cm2 leaf material to complete development. We also measured the area of natural leaf ties found in a Maryland forest, to determine the distribution of resources available to caterpillars in situ. Of 158 natural leaf ties examined, 47% were too small to sustain an average Psilocorsis spp. caterpillar for the entirety of its development. We also manipulated caterpillar densities within experimental ties on potted trees to determine the effects of cohabitants on the likelihood of a caterpillar to leave its tie. We placed 1, 2, or 4 caterpillars in ties of a standard size and monitored the caterpillars twice daily to track their movement. In ties with more than one occupant, caterpillars showed a significantly greater propensity to leave their tie, and left sooner and at a faster rate than those in ties as single occupants. To understand the consequences of leaf tie abandonment, we observed caterpillars searching a tree for a site to build a shelter in the field. This is a risky behavior, as 17% of the caterpillars observed died while searching for a shelter site. Caterpillars that successfully built a shelter traveled 110 ± 20 cm and took 28 ± 7 min to find a suitable site to build a shelter. In conclusion, leaf-tying caterpillars must frequently

  13. Antibiotic Treatment of Blister Rust Cankers in Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1970-01-01

    Cycloheximide (Acti-dione) and Phytoactin antibiotics, applied as basal stem treatments, aerial spray treatments, and complete foliar drenches were not effective in controlling blister rust cankers in eastern white pine. Cycloheximide was effective in suppressing canker activity and growth if directly applied to scarified cankers.

  14. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  15. Blister rust control in the management of western white pine

    Science.gov (United States)

    Kenneth P. Davis; Virgil D. Moss

    1940-01-01

    The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...

  16. Resistance of three interspecific white pine hybrids to blister rust

    Science.gov (United States)

    R. Z. Callaham

    1962-01-01

    Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...

  17. Characteristics of Blister Rust Cankers on Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1969-01-01

    The growth, development, and sporulation of white pine blister rust cankers were studied on eastern white pine in Wisconsin and Minnesota. Three district canker types were identified on the basis of physical appearance, growth rate, and sporulation. Canker growth rate and sporulation decreased as tree size or age increased, and many cankers apparently became inactive...

  18. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  19. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  20. White pine blister rust resistance research in Minnesota and Wisconsin

    Science.gov (United States)

    Andrew David; Paul Berrang; Carrie Pike

    2012-01-01

    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  1. White pines, Ribes, and blister rust: integration and action

    Science.gov (United States)

    R. S. Hunt; B. W. Geils; K. E. Hummer

    2010-01-01

    The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...

  2. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  3. White pines, Ribes, and blister rust: a review and synthesis

    Science.gov (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt

    2010-01-01

    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  4. White pine blister rust in the interior Mountain West

    Science.gov (United States)

    Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle

    2010-01-01

    White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...

  5. Screening of fungicides for the management of wattle rust ...

    African Journals Online (AJOL)

    % of the revenue from the species obtained from the timber and 15% from the bark. From 2012/13 a wattle rust disease has spread throughout the black wattle plantation area in KwaZulu-Natal and from 2015 it was recorded in southern ...

  6. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)

    Science.gov (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas

    2012-01-01

    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  7. Taxonomy, phylogeny, and coevolution of pines and their stem rusts

    Science.gov (United States)

    C. I. Millar; B. B. Kinloch

    1991-01-01

    We review and reinterpret major events in the evolution of pines and their stem rusts using information from their taxonomy, genetics, biogeography, and fossil history. Understanding of pine evolution has been significantly revised in the last 20 years. Pines appear to have evolved early in the Mesozoic and to have diversified and migrated throughout middle latitudes...

  8. HOW TO Identify White Pine Blister Rust and Remove Cankers

    Science.gov (United States)

    Thomas H. Nicholls; Robert L. Anderson

    1977-01-01

    White pine blister rust (caused by the fungus Cronartium ribicola J. C. Fisch. ex Rabenh.) was introduced into the United States about 1900 and has since spread throughout the range of white pine. The disease intensity varies throughout the range but is normally most severe where late summers (July-September) are cool (below 67? F) and damp, conditions necessary for...

  9. Molecular Characterization of wheat stem rust races in Kenya

    Science.gov (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  10. Rust and Thinning Management Effect on Cup Quality and Plant Performance for Two Cultivars of Coffea arabica L.

    Science.gov (United States)

    Echeverria-Beirute, Fabian; Murray, Seth C; Klein, Patricia; Kerth, Chris; Miller, Rhonda; Bertrand, Benoit

    2018-05-30

    Beverage quality is a complex attribute of coffee ( Coffea arabica L.). Genotype (G), environment (E), management (M), postharvest processing, and roasting are all involved. However, little is known about how G × M interactions influence beverage quality. We investigated how yield and coffee leaf rust (CLR) disease (caused by Hemileia vastatrix Berk. et Br.) management affect cup quality and plant performance, in two coffee cultivars. Sensory and chemical analyses revealed that 10 of 70 attributes and 18 of 154 chemical volatile compounds were significantly affected by G and M. Remarkably, acetaminophen was found for the first time in roasted coffee and in higher concentrations under more stressful conditions. A principal component analysis described 87% of the variation in quality and plant overall performance. This study is a first step in understanding the complexity of the physiological, metabolic, and molecular changes in coffee production, which will be useful for the improvement of coffee cultivars.

  11. Contribution to Kinetics of Formation of White Rust on Galvanized Steel

    International Nuclear Information System (INIS)

    Han, D. J.; Pyun, Su Il; Hahn, Y. D.

    1981-01-01

    Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion

  12. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  13. Impact of Moringa oleifera lam. Leaf powder supplementation versus nutritional counseling on the body mass index and immune response of HIV patients on antiretroviral therapy: a single-blind randomized control trial.

    Science.gov (United States)

    Tshingani, Koy; Donnen, Philippe; Mukumbi, Henri; Duez, Pierre; Dramaix-Wilmet, Michèle

    2017-08-22

    To achieve effective antiretroviral therapy (ART) outcomes, adherence to an antiretroviral regimen and a good immunometabolic response are essential. Food insecurity can act as a real barrier to adherence to both of these factors. Many people living with human immunodeficiency virus (PLHIV) treated with ART in the Democratic Republic of the Congo (DRC) are faced with nutritional challenges. A significant proportion are affected by under nutrition, which frequently leads to therapeutic failure. Some HIV care facilities recommend supplementation with Moringa oleifera (M.O.) Lam. leaf powder to combat marginal and major nutritional deficiencies. This study aims to assess the impact of M.O. Lam. leaf powder supplementation compared to nutritional counseling on the nutritional and immune status of PLHIV treated with ART. A single-blind randomized control trial was carried out from May to September 2013 at an outpatient clinic for HIV-infected patients in Kinshasa (DRC). Sixty adult patients who were at stable HIV/AIDS clinical staging 2, 3 or 4 according to the World Health Organization (WHO), and were undergoing ART were recruited. After random allocation, 30 patients in the Moringa intervention group (MG) received the M.O. Lam. leaf powder daily over 6 months, and 30 in the control group (CG) received nutritional counseling over the same period. Changes in the body mass index (BMI) were measured monthly and biological parameters were measured upon admission and at the end of the study for the patients in both groups. The two study groups were similar in terms of long-term nutritional exposure, sociodemographic, socioeconomic, clinical, and biological features. At 6 months follow-up, patients in the MG exhibited a significantly greater increase in BMI and albumin levels than those in the CG. The interaction between the sociodemographic, clinical, and biological characteristics of patients in the two groups was not significant, with the exception of professional

  14. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  15. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L

    2018-03-21

    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  16. Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

    Science.gov (United States)

    Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

    2018-01-01

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

  17. Kinetics of structural rust transformation in environments containing chloride and SO2

    International Nuclear Information System (INIS)

    Rendon, J. L.; Valencia, A.

    2003-01-01

    The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs

  18. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2016-02-01

    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  19. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    Science.gov (United States)

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust

  20. Emergence of virulence to SrTmp in the Ug99 race group of wheat stem rust, Puccinia graminis f. sp. tritici, in Africa

    DEFF Research Database (Denmark)

    Patpour, M.; Hovmøller, M. S.; Justesen, A. F.

    2016-01-01

    of wheat fields in Africa (Kenya, 9; Uganda, 28; Rwanda, 41; and Egypt, 6) were sent to the Global Rust Reference Center (GRRC, Denmark) for race analysis. Puccinia graminis f. sp. tritici (Pgt) samples were recovered on cv. Morocco, and resulting urediniospores of 53 single-pustule isolates were......Tmp) to confirm their virulence/avirulence combinations to Sr24, Sr31, Sr36, and SrTmp. Race TTKTK was also detected at two locations in Uganda (Rubaya and Muko in Kabale region) and at five locations in Rwanda (Kinigi, Rwerere, Rufungo, Gatebe, and Kamenyo). Three isolates derived from stem rust samples...

  1. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene

    OpenAIRE

    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.

    2009-01-01

    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  2. Quantitative variables associated to the resistance to sugarcane brown rust disease

    Directory of Open Access Journals (Sweden)

    Joaquin Montalvan Delgado

    2017-01-01

    Full Text Available With the purpose to analyze the behavior of a group of sugarcane cultivars in the presence of brown rust (Puccinia melanocephala Sydow and P. Sydow in the area of the Territorial Sugarcane Research Station Oriental Center Camagüey, it was carried out an experiment with 11 sugarcane cultivars (C1051-73, C132-81, C266-70, C323-68, C86-12, C86-503, C86- 56, C88-380, C90-530, Co997, SP70-1284 and six patterns of well-known reaction PR980 (I grade, Ja64-11 (II grade, C334-64 (III grade, My5514 y Ja60-5 (IV grade y B4362 (V grade. The evaluations were made at the plant and ratoon shoot at the ages of three, four, five, six and nine months in the leaves +1, +3 y +5. The evaluated parameters were: length and the number of pustules, size of the biggest pustule, and the occupied area by pustules. It was made an analysis of variance and Tukey’s test to find the differences between the cultivars. The statistical packet SPSS such as the main additive and multiplicative interactions (AMMI Models were used. There are differences in every analyzed factors (cultivar, leaf and evaluation moment and in the analyzed variables (TPM and occupied area by pustule. The resistance patterns kept the expected behavior and the biggest cultivars percentage behaved like resistant.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  5. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  6. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea

    OpenAIRE

    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego

    2014-01-01

    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  7. An analysis of the risk of introduction of additional strains of the rust puccinia psidii Winter ('Ohi'a Rust) to Hawai'i

    Science.gov (United States)

    Loope, Lloyd; La Rosa, Anne Marie

    2010-01-01

    In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant

  8. Structure analysis of cation selective Cr-goethite as protective rust of weathering steel

    International Nuclear Information System (INIS)

    Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi

    2005-01-01

    We have performed extended X-ray absorption fine structure (EXAFS) analysis for artificial Cr-goethite to elucidate the local structure around Cr in Cr-goethite. The spectra were obtained using synchrotron radiation X-rays at the Photon Factory in Tsukuba. The first shell contributions were isolated by Fourier filtering EXAFS data, and the inverse Fourier transformed single-shell data were analyzed using a curve fitting method. The results show that Cr is coordinated with (7±1)O 2- ions. The protective characteristics of the Cr-goethite protective rust layer on weathering steel can be interpreted in terms of the O 2- coordination around Cr 3+ resulting in the creation of negative fixed charge in the Cr-goethite particles. (author)

  9. Severity of angular leaf spot and rust diseases on common beans in ...

    African Journals Online (AJOL)

    ACSS

    5.3, respectively. Key words: Common beans, disease management, Phaseolus vulgaris, Pseudocercospora griseola, .... Pearson product- moment ..... SAS Institute. 1989. SAS/STAT User's. Guide (version 6, vol. 1, 4th ed.), Cary: SAS Institute ...

  10. Magnetic property based characterization of rust on weathering steels

    International Nuclear Information System (INIS)

    Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.

    2005-01-01

    The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39

  11. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  12. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  13. Study of a low alloy steel rust using Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Maier, I.A.; Saragovi-Badler, C.; Labenski, F.

    1978-01-01

    Moessbauer spectroscopy has been used to analyze the internal and external rust layers of a weathering steel exposed for ten months to an urban-industrial atmosphere. Superparamagnetic α-FeOOH and γ-FeOOH were found in both layers. The external one also contained small sized delta-FeOOH and/or amorphous iron oxyhydroxide. These compounds were not present in the internal layer at this stage of the patina formation. (author)

  14. Influence of lactate ions on the formation of rust

    International Nuclear Information System (INIS)

    Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.

    2007-01-01

    The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH

  15. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)

  16. Spread, genetic variation and methods for the detection of Puccinia kuehnii, the causal agent of sugarcane orange rust.

    Science.gov (United States)

    Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...

  17. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Science.gov (United States)

    Vaz Patto, Maria Carlota; Rubiales, Diego

    2014-01-01

    Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128

  18. Bulked fusiform rust inocula and Fr gene interactions in loblolly pine

    Science.gov (United States)

    Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand

    2012-01-01

    Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.

  19. Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat

    Science.gov (United States)

    In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

  20. Current and future molecular approaches to investigate the white pine blister rust pathosystem

    Science.gov (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein

    2010-01-01

    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  1. Effect of orange rust on sugarcane breeding program at canal Point

    Science.gov (United States)

    Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...

  2. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Directory of Open Access Journals (Sweden)

    Maria Carlota eVaz Patto

    2014-11-01

    Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.

  3. Low average blister-rust infection rates may mean high control costs

    Science.gov (United States)

    Robert Marty

    1965-01-01

    The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...

  4. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  5. Determining yield loss caused by brown rust in production fields of sugarcane

    Science.gov (United States)

    Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...

  6. Utilization of a major brown rust resistance gene in sugarcane breeding

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...

  7. Detection, breeding, and selection of durable resistance to brown rust in sugarcane

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...

  8. Screening for sugarcane brown rust in first clonal stage of the Canal Point sugarcane breeding program

    Science.gov (United States)

    Sugarcane (Saccharum spp.) brown rust (caused by Puccinia melanocephala H. & P. Sydow) was first reported in the United States in 1978 and is still one of great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize b...

  9. Biology and pathology of Ribes and their implications for management of white pine blister rust

    Science.gov (United States)

    P. J. Zambino

    2010-01-01

    Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...

  10. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  11. MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS

    Science.gov (United States)

    Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...

  12. White pine blister rust resistance in limber pine: Evidence for a major gene

    Science.gov (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

    2014-01-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  13. Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.

    Science.gov (United States)

    Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping

    2017-01-01

    While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P  rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P  rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.

  14. Resistance to white pine blister rust in Pinus flexilis and P

    Science.gov (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns

    2010-01-01

    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  15. Blister rust in North America: What we have not learned in the past 100 years

    Science.gov (United States)

    Eugene P. Van Arsdel; Brian W. Geils

    2011-01-01

    Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...

  16. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  17. CHEMICAL INTERACTIONS OF ARSENATE, ARSENITE, PHOSPHATE, AND SILICATE WITH IRON (II, III) HYDROXYCARBONATE GREEN RUST

    Science.gov (United States)

    Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...

  18. Long-term changes in fusiform rust incidence in the southeastern United States

    Science.gov (United States)

    KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey

    2015-01-01

    Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...

  19. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  20. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  1. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  2. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  3. Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere

    International Nuclear Information System (INIS)

    Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.

    2008-01-01

    The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere

  4. Mechanical properties of the rust layer induced by impressed current method in reinforced mortar

    International Nuclear Information System (INIS)

    Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.

    2008-01-01

    This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer

  5. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  6. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  7. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  8. Correlation between RUST assessments of fracture healing to structural and biomechanical properties.

    Science.gov (United States)

    Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul

    2018-03-01

    Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  9. Annotation of a hybrid partial genome of the Coffee Rust (Hemileia vastatrix contributes to the gene repertoire catalogue of the Pucciniales

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Cristancho

    2014-10-01

    Full Text Available Coffee leaf rust caused by the fungus Hemileia vastatrix is the most damaging disease to coffee worldwide. The pathogen has recently appeared in multiple outbreaks in coffee producing countries resulting in significant yield losses and increases in costs related to its control. New races/isolates are constantly emerging as evidenced by the presence of the fungus in plants that were previously resistant. Genomic studies are opening new avenues for the study of the evolution of pathogens, the detailed description of plant-pathogen interactions and the development of molecular techniques for the identification of individual isolates. For this purpose we sequenced 8 different H. vastatrix isolates using NGS technologies and gathered partial genome assemblies due to the large repetitive content in the coffee rust hybrid genome; 74.4% of the assembled contigs harbor repetitive sequences. A hybrid assembly of 333Mb was built based on the 8 isolates; this assembly was used for subsequent analyses.Analysis of the conserved gene space showed that the hybrid H. vastatrix genome, though highly fragmented, had a satisfactory level of completion with 91.94% of core protein-coding orthologous genes present. RNA-Seq from urediniospores was used to guide the de novo annotation of the H. vastatrix gene complement. In total, 14,445 genes organized in 3,921 families were uncovered; a considerable proportion of the predicted proteins (73.8% were homologous to other Pucciniales species genomes. Several gene families related to the fungal lifestyle were identified, particularly 483 predicted secreted proteins that represent candidate effector genes and will provide interesting hints to decipher virulence in the coffee rust fungus. The genome sequence of Hva will serve as a template to understand the molecular mechanisms used by this fungus to attack the coffee plant, to study the diversity of this species and for the development of molecular markers to distinguish

  10. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    Science.gov (United States)

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  11. Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust

    Directory of Open Access Journals (Sweden)

    Rosa Laura Andrade Melchor

    Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.

  12. Effectors from Wheat Rust Fungi Suppress Multiple Plant Defense Responses.

    Science.gov (United States)

    Ramachandran, Sowmya R; Yin, Chuntao; Kud, Joanna; Tanaka, Kiwamu; Mahoney, Aaron K; Xiao, Fangming; Hulbert, Scot H

    2017-01-01

    Fungi that cause cereal rust diseases (genus Puccinia) are important pathogens of wheat globally. Upon infection, the fungus secretes a number of effector proteins. Although a large repository of putative effectors has been predicted using bioinformatic pipelines, the lack of available high-throughput effector screening systems has limited functional studies on these proteins. In this study, we mined the available transcriptomes of Puccinia graminis and P. striiformis to look for potential effectors that suppress host hypersensitive response (HR). Twenty small (wheat, confirming its activity in a homologous system. Overall, this study provides the first evidence for the presence of effectors in Puccinia species suppressing multiple plant defense responses.

  13. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  14. Seagrass leaf element content

    NARCIS (Netherlands)

    Vonk, J.A.; Smulders, Fee O.H.; Christianen, Marjolijn J.A.; Govers, Laura L.

    2017-01-01

    Knowledge on the role of seagrass leaf elements and in particular micronutrients and their ranges is limited. We present a global database, consisting of 1126 unique leaf values for ten elements, obtained from literature and unpublished data, spanning 25 different seagrass species from 28 countries.

  15. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati

    2016-04-01

    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  16. Study of Rust Effect on the Corrosion Behavior of Reinforcement Steel Using Impedance Spectroscopy

    Science.gov (United States)

    Bensabra, Hakim; Azzouz, Noureddine

    2013-12-01

    Most studies on corrosion of steel reinforcement in concrete are conducted on steel samples with polished surface (free of all oxides) in order to reproduce the same experimental conditions. However, before embedding in concrete, the steel bars are often covered with natural oxides (rust), which are formed during exposure to the atmosphere. The presence of this rust may affect the electrochemical behavior of steel rebar in concrete. In order to understand the effect of rust on the corrosion behavior of reinforcement steel, potentiodynamic and electrochemical impedance spectroscopy (EIS) tests were carried out in a simulated concrete pore solution using steel samples with two different surface conditions: polished and rusted samples. The obtained results have shown that the presence of rust on the steel bar has a negative effect on its corrosion behavior, with or without the presence of chlorides. This detrimental effect can be explained by the fact that the rust provokes a decrease of the electrolyte resistance at the metal-concrete interface and reduces the repassivating ability. In addition, the rust layer acts as a barrier against the hydroxyl ion diffusion, which prevents the realkalinization phenomenon.

  17. A reassessment of the risk of rust fungi developing resistance to fungicides.

    Science.gov (United States)

    Oliver, Richard P

    2014-11-01

    Rust fungi are major pathogens of many annual and perennial crops. Crop protection is largely based on genetic and chemical control. Fungicide resistance is a significant issue that has affected many crop pathogens. Some pathogens have rapidly developed resistance and hence are regarded as high-risk species. Rust fungi have been classified as being low risk, in spite of sharing many relevant features with high-risk pathogens. An examination of the evidence suggests that rust fungi may be wrongly classified as low risk. Of the nine classes of fungicide to which resistance has developed, six are inactive against rusts. The three remaining classes are quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs) and succinate dehydrogenase inhibitors (SDHIs). QoIs have been protected by a recently discovered intron that renders resistant mutants unviable. Low levels of resistance have developed to DMIs, but with limited field significance. Older SDHI fungicides were inactive against rusts. Some of the SDHIs introduced since 2003 are active against rusts, so it may be that insufficient time has elapsed for resistance to develop, especially as SDHIs are generally sold in mixtures with other actives. It would therefore seem prudent to increase the level of vigilance for possible cases of resistance to established and new fungicides in rusts. © 2014 Society of Chemical Industry.

  18. Photosynthesis in Norway spruce seedlings infected by the needle rust Chrysomyxa rhododendri.

    Science.gov (United States)

    Bauer, Helmut; Plattner, Karin; Volgger, Waltraud

    2000-02-01

    Chrysomyxa rhododendri (DC.) De Bary is a needle rust with a host shift between Rhododendron sp. and Norway spruce (Picea abies (L.) Karst.), penetrating only the new developing flushes of the conifer. Because little is known about its effects on trees, we investigated several parameters related to photosynthesis in artificially infected 3-year-old Norway spruce seedlings. The potential efficiency of photosystem II (PSII; derived from chlorophyll fluorescence measurements) was reduced in infected current-year needles as soon as disease symptoms were visible, about three weeks after inoculation. Two weeks later, photosynthetic O(2) evolution (P(max)) of infected needles was less than 20% of control needles, whereas respiratory O(2) uptake (R(D)) was about three times higher than that of control needles. Nonstructural carbohydrate concentrations were about 60% of control values in all parts of the shoots of infected trees. Photosynthetic inhibition was associated with marked decreases in chlorophyll concentration and chlorophyll a/b ratio but only a small reduction in carotenoid concentration. In infected trees, P(max) of noninfected 1-year-old and 2-year-old needles was 50 and 80% higher than in the corresponding age class of needles of control trees. Estimation of potential daily net dry mass production, based on P(max), R(D), specific leaf area, carbon content and needle biomass, indicated that seedlings infected once were able to produce 60%, and those infected twice only 25%, of the dry mass of controls. We conclude that afforestation and regeneration of Norway spruce is seriously impaired in regions where seedlings are frequently attacked by Chrysomyxa.

  19. Creation and validation of a simulator for corneal rust ring removal.

    Science.gov (United States)

    Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie

    2017-10-01

    To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

  20. Characterization of Brachypodium distachyon as a nonhost model against switchgrass rust pathogen Puccinia emaculata.

    Science.gov (United States)

    Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S

    2015-05-08

    Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.

  1. Induced mutations for tolerance of oats to crown rust

    International Nuclear Information System (INIS)

    Simons, M.D.; Frey, K.J.

    1977-01-01

    Seeds of three oat (Avena sativa and A. abyssinica) strains were treated with ethyl methanesulphonate (EMS), and crown rust (caused by Puccinia coronata var. avenae) tolerance ratios of M 5 -derived lines were compared with untreated checks. Tolerance ratios of mutant lines tended to be distributed in both plus and minus directions. No mutant oat line had a significant increase in grain yield, but many showed significantly depressed yields. With C.I. 6665, only five of 130 mutagen-derived lines were not significantly below the check for grain yield; one of these had significantly improved tolerance. Re-treatment of selected strains from a previous EMS treatment (original cultivar was Clintland-60) gave one M 5 -derived oat line (of 100 tested) that was equal to Clintland-60 in grain yield and sustained no damage from crown rust (i.e. it had a tolerance ratio of 100). EMS treatment of the highly susceptible tetraploid C.I. 2110 resulted in both significantly increased and reduced tolerance. (author)

  2. Protein modeling of yellow rust disease in wheat

    International Nuclear Information System (INIS)

    Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.

    2017-01-01

    Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)

  3. Genetics and mapping of the R₁₁ gene conferring resistance to recently emerged rust races, tightly linked to male fertility restoration, in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Seiler, G J; Vick, B A; Gulya, T J

    2012-09-01

    Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9

  4. REVIEW - Advances on molecular studies of the interaction soybean - Asian rust

    Directory of Open Access Journals (Sweden)

    Aguida Maria Alves Pereira Morales

    2012-01-01

    Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions

  5. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    User

    2013-05-22

    May 22, 2013 ... increased production of wheat could help to ensure food and nutritional ... also characterized by genes with additive effects and non hypersensitive .... to create an artificial stem rust epidemic in the field (Hickey et al.,. 2012 ...

  6. Hyperfine interactions and structures of ferrous hydroxide and green rust II in sulfated aqueous media

    International Nuclear Information System (INIS)

    Olowe, A.A.; Genin, J.M.R.; Bauer, P.

    1988-01-01

    A sulfated ferrous hydroxide is obtained by mixing NaOH with melanterite depending on the R = [SO 4 -- ]/[OH - ] ratio and leading by oxidation to the green rust II transient compound. Hyperfine parameters are presented. (orig.)

  7. Nanostructure of protective rust layer on weathering steel examined using synchrotron radiation x-rays

    International Nuclear Information System (INIS)

    Yamashita, Masato; Uchida, Hitoshi; Konishi, Hiroyuki; Mizuki, Jun'ichiro

    2004-01-01

    The X-ray absorption fine structure (XAFS) spectrum of pure goethite around the Fe K absorption edge and that of the protective rust layer formed on weathering steel exposed for 17 years in an atmospheric environment around the Cr K edge, have been examined using synchrotron radiation X-rays. It was found that the rust layer on the weathering steel mainly consisted of Cr-goethite. By examining the fine structure at the Cr K edge and the Fe K edge, we concluded that Cr 3+ in the rust layer is coordinated with O 2- and is positioned in the double chains of vacant sites in the network of FeO 3 (OH) 3 octahedra in the goethite crystal. This Cr 3+ site indicates that the protective effect of the rust layer is due to the dense aggregation of fine crystals of Cr-goethite with cation selectivity. (author)

  8. ARSENIC INTERACTION WITH IRON (II, III) HYDROXYCARBONATE GREEN RUST: IMPLICATIONS FOR ARSENIC REMEDIATION

    Science.gov (United States)

    Zerovalent iron is being used in permeable reactive barriers (PRBs) to remediate groundwater arsenic contamination. Iron(II, III) hydroxycarbonate green rust is a major corrosion product of zerovalent iron under anaerobic conditions. The interaction between arsenic and this green...

  9. Chemical reduction of rust on 2 1/4 Cr-1 Mo steel surface in sodium

    International Nuclear Information System (INIS)

    Yokota, N.; Shimoyashiki, S.

    1986-01-01

    Low-alloy Fe-2 1/4 Cr-1 Mo ferritic steel has been favored for the tube material of steam generators in fast breeder reactors (FBRs). However, this material rusts easily due to moisture condensation on its surface when left in air. Therefore, measures to prevent tube materials from rusting have been taken during manufacturing of the steam generators. When rust is present on tube surfaces, its oxygen and iron dissolve into liquid sodium. When the concentration of these impurities in the sodium increases rapidly, the cold traps can become choked locally and lose their removal ability. This work has been done, therefore, to clarify reduction processes of rust in sodium and to select optimum operating temperatures of steam generators in the initial operation

  10. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology.

    Directory of Open Access Journals (Sweden)

    Feng Qin

    Full Text Available Common leaf spot (caused by Pseudopeziza medicaginis, rust (caused by Uromyces striatus, Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana and Cercospora leaf spot (caused by Cercospora medicaginis are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis. After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection, disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features was the optimal model. For this SVM model, the

  11. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology

    Science.gov (United States)

    Qin, Feng; Liu, Dongxia; Sun, Bingda; Ruan, Liu; Ma, Zhanhong; Wang, Haiguang

    2016-01-01

    Common leaf spot (caused by Pseudopeziza medicaginis), rust (caused by Uromyces striatus), Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana) and Cercospora leaf spot (caused by Cercospora medicaginis) are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering) and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis). After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection), disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM) and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features) was the optimal model. For this SVM model, the

  12. 16 CFR 23.10 - Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant...

    Science.gov (United States)

    2010-01-01

    ... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant,” etc. (a) It is unfair or deceptive to: (1) Use the terms “corrosion proof,” “noncorrosive... the product will be immune from rust and other forms of corrosion during the life expectancy of the...

  13. Differential resistance to stripe rust (Puccinia striiformis) in collections of basin wild rye (Leymus cinereus)

    Science.gov (United States)

    Frank M. Dugan; Michael J. Cashman; Richard C. Johnson; Meinan Wang; Chen Xianming

    2014-01-01

    Differential resistance to stripe rust (Puccinia striiformis) in a planting of 111 wild collections of Basin wild rye (Leymus cinereus) was noted 2011-2013. In 2011, rust severity was rated on a scale of 1-9. Much lighter infection in 2012 and 2013 was rated as the number of symptomatic leaves per plant divided by plant circumference (to adjust for plant size). Effect...

  14. Evaluation of sugarcane introgression lines for resistance to brown rust disease caused by Puccinia melanocephala

    OpenAIRE

    Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang

    2013-01-01

    Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...

  15. Sustracted library obtained from mutant sugarcane variety B 4362 resistant to rust

    OpenAIRE

    María I. Oloriz; Luis Rojas; Víctor Gil; Elio Jiménez

    2002-01-01

    The hypersensitive response is one of the most powerful mechanisms for which the plants resist pathogen attack. Mutations carried out previously on the variety B4362, of sugarcane, originated five mutants that express this mechanism towards the attack of rust (Puccinia melanocephala Syd.). By means of a subtractive hybridization among the cDNA obtained starting from the resistant clone inoculated with rust and a pool of cDNA of the susceptible variety (B4362) inoculated and of the resistant c...

  16. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    OpenAIRE

    Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.

    2015-01-01

    The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...

  17. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-06-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  18. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on vir...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments......Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...

  19. SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

  20. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

    International Nuclear Information System (INIS)

    Wang, Y.J.; Wang, C.Y.; Zhang, H.

    2015-01-01

    Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

  1. Geometric leaf placement strategies

    International Nuclear Information System (INIS)

    Fenwick, J D; Temple, S W P; Clements, R W; Lawrence, G P; Mayles, H M O; Mayles, W P M

    2004-01-01

    Geometric leaf placement strategies for multileaf collimators (MLCs) typically involve the expansion of the beam's-eye-view contour of a target by a uniform MLC margin, followed by movement of the leaves until some point on each leaf end touches the expanded contour. Film-based dose-distribution measurements have been made to determine appropriate MLC margins-characterized through an index d 90 -for multileaves set using one particular strategy to straight lines lying at various angles to the direction of leaf travel. Simple trigonometric relationships exist between different geometric leaf placement strategies and are used to generalize the results of the film work into d 90 values for several different strategies. Measured d 90 values vary both with angle and leaf placement strategy. A model has been derived that explains and describes quite well the observed variations of d 90 with angle. The d 90 angular variations of the strategies studied differ substantially, and geometric and dosimetric reasoning suggests that the best strategy is the one with the least angular variation. Using this criterion, the best straightforwardly implementable strategy studied is a 'touch circle' approach for which semicircles are imagined to be inscribed within leaf ends, the leaves being moved until the semicircles just touch the expanded target outline

  2. Effects of rust in the crack face on crack detection based on Sonic-IR method

    International Nuclear Information System (INIS)

    Harai, Y.; Izumi, Y.; Tanabe, H.; Takamatsu, T.; Sakagami, T.

    2015-01-01

    Sonic-IR, which is based on the thermographic detection of the temperature rise due to frictional heating at the defect faces under ultrasonic excitation, has an advantage in the detection of closed and small defects. However, this method has a lot of nuclear factors relating to heat generation. In this study, effects of rust in the crack faces on the crack detection based on the sonic-IR method is experimentally investigated by using crack specimens. The heat generation by ultrasonic excitation was observed regularly during rust accelerated test using original device. The distribution of temperature change around the crack was changed with the progress of rust. This change in heat generation, it believed to be due to change in the contact state of the crack surface due to rust. As a result, it was found that heat generation by ultrasonic excitation is affected by rust in the crack faces. And it was also found that crack detection can be conducted by sonic-IR even if rust was generated in the crack faces. (author)

  3. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...

  4. Quantitative characterization of the atomic-scale structure of oxyhydroxides in rusts formed on steel surfaces

    International Nuclear Information System (INIS)

    Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.

    2005-01-01

    Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces

  5. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  6. Flavan-3-ols Are an Effective Chemical Defense against Rust Infection1[OPEN

    Science.gov (United States)

    Unsicker, Sybille B.; Fellenberg, Christin; Schmidt, Axel

    2017-01-01

    Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar (Populus nigra), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(−)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus (Melampsora larici-populina) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen (Populus tremula × Populus alba) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134, on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. PMID:29070515

  7. Induced mutants in beans and peas resistant to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M 1 was cultivated in 1978

  8. A summary of information on the rust Puccinia psidii Winter (guava rust) with emphasis on means to prevent introduction of additional strains to Hawaii

    Science.gov (United States)

    Loope, Lloyd

    2010-01-01

    The neotropical rust fungus Puccinia psidii(P. psidii) was originally described from the host common guava in its native Brazil but has been found since on hosts throughout the myrtle family (Myrtaceae), including a dramatic host jump to nonnative Eucalyptus plantations. Most rust fungi are able to live only on a very narrow range of host species. P. psidii is unusual both for having a broad host range and for the intensity of its damage to susceptible young growth. This rust first got a foothold in the United States in Florida more than three decades ago. The U.S. Department of Agriculture (USDA) has since considered it a nonactionable, nonreportable pest. Hawaii and Florida are the only two states with native species in the myrtle family. Over a period of 30 years, this rust has done little damage to any of the scattered native Myrtaceae in Florida, although the host range of the rust has gradually grown to about 30 mostly nonnative species in the family, apparently because of increasing genetic variety of the rust by repeated introductions. However, Florida’s native Myrtaceae are among the roughly 1,100 neotropical species that are largely resistant to P. psidii. The 3,000 species of non-neotropical Myrtaceae of the Pacific, Australia, Asia, and Africa are expected to prove much more vulnerable to P. psidii. Little is known about the genetics or genetic strains of P. psidii, although existing literature shows that there are numerous strains that have differential ability to infect suites of host plants.

  9. Phenylalanine ammonia-lyase (pal) and peroxidase activity in brown rust infected tissues of pakistani wheat cultivars

    International Nuclear Information System (INIS)

    Riaz, A.; Tahir, M.I.

    2014-01-01

    Besides other factors resistance and susceptibility is the outcome of biochemical processes such as activities of defense-related enzymes. So in this study, Phenylalanine ammonia-lyase (PAL) and Peroxidase activity of resistant (Inqilab-91) and susceptible (Kirin-95) wheat cultivars were determined through spectrophotometer to address the biochemical aspect related to the disease after 8 hours, 24 hours, 48 hours and 72 hours of leaf rust inoculation. The results have shown that these enzymes were present in both the resistant and susceptible cultivars but the activity was more pronounced in the resistant one. The effect of PAL and peroxidase activity was also investigated among inoculated and uninoculated plants within the same cultivar. The activity of both PAL and peroxidase were more significant in inoculated ones. The results have shown that the after 72 hours of inoculation Inqilab-91 had more PAL activity i.e., 5.47 IU/ml/min than in Kirin-95 i.e., 2.08 IU/ml/min at 270 nm. While peroxidase activity in Inqilab-91 was 6.41 IU/ml/min and in Kirin-95, 3.66 IU/ml/min after 72 hours of inoculation, observed under 470 nm wavelength. Increase in one's activity increases the other enzyme's activity. The activity was more prominent after 72 hours of infection as pathogen had successfully established itself in the host plant tissue. The activities of these enzymes act as plants active defense mechanism against the attack of pathogen. (author)

  10. Photoperiod-H1 (Ppd-H1) Controls Leaf Size1[OPEN

    Science.gov (United States)

    Digel, Benedikt; Tavakol, Elahe; Verderio, Gabriele; Xu, Xin

    2016-01-01

    Leaf size is a major determinant of plant photosynthetic activity and biomass; however, it is poorly understood how leaf size is genetically controlled in cereal crop plants like barley (Hordeum vulgare). We conducted a genome-wide association scan for flowering time, leaf width, and leaf length in a diverse panel of European winter cultivars grown in the field and genotyped with a single-nucleotide polymorphism array. The genome-wide association scan identified PHOTOPERIOD-H1 (Ppd-H1) as a candidate gene underlying the major quantitative trait loci for flowering time and leaf size in the barley population. Microscopic phenotyping of three independent introgression lines confirmed the effect of Ppd-H1 on leaf size. Differences in the duration of leaf growth and consequent variation in leaf cell number were responsible for the leaf size differences between the Ppd-H1 variants. The Ppd-H1-dependent induction of the BARLEY MADS BOX genes BM3 and BM8 in the leaf correlated with reductions in leaf size and leaf number. Our results indicate that leaf size is controlled by the Ppd-H1- and photoperiod-dependent progression of plant development. The coordination of leaf growth with flowering may be part of a reproductive strategy to optimize resource allocation to the developing inflorescences and seeds. PMID:27457126

  11. Photoperiod-H1 (Ppd-H1) Controls Leaf Size.

    Science.gov (United States)

    Digel, Benedikt; Tavakol, Elahe; Verderio, Gabriele; Tondelli, Alessandro; Xu, Xin; Cattivelli, Luigi; Rossini, Laura; von Korff, Maria

    2016-09-01

    Leaf size is a major determinant of plant photosynthetic activity and biomass; however, it is poorly understood how leaf size is genetically controlled in cereal crop plants like barley (Hordeum vulgare). We conducted a genome-wide association scan for flowering time, leaf width, and leaf length in a diverse panel of European winter cultivars grown in the field and genotyped with a single-nucleotide polymorphism array. The genome-wide association scan identified PHOTOPERIOD-H1 (Ppd-H1) as a candidate gene underlying the major quantitative trait loci for flowering time and leaf size in the barley population. Microscopic phenotyping of three independent introgression lines confirmed the effect of Ppd-H1 on leaf size. Differences in the duration of leaf growth and consequent variation in leaf cell number were responsible for the leaf size differences between the Ppd-H1 variants. The Ppd-H1-dependent induction of the BARLEY MADS BOX genes BM3 and BM8 in the leaf correlated with reductions in leaf size and leaf number. Our results indicate that leaf size is controlled by the Ppd-H1- and photoperiod-dependent progression of plant development. The coordination of leaf growth with flowering may be part of a reproductive strategy to optimize resource allocation to the developing inflorescences and seeds. © 2016 American Society of Plant Biologists. All rights reserved.

  12. Severidade de ferrugem polissora em cultivares de milho e seu efeito na produtividade Severity of southern rust in maize cultivars and its effect on yield

    Directory of Open Access Journals (Sweden)

    Christina Dudienas

    2013-03-01

    localities of São Paulo State, correlated to yield. A total of 50 simple and triple hybrids (HST and 22 double hybrids and varieties of maize (HDV in use by farmers were evaluated in 2005/2006 for their reaction to southern rust in six locations in western and north-central regions of São Paulo State. In the experiments with HST, the most resistant cultivars with the highest yields were: 30F80, 30F90, 30K73, AG 7000, DAS 2B710, DKB 191, DKB 466 and Impacto. Among HDV, the most resistant ones presenting the highest yields were: 30S40 and AG 2040. Yield losses due to the severity of southern rust, assessed in the stage of pastry grain, ranged from 3.5%, for cultivars with approximately 2.5% of leaf area affected by the disease, to 20.3% for cultivars with 39% of the leaf area affected, compared to cultivars of higher resistance to the disease (1.4% affected leaf area.

  13. Influence of Rust Permeability on Corrosion of E690 Steel in Industrial and Non-industrial Marine Splash Zones

    Science.gov (United States)

    Chen, Mindong; Pang, Kun; Liu, Zhiyong; Wu, Junsheng; Li, Xiaogang

    2018-05-01

    The corrosion behaviour of E690 steel in industrial and non-industrial marine splash environments was studied by environmental testing, morphology analysis, electrochemical measurements, and scanning Kelvin probe microscopy. Chloride and sulphide anions were found to diffuse across the rust layer following the evaporation of seawater splashed on the steel's surface. The cation-selective permeability of the rust layer resulted in an anion concentration gradient across the rust layer, which was more significant in the presence of sulphur dioxide. In addition, sulphur dioxide enhanced the formation of α-FeOOH, which led to the formation of distinct anode and cathode areas at the rust/steel interface.

  14. BOREAS TE-9 NSA Leaf Chlorophyll Density

    Science.gov (United States)

    Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Margolis, Hank; Sy, Mikailou

    2000-01-01

    The BOREAS TE-9 team collected several data sets related to chemical and photosynthetic properties of leaves in boreal forest tree species. These data were collected to help provide an explanation of potential seasonal and spatial changes of leaf pigment properties in boreal forest species at the NSA. At different dates (FFC-Winter, FFC-Thaw, IFC-1, IFC-2, and IMC-3), foliage samples were collected from the upper third of the canopy for five NSA sites (YJP, OJP, OBS, UBS, and OA) near Thompson, Manitoba. Subsamples of 100 needles for black spruce, 20 needles for jack pine, and single leaf for trembling aspen were cut into pieces and immersed in a 20-mL DMF aliquot in a Nalgene test tube. The extracted foliage materials were then oven-dried at 68 C for 48 hours and weighed. Extracted leaf dry weight was converted to a total leaf area basis to express the chlorophyll content in mg/sq cm of total leaf area. The data are provided in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  15. Automated Leaf Tracking using Multi-view Image Sequences of Maize Plants for Leaf-growth Monitoring

    Science.gov (United States)

    Das Choudhury, S.; Awada, T.; Samal, A.; Stoerger, V.; Bashyam, S.

    2017-12-01

    Extraction of phenotypes with botanical importance by analyzing plant image sequences has the desirable advantages of non-destructive temporal phenotypic measurements of a large number of plants with little or no manual intervention in a relatively short period of time. The health of a plant is best interpreted by the emergence timing and temporal growth of individual leaves. For automated leaf growth monitoring, it is essential to track each leaf throughout the life cycle of the plant. Plants are constantly changing organisms with increasing complexity in architecture due to variations in self-occlusions and phyllotaxy, i.e., arrangements of leaves around the stem. The leaf cross-overs pose challenges to accurately track each leaf using single view image sequence. Thus, we introduce a novel automated leaf tracking algorithm using a graph theoretic approach by multi-view image sequence analysis based on the determination of leaf-tips and leaf-junctions in the 3D space. The basis of the leaf tracking algorithm is: the leaves emerge using bottom-up approach in the case of a maize plant, and the direction of leaf emergence strictly alternates in terms of direction. The algorithm involves labeling of the individual parts of a plant, i.e., leaves and stem, following graphical representation of the plant skeleton, i.e., one-pixel wide connected line obtained from the binary image. The length of the leaf is measured by the number of pixels in the leaf skeleton. To evaluate the performance of the algorithm, a benchmark dataset is indispensable. Thus, we publicly release University of Nebraska-Lincoln Component Plant Phenotyping dataset-2 (UNL-CPPD-2) consisting of images of the 20 maize plants captured by visible light camera of the Lemnatec Scanalyzer 3D high throughout plant phenotyping facility once daily for 60 days from 10 different views. The dataset is aimed to facilitate the development and evaluation of leaf tracking algorithms and their uniform comparisons.

  16. Susceptibility of field populations of the fall armyworm (Lepidoptera: Noctuidae) from Florida and Puerto Rico to purified Cry1F protein and corn leaf tissue containing single and pyramided Bt genes

    Science.gov (United States)

    Larval survival of Cry1F-susceptible (FL), -resistant (PR and Cry1F-RR), and -heterozygous (FL x PR and Cry1F-RS) populations of the fall armyworm, Spodoptera frugiperda (J.E. Smith) to purified Cry1F protein and corn leaf tissue of seven Bacillus thuringiensis (Bt) corn hybrids and five non-Bt corn...

  17. A hairy-leaf gene, BLANKET LEAF, of wild Oryza nivara increases photosynthetic water use efficiency in rice.

    Science.gov (United States)

    Hamaoka, Norimitsu; Yasui, Hideshi; Yamagata, Yoshiyuki; Inoue, Yoko; Furuya, Naruto; Araki, Takuya; Ueno, Osamu; Yoshimura, Atsushi

    2017-12-01

    High water use efficiency is essential to water-saving cropping. Morphological traits that affect photosynthetic water use efficiency are not well known. We examined whether leaf hairiness improves photosynthetic water use efficiency in rice. A chromosome segment introgression line (IL-hairy) of wild Oryza nivara (Acc. IRGC105715) with the genetic background of Oryza sativa cultivar 'IR24' had high leaf pubescence (hair). The leaf hairs developed along small vascular bundles. Linkage analysis in BC 5 F 2 and F 3 populations showed that the trait was governed by a single gene, designated BLANKET LEAF (BKL), on chromosome 6. IL-hairy plants had a warmer leaf surface in sunlight, probably due to increased boundary layer resistance. They had a lower transpiration rate under moderate and high light intensities, resulting in higher photosynthetic water use efficiency. Introgression of BKL on chromosome 6 from O. nivara improved photosynthetic water use efficiency in the genetic background of IR24.

  18. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery

    Directory of Open Access Journals (Sweden)

    Qiong Zheng

    2018-03-01

    Full Text Available Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI, a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor’s relative spectral response (RSR function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red, B5 (Re1, and B7 (Re3, were found to be sensitive bands using the random forest (RF method. A new multispectral index, the Red Edge Disease Stress Index (REDSI, which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI’s ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and

  19. New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery.

    Science.gov (United States)

    Zheng, Qiong; Huang, Wenjiang; Cui, Ximin; Shi, Yue; Liu, Linyi

    2018-03-15

    Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI), a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe) in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor's relative spectral response (RSR) function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red), B5 (Re1), and B7 (Re3), were found to be sensitive bands using the random forest (RF) method. A new multispectral index, the Red Edge Disease Stress Index (REDSI), which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI's ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and generalized ability

  20. Leaf-IT: An Android application for measuring leaf area.

    Science.gov (United States)

    Schrader, Julian; Pillar, Giso; Kreft, Holger

    2017-11-01

    The use of plant functional traits has become increasingly popular in ecological studies because plant functional traits help to understand key ecological processes in plant species and communities. This also includes changes in diversity, inter- and intraspecific interactions, and relationships of species at different spatiotemporal scales. Leaf traits are among the most important traits as they describe key dimensions of a plant's life history strategy. Further, leaf area is a key parameter with relevance for other traits such as specific leaf area, which in turn correlates with leaf chemical composition, photosynthetic rate, leaf longevity, and carbon investment. Measuring leaf area usually involves the use of scanners and commercial software and can be difficult under field conditions. We present Leaf-IT, a new smartphone application for measuring leaf area and other trait-related areas. Leaf-IT is free, designed for scientific purposes, and runs on Android 4 or higher. We tested the precision and accuracy using objects with standardized area and compared the area measurements of real leaves with the well-established, commercial software WinFOLIA using the Altman-Bland method. Area measurements of standardized objects show that Leaf-IT measures area with high accuracy and precision. Area measurements with Leaf-IT of real leaves are comparable to those of WinFOLIA. Leaf-IT is an easy-to-use application running on a wide range of smartphones. That increases the portability and use of Leaf-IT and makes it possible to measure leaf area under field conditions typical for remote locations. Its high accuracy and precision are similar to WinFOLIA. Currently, its main limitation is margin detection of damaged leaves or complex leaf morphologies.

  1. Relative Fusiform Rust Resistance of Loblolly and Slash Pine Sources and Families in Georgia and South Carolina

    Science.gov (United States)

    E. George Kuhlman; Harry R. Powers; William D. Pepper

    1995-01-01

    Loblolly and slash pine seedlings from the fusiform rust resistant orchards developed cooperatively by the USDA Forest Service and the Georgia Forestry Commission had significantly less rust 7 to 8 years after planting on four of five sites in the Southeastern United States than seedlings of the same species from orchard sources developed primarily for silvicultural...

  2. Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.)

    Science.gov (United States)

    Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia

    2015-01-01

    Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

  3. 76 FR 13970 - Notice of Request for Extension of Approval of an Information Collection; Black Stem Rust...

    Science.gov (United States)

    2011-03-15

    ... Requirements for Addition of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection Service, USDA... Rust-Resistant Varieties. OMB Number: 0579-0186. Type of Request: Extension of approval of an... products to prevent the introduction of plant pests into the United States or their dissemination within...

  4. White pine blister rust in Korea, Japan and other Asian regions: comparisons and implications for North America

    Science.gov (United States)

    M.-S. Kim; N. B. Klopfenstein; Y. Ota; S. K. Lee; K.-S. Woo; S. Kaneko

    2010-01-01

    This article briefly reviews the history of white pine blister rust, attributed to Cronartium ribicola, and addresses current research and management issues in South Korea, Japan and other regions of eastern Asia (China, Russia and Himalaya). For each region, the distribution, damage, aecial hosts, telial hosts and management of C. ribicola and other blister rust fungi...

  5. Prediction of yield losses in wheat (triticum aestivum l.) caused by yellow rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Ahmad, S.; Afzal, M.; Noorka, I.R.; Iqbal, Z.; Akhtar, N.; Iiftikhar, Y.; Kamran, M.

    2010-01-01

    Thirty six genotypes were screened against yellow rust to check their level of susceptibility or resistance. Among 36 genotypes screened against yellow rust, 18 were susceptible, 6 were moderately susceptible to susceptible, 7 were moderately resistant to moderately susceptible and 5 genotypes remained resistant. Yield losses were predicted in wheat on the basis of varying level of yellow rust severities. It was observed that susceptible genotypes showed higher yield losses as compared to resistant genotypes. Maximum severity of 90% of yellow rust resulted in 54% to 55% calculated and predicted losses, respectively. While 40, 50, 60 and 70% disease severity of yellow rust caused 35-34%, 38-37%, 42-40% and 46-47% calculated and predicted losses, respectively. However, the decline in losses was observed as the genotypes changed their reaction from susceptible to moderate susceptible. Similarly, losses were diminished as the varieties/lines showed moderate resistant reaction from moderate susceptible. Minimum temperature and relative humidity remained positively correlated while the maximum temperature showed negative correlation with stripe rust severity. With the increase of minimum temperature and relative humidity a rise up in stripe rust infection was seen while as the maximum temperature increased stripe rust infection decreased on different genotypes. It may be concluded from the study that environmental factors played major role in the spread of the disease which result in yield losses. (author)

  6. Tracking the distribution of Puccinia psidii genotypes that cause rust disease on diverse myrtaceous trees and shrubs

    Science.gov (United States)

    Amy L. Ross-Davis; Rodrigo N. Graca; Acelino C. Alfenas; Tobin L. Peever; Jack W. Hanna; Janice Y. Uchida; Rob D. Hauff; Chris Y. Kadooka; Mee-Sook Kim; Phil G. Cannon; Shigetou Namba; Nami Minato; Sofia Simeto; Carlos A. Perez; Min B. Rayamajhi; Mauricio Moran; D. Jean Lodge; Marcela Arguedas; Rosario Medel-Ortiz; M. Armando Lopez-Ramirez; Paula Tennant; Morag Glen; Ned B. Klopfenstein

    2014-01-01

    Puccinia psidii Winter (Basidiomycota, Uredinales) is a biotrophic rust fungus that was first reported in Brazil from guava in 1884 (Psidium guajava; Winter 1884) and later from eucalypt in 1912 (Joffily 1944). Considered to be of neotropical origin, the rust has also been reported to infect diverse myrtaceous hosts elsewhere in South America, Central America, the...

  7. Screening for Sugarcane Brown Rust in the First Clonal Stage of the Canal Point Sugarcane Breeding Program

    Directory of Open Access Journals (Sweden)

    Duli Zhao

    2015-07-01

    Full Text Available Sugarcane (Saccharum spp. brown rust (caused by Puccinia melanocephala Syd. & P. Syd. was first reported in the United States in 1978 and is still one of the great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize breeding and selection strategies for disease resistance. Brown rust ratings were scaled from non-infection (0 to severe infection (4 with intervals of 0.5 and routinely recorded for genotypes in the first clonal selection stage of the Canal Point sugarcane breeding program in Florida. Data were collected from 14,272 and 12,661 genotypes and replicated check cultivars in 2012 and 2013, respectively. Mean rust rating, % infection, and severity in each family and progeny of female parent were determined, and their coefficients of variation (CV within and among families (females were estimated. Considerable variation exists in rust ratings among families or females. The families and female parents with high susceptibility or resistance to brown rust were identified and ranked. The findings of this study can help scientists to evaluate sugarcane crosses and parents for brown rust disease, to use desirable parents for crossing, and to improve genetic resistance to brown rust in breeding programs.

  8. Distribution and frequency of Bru1, a major brown rust resistance gene, in the sugarcane world collection

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane worldwide. Molecular markers for a major brown rust resistance gene, Bru1, were used to screen a total of 1,282 clones in the World Collection of Sugarcane and Related Grasses (WCSRG) to determine the distribution and...

  9. Frequency and distribution of the brown rust resistance gene Bru1 and implications for the Louisiana sugarcane breeding programme

    Science.gov (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is an important disease of sugarcane posing an increasing threat to sugarcane industries worldwide. A major gene, Bru1, has been shown to contribute a significant proportion of brown rust resistance in multiple sugarcane industries. The recent...

  10. Dissection of the multigenic wheat stem rust resistance present in the Montenegrin spring wheat accession PI 362698

    Science.gov (United States)

    Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...

  11. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates

    Science.gov (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  12. White pine blister rust resistance of 12 western white pine families at three field sites in the Pacific Northwest

    Science.gov (United States)

    Richard A. Sniezko; Robert Danchok; Jim Hamlin; Angelia Kegley; Sally Long; James Mayo

    2012-01-01

    Western white pine (Pinus monticola Douglas ex D. Don) is highly susceptible to the non-native, invasive pathogen Cronartium ribicola, the causative agent of white pine blister rust. The susceptibility of western white pine to blister rust has limited its use in restoration and reforestation throughout much of western North...

  13. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest'

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  14. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  15. Morphology of germlings of urediniospores and its value for the identification and classification of grass rust fungi

    NARCIS (Netherlands)

    Swertz, C.A.

    1994-01-01

    The identification and classification of grass rust fungi is often difficult since most traditionally used morphological characters are quantitative and subjective. Besides, when using the host range as a taxonomic criterion, it is important to realize that a rust fungus may have jumped to

  16. Creation of variation in Basella for rust resistance through mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Makambila, C [Phytopathology Lab., Faculty of Sciences, Brazzaville (Congo)

    1997-07-01

    African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD{sub 50} for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs.

  17. Creation of variation in Basella for rust resistance through mutagenesis

    International Nuclear Information System (INIS)

    Makambila, C.

    1997-01-01

    African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD 50 for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs

  18. Potential impact of the global climate changes on the spatial distribution of areas of risk for the occurrence of eucalyptus rust in Brazil

    Directory of Open Access Journals (Sweden)

    Willian Bucker Moraes

    2014-06-01

    Full Text Available Rust, caused by Puccinia psidii, is one of the most important diseases affecting eucalyptus in Brazil. This pathogen causes disease in mini-clonal garden and in young plants in the field, especially in leaves and juvenile shoots. Favorable climate conditions for infection by this pathogen in eucalyptus include temperature between 18 and 25 ºC, together with at least 6-hour leaf wetness periods, for 5 to 7 consecutive days. Considering the interaction between the environment and the pathogen, this study aimed to evaluate the potential impact of global climate changes on the spatial distribution of areas of risk for the occurrence of eucalyptus rust in Brazil. Thus, monthly maps of the areas of risk for the occurrence of this disease were elaborated, considering the current climate conditions, based on a historic series between 1961 and 1990, and the future scenarios A2 and B2, predicted by IPCC. The climate conditions were classified into three categories, according to the potential risk for the disease occurrence, considering temperature (T and air relative humidity (RH: i high risk (18 90%; ii medium risk (18 25 ºC and RH > 90%; and iii low risk (T 25 ºC and RH < 90%. Data about the future climate scenarios were supplied by GCM Change Fields. In this study, the simulation model Hadley Centers for Climate Prediction and Research (HadCm3 was adopted, using the software Idrisi 32. The obtained results led to the conclusion that there will be a reduction in the area favorable to eucalyptus rust occurrence, and such a reduction will be gradual for the decades of 2020, 2050 and 2080 but more marked in scenario A2 than in B2. However, it is important to point out that extensive areas will still be favorable to the disease development, especially in the coldest months of the year, i.e., June and July. Therefore, the zoning of areas and periods of higher occurrence risk, considering the global climate changes, becomes important knowledge for the

  19. Environment-Friendly Control of Pear Scab and Rust Using Lime Sulfur

    Directory of Open Access Journals (Sweden)

    Ju Hoon Cha

    2018-03-01

    Full Text Available Pear scab and rust are the major diseases causing severe epidemics in organic cultivation of pear trees. Incidences of pear scab and rust were compared in organically managed plots and conventionally managed plots to obtain optimum application schedule of environment-friendly control agents in organically managed plots. Organically cultural practice with 10 time-applications of lime sulfur and Bordeaux mixture showed higher than 40% of control efficacies of pear scab and rust compared to conventionally cultural practice. Organically cultural practice with 8 time-applications of lime sulfur considering weather condition showed higher than 30% of control efficacies of pear scab compared to conventionally cultural practice. The results suggest that proper application of environment-friendly control agents such as lime sulfur considering weather condition will enable effective control of the major diseases for organic cultivation of pear.

  20. Rust formed on cannons of XVIII century under two environment conditions

    International Nuclear Information System (INIS)

    Cindra Fonseca, M.P.; Bastos, I.N.; Caytuero, A.; Baggio Saitovitch, E.M.

    2007-01-01

    The corrosion products of two ancient cannons exposed to atmospheric corrosion were analysed by X-ray powder diffraction, transmission Moessbauer spectroscopy and scanning electron microscopy (SEM). After almost three centuries exposed in marine environment one of them was moved to a rural region and was maintained in this environment for approximately 30 years. The inland region has an altitude of 1000 m above sea level and consequently low aggressiveness. The studied rusts were obtained from external and internal surfaces of the cannon barrels. This investigation, using three different techniques, was done to check if the relatively short time (ca. 30 years) in rural area was sufficient to change the characteristics of the thick rust formed during long time exposure (ca. 300 years) in marine atmosphere. The time-environment effects change the physical nature of rust, mainly observed by Moessbauer spectroscopy results

  1. Corrosion-resistant amorphous alloy ribbons for electromagnetic filtration of iron rusts from water

    International Nuclear Information System (INIS)

    Kawashima, Asahi; Asami, Katsuhiko; Sato, Takeaki; Hashimoto, Koji

    1985-01-01

    An attempt was made to use corrosion-resistant amorphous Fe-9Cr-13P-7C alloy ribbons as an electromagnetic filter material for trapping various iron rusts suspended in water at 40 0 C. The ferrimagnetic Fe 3 O 4 rust was trapped with the 100 % efficiency and paramagnetic rusts such as α-Fe 2 O 3 , α-FeOOH and amorphous ferric oxyhydroxide were trapped with certain efficiencies at the magnetic field strength of 0.5-10 kOe. The regeneration of the filter by back-washing was easy. The trapping capacity of electromagnetic filter was proportional to the edge length of the filter material where the high magnetic field strength existed. Therefore, melt-spun thin and narrow amorphous alloy ribbons having the high corrosion resistance have the potential utility as electromagnetic filter material. (author)

  2. A coupled carbonation-rust formation mechanical damage model for steel corrosion in reinforced concrete

    International Nuclear Information System (INIS)

    Nguyen, Huyen; Bary, B.; L'Hostis, Valerie; DeLarrard, T.

    2014-01-01

    This paper aims at presenting a strategy to simulate the corrosion of steel reinforcement due to carbonation of concrete in atmospheric environment. We propose a model coupling drying, carbonation, diffusion of oxygen, formation of rust and mechanics to describe these phenomena. The rust layer is assumed to be composed of two sub-layers with different elastic modulus. An unstable layer with a low modulus (from 0.1 to 5 GPa) is located next to the transformed medium, and another more stable one with a higher modulus (from 100 to 150 GPa) at the interface with steel reinforcement. This model is applied to a numerical meso-structure composed of 4 phases: mortar matrix, randomly distributed aggregates, steel rebar and rust layers to underline the effect of aggregates on damage initiation and corresponding crack pattern of concrete cover. (authors)

  3. Non-destructive estimation of leaf area for different plant ages and accessions of Capsicum annuum L.

    NARCIS (Netherlands)

    Swart, de E.A.M.; Groenwold, R.; Kanne, H.J.; Stam, P.; Marcelis, L.F.M.; Voorrips, R.E.

    2004-01-01

    Accurate measurements of leaf area are important for agronomic and physiological studies. To be able to perform repeated measurements of leaf area on single (genetically unique) plants, a method was developed to estimate leaf area from non-destructive measurements in Capsicum annuum L. independent

  4. Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean

    Directory of Open Access Journals (Sweden)

    Oscar P. Hurtado-Gonzales

    2017-02-01

    Full Text Available Bean rust, caused by Uromyces appendiculatus, is a devastating disease of common bean (Phaseolus vulgaris in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3. An F2 population from the cross Pinto 114 (susceptible × Aurora (resistant with Ur-3 was evaluated for its reaction to four different races of U. appendiculatus. A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3. Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3. This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean.

  5. Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean.

    Science.gov (United States)

    Hurtado-Gonzales, Oscar P; Valentini, Giseli; Gilio, Thiago A S; Martins, Alexandre M; Song, Qijian; Pastor-Corrales, Marcial A

    2017-02-09

    Bean rust, caused by Uromyces appendiculatus , is a devastating disease of common bean ( Phaseolus vulgaris ) in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3 An F 2 population from the cross Pinto 114 (susceptible) × Aurora (resistant with Ur-3 ) was evaluated for its reaction to four different races of U. appendiculatus A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3 Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3 This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean. Copyright © 2017 Hurtado-Gonzales et al.

  6. Flavan-3-ols Are an Effective Chemical Defense against Rust Infection.

    Science.gov (United States)

    Ullah, Chhana; Unsicker, Sybille B; Fellenberg, Christin; Constabel, C Peter; Schmidt, Axel; Gershenzon, Jonathan; Hammerbacher, Almuth

    2017-12-01

    Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar ( Populus nigra ), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(-)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus ( Melampsora larici-populina ) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen ( Populus tremula × Populus alba ) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134 , on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. © 2017 American Society of Plant Biologists. All Rights Reserved.

  7. Variable depth recursion algorithm for leaf sequencing

    International Nuclear Information System (INIS)

    Siochi, R. Alfredo C.

    2007-01-01

    The processes of extraction and sweep are basic segmentation steps that are used in leaf sequencing algorithms. A modified version of a commercial leaf sequencer changed the way that the extracts are selected and expanded the search space, but the modification maintained the basic search paradigm of evaluating multiple solutions, each one consisting of up to 12 extracts and a sweep sequence. While it generated the best solutions compared to other published algorithms, it used more computation time. A new, faster algorithm selects one extract at a time but calls itself as an evaluation function a user-specified number of times, after which it uses the bidirectional sweeping window algorithm as the final evaluation function. To achieve a performance comparable to that of the modified commercial leaf sequencer, 2-3 calls were needed, and in all test cases, there were only slight improvements beyond two calls. For the 13 clinical test maps, computation speeds improved by a factor between 12 and 43, depending on the constraints, namely the ability to interdigitate and the avoidance of the tongue-and-groove under dose. The new algorithm was compared to the original and modified versions of the commercial leaf sequencer. It was also compared to other published algorithms for 1400, random, 15x15, test maps with 3-16 intensity levels. In every single case the new algorithm provided the best solution

  8. Partial resistance to stripe rust and its effect on sustainability of wheat yield

    International Nuclear Information System (INIS)

    Qamar, M.; Din, R.U.; Gardazi, D.A.

    2014-01-01

    Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use

  9. Use of AFLP marker system on sugarcane somaclones to study their resistance to rust

    OpenAIRE

    María Ileana Oloriz; Luis Rojas; Víctor Gil; Milady Mendoza; Ariel Arencibia; Elva Rosa Carmona; Elio Jiménez

    2002-01-01

    AFLPs (amplified fragment length polymorphism) was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg). Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study thei...

  10. Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyrhizi syd)

    International Nuclear Information System (INIS)

    Ratma, R.

    1988-01-01

    Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyhizi syd). Eleven soybean mutant lines of orba variety derived from gamma fungus disease in the wet season 1985/86 at the experimental station of Citayam, Bogor. Based on IWGSR rating system, soybean mutant lines No 18/PsJ was moderately resistant to rust fungus disease. The other mutant lines, 14/PsJ, 15/PsJ, 20/PsJ, 102/PsJ, 106/PsJ, 111/PsJ, 118/PsJ, 119/PsJ and 220/PsJ were susceptible. (author). 4 figs.; 8 refs

  11. De Novo Assembly and Phasing of Dikaryotic Genomes from Two Isolates of Puccinia coronata f. sp. avenae, the Causal Agent of Oat Crown Rust.

    Science.gov (United States)

    Miller, Marisa E; Zhang, Ying; Omidvar, Vahid; Sperschneider, Jana; Schwessinger, Benjamin; Raley, Castle; Palmer, Jonathan M; Garnica, Diana; Upadhyaya, Narayana; Rathjen, John; Taylor, Jennifer M; Park, Robert F; Dodds, Peter N; Hirsch, Cory D; Kianian, Shahryar F; Figueroa, Melania

    2018-02-20

    Oat crown rust, caused by the fungus Pucinnia coronata f. sp. avenae , is a devastating disease that impacts worldwide oat production. For much of its life cycle, P. coronata f. sp. avenae is dikaryotic, with two separate haploid nuclei that may vary in virulence genotype, highlighting the importance of understanding haplotype diversity in this species. We generated highly contiguous de novo genome assemblies of two P. coronata f. sp. avenae isolates, 12SD80 and 12NC29, from long-read sequences. In total, we assembled 603 primary contigs for 12SD80, for a total assembly length of 99.16 Mbp, and 777 primary contigs for 12NC29, for a total length of 105.25 Mbp; approximately 52% of each genome was assembled into alternate haplotypes. This revealed structural variation between haplotypes in each isolate equivalent to more than 2% of the genome size, in addition to about 260,000 and 380,000 heterozygous single-nucleotide polymorphisms in 12SD80 and 12NC29, respectively. Transcript-based annotation identified 26,796 and 28,801 coding sequences for isolates 12SD80 and 12NC29, respectively, including about 7,000 allele pairs in haplotype-phased regions. Furthermore, expression profiling revealed clusters of coexpressed secreted effector candidates, and the majority of orthologous effectors between isolates showed conservation of expression patterns. However, a small subset of orthologs showed divergence in expression, which may contribute to differences in virulence between 12SD80 and 12NC29. This study provides the first haplotype-phased reference genome for a dikaryotic rust fungus as a foundation for future studies into virulence mechanisms in P. coronata f. sp. avenae IMPORTANCE Disease management strategies for oat crown rust are challenged by the rapid evolution of Puccinia coronata f. sp. avenae , which renders resistance genes in oat varieties ineffective. Despite the economic importance of understanding P. coronata f. sp. avenae , resources to study the

  12. Leaf absorbance and photosynthesis

    Science.gov (United States)

    Schurer, Kees

    1994-01-01

    The absorption spectrum of a leaf is often thought to contain some clues to the photosynthetic action spectrum of chlorophyll. Of course, absorption of photons is needed for photosynthesis, but the reverse, photosynthesis when there is absorption, is not necessarily true. As a check on the existence of absorption limits we measured spectra for a few different leaves. Two techniques for measuring absorption have been used, viz. the separate determination of the diffuse reflectance and the diffuse transmittance with the leaf at a port of an integrating sphere and the direct determination of the non-absorbed fraction with the leaf in the sphere. In a cross-check both methods yielded the same results for the absorption spectrum. The spectrum of a Fuchsia leaf, covering the short-wave region from 350 to 2500 nm, shows a high absorption in UV, blue and red, the well known dip in the green and a steep fall-off at 700 nm. Absorption drops to virtually zero in the near infrared, with subsequent absorptions, corresponding to the water absorption bands. In more detailed spectra, taken at 5 nm intervals with a 5 nm bandwidth, differences in chlorophyll content show in the different depths of the dip around 550 nm and in a small shift of the absorption edge at 700 nm. Spectra for Geranium (Pelargonium zonale) and Hibiscus (with a higher chlorophyll content) show that the upper limit for photosynthesis can not be much above 700 nm. No evidence, however, is to be seen of a lower limit for photosynthesis and, in fact, some experiments down to 300 nm still did not show a decrease of the absorption although it is well recognized that no photosynthesis results with 300 nm wavelengths.

  13. Non-destructive linear model for leaf area estimation in Vernonia ferruginea Less

    Directory of Open Access Journals (Sweden)

    MC. Souza

    Full Text Available Leaf area estimation is an important biometrical trait for evaluating leaf development and plant growth in field and pot experiments. We developed a non-destructive model to estimate the leaf area (LA of Vernonia ferruginea using the length (L and width (W leaf dimensions. Different combinations of linear equations were obtained from L, L2, W, W2, LW and L2W2. The linear regressions using the product of LW dimensions were more efficient to estimate the LA of V. ferruginea than models based on a single dimension (L, W, L2 or W2. Therefore, the linear regression “LA=0.463+0.676WL” provided the most accurate estimate of V. ferruginea leaf area. Validation of the selected model showed that the correlation between real measured leaf area and estimated leaf area was very high.

  14. Control of Fe(O,OH)6 nano-network structures of rust for high atmospheric-corrosion resistance

    International Nuclear Information System (INIS)

    Kimura, Masao; Kihira, Hiroshi; Ohta, Noriaki; Hashimoto, Misao; Senuma, Takehide

    2005-01-01

    A new-type of weathering steel containing 3.0 mass% Ni and 0.4 mass% Cu ('advanced weathering steel') exhibits good atmospheric-corrosion resistance in an atmosphere containing relatively high air-born salinity. Here, we show that the high performance was successfully achieved by controlling Fe(O,OH) 6 nano-network structures of rust formed on their surfaces. A novel technique using synchrotron radiation has been developed for the in situ observation of rust-formation during wet-dry cycles. It has been revealed that the evolution of Fe(O,OH) 6 nano-network structures of rust formed on the advanced weathering steel was more unique than those of conventional weathering steel and mild steel. At an early stage of reaction, Fe 2 NiO 4 and CuO phases precipitate, which provide sites for the nucleation of the Fe(O,OH) 6 nano-network resulting in the formation of rust composed of fine and dense-packed grains. The existence of Fe 2 NiO 4 in the nano-network changes the ion-exchanging properties of rust from anion to cation selective. Then, the rust on the advanced weathering steel 'breathes out' chloride ions from the rust/steel interface, and protects steel for more than a century by reducing the life cycle maintenance cost in an environment-friendly manner

  15. High-resolution mapping of genes involved in plant stage-specific partial resistance of barley to leaf rust

    NARCIS (Netherlands)

    Yeo, F.K.S.; Bouchon, R.; Kuijken, R.; Loriaux, A.; Boyd, C.; Niks, R.E.; Marcel, T.C.

    2017-01-01

    Partial resistance quantitative trait loci (QTLs) Rphq11 and rphq16 against Puccinia hordei isolate 1.2.1 were previously mapped in seedlings of the mapping populations Steptoe/Morex and Oregon Wolfe Barleys, respectively. In this study, QTL mapping was performed at adult plant stage for the two

  16. WHEAT LEAF RUST SEVERITY AS AFFECTED BY PLANT DENSITY AND SPECIES PROPORTION IN SIMPLE COMMUNITIES OF WHEAT AND WILD OATS

    Science.gov (United States)

    While it is generally accepted that dense stands of plants exacerbate epidemics caused by foliar pathogens, there is little experimental evidence to support this view. We grew model plant communities consisting of wheat and wild oats at different densities and proportions and exp...

  17. Genetic and molecular characterization of leaf rust resistance in two durum landraces against the durum- specific Puccinia triticina races

    Science.gov (United States)

    The Portuguese durum landraces, Aus26582 and Aus26579, showed resistance against two very different durum-specific Puccinia triticina (Pt) races CA 1.2 and ETH 12.5-2 collected from California and Ethiopia, respectively. Aus26582 and Aus26579 were crossed with a susceptible landrace Bansi to develop...

  18. Uromyces ciceris-arietini, the cause of chickpea rust: new hosts in the Trifolieae, Fabaceae

    Science.gov (United States)

    Plants of Medicago polymorpha in Riverside and San Diego, California were collected with severe rust caused by Uromyces ciceris-arietini. Reported hosts of U. ciceris-arietini are Cicer arietinum (chickpea) and Medicago polyceratia. To confirm the potential new host range, a monouredinial isolate RM...

  19. First Report of Garlic Rust Caused by Puccinia allii on Allium sativum in Minnesota

    Science.gov (United States)

    In July 2010, Allium sativum, cultivar German Extra Hardy Porcelain plants showing foliar symptoms typical of rust infection were brought to the Plant Disease Clinic at the University of Minnesota by a commercial grower from Fillmore county Minnesota. Infected leaves showed circular to oblong lesio...

  20. Expression of a synthetic rust fungal virus cDNA in yeast

    Science.gov (United States)

    Mycoviruses are viruses that infect fungi. Recently, mycovirus-like RNAs were sequenced from the fungus Phakopsora pachyrhizi, the causal agent of soybean rust. One of the RNAs appeared to represent a novel mycovirus and was designated Phakopsora pachyrhizi virus 2383 (PpV2383). The genome of PpV...

  1. Modification of tolerance of oats to crown rust induced by chemical mutagens

    International Nuclear Information System (INIS)

    Simons, M.D.; Browning, J.A.; Frey, K.J.

    1983-01-01

    Seeds of crown rust (Puccinia coronata) susceptible cultivated oats (Avena sativa) were treated with the mutagenic chemical ethyl methanesulphonate (EMS), and pure lines derived from these treated seeds were tested in later generations for the relative amount of reduction in yield and seed weight caused by crown rust infection. In the absence of crown rust, the yield of most of the treated lines was greatly reduced. The overall means of the treated lines for both yield and seed weight response to infection were significantly lower than the control, but 10 lines significantly exceeded the control for yield response and 15 exceeded it for seed weight response. Recurrent EMS treatment of once-treated lines rated as tolerant resulted in groups of lines that were more tolerant, on the average, than groups of lines from recurrently treated lines rated as susceptible. A few of the recurrently treated individual lines derived from tolerant parents had a higher degree of tolerance than their parental lines. EMS treatment of diploid (A. strigosa) and tetraploid (A. abyssinica) oats resulted in groups of lines showing significant genetic variance for response to crown rust, indicating that treatment had induced real genetic change. A few diploid lines were a little more tolerant than their control, but none of the tetraploid lines showed any consistent improvement. (author)

  2. Monitoring white pine blister rust infection and mortality in whitebark pine in the Greater Yellowstone ecosystem

    Science.gov (United States)

    Cathie Jean; Erin Shanahan; Rob Daley; Gregg DeNitto; Dan Reinhart; Chuck Schwartz

    2011-01-01

    There is a critical need for information on the status and trend of whitebark pine (Pinus albicaulis) in the Greater Yellowstone Ecosystem (GYE). Concerns over the combined effects of white pine blister rust (WPBR, Cronartium ribicola), mountain pine beetle (MPB, Dendroctonus ponderosae), and climate change prompted an interagency working group to design and implement...

  3. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  4. Sequencing Ug99 and Other Stem Rust Races: Progress and Results

    Science.gov (United States)

    Over the last decade a number of different molecular methods have been used to characterize genetic diversity in Puccinia graminis. Multilocus DNA fingerprinting methods (AFLPs, RAPDs, SAMs and S-SAPs) have proven to be useful, but limited to phenotypic analysis due to the dikaryotic nature of rust ...

  5. Somatic recombination in wheat stem rust leads to virulence for Ug99-effective SR50 resistance

    Science.gov (United States)

    Race-specific resistance genes protect much of the global wheat crop from stem rust disease caused by Puccinia graminis f. sp. tritici (Pgt), but often break down due to evolution of new virulent pathogen races. To understand the molecular mechanisms of virulence evolution in Pgt we identified the p...

  6. Label-Free Detection of Soybean Rust Spores using Photonic Crystal Biosensors

    Science.gov (United States)

    Soybean rust, caused by the fungus Phakopsora pachyrhizi, is one of the most devastating foliar diseases affecting soybeans grown worldwide. The disease was reported for the first time in the United States in 2004. Early spore detection, prior to the appearance of visible symptoms, is critical to ef...

  7. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections

    Science.gov (United States)

    Rust fungi infect a wide range of plant species making them of particular interest to plant pathologists. In order to study the interactions between these important pathogenic fungi and their host plants it is useful to be able to differentiate fungal tissue from plant tissue. This can be accomplish...

  8. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  9. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  10. Conservation of biodiversity in sugar pine: effects of the blister rust epidemic on genetic diversity

    Science.gov (United States)

    Constance I. Millar; Bohun B. Kinloch; Robert D. Westfall

    1992-01-01

    Genetic diversity in sugar plne will be severely reduced by the blister rust pandemic predicted within the next 50 to 75 years. We model effects of the epidemic on genetic diversity at the stand and landscape levels for both natural and artificial regeneration. In natural stands, because natural frequencies of the dominant gene (R) for resistance are low, the most...

  11. Copper-mediated reductive dechlorination by green rust intercalated with dodecanoate

    DEFF Research Database (Denmark)

    Huang, Lizhi; Yin, Zhou; Cooper, Nicola G.A.

    2018-01-01

    A layered FeII-FeIII hydroxide (green rust, GR) was intercalated with dodecanoate (known as GRC12) and then amended with CuII (GRC12(Cu)) before reaction with chloroform (CF), carbon tetrachloride (CT), trichloroethylene (TCE) or tetrachloroethylene (PCE). Reduction of CT by GRC12(Cu) was 37 times...

  12. Glycine buffered synthesis of layered iron(II)-iron(III) hydroxides (green rusts)

    DEFF Research Database (Denmark)

    Yin, Weizhao; Huang, Lizhi; Pedersen, Emil Bjerglund

    2017-01-01

    Layered Fe(II)-Fe(III) hydroxides (green rusts, GRs) are efficient reducing agents against oxidizing contaminants such as chromate, nitrate, selenite, and nitroaromatic compounds and chlorinated solvents. In this study, we adopted a buffered precipitation approach where glycine (GLY) was used...

  13. Multi-location wheat stripe rust QTL analysis: genetic background and epistatic interactions.

    Science.gov (United States)

    Vazquez, M Dolores; Zemetra, Robert; Peterson, C James; Chen, Xianming M; Heesacker, Adam; Mundt, Christopher C

    2015-07-01

    Epistasis and genetic background were important influences on expression of stripe rust resistance in two wheat RIL populations, one with resistance conditioned by two major genes and the other conditioned by several minor QTL. Stripe rust is a foliar disease of wheat (Triticum aestivum L.) caused by the air-borne fungus Puccinia striiformis f. sp. tritici and is present in most regions around the world where commercial wheat is grown. Breeding for durable resistance to stripe rust continues to be a priority, but also is a challenge due to the complexity of interactions among resistance genes and to the wide diversity and continuous evolution of the pathogen races. The goal of this study was to detect chromosomal regions for resistance to stripe rust in two winter wheat populations, 'Tubbs'/'NSA-98-0995' (T/N) and 'Einstein'/'Tubbs' (E/T), evaluated across seven environments and mapped with diversity array technology and simple sequence repeat markers covering polymorphic regions of ≈1480 and 1117 cM, respectively. Analysis of variance for phenotypic data revealed significant (P located in chromosomes 2AS and 6AL, with epistatic interaction between them, were responsible for the main phenotypic response. For the T/N population, eight QTL were identified, with those in chromosomes 2AL and 2BL accounting for the largest percentage of the phenotypic variance.

  14. Strong partial resistance to white pine blister rust in sugar pine

    Science.gov (United States)

    Bohun B. Kinloch, Jr.; Deems Burton; Dean A. Davis; Robert D. Westfall; Joan Dunlap; Detlev Vogler

    2012-01-01

    Quantitative resistance to white pine blister rust in 128 controlled- and open-pollinated sugar pine families was evaluated in a “disease garden”, where alternate host Ribes bushes were interplanted among test progenies. Overall infection was severe (88%), but with great variation among and within families: a 30-fold range in numbers of infections...

  15. The rust fungus Gymnosporangium in Korea including two new species, G. monticola and G. unicorne

    Science.gov (United States)

    A survey was conducted of species of the rust fungus Gymnosporangium in Korea. The previously known species were recollected, namely Gymnosporangium asiaticum, G. clavariiforme, G. globosum, G. japonicum, and G. yamadae. Although G. cornutum was reported from Korea, collections similar to that speci...

  16. Sources of stem rust resistance in wheat-alien introgression lines

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  17. Selection for resistance to white pine blister rust affects the abiotic stress tolerances of limber pine

    Science.gov (United States)

    Patrick J. Vogan; Anna W. Schoettle

    2015-01-01

    Limber pine (Pinus flexilis) mortality is increasing across the West as a result of the combined stresses of white pine blister rust (Cronartium ribicola; WPBR), mountain pine beetle (Dendroctonus ponderosae), and dwarf mistletoe (Arceuthobium cyanocarpum) in a changing climate. With the continued spread of WPBR, extensive mortality will continue with strong selection...

  18. Green rust formation controls nutrient availability in a ferruginous water column

    DEFF Research Database (Denmark)

    Zegeye, Asfaw; Bonneville, Steeve; Benning, Liane G.

    2013-01-01

    a mechanism for reconstructing ancient ocean chemistry. Such reconstructions depend, however, on precise knowledge of the iron minerals formed in the water column. Here, we combine mineralogical and geochemical analyses to demonstrate formation of the mixed-valence iron mineral, green rust, in ferruginous...

  19. Antibiotics Do Not Control Blister Rust in Eastern White Pine Seedlings

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1968-01-01

    To prevent blister rust infections in Eastern white pine seedlings, the antibiotics, cycloheximide (acti-dione) and Phytoactin, were tested in root dips, root slurries, and foliar drenches before planting and after planting the trees. None of the methods and materials tested was effective.

  20. The formation of green rust induced by tropical river biofilm components

    International Nuclear Information System (INIS)

    Jorand, F.; Zegeye, A.; Ghanbaja, J.; Abdelmoula, M.

    2011-01-01

    In the Sinnamary Estuary (French Guiana), a dense red biofilm grows on flooded surfaces. In order to characterize the iron oxides in this biofilm and to establish the nature of secondary minerals formed after anaerobic incubation, we conducted solid analysis and performed batch incubations. Elemental analysis indicated a major amount of iron as inorganic compartment along with organic matter. Solid analysis showed the presence of two ferric oxides ferrihydrite and lepidocrocite. Bacteria were abundant and represented more than 10 11 cells g -1 of dry weight among which iron reducers were revealed. Optical and electronic microscopy analysis revealed than the bacteria were in close vicinity of the iron oxides. After anaerobic incubations with exogenous electron donors, the biofilm's ferric material was reduced into green rust, a Fe II -Fe III layered double hydroxide. This green rust remained stable for several years. From this study and previous reports, we suggest that ferruginous biofilms should be considered as a favorable location for GR biomineralization when redox conditions and electron donors availability are gathered. - Research highlights: → Characterization of ferruginous biofilm components by solid analysis methods. → Lepidocrocite and ferrihydrite were the main iron oxides. → Anaerobic incubation of biofilm with electron donors produced green rust. → Biofilm components promote the formation of the green rust. → Ferruginous biofilm could contribute to the natural mercury attenuation.

  1. The formation of green rust induced by tropical river biofilm components

    Energy Technology Data Exchange (ETDEWEB)

    Jorand, F., E-mail: jorand@pharma.uhp-nancy.fr [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France); Zegeye, A. [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France); Ghanbaja, J. [Service Commun de Microscopies Electroniques et Microanalyses X (SCMEM), Nancy-Universite, Bvd des Aiguillettes, BP 239, 54506, Vandoeuvre-les-Nancy (France); Abdelmoula, M. [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France)

    2011-06-01

    In the Sinnamary Estuary (French Guiana), a dense red biofilm grows on flooded surfaces. In order to characterize the iron oxides in this biofilm and to establish the nature of secondary minerals formed after anaerobic incubation, we conducted solid analysis and performed batch incubations. Elemental analysis indicated a major amount of iron as inorganic compartment along with organic matter. Solid analysis showed the presence of two ferric oxides ferrihydrite and lepidocrocite. Bacteria were abundant and represented more than 10{sup 11} cells g{sup -1} of dry weight among which iron reducers were revealed. Optical and electronic microscopy analysis revealed than the bacteria were in close vicinity of the iron oxides. After anaerobic incubations with exogenous electron donors, the biofilm's ferric material was reduced into green rust, a Fe{sup II}-Fe{sup III} layered double hydroxide. This green rust remained stable for several years. From this study and previous reports, we suggest that ferruginous biofilms should be considered as a favorable location for GR biomineralization when redox conditions and electron donors availability are gathered. - Research highlights: {yields} Characterization of ferruginous biofilm components by solid analysis methods. {yields} Lepidocrocite and ferrihydrite were the main iron oxides. {yields} Anaerobic incubation of biofilm with electron donors produced green rust. {yields} Biofilm components promote the formation of the green rust. {yields} Ferruginous biofilm could contribute to the natural mercury attenuation.

  2. Evaluation of brown rust resistance in the Louisiana basic breeding program’s first clonal trial

    Science.gov (United States)

    Over the past decade, the Louisiana sugarcane industry has experienced increasing levels of pressure from brown rust (Puccinia melanocephala). In 2000, an epidemic spread throughout the Louisiana industry, severely affecting the state’s top yielding variety, previously resistant LCP85-384, which at ...

  3. Identification of RAPD marker associated with brown rust resistance in sugarcane

    Science.gov (United States)

    Susceptibility to brown rust caused by Puccinia melanocephala is a major reason for the withdrawal of sugarcane cultivars from production. An efficient way to control the disease is to breed cultivars with durable resistance. Our aim was to identify random amplified polymorphic DNA (RAPD) markers ...

  4. Genotyping Sugarcane for the Brown Rust Resistance Locus Bru1 Using Unlabeled Probe Melting

    Science.gov (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is a major disease of sugarcane (Saccharum spp.) in Florida, Louisiana, and other sugarcane growing regions. The Bru1 locus has been used as a durable and effective source of resistance, and markers are available to select for the trait. The...

  5. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    Unknown

    areas of temperate zones (Johnson 1988). Yield losses can be considerable, ranging from about 40 per cent to com- plete destruction of the crop depending upon the growth stage at which the disease attacks. Using diverse genes for resistance against stripe rust disease is the most eco- nomical and environmentally safe ...

  6. First Report of Orange Rust of Sugarcane caused by Puccinia kuehnii in Ecuador

    Science.gov (United States)

    Orange rust, Puccinia kuehnii (W. Krüger) E.J. Butler, is an important disease of sugarcane (complex hybrid of Saccharum L. species) that causes yield losses, and impacts breeding programs. Initially confined to the Asia-Oceania region (5), P. kuehnii was reported in Florida in June 2007 (2) and lat...

  7. Harvest intensity and competition control impacts on loblolly pine fusiform rust incidence

    Science.gov (United States)

    Robert J. Eaton; Paula Spaine; Felipe G. Sanchez

    2006-01-01

    The Long Term Soil Productivity experiment tests the effects of soil compaction, surface organic matter removal, and understory control on net primary productivity. An unintended consequence of these treatments may be an effect on the incidence of fusiform rust [Cronartium quercuum (Berk.) Miy. ex Shirai f. sp. fusiforme Burdsall et Snow]. Loblolly pine (Pinus...

  8. Rust resistance in seedling families of Pinus albicaulis and Pinus strobiformis and implications for restoration

    Science.gov (United States)

    R. A. Sniezko; A. Kegley; R. Danchok; J. Hamlin; J. Hill; D. Conklin

    2011-01-01

    Infection and mortality levels from Cronartium ribicola, the fungus causing white pine blister rust, are very high in parts of the geographic range of Pinus albicaulis (whitebark pine) and P. strobiformis (Southwestern white pine). Genetic resistance to this non-native fungus will be one of the key factors in maintaining or restoring populations of these species in...

  9. Phylogeny and taxonomy of grass rusts with aecia on Ranunculus and Ficaria

    Czech Academy of Sciences Publication Activity Database

    Hrabětová, M.; Kolařík, Miroslav; Marková, J.

    2015-01-01

    Roč. 14, č. 3 (2015) ISSN 1617-416X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Rust fungi * Pucciniales * Puccinia Subject RIV: EE - Microbiology, Virology Impact factor: 1.572, year: 2015

  10. ARSENATE AND ARSENITE SORPTION AND ARSENITE OXIDATION BY IRON (II, III) HYDROXYCARBONATE GREEN RUST

    Science.gov (United States)

    Iron (II, III) hydroxycarbonate green rust is a major corrosion product of zerovalent iron that is being used in permeable reactive barriers to remediate groundwater arsenic contamination. To optimize the design of iron barriers, it is important to evaluate the influence of geoch...

  11. URS Brava – a new oat cultivar with partial resistance to crown rust

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Federizzi

    2015-08-01

    Full Text Available The cultivar URS Brava, obtained from a simple cross between the line ‘UFRGS 995078-2’ and the cultivar ‘URS 21’, shows high grain yield and stability, high grain quality, desirable agronomical traits and partial resistance to crown rust, caused by the fungus Puccinia coronata f. sp. avenae.

  12. Paradoxes in Policy Practice: Signaling Postsecondary Pathways in the Rust Belt

    Science.gov (United States)

    Mitra, Dana; Halabi, Saamira

    2012-01-01

    Context: Research increasingly suggests that the high school diploma has lost its meaning as a symbol of life preparation. Having faced economic struggles earlier and longer than most regions of the United States, the "Rust Belt" region offers important lessons for the broader nation regarding how high schools might prepare youth for…

  13. Preempting the pathogen: Blister rust and proactive management of high-elevation pines

    Science.gov (United States)

    Sue Miller; Anna Schoettle; Kelly Burns; Richard Sniezko; Patty Champ

    2017-01-01

    White pine blister rust has been spreading through western forests since 1910, causing widespread mortality in a group that includes some of the oldest and highest-elevation pines in the United States. The disease has recently reached Colorado and is expected to travel through the southern Rockies. Although it cannot be contained, RMRS researchers and collaborators are...

  14. Civic Capacity in Educational Reform Efforts: Emerging and Established Regimes in Rust Belt Cities

    Science.gov (United States)

    Mitra, Dana L.; Frick, William C.

    2011-01-01

    Using urban regime theory, the article examines two Rust Belt cities that tried to break the cycle of social reproduction in their communities by reforming their schools. The article contributes to the development of urban regime theory by comparing an "emerging" regime to an "established" regime. The comparison highlights the interdependent…

  15. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823

    Science.gov (United States)

    Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance to P. pachyrhizi conditioned by Rpp genes has been found in numerous soybean accessions, and at...

  16. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  17. Flavonoid Accumulation Plays an Important Role in the Rust Resistance of Malus Plant Leaves

    Directory of Open Access Journals (Sweden)

    Yanfen Lu

    2017-07-01

    Full Text Available Cedar-apple rust (Gymnosporangium yamadai Miyabe is a fungal disease that causes substantial injury to apple trees and results in fruit with reduced size and quality and a lower commercial value. The molecular mechanisms underlying the primary and secondary metabolic effects of rust spots on the leaves of Malus apple cultivars are poorly understood. Using HPLC, we found that the contents of flavonoid compounds, especially anthocyanin and catechin, were significantly increased in rust-infected symptomatic tissue (RIT. The expression levels of structural genes and MYB transcription factors related to flavonoid biosynthesis were one- to seven-fold higher in the RIT. Among these genes, CHS, DFR, ANS, FLS and MYB10 showed more than a 10-fold increase, suggesting that these genes were expressed at significantly higher levels in the RIT. Hormone concentration assays showed that the levels of abscisic acid (ABA, ethylene (ETH, jasmonate (JA and salicylic acid (SA were higher in the RIT and were consistent with the expression levels of McNCED, McACS, McLOX and McNPR1, respectively. Our study explored the complicated crosstalk of the signal transduction pathways of ABA, ETH, JA and SA; the primary metabolism of glucose, sucrose, fructose and sorbitol; and the secondary metabolism of flavonoids involved in the rust resistance of Malus crabapple leaves.

  18. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    SONY

    2013-05-01

    May 1, 2013 ... accelerating wheat production in the last forty years and ensured food security of the Nation. In the present investigation, Sr2 specific molecular markers were used to assess their efficacy for assessing the deployment of Sr2 gene in Indian wheat cultivars of highly productive north-west plains and stem rust ...

  19. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  20. Limber pine forests on the leading edge of white pine blister rust distribution in Northern Colorado

    Science.gov (United States)

    Jennifer G. Klutsch; Betsy A. Goodrich; Anna W. Schoettle

    2011-01-01

    The combined threats of the current mountain pine beetle (Dendroctonus ponderosae, MPB) epidemic with the imminent invasion of white pine blister rust (caused by the non-native fungus Cronartium ribicola, WPBR) in limber pine (Pinus flexilis) forests in northern Colorado threatens the limber pine's regeneration cycle and ecosystem function. Over one million...

  1. Histology of white pine blister rust in needles of resistant and susceptible eastern white pine

    Science.gov (United States)

    Joel A. Jurgens; Robert A. Blanchette; Paul J. Zambino; Andrew David

    2003-01-01

    White pine blister rust, Cronartium ribicola, has plagued the forests of North America for almost a century. Over past decades, eastern white pine (Pinus strobus) that appear to tolerate the disease have been selected and incorporated into breeding programs. Seeds from P. strobus with putative resistance were...

  2. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran

    2015-12-01

    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  3. Scaling up stomatal conductance from leaf to canopy using a dual-leaf model for estimating crop evapotranspiration.

    Directory of Open Access Journals (Sweden)

    Risheng Ding

    Full Text Available The dual-source Shuttleworth-Wallace model has been widely used to estimate and partition crop evapotranspiration (λET. Canopy stomatal conductance (Gsc, an essential parameter of the model, is often calculated by scaling up leaf stomatal conductance, considering the canopy as one single leaf in a so-called "big-leaf" model. However, Gsc can be overestimated or underestimated depending on leaf area index level in the big-leaf model, due to a non-linear stomatal response to light. A dual-leaf model, scaling up Gsc from leaf to canopy, was developed in this study. The non-linear stomata-light relationship was incorporated by dividing the canopy into sunlit and shaded fractions and calculating each fraction separately according to absorbed irradiances. The model includes: (1 the absorbed irradiance, determined by separately integrating the sunlit and shaded leaves with consideration of both beam and diffuse radiation; (2 leaf area for the sunlit and shaded fractions; and (3 a leaf conductance model that accounts for the response of stomata to PAR, vapor pressure deficit and available soil water. In contrast to the significant errors of Gsc in the big-leaf model, the predicted Gsc using the dual-leaf model had a high degree of data-model agreement; the slope of the linear regression between daytime predictions and measurements was 1.01 (R2 = 0.98, with RMSE of 0.6120 mm s-1 for four clear-sky days in different growth stages. The estimates of half-hourly λET using the dual-source dual-leaf model (DSDL agreed well with measurements and the error was within 5% during two growing seasons of maize with differing hydrometeorological and management strategies. Moreover, the estimates of soil evaporation using the DSDL model closely matched actual measurements. Our results indicate that the DSDL model can produce more accurate estimation of Gsc and λET, compared to the big-leaf model, and thus is an effective alternative approach for estimating and

  4. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2015-07-01

    Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in

  5. Stem rust (Puccinia graminis ssp. graminicola Urban its hosts and harmfulness in grasses grown for seed

    Directory of Open Access Journals (Sweden)

    Maria Prończuk

    2013-12-01

    Full Text Available Stem rust development on four species of grasses was studied in field experiments conducted at Radzików in 1997-2001. Population of Puccinia graminis ssp. graminicola from different hosts was characterised and their harmfulness for grass grown for seed was estimated. The materials for study were ecotypes and strains of Lolium perenne, Festuca rubra, Poa pratensis and Deschampsia caespitosa collected in breeding nursery and cultivars and strains of L.perenne, F.rubra, P.pratensis cultivated for seed. It was found that the changes in environmental conditions during last years influenced earlier occurrence of stem rust on grasses in Poland. All examined species were the host of P.graminis ssp. graminicola, however the period of infection of particular hosts were different. L.perenne and D.caespitosa were infected in early summer but F.rubra and P.pratensis in late summer or in the autumn. Morphological analysis of spores of P.graminis ssp. graminicola have shoved significant differences between populations obtained from L.perenne and D.caespitosa. Some differences were found between populations from F.rubra and P.pratensis also, but they need more study. Every year occurrence of stem rust on L.perenne and D.caespitosa and its relation with spring temperature in Radzików indicated that populations of patogen could overwinter in local turf. Incidental appearance of stem rust on F.rubra and P.pratensis in centre of Poland allowed to suppose that spores of these forms might be transfer by wind from other regions. The investigation revealed that stem rust can be dangerous for L.perenne grown for seed when infection occurs at flowering time. It has been established that infection of F.rubra and P.pratensis in autumn should not be disregarded. Damages of leaves by P.graminis ssp. graminicola substantially limited plant heading in the next year.

  6. (TECTONA GRANDIS LEAF POWDER

    Directory of Open Access Journals (Sweden)

    Yash Mishra

    2015-01-01

    Full Text Available In this study, the adsorption potential of Teak (Tectona grandis leaf powder (TLP toremove Methylene blue (MB and Malachite Green (MG dye molecules from aqueoussolution was investigated. Batch experiments were conducted to evaluate the influenceof operational parameters such as, pH (2−9, adsorbent dosage (1−7 g/L, contact time(15−150 minutes and initial dye concentration (20−120 mg/L at stirring speed of 150rpm for the adsorption of MB and MG on TLP. Maximum removal efficiency of 98.4%and 95.1% was achieved for MB and MG dye, respectively. The experimentalequilibrium data were analysed using Langmuir, Freundlich and Temkin isothermmodels and it was found that, it fitted well to the Freundlich isotherm model. Thesurface structure and morphology of the adsorbent was characterized using scanningelectron microscopy (SEM and the presence of functional groups and its interactionwith the dye molecules were analysed using Fourier transform infrared spectroscopy(FTIR. Based on the investigation, it has been demonstrated that the teak leaf powderhas good potential for effective adsorption of methylene blue and malachite green dye.

  7. X-ray diffraction analysis of rust layer on a weathering steel bridge with surface treatment using synchrotron radiation

    International Nuclear Information System (INIS)

    Yamashita, Masato; Hara, Shuichi; Kamimura, Takayuki; Miyuki, Hideaki; Sato, Masugu

    2007-01-01

    We have examined the structure of rust layer formed on a weathering steel bridge, to which the surface treatment, employing the effect of Cr 2 (SO 4 ) 3 sophisticatedly designed to form the protective goethite (α-FeOOH) rust layer which contains a certain amount of Cr, Cr-goethite, was applied in 1996, using X-ray diffraction at SPring-8 synchrotron radiation facility. It was shown that the formation of α-FeOOH was promoted and/or crystal growth of γ-FeOOH was suppressed by the surface treatment. The increase in the protective ability index (PAI) of the rust layer indicates that the protective goethite was predominantly formed under the effect of the surface treatment. In conclusion, it can be said that the surface treatment worked well to promote the formation of the protective goethite rust layer on the weathering steel bridge during the 10-year exposure. (author)

  8. Impairment of leaf photosynthesis after insect herbivory or mechanical injury on common milkweed, Asclepias syriaca.

    Science.gov (United States)

    Delaney, K J; Haile, F J; Peterson, R K D; Higley, L G

    2008-10-01

    Insect herbivory has variable consequences on plant physiology, growth, and reproduction. In some plants, herbivory reduces photosynthetic rate (Pn) activity on remaining tissue of injured leaves. We sought to better understand the influence of leaf injury on Pn of common milkweed, Asclepias syriaca (Asclepiadaceae), leaves. Initially, we tested whether Pn reductions occurred after insect herbivory or mechanical injury. We also (1) examined the duration of photosynthetic recovery, (2) compared mechanical injury with insect herbivory, (3) studied the relationship between leaf Pn with leaf injury intensity, and (4) considered uninjured leaf compensatory Pn responses neighboring an injured leaf. Leaf Pn was significantly reduced on mechanically injured or insect-fed leaves in all reported experiments except one, so some factor(s) (cardiac glycoside induction, reproductive investment, and water stress) likely interacts with leaf injury to influence whether Pn impairment occurs. Milkweed tussock moth larval herbivory, Euchaetes egle L. (Arctiidae), impaired leaf Pn more severely than mechanical injury in one experiment. Duration of Pn impairment lasted > 5 d to indicate high leaf Pn sensitivity to injury, but Pn recovery occurred within 13 d in one experiment. The degree of Pn reduction was more severe from E. egle herbivory than similar levels of mechanical tissue removal. Negative linear relationships characterized leaf Pn with percentage tissue loss from single E. egle-fed leaves and mechanically injured leaves and suggested that the signal to trigger leaf Pn impairment on remaining tissue of an injured leaf was amplified by additional tissue loss. Finally, neighboring uninjured leaves to an E. egle-fed leaf had a small (approximately 10%) degree of compensatory Pn to partly offset tissue loss and injured leaf Pn impairment.

  9. Investigation of Leaf Diseases and Estimation of Chlorophyll Concentration in Seven Barley Varieties Using Fluorescence and Hyperspectral Indices

    Directory of Open Access Journals (Sweden)

    Kang Yu

    2013-12-01

    Full Text Available Leaf diseases, such as powdery mildew and leaf rust, frequently infect barley plants and severely affect the economic value of malting barley. Early detection of barley diseases would facilitate the timely application of fungicides. In a field experiment, we investigated the performance of fluorescence and reflectance indices on (1 detecting barley disease risks when no fungicide is applied and (2 estimating leaf chlorophyll concentration (LCC. Leaf fluorescence and canopy reflectance were weekly measured by a portable fluorescence sensor and spectroradiometer, respectively. Results showed that vegetation indices recorded at canopy level performed well for the early detection of slightly-diseased plants. The combined reflectance index, MCARI/TCARI, yielded the best discrimination between healthy and diseased plants across seven barley varieties. The blue to far-red fluorescence ratio (BFRR_UV and OSAVI were the best fluorescence and reflectance indices for estimating LCC, respectively, yielding R2 of 0.72 and 0.79. Partial least squares (PLS and support vector machines (SVM regression models further improved the use of fluorescence signals for the estimation of LCC, yielding R2 of 0.81 and 0.84, respectively. Our results demonstrate that non-destructive spectral measurements are able to detect mild disease symptoms before significant losses in LCC due to diseases under natural conditions.

  10. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  11. [Prediction model of meteorological grade of wheat stripe rust in winter-reproductive area, Sichuan Basin, China].

    Science.gov (United States)

    Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi

    2017-12-01

    The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.

  12. Rust Layer Formed on Low Carbon Weathering Steels with Different Mn, Ni Contents in Environment Containing Chloride Ions

    Directory of Open Access Journals (Sweden)

    Gui-qin FU

    2016-11-01

    Full Text Available The rusting evolution of low carbon weathering steels with different Mn, Ni contents under a simulated environment containing chloride ions has been investigated to clarify the correlation between Mn, Ni and the rust formed on steels. The results show that Mn contents have little impact on corrosion kinetics of experimental steels. Content increase of Ni both enhances the anti-corrosion performance of steel substrate and the rust. Increasing Ni content is beneficial to forming compact rust. Semi-quantitative XRD phase analysis shows that the quantity ratio of α/γ*(α-FeOOH/(γ-FeOOH+Fe3O4 decreases as Mn content increases but it increases as Ni content increases. Ni enhances rust layer stability but Mn content exceeding 1.06 wt.% is disadvantageous for rust layer stability. The content increase of Mn does not significantly alter the parameters of the polarization curve. However, as Ni contents increases, Ecorr has shifted to the positive along with decreased icorr values indicating smaller corrosion rate especially as Ni content increases from 0.42 wt.% to 1.50 wt.%.DOI: http://dx.doi.org/10.5755/j01.ms.22.4.12844

  13. Identifying Quantitative Trait Loci (QTLs) and Developing Diagnostic Markers Linked to Orange Rust Resistance in Sugarcane (Saccharum spp.).

    Science.gov (United States)

    Yang, Xiping; Islam, Md S; Sood, Sushma; Maya, Stephanie; Hanson, Erik A; Comstock, Jack; Wang, Jianping

    2018-01-01

    Sugarcane ( Saccharum spp.) is an important economic crop, contributing up to 80% of table sugar used in the world and has become a promising feedstock for biofuel production. Sugarcane production has been threatened by many diseases, and fungicide applications for disease control have been opted out for sustainable agriculture. Orange rust is one of the major diseases impacting sugarcane production worldwide. Identifying quantitative trait loci (QTLs) and developing diagnostic markers are valuable for breeding programs to expedite release of superior sugarcane cultivars for disease control. In this study, an F 1 segregating population derived from a cross between two hybrid sugarcane clones, CP95-1039 and CP88-1762, was evaluated for orange rust resistance in replicated trails. Three QTLs controlling orange rust resistance in sugarcane (qORR109, qORR4 and qORR102) were identified for the first time ever, which can explain 58, 12 and 8% of the phenotypic variation, separately. We also characterized 1,574 sugarcane putative resistance ( R ) genes. These sugarcane putative R genes and simple sequence repeats in the QTL intervals were further used to develop diagnostic markers for marker-assisted selection of orange rust resistance. A PCR-based Resistance gene-derived maker, G1 was developed, which showed significant association with orange rust resistance. The putative QTLs and marker developed in this study can be effectively utilized in sugarcane breeding programs to facilitate the selection process, thus contributing to the sustainable agriculture for orange rust disease control.

  14. 75 FR 53861 - Airworthiness Directives; Robert E. Rust, Jr. Model DeHavilland DH.C1 Chipmunk 21, DH.C1 Chipmunk...

    Science.gov (United States)

    2010-09-02

    ... Airworthiness Directives; Robert E. Rust, Jr. Model DeHavilland DH.C1 Chipmunk 21, DH.C1 Chipmunk 22, and DH.C1...). ACTION: Final rule. SUMMARY: We are adopting a new airworthiness directive (AD) for all Robert E. Rust... CFR part 39) to include an AD that would apply to all Robert E. Rust, Jr. Models DeHavilland DH.C1...

  15. Difference between Cr and Ni K-edge XANES spectra of rust layers formed on Fe-based binary alloys exposed to Cl-rich environment

    International Nuclear Information System (INIS)

    Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi

    2005-01-01

    The rust layer formed on weathering steel possesses a strong protective ability against corrosives in an atmospheres. This ability is related to the structure of the rust layer. The difference in the protective ability of a rust layer. The difference in the protective ability of a rust layer in a Cl-rich environment between conventional weathering steel containing Cr and advanced weathering steel containing Ni is believed to be caused by the differences in local structural and chemical properties between alloying elements. Cr and Ni, in the rust layer. In order to examine the effect of these alloying elements on the structure of the rust layer formed on steel in a Cl-rich environment, we have performed Cr and Ni K-edge X-ray absorption near-edge structure (XANES) measurements for the rust layer of Fe-Cr and Fe-Ni binary alloys exposed to a Cl-rich atmosphere using synchrotron radiation. The results of the Cr K-edge XANES measurements for the rust layer of Fe-Cr binary alloys show that the atomic geometry around Cr depends on the concentration of Cr. Therefore, it is expected that the local structure around Cr in the rust layer is unstable. On the other hand, from the results of the Ni K-edge XANES measurements for the rust layer of Fe-Ni binary alloys. Ni is considered to be positioned at a specific site in the crystal structure of a constituent of the rust layer, such as akaganeite or magnetite. As a consequence, Ni negligibly interacts with Cl - ions in the rust layer. (author)

  16. Kinetics of structural rust transformation in environments containing chloride and SO2

    Directory of Open Access Journals (Sweden)

    Valencia, A.

    2003-12-01

    Full Text Available The behavior of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Mössbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behavior in rust formation. For this ratio, corrosion rates were much less than expected. It is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres.Se estudió el comportamiento de las herrumbres de un acero de bajo carbono expuesto en la simulación de atmósferas industriales con diferentes distancias al mar, con del ciclo de humectación y secado en el ensayo CEBELCOR y en soluciones representativas de las atmósferas en cuestión. Se hizo seguimiento del potencial de electrodo de los cuerpos de prueba y se analizó la capa de productos de corrosión por técnicas gravimétricas, microscopía óptica y espectroscopia Mössbauer. Se determinó un valor de cloruros y sulfatos en la atmósfera que genera un comportamiento particular en la formación de la herrumbre, presentando velocidades de corrosión menores a las esperadas para el tenor de agentes agresivos, y se postuló un mecanismo cinético en la formación de la película como causante del fenómeno particular. Se observó un comportamiento del potencial próximo al de un acero autoprotector, que se refleja en una menor velocidad de corrosión. La propuesta del mecanismo cin

  17. Whitebark pine mortality related to white pine blister rust, mountain pine beetle outbreak, and water availability

    Science.gov (United States)

    Shanahan, Erin; Irvine, Kathryn M.; Thoma, David P.; Wilmoth, Siri K.; Ray, Andrew; Legg, Kristin; Shovic, Henry

    2016-01-01

    Whitebark pine (Pinus albicaulis) forests in the western United States have been adversely affected by an exotic pathogen (Cronartium ribicola, causal agent of white pine blister rust), insect outbreaks (Dendroctonus ponderosae, mountain pine beetle), and drought. We monitored individual trees from 2004 to 2013 and characterized stand-level biophysical conditions through a mountain pine beetle epidemic in the Greater Yellowstone Ecosystem. Specifically, we investigated associations between tree-level variables (duration and location of white pine blister rust infection, presence of mountain pine beetle, tree size, and potential interactions) with observations of individual whitebark pine tree mortality. Climate summaries indicated that cumulative growing degree days in years 2006–2008 likely contributed to a regionwide outbreak of mountain pine beetle prior to the observed peak in whitebark mortality in 2009. We show that larger whitebark pine trees were preferentially attacked and killed by mountain pine beetle and resulted in a regionwide shift to smaller size class trees. In addition, we found evidence that smaller size class trees with white pine blister rust infection experienced higher mortality than larger trees. This latter finding suggests that in the coming decades white pine blister rust may become the most probable cause of whitebark pine mortality. Our findings offered no evidence of an interactive effect of mountain pine beetle and white pine blister rust infection on whitebark pine mortality in the Greater Yellowstone Ecosystem. Interestingly, the probability of mortality was lower for larger trees attacked by mountain pine beetle in stands with higher evapotranspiration. Because evapotranspiration varies with climate and topoedaphic conditions across the region, we discuss the potential to use this improved understanding of biophysical influences on mortality to identify microrefugia that might contribute to successful whitebark pine conservation

  18. Modeling canopy-level productivity: is the "big-leaf" simplification acceptable?

    Science.gov (United States)

    Sprintsin, M.; Chen, J. M.

    2009-05-01

    The "big-leaf" approach to calculating the carbon balance of plant canopies assumes that canopy carbon fluxes have the same relative responses to the environment as any single unshaded leaf in the upper canopy. Widely used light use efficiency models are essentially simplified versions of the big-leaf model. Despite its wide acceptance, subsequent developments in the modeling of leaf photosynthesis and measurements of canopy physiology have brought into question the assumptions behind this approach showing that big leaf approximation is inadequate for simulating canopy photosynthesis because of the additional leaf internal control on carbon assimilation and because of the non-linear response of photosynthesis on leaf nitrogen and absorbed light, and changes in leaf microenvironment with canopy depth. To avoid this problem a sunlit/shaded leaf separation approach, within which the vegetation is treated as two big leaves under different illumination conditions, is gradually replacing the "big-leaf" strategy, for applications at local and regional scales. Such separation is now widely accepted as a more accurate and physiologically based approach for modeling canopy photosynthesis. Here we compare both strategies for Gross Primary Production (GPP) modeling using the Boreal Ecosystem Productivity Simulator (BEPS) at local (tower footprint) scale for different land cover types spread over North America: two broadleaf forests (Harvard, Massachusetts and Missouri Ozark, Missouri); two coniferous forests (Howland, Maine and Old Black Spruce, Saskatchewan); Lost Creek shrubland site (Wisconsin) and Mer Bleue petland (Ontario). BEPS calculates carbon fixation by scaling Farquhar's leaf biochemical model up to canopy level with stomatal conductance estimated by a modified version of the Ball-Woodrow-Berry model. The "big-leaf" approach was parameterized using derived leaf level parameters scaled up to canopy level by means of Leaf Area Index. The influence of sunlit

  19. Characterization of the symptoms of sugarcane orange rust (Puccinia kuehnii (W. Kruger E. J. Butler in four sugarcane cultivars in Cuba

    Directory of Open Access Journals (Sweden)

    Osmany de la Caridad Aday Díaz

    2017-07-01

    Full Text Available The characterization of the symptoms of the orange rust was carried out on the Sugar Cane Research Territorial Station (ETICA Centro Villa Clara, of the Sugarcane Research Institute (INICA in Cuba. Ten infected stalks of the cultivars B52107, CSG398-92, C01-227 and Clon218-2011 were evaluated. With a photographic camera the image of the three thirds of 236 leaves infected was captured on a squared paper with well-known distances. By means of the processing of images ImageJ® 1.43u the Affected Foliate Area (AFA was determined to in each third and of the complete leaf, later on the long, wide and area occupied by 554 pustules of the P. kuehnii. In the leaves from +3 at +7 were the intermediate values of AFA for P. kuehnii and this it was significantly major in the superior third of the leaves and minor in the basal part. The most frequent dimensions in the pustules of P. kuehnii reached the length understood between 0.75 and 3.0 mm, between 0.24 and 0.61 mm wide and an area of 1.39 mm2, with differences among cultivars. The emergency of the pustules was generally presented in to add form and with collapsed areas of 2.97 mm2 to 979.8 mm2.

  20. A study of the evolution of rust on Mo–Cu-bearing fire-resistant steel submitted to simulated atmospheric corrosion

    International Nuclear Information System (INIS)

    Hao Long; Zhang Sixun; Dong Junhua; Ke Wei

    2012-01-01

    Highlights: ► The rusting evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated. ► The rusting evolution of the steel is related to the rust composition, structure, and electrochemical characteristics. ► Increased content of α-FeOOH and decreased γ-FeOOH and Fe 3 O 4 indicate the enhanced resistance of the rust. ► Mo and Cu are involved in the formation of molybdate and Cu(I)-bearing compounds in the rust. - Abstract: The corrosion evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated by corrosion weight gain, XRD, EPMA, XPS, and polarization curves. The results indicate that the corrosion kinetics is closely related to the rust composition and electrochemical properties. As the corrosion proceeds, the relative content of γ-FeOOH and Fe 3 O 4 decreases and α-FeOOH increases, and the rust layer becomes compact and adherent to steel substrate. Molybdenum and copper enrich in the inner rust layer, especially at the bottom of the corrosion nest, forming non-soluble molybdate and Cu(I)-bearing compounds responsible for enhanced corrosion resistance of the rust layer.