WorldWideScience

Sample records for single leaf rust

  1. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  2. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  3. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... leaf rust race 77-5 under artificial epiphytotic conditions. NILF3s were tested in two isolated nurseries inoculated with mixture of leaf and stem rust races. The generations raised at Wellington were naturally exposed to leaf and stem rusts, as Wellington is a natural hot spot for the two rusts (Nagarajan et al.

  4. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... (Short Title: Marker assisted pyramiding of leaf rust resistance genes). Key words: Wheat, leaf rust, molecular marker, gene pyramiding,marker assisted selection. Abstract. The study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from Thinopyrum(syn.Agropyron) ...

  5. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 showed resistance at both seedling and adult plant stages. Genetic analysis in F1, F2 and F2:3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR ...

  6. leaf and stripe rust resistance among ethiopian grown wheat ...

    African Journals Online (AJOL)

    ADMIN

    pathogen pathotypes. These varieties and lines, therefore, may be utilized in leaf and stripe rust resistance breeding programs. Key words/phrases: Leaf rust, resistance, stripe rust, Triticum aestivum, Triticum turgidum. * Current address: University of Limpopo, School of Agricultural and Environmental Sciences, Private Bag ...

  7. Leaf Rust of Wheat: Pathogen Biology, Variation and Host Resistance

    Directory of Open Access Journals (Sweden)

    James Kolmer

    2013-01-01

    Full Text Available Rusts are important pathogens of angiosperms and gymnosperms including cereal crops and forest trees. With respect to cereals, rust fungi are among the most important pathogens. Cereal rusts are heteroecious and macrocyclic requiring two taxonomically unrelated hosts to complete a five spore stage life cycle. Cereal rust fungi are highly variable for virulence and molecular polymorphism. Leaf rust, caused by Puccinia triticina is the most common rust of wheat on a worldwide basis. Many different races of P. triticina that vary for virulence to leaf rust resistance genes in wheat differential lines are found annually in the US. Molecular markers have been used to characterize rust populations in the US and worldwide. Highly virulent races of P. triticina are selected by leaf rust resistance genes in the soft red winter wheat, hard red winter wheat and hard red spring wheat cultivars that are grown in different regions of the US. Cultivars that only have race-specific leaf rust resistance genes that are effective in seedling plants lose their effective resistance and become susceptible within a few years of release. Cultivars with combinations of race non-specific resistance genes have remained resistant over a period of years even though races of the leaf rust population have changed constantly.

  8. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  9. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  10. Genetics of leaf and stripe rust resistance in a bread wheat cultivar ...

    Indian Academy of Sciences (India)

    MYT), Mexico, has shown resistance to leaf rust and stripe rust in the Indian ... rust resistance against. -isogenic line genes present Leaf rust. Stripe rust. Origin. Source. Parentage. Tonichi. –. TR. 10.0. Mexico. RAMC CAR422/Anahuac75. CSP44. Lr48 .... separately have been reported earlier by several authors. Table 2.

  11. RESEARCH ARTICLE Genetics and mapping of a new leaf rust ...

    Indian Academy of Sciences (India)

    Leaf rust caused by the fungus Pucciniatriticina,is one of the most widespread diseases of bread wheat (TriticumaestivumL.). Though, rust diseases have chemical control, genetic resistance in the host is the most economical and environment-friendly method. Wild relatives of wheat are reservoir of useful genes, including ...

  12. Pathological and molecular characterizations of slow leaf rusting in ...

    African Journals Online (AJOL)

    Sundeep

    2012-10-18

    110012, India. 5CIMMYT South Asia, Singha Durbar Road, Kathmandu, Nepal. Accepted 5 September, 2012. Leaf rust caused by Puccinia triticina, is a globally important fungal disease of wheat (Triticum aestivum L. em. Thell) ...

  13. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  14. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  15. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    wheat were undertaken. An F2 population derived from the cross of Triticum aestivum cv. WL711 – Ae. caudata introgression line T291-2 with wheat cultivar PBW343 segregated for a single dominant leaf rust resistance gene at the seedling and adult plant stages. Progeny testing in F3 confirmed the introgression of a single ...

  16. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  17. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  18. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  19. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  20. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  1. Coffee Leaf Rust Epidemics ( Hemileia vastatrix ) in Montane Coffee ...

    African Journals Online (AJOL)

    Besides drastic reduction in the forest cover and low average yield, the crop is attacked by several diseases among which coffee berry disease, coffee wilt disease and coffee leaf rust caused by Colletotrichum kahawae, Gibberella xylarioides and Hemileia vastatrix, respectively, are the major fungal diseases contributing to ...

  2. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... pathogenesis related (PR) proteins (β-1,3-glucanase, chitinase and peroxidase). This was the case in both susceptible and resistant wheat lines whether the plants were uninfected or infected with leaf rust. (Puccinia triticina). The aim of this study was to determine the influence of the A. africanus extract on.

  3. Pathological and molecular characterizations of slow leaf rusting in ...

    African Journals Online (AJOL)

    Fifteen (15) wheat genotypes which also included multiple crosses with the aim to characterize pyramid resistance genes, including slow rusting genes like Lr46 and Lr50 were evaluated for disease severity percent, latent period and incubation period under field conditions. Detached leaf assay was also performed with ...

  4. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    ... 97.27 and 98.94%, respectively, of genomic similarity with the parent cultivar, after two backcrossing and one generation of selfing.NILs were intercrossed to combine the genes Lr19 and Lr24. The combination of these two genes in the cultivarHD2733 is expected to provide durable leaf rust resistance in farmers' fields.

  5. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... 2001, HD2733 was released for irrigated timely sown conditions of the north eastern plains zone (NEPZ) of India became susceptible to leaf rust, a major disease of the region. Background .... Lambda uncut DNA. Working DNA stocks were prepared by diluting in TE buffer to achieve final concentration of.

  6. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Additive and dominance, as well as epistatic genetic effects, are involved in the inheritance of leaf rust resistance. However, the narrow sense heritability estimates were low, which also exhibited the presence of epistatic genetic effects. Thus, selection of resistant adult plant in later segregating generations ...

  7. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  8. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  9. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using specific STS primer. ... conducted on the life cycles of rust pathogens and their management. Due to airborne nature .... To date, more than 45 stem rust resistance Sr (genes) (McIntosh et ...

  10. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    Keywords. alien introgression; molecular mapping; leaf rust; Puccinia triticina; Triticum aestivum; Aegilops caudata. Abstract. Rusts are the most important biotic constraints limiting wheat productivity worldwide. Deployment of cultivars with broad spectrum rust resistance is the only environmentally viable option to combat ...

  11. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  12. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  13. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

    2007-01-01

    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  14. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  16. Genetic differentiation of the wheat leaf rust fungus Puccinia triticina in Pakistan and genetic relationship to other worldwide populations

    Science.gov (United States)

    Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...

  17. Molecular mapping of stem and leaf rust resistance in wheat.

    Science.gov (United States)

    Khan, R R; Bariana, H S; Dholakia, B B; Naik, S V; Lagu, M D; Rathjen, A J; Bhavani, S; Gupta, V S

    2005-09-01

    Stem rust caused by Puccinia graminis f. sp. tritici Eriks and Henn and leaf rust caused by Puccinia triticina Rob. ex Desm. are major constraints to wheat production worldwide. In the present study, F(4)-derived SSD population, developed from a cross between Australian cultivars 'Schomburgk' and 'Yarralinka', was used to identify molecular markers linked to rust resistance genes Lr 3 a and Sr 22. A total of 1,330 RAPD and 100 ISSR primers and 33 SSR primer pairs selected ob the basis of chromosomal locations of these genes were used. The ISSR marker UBC 840(540) was found to be linked with Lr 3 a in repulsion at a distance of 6.0 cM. Markers cfa 2019 and cfa 2123 flanked Sr 22 at a distance of 5.9 cM (distal) and 6.0 cM (proximal), respectively. The use of these markers in combination would predict the presence or absence of Sr 22 in breeding populations. A previously identified PCR-based diagnostic marker STS 638 linked to Lr 20 was validated in this population. This marker showed a recombination value of 7.1 cM with Lr 20.

  18. Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat

    OpenAIRE

    Singh, A.; Pandey, M. P.; Singh, A. K.; Knox, R. E.; Ammar, K.; Clarke, J. M.; Clarke, F. R.; Singh, R. P.; Pozniak, C. J.; DePauw, R. M.; McCallum, B. D.; Cuthbert, R. D.; Randhawa, H. S.; Fetch, T. G.

    2012-01-01

    Leaf rust (Puccinia triticina Eriks.), stripe rust (Puccinia striiformis f. tritici Eriks.) and stem rust (Puccinia graminis f. sp. tritici) cause major production losses in durum wheat (Triticum turgidum L. var. durum). The objective of this research was to identify and map leaf, stripe and stem rust resistance loci from the French cultivar Sachem and Canadian cultivar Strongfield. A doubled haploid population from Sachem/Strongfield and parents were phenotyped for seedling reaction to leaf ...

  19. Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat.

    Science.gov (United States)

    Singh, A; Pandey, M P; Singh, A K; Knox, R E; Ammar, K; Clarke, J M; Clarke, F R; Singh, R P; Pozniak, C J; Depauw, R M; McCallum, B D; Cuthbert, R D; Randhawa, H S; Fetch, T G

    2013-02-01

    Leaf rust (Puccinia triticina Eriks.), stripe rust (Puccinia striiformis f. tritici Eriks.) and stem rust (Puccinia graminis f. sp. tritici) cause major production losses in durum wheat (Triticum turgidum L. var. durum). The objective of this research was to identify and map leaf, stripe and stem rust resistance loci from the French cultivar Sachem and Canadian cultivar Strongfield. A doubled haploid population from Sachem/Strongfield and parents were phenotyped for seedling reaction to leaf rust races BBG/BN and BBG/BP and adult plant response was determined in three field rust nurseries near El Batan, Obregon and Toluca, Mexico. Stripe rust response was recorded in 2009 and 2011 nurseries near Toluca and near Njoro, Kenya in 2010. Response to stem rust was recorded in field nurseries near Njoro, Kenya, in 2010 and 2011. Sachem was resistant to leaf, stripe and stem rust. A major leaf rust quantitative trait locus (QTL) was identified on chromosome 7B at Xgwm146 in Sachem. In the same region on 7B, a stripe rust QTL was identified in Strongfield. Leaf and stripe rust QTL around DArT marker wPt3451 were identified on chromosome 1B. On chromosome 2B, a significant leaf rust QTL was detected conferred by Strongfield, and at the same QTL, a Yr gene derived from Sachem conferred resistance. Significant stem rust resistance QTL were detected on chromosome 4B. Consistent interactions among loci for resistance to each rust type across nurseries were detected, especially for leaf rust QTL on 7B. Sachem and Strongfield offer useful sources of rust resistance genes for durum rust breeding.

  20. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  1. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  2. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  3. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  4. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    friendly method. Wild relatives of wheat are reservoir of useful genes, including genes for rust resis- tance. To date, 74 leaf rust resistance genes have been des- ignated and about half of them have originated from various closely or distantly related ...

  5. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  7. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  8. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments

    Directory of Open Access Journals (Sweden)

    Caixia Lan

    2017-08-01

    Full Text Available Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR and stripe rust (YR diseases. In this study, a population of 186 F8 recombinant inbred lines (RILs derived from a cross between a synthetic wheat derivative (PI610750 and an adapted common wheat line (cv. “UC1110” were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR locus, QLr.cim-2DS, contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC, and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48, were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  9. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  10. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  11. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  12. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  13. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Directory of Open Access Journals (Sweden)

    Hui Wang

    Full Text Available It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS and support vector machine (SVM, and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS and support vector regression (SVR. All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2 of more than 0.90 and the root mean square errors (RMSE of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  14. EPIDEMIOLOGY OF WHEAT LEAF AND STEM RUST IN THE CENTRAL GREAT PLAINS OF THE USA.

    Science.gov (United States)

    Eversmeyer, M. G.; Kramer, C. L.

    2000-01-01

    Wheat (Triticum aestivum L) is grown throughout the grasslands from southern Mexico into the prairie provinces of Canada, a distance of nearly 4200 km. The total area seeded to wheat varies considerably each year; however, from 28 to 32 million ha are planted in the Great Plains of the United States alone. Generally in the central Great Plains, an area from central Texas through central Nebraska, 15 million ha are seeded to winter wheat each year. A wide range of environmental conditions exist throughout this area that may affect the development and final severity of wheat leaf rust (caused by Puccinia triticina L), stripe rust (caused by P. striiformis), and stem rust (caused by P. graminis Pers. f. sp tritici) epidemics and the subsequent reduction in wheat yields. Variation in severity of rust epidemics in this area depends on differences in crop maturity at the time of infection by primary inoculum, host resistance used, and environmental conditions. The interrelationships among time, host, pathogen and environment are complex, and studying the interactions is very difficult. Historically, cultivars with new or different leaf rust resistance genes become ineffective after several years of large-scale production within the Great Plains, and then cultivars carrying new or different resistance genes must be developed and released into production. This is the typical "boom and bust" cycle of the cereal rust resistance genes in the central Great Plains.

  15. Identifying leaf rust resistance gene Lr19 in durum wheat using ...

    African Journals Online (AJOL)

    Leaf rust, caused by Puccinia triticina Eriks., is an important disease affecting durum wheat (Triticum turgidum ssp. durum) worldwide, particularly in the Mediterranean region. The disease can be controlled through the use of plant host resistance. Based on seedling resistance tests of 103 durum genotypes against a bulk of ...

  16. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 2. Genetics and mapping of a new leaf rust resistance gene in Triticum aestivum L. × Triticum timopheevii Zhuk. derivative 'Selection G12'. AMIT KUMAR SINGH JAI BHAGWAN SHARMA VINOD PRADEEP KUMAR SINGH ANUPAM SINGH NIHARIKA MALLICK.

  17. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    RESEARCH ARTICLE. Genetics and mapping of a new leaf rust resistance gene in Triticum aestivum L. × Triticum timopheevii Zhuk. derivative 'Selection G12'. AMIT KUMAR SINGH1,2∗, JAI BHAGWAN SHARMA1, VINOD1, PRADEEP KUMAR SINGH1,. ANUPAM SINGH1 and NIHARIKA MALLICK1. 1Indian Agricultural ...

  18. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  19. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Abstract. A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen,. Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant ...

  20. Prehaustorial resistance to the wheat leaf rust fungus, Puccinia triticina, in Triticum monococcum (s.s.)

    NARCIS (Netherlands)

    Anker, C.C.; Niks, R.E.

    2001-01-01

    Diploid wheat, Triticum monococcum s.l., is a host for the wheat leaf rust fungus, Puccinia triticina. Some accessions have been reported to show a high degree of prehaustorial resistance. This is non-hypersensitivity resistance, which acts before the formation of haustoria by the pathogen. To

  1. Resistance to wheat leaf rust and stem rust in Triticum tauschii and inheritance in hexaploid wheat of resistance transferred from T. tauschii.

    Science.gov (United States)

    Innes, R L; Kerber, E R

    1994-10-01

    Twelve accessions of Triticum tauschii (Coss.) Schmal. were genetically analyzed for resistance to leaf rust (Puccinia recondita Rob. ex Desm.) and stem rust (Puccinia graminis Pers. f.sp. tritici Eriks. and E. Henn.) of common wheat (Triticum aestivum L.). Four genes conferring seedling resistance to leaf rust, one gene conferring seedling resistance to stem rust, and one gene conferring adult-plant resistance to stem rust were identified. These genes were genetically distinct from genes previously transferred to common wheat from T. tauschii and conferred resistance to a broad spectrum of pathogen races. Two of the four seedling leaf rust resistance genes were not expressed in synthetic hexaploids, produced by combining tetraploid wheat with the resistant T. tauschii accessions, probably owing to the action of one or more intergenomic suppressor loci on the A or B genome. The other two seedling leaf rust resistance genes were expressed at the hexaploid level as effectively as in the source diploids. One gene was mapped to the short arm of chromosome 2D more than 50 cM from the centromere and the other was mapped to chromosome 5D. Suppression of seedling resistance to leaf rust in synthetic hexaploids derived from three accessions of T. tauschii allowed the detection of three different genes conferring adult-plant resistance to a broad spectrum of leaf rust races. The gene for seedling resistance to stem rust was mapped to chromosome ID. The degree of expression of this gene at the hexaploid level was dependent on the genetic background in which it occurred and on environmental conditions. The expression of the adult-plant gene for resistance to stem rust was slightly diminished in hexaploids. The production of synthetic hexaploids was determined to be the most efficient and flexible method for transferring genes from T. tauschii to T. aestivum, but crossing success was determined by the genotypes of both parents. Although more laborious, the direct introgression

  2. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  3. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  4. Association analysis identifies Melampsora ×columbiana poplar leaf rust resistance SNPs.

    Directory of Open Access Journals (Sweden)

    Jonathan La Mantia

    Full Text Available Populus species are currently being domesticated through intensive time- and resource-dependent programs for utilization in phytoremediation, wood and paper products, and conversion to biofuels. Poplar leaf rust disease can greatly reduce wood volume. Genetic resistance is effective in reducing economic losses but major resistance loci have been race-specific and can be readily defeated by the pathogen. Developing durable disease resistance requires the identification of non-race-specific loci. In the presented study, area under the disease progress curve was calculated from natural infection of Melampsora ×columbiana in three consecutive years. Association analysis was performed using 412 P. trichocarpa clones genotyped with 29,355 SNPs covering 3,543 genes. We found 40 SNPs within 26 unique genes significantly associated (permutated P<0.05 with poplar rust severity. Moreover, two SNPs were repeated in all three years suggesting non-race-specificity and three additional SNPs were differentially expressed in other poplar rust interactions. These five SNPs were found in genes that have orthologs in Arabidopsis with functionality in pathogen induced transcriptome reprogramming, Ca²⁺/calmodulin and salicylic acid signaling, and tolerance to reactive oxygen species. The additive effect of non-R gene functional variants may constitute high levels of durable poplar leaf rust resistance. Therefore, these findings are of significance for speeding the genetic improvement of this long-lived, economically important organism.

  5. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  6. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  7. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  9. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  10. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  11. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  13. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  14. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  15. Winter wheat susceptibilty to leaf rust and resistance sources to diseases

    Directory of Open Access Journals (Sweden)

    Jerzy Chełkowski

    2012-12-01

    Full Text Available Winter wheat cultivars were significantly infected by Puccinia triticina causing leaf rust in seasons 2000-2002 in southern and also central regions of Poland. Resistance genes Lr9, Lr19 and Lr24 were found to be effective against dominating populations of the pathogen and typical isolates of P. triticina. Mentioned three resistance genes as well as genes Lr10 and Lr37 were identified using STS (Sequence Tagged Site DNA - PCR markers in cultivars and resistance sources. Mentioned markers were found very useful in resistance breeding of wheat.

  16. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  17. Resistance to brown leaf rust of hybrids between wheat and amphiploids wheat-thinopyrum

    Directory of Open Access Journals (Sweden)

    Alexander Lvovivh SECHNYAK

    2011-11-01

    Full Text Available The resistance to a brown leaf rust in 56 chromosomal partial аmphiploids (Triticum aestivum L. × Thinopyrum ponticum (Podp. Z.-W. Liu and R.-C. Wang, РА 2 (Triticum aestivum L. × Thinopyrum intermedium (Host Barkworth and D.R. Devey, H79/9-9 (Triticum aestivum L. × Elymus sp., Triticum aestivum L. cvs. Albatross odesskiy, Fantaziya odesskaya, Zhatva Altaya and their hybrids, F2-F4 were studied at artificial infection in field infectious nursery in 2009, 2010 and 2011. The investigated varieties of wheat have shown a high susceptibility to pathogen. Amphiploids РА 1 and РА 2 also are susceptible to pathogen, but in a lesser degree, than the wheat. Good resistance was shown only by amphiploid Н79/9-9, but its hybrid with wheat Albatross Odessa appeared is susceptible to pathogen. The hybrids with amphiploids РА 1 and РА 2 have shown a various degree of resistance to brown leaf rust. Hybrid Zhatva Altaya × РА 2 within three years stably showed 8 point resistance to disease. The reasonsfor different resistance of amphiploids and its hybrids with wheat are discussed.

  18. De Novo Assembled Wheat Transcriptomes Delineate Differentially Expressed Host Genes in Response to Leaf Rust Infection.

    Directory of Open Access Journals (Sweden)

    Saket Chandra

    Full Text Available Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28. Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants.

  19. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  20. Development of monitoring method of coffee leaf rust fungus (Hemileia vastatrix) infected area using satellite remote sensing

    Science.gov (United States)

    Katsuhama, N.; Ikeda, K.; Imai, M.; Watanabe, K.; Marpaung, F.; Yoshii, T.; Naruse, N.; Takahashi, Y.

    2016-12-01

    Since 2008, coffee leaf rust fungus (Hemileia vastatrix) has expanded its infection in Latin America, and early trimming and burning infected trees have been only effective countermeasures to prevent spreading infection. Although some researchers reported a case about the monitoring of coffee leaf rust using satellite remote sensing in 1970s, the spatial resolution was unsatisfied, and therefore, further technological development has been required. The purpose of this research is to develop effective method of discovering coffee leaf rust infected areas using satellite remote sensing. Annual changes of vegetation indices, i.e. Normalized Difference Vegetation Index (NDVI) and Modified Structure Insensitive Pigment Index (MSIPI), around Cuchumatanes Mountains, Republic of Guatemala, were analyzed by Landsat 7 images. Study fields in the research were limited by the coffee farm areas based on a previous paper about on site surveys in different damage areas. As the result of the analysis, the annual change of NDVI at the coffee farm areas with damages tended to be lower than those without damages. Moreover, the decline of NDVI appear from 2008 before the damage was reported. On the other hand, the change of MSIPI had no significant difference. NDVI and MSIPI are mainly related to the amount of chlorophyll and carotenoid in the leaves respectively. This means that the infected coffee leaves turned yellow without defoliation. This situation well matches the symptom of coffee leaf rust. The research concluded that the property of infected leaves turning yellow is effective to monitoring of infection areas by satellite remote sensing.

  1. Effect of partial resistance to barley leaf rust, Puccinia hordei, on the yield of three barley cultivars

    NARCIS (Netherlands)

    Ochoa, J.; Parlevliet, J.E.

    2007-01-01

    Three barley cultivars, Shyri, Clipper and Terán, with different levels of partial resistance to barley leaf rust, caused by Puccinia hordei, were exposed to six levels of the pathogen. These levels were obtained by 5, 4, 3, 2, 1 and 0 fungicide (Propiconazol) applications respectively and occurred

  2. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  3. Morphological and molecular characterisation confirm that Triticum monococcum s.s. is resistant to wheat leaf rust

    NARCIS (Netherlands)

    Anker, C.C.; Buntjer, J.B.; Niks, R.E.

    2001-01-01

    The three diploid wheat species Triticum monococcum, Triticum boeoticum and Triticum urartu differ in their reaction to wheat leaf rust, Puccinia triticina. In general, T. monococcum is resistant while T. boeoticum and T. urartu are susceptible. However, upon screening a large collection of diploid

  4. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  5. Monosomic and molecular mapping of adult plant leaf rust resistance genes in the Brazilian wheat cultivar Toropi.

    Science.gov (United States)

    Da-Silva, P R; Brammer, S P; Guerra, D; Milach, S C K; Barcellos, A L; Baggio, M I

    2012-08-24

    Leaf rust is one of the most destructive diseases affecting wheat worldwide. The most effective way to control it is to use resistant cultivars. Resistance based on slow-rusting adult plant resistance (APR) genes has proven to be the best method for developing cultivars with durable resistance. A source of slow-rusting APR for leaf rust is the Brazilian wheat cultivar Toropi. The Toropi/IAC 13 F₂ and F₇ recombinant inbred lines (RILs) were developed in previous studies. Phenotypic analysis of the F₂ and F₇ RILs showed that 2 recessive genes that were temporarily named trp-1 and trp-2 conferred APR in Toropi. In the present study, we used monosomic families and amplified fragment length polymorphism (AFLP), sequence-tagged site, and simple sequence repeat (SSR) markers to map trp-1 and trp-2 on wheat chromosomes. Analysis of the F₂ monosomic RIL showed that trp- 1 and trp-2 were located on chromosomes 1A and 4D, respectively. AFLP analysis of the F₇ RIL identified 2 independent AFLP markers, XPacgMcac3 and XPacgMcac6, which were associated with Toropi APR. These markers explained 71.5% of the variation in the phenotypic data in a multiple linear regression model. The AFLP markers XPacg/ Mcac3 and XPacg/Mcac6 were anchored by SSR markers previously mapped on the short arms of chromosomes 1A (1AS) and 4D (4DS), respectively. The trp-2 gene is the first leaf rust resistance gene mapped on wheat chromosome 4DS. The mapping of trp-1 and trp-2 provides novel and valuable information that could be used in future studies involving the fine mapping of these genes, as well as in the identification of molecular markers that are closely related to these genes for marker-assisted selection of this important trait in wheat.

  6. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  7. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  8. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat

    Directory of Open Access Journals (Sweden)

    Feng Li

    2018-02-01

    Full Text Available Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici, and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL confers resistance only to powdery mildew at both stages. The chromosomal composition of BC2F3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization and FISH (fluorescence in situ hybridization. Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  9. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)

    M. SERENIUS

    2008-12-01

    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  10. Resistance of Glycine tomentella to soybean leaf rust Phakopsora pachyrhizi in relation to ploidy level and geographic distribution.

    Science.gov (United States)

    Schoen, D J; Burdon, J J; Brown, A H

    1992-04-01

    Accessions of five diploid and five tetraploid isozymically defined groups of Glycine tomentella collected from throughout the species range in Australasia were scored for resistance to three separate isolates of Phakopsora pachyrhizi, the causal agent of soybean leaf rust. Resistance levels were found to be high (>75%) in most of the groups. While resistance levels differed among groups, the overall levels in polyploids were similar to those in diploids. Geographical patterns of resistance and susceptibility to P. pachyrhizi indicate that two regions of susceptibility exist. The highest proportion of susceptible accessions occurs in the Kimberley Plateau region of Western Australia and the Northern Territory, while another region of susceptibility is found in the Townsville/Cairns region of Queensland. Results from genetic crosses between accessions within two forms of the tetraploids indicate that in the aneuploid form (2n = 78), resistance to P. pachyrhizi was under the control of a single dominant gene, whereas in a second group of tetraploids (2n=80), resistance was controlled by two or three gene loci.

  11. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  12. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  13. Modelling coffee leaf rust risk in Colombia with climate reanalysis data

    Science.gov (United States)

    Castillo, Ángela Delgado; Gurr, Sarah J.

    2016-01-01

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008–2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available. This article is part of the themed issue ‘Tackling emerging fungal threats to animal health, food security and ecosystem resilience’. PMID:28080984

  14. Modelling coffee leaf rust risk in Colombia with climate reanalysis data.

    Science.gov (United States)

    Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J

    2016-12-05

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.

  15. Protection of wheat against leaf and stem rust and powdery mildew diseases by inhibition of polyamine metabolism

    Science.gov (United States)

    Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.

    1987-01-01

    In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.

  16. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  17. Molecular cytological characterization of two novel durum--Thinopyrum intermedium partial amphiploids with resistance to leaf rust, stem rust and Fusarium head blight.

    Science.gov (United States)

    Zeng, J; Cao, W; Fedak, G; Sun, S; McCallum, B; Fetch, T; Xue, A; Zhou, Y

    2013-02-01

    Thinopyrum intermedium, a wild relative of wheat, is an excellent source of disease resistance. Two novel partial amphiploids, 08-47-50 and 08-53-55 (2n = 6x = 42), were developed from wide crosses between durum wheat and Th. intermedium. Meiotic analysis showed that pollen mother cells of the two partial amphiploids formed an average 20.49 bivalents for 08-47-50 and 20.67 bivalents for 08-53-55, indicating that they are basically cytologically stable. GISH analysis revealed that the two partial amphiploids carried different chromosome compositions. 08-47-50 had fourteen chromosomes from Th. intermedium and its alien chromosomes included six St-, four E(e) - and four E(e)-St translocated chromosomes, whereas 08-53-55 had four St- and ten E(e)-St translocated chromosomes. Fungal disease evaluation indicated that both partial amphiploids had a high level of resistance to FHB, leaf rust and stem rust race Ug99. These two novel partial amphiploids with multiple disease resistance could be used as a new source of multiple disease resistance in bread wheat and durum wheat breeding programs. © 2013 The Authors.

  18. Comparative analysis of secreted protein evolution using expressed sequence tags from four poplar leaf rusts (Melampsora spp.

    Directory of Open Access Journals (Sweden)

    Tanguay Philippe

    2010-07-01

    Full Text Available Abstract Background Obligate biotrophs such as rust fungi are believed to establish long-term relationships by modulating plant defenses through a plethora of effector proteins, whose most recognizable feature is the presence of a signal peptide for secretion. Since the phenotypes of these effectors extend to host cells, their genes are expected to be under accelerated evolution stimulated by host-pathogen coevolutionary arms races. Recently, whole genome sequence data has allowed the prediction of secretomes, facilitating the identification of putative effectors. Results We generated cDNA libraries from four poplar leaf rust pathogens (Melampsora spp. and used computational approaches to identify and annotate putative secreted proteins with the aim of uncovering new knowledge about the nature and evolution of the rust secretome. While more than half of the predicted secretome members encoded lineage-specific proteins, similarities with experimentally characterized fungal effectors were also identified. A SAGE analysis indicated a strong stage-specific regulation of transcripts encoding secreted proteins. The average sequence identity of putative secreted proteins to their closest orthologs in the wheat stem rust Puccinia graminis f. sp. tritici was dramatically reduced compared with non-secreted ones. A comparative genomics approach based on homologous gene groups unravelled positive selection in putative members of the secretome. Conclusion We uncovered robust evidence that different evolutionary constraints are acting on the rust secretome when compared to the rest of the genome. These results are consistent with the view that these genes are more likely to exhibit an effector activity and be involved in coevolutionary arms races with host factors.

  19. Comparative analysis of secreted protein evolution using expressed sequence tags from four poplar leaf rusts (Melampsora spp.).

    Science.gov (United States)

    Joly, David L; Feau, Nicolas; Tanguay, Philippe; Hamelin, Richard C

    2010-07-08

    Obligate biotrophs such as rust fungi are believed to establish long-term relationships by modulating plant defenses through a plethora of effector proteins, whose most recognizable feature is the presence of a signal peptide for secretion. Since the phenotypes of these effectors extend to host cells, their genes are expected to be under accelerated evolution stimulated by host-pathogen coevolutionary arms races. Recently, whole genome sequence data has allowed the prediction of secretomes, facilitating the identification of putative effectors. We generated cDNA libraries from four poplar leaf rust pathogens (Melampsora spp.) and used computational approaches to identify and annotate putative secreted proteins with the aim of uncovering new knowledge about the nature and evolution of the rust secretome. While more than half of the predicted secretome members encoded lineage-specific proteins, similarities with experimentally characterized fungal effectors were also identified. A SAGE analysis indicated a strong stage-specific regulation of transcripts encoding secreted proteins. The average sequence identity of putative secreted proteins to their closest orthologs in the wheat stem rust Puccinia graminis f. sp. tritici was dramatically reduced compared with non-secreted ones. A comparative genomics approach based on homologous gene groups unravelled positive selection in putative members of the secretome. We uncovered robust evidence that different evolutionary constraints are acting on the rust secretome when compared to the rest of the genome. These results are consistent with the view that these genes are more likely to exhibit an effector activity and be involved in coevolutionary arms races with host factors.

  20. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L on Leaf Rust (Hemileia vastatrix Pathogenesis

    Directory of Open Access Journals (Sweden)

    Lucile Toniutti

    2017-11-01

    Full Text Available Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR, resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids were grown in controlled conditions with a combination of thermal regime (TR, nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix. It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23–18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.

  1. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H.; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix. It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23–18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control. PMID:29234340

  2. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis.

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix . It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23-18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.

  3. Dose and application rate of fungicide to control leaf rust (Puccinia triticina and yellow spot (Pyrenophora tritici repentis of wheat

    Directory of Open Access Journals (Sweden)

    Gustavo Migliorini de Oliveira

    2015-02-01

    Full Text Available The aim of this paper was to study the role of dose and rate of application, and the effect of concentration of fungicide in the spray solution resulted from the interaction of these factors, in the control of leaf rust and yellow spot of wheat. It was conducted two experiments, the first used the CD 104 cultivar (susceptible to lead rust and yellow spot. The experimental design was an factorial 3 x 3 + untreated control, that involve the factors dose (0,25, 0,30 and 0,35 L.ha-1 and application rate (143, 286 and 429 L.ha-1. The second experiment used the BRS 208 cultivar (resistant to leaf rust and moderately resistant to yellow spot. The experimental design was an factorial 2 x 2 + untreated control, consisting the factors dose (0,2 and 0,3 L.ha-1 and application rate (143 and 286 L.ha-1. The applications were made with a coastal sprayer by CO2, pressure of 250 kPa, XR 110-02 nozzle, which generated an application rate of 143 L.ha-1. The respective rates of each treatment were changed by the number of sprayers per area. It was also used a spore trap denominated Siga, associated with meteorological data and weather forecast, which detected spores of rust and yellow spot before the symptoms in the plants, helping in the identification of disease and in the timing of application. There wasn´t any interaction between dose and rate of application for any of the experiments, therefore, there wasn´t effect of concentration of fungicide in control. The dose and rate of application just influenced in the control of the yellow spot. Higher doses and rates were more effective. However, no difference was observed for yield and hectolitre weight among treatments, except untreated control

  4. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  5. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  6. Heritable, de novo resistance to leaf rust and other novel traits in selfed descendants of wheat responding to inoculation with wheat streak mosaic virus.

    Science.gov (United States)

    Seifers, Dallas L; Haber, Steve; Martin, Terry J; McCallum, Brent D

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar 'Lakin' following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, 'R1', heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant 'Lakin' sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the 'Lakin' progenitor was susceptible. The next generation of six of the 'Lakin'-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the 'Lakin' progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm.

  7. Heritable, de novo resistance to leaf rust and other novel traits in selfed descendants of wheat responding to inoculation with wheat streak mosaic virus.

    Directory of Open Access Journals (Sweden)

    Dallas L Seifers

    Full Text Available Stable resistance to infection with Wheat streak mosaic virus (WSMV can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar 'Lakin' following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, 'R1', heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant 'Lakin' sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the 'Lakin' progenitor was susceptible. The next generation of six of the 'Lakin'-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the 'Lakin' progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm.

  8. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  9. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  10. The estimation of rust disease of daylily leaf images with GLCM based different classification methods

    OpenAIRE

    ÖZERDEM, Mehmet Siraç; ACAR, Emrullah

    2011-01-01

    Crop diseases can affect yield and/or quality of the harvested commodity. This can influence profitability and raise the risks of farming. When the diseases are estimated early, the yield will increase by taking measures thanks to farmers. The rust disease is one of the most major crop diseases that affect crop yield. Rust disease can be defined as a fungus; it makes the crops weak by blocking food to the roots and leaves. It is named “rust” disease, since the spots on the leaves look like gr...

  11. Severity of angular leaf spot and rust diseases on common beans in ...

    African Journals Online (AJOL)

    ACSS

    plants has been shown to reduce pest and disease damage (Trenbath, 1993). Boudreau and Mundt (1992) and Fininsa. (1996) reported reduced rust severities for beans intercropped with maize. Fungal disease control in intercrops is believed to result from effects such as host dilution. (reduced numbers of susceptible ...

  12. Smallholder Food and Water Security in the Face of Climatic Stress and the Coffee Leaf Rust: Lessons from Nicaragua

    Science.gov (United States)

    Stewart, I. T.; Bacon, C. M.; Sundstrom, W.

    2015-12-01

    Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.

  13. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  14. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  15. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  16. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  17. Genetic analysis of adult-plant resistance to leaf rust in a double haploid wheat (Triticum aestivum L. em Thell population

    Directory of Open Access Journals (Sweden)

    Sandra Patussi Brammer

    2004-01-01

    Full Text Available A genetic analysis of adult plant resistance to leaf rust (Puccinia triticina was performed in in vitro obtained double haploid progenies from a cross between the Brazilian wheat cultivar Trigo BR 35, which, under the high inoculum pressure of the southern region, has been resistant to leaf rust for more than 12 years, and the susceptible cultivar IAC 13-Lorena. Haplodiploidization via in vitro gimnogenesis was done by somatic elimination of the pollen donor genome after maize pollination of the F1 plants. The advantages and usefulness of double haploids (DH for genetic analysis of complex inherited traits like durable adult-plant resistance to wheat leaf rust were evident: it was possible to analyze inheritance patterns in this cross by using only the 35 DH homozygous segregant lines obtained by in vitro embryo culture of F1 flowers pollinated by maize, this number being equivalent to 1,225 conventional F2 lines because of lack of heterozygosity. After being infected with MCG and LPG races, the results indicated that Trigo BR 35 has two resistance genes. One of the genes expressed resistance only after the intermediate stage of plant development (5-6 leaves.

  18. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust.

    Science.gov (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja

    2018-02-01

    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  19. Loss of Abaxial Leaf Epicuticular Wax in Medicago truncatula irg1/palm1 Mutants Results in Reduced Spore Differentiation of Anthracnose and Nonhost Rust Pathogens[W

    Science.gov (United States)

    Uppalapati, Srinivasa Rao; Ishiga, Yasuhiro; Doraiswamy, Vanthana; Bedair, Mohamed; Mittal, Shipra; Chen, Jianghua; Nakashima, Jin; Tang, Yuhong; Tadege, Million; Ratet, Pascal; Chen, Rujin; Schultheiss, Holger; Mysore, Kirankumar S.

    2012-01-01

    To identify genes that confer nonhost resistance to biotrophic fungal pathogens, we did a forward-genetics screen using Medicago truncatula Tnt1 retrotransposon insertion lines. From this screen, we identified an inhibitor of rust germ tube differentation1 (irg1) mutant that failed to promote preinfection structure differentiation of two rust pathogens, Phakopsora pachyrhizi and Puccinia emaculata, and one anthracnose pathogen, Colletotrichum trifolii, on the abaxial leaf surface. Cytological and chemical analyses revealed that the inhibition of rust preinfection structures in irg1 mutants is due to complete loss of the abaxial epicuticular wax crystals and reduced surface hydrophobicity. The composition of waxes on abaxial leaf surface of irg1 mutants had >90% reduction of C30 primary alcohols and a preferential increase of C29 and C31 alkanes compared with the wild type. IRG1 encodes a Cys(2)His(2) zinc finger transcription factor, PALM1, which also controls dissected leaf morphology in M. truncatula. Transcriptome analysis of irg1/palm1 mutants revealed downregulation of eceriferum4, an enzyme implicated in primary alcohol biosynthesis, and MYB96, a major transcription factor that regulates wax biosynthesis. Our results demonstrate that PALM1 plays a role in regulating epicuticular wax metabolism and transport and that epicuticular wax influences spore differentiation of host and nonhost fungal pathogens. PMID:22294617

  20. Loss of abaxial leaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens.

    Science.gov (United States)

    Uppalapati, Srinivasa Rao; Ishiga, Yasuhiro; Doraiswamy, Vanthana; Bedair, Mohamed; Mittal, Shipra; Chen, Jianghua; Nakashima, Jin; Tang, Yuhong; Tadege, Million; Ratet, Pascal; Chen, Rujin; Schultheiss, Holger; Mysore, Kirankumar S

    2012-01-01

    To identify genes that confer nonhost resistance to biotrophic fungal pathogens, we did a forward-genetics screen using Medicago truncatula Tnt1 retrotransposon insertion lines. From this screen, we identified an inhibitor of rust germ tube differentation1 (irg1) mutant that failed to promote preinfection structure differentiation of two rust pathogens, Phakopsora pachyrhizi and Puccinia emaculata, and one anthracnose pathogen, Colletotrichum trifolii, on the abaxial leaf surface. Cytological and chemical analyses revealed that the inhibition of rust preinfection structures in irg1 mutants is due to complete loss of the abaxial epicuticular wax crystals and reduced surface hydrophobicity. The composition of waxes on abaxial leaf surface of irg1 mutants had >90% reduction of C30 primary alcohols and a preferential increase of C29 and C31 alkanes compared with the wild type. IRG1 encodes a Cys(2)His(2) zinc finger transcription factor, PALM1, which also controls dissected leaf morphology in M. truncatula. Transcriptome analysis of irg1/palm1 mutants revealed downregulation of eceriferum4, an enzyme implicated in primary alcohol biosynthesis, and MYB96, a major transcription factor that regulates wax biosynthesis. Our results demonstrate that PALM1 plays a role in regulating epicuticular wax metabolism and transport and that epicuticular wax influences spore differentiation of host and nonhost fungal pathogens.

  1. Yellow rust protection on the wheat

    OpenAIRE

    Hanzalová, Alena; Bartoš, Pavel

    2015-01-01

    Heavy incidence of yellow rust in the years 2014 and 2015 has proved high deleterious effects of this rust. For this reason this publication deals with yellow rust on wheat. Rusts on wheat cause losses every year. In the years of an epidemic yield can be decreased by more than a half. Epidemics of stem rust and yellow rust occur in irregular intervals. Leaf rust causes damage every year particularly in central and southern part of Moravia. Chemical control limits yield losses, however in the ...

  2. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  3. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  4. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  6. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  7. Impact of Regionally Distinct Agroecosystem Communities on the Potential for Autonomous Control of the Coffee Leaf Rust.

    Science.gov (United States)

    Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John

    2016-12-01

    Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements.

    Science.gov (United States)

    Fellers, John P; Soltani, Bahram M; Bruce, Myron; Linning, Rob; Cuomo, Christina A; Szabo, Les J; Bakkeren, Guus

    2013-01-29

    Wheat leaf rust (Puccinia triticina Eriks; Pt) and stem rust fungi (P. graminis f.sp. tritici; Pgt) are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. A bacterial artificial chromosome (BAC) library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny) was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  9. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  10. Overview of the functional virulent genome of the coffee leaf rust pathogen Hemileia vastatrix with an emphasis on early stages of infection

    Directory of Open Access Journals (Sweden)

    Pedro eTalhinhas

    2014-03-01

    Full Text Available Hemileia vastatrix is the causal agent of coffee leaf rust, the most important disease of coffee (Coffea arabica. In this work, a 454-pyrosequencing transcriptome analysis of H. vastatrix germinating urediniospores (gU and appressoria (Ap was performed and compared to previously published in planta haustoria-rich (H data. A total of 9234 transcripts were identified and annotated. Ca. 50% of these transcripts showed no significant homology to international databases. Only 784 sequences were shared by the three conditions, and 75% were exclusive of either gU (2146, Ap (1479 or H (3270. Relative transcript abundance and RT-qPCR analyses for a selection of genes indicated a particularly active metabolism, translational activity and production of new structures in the appressoria and intense signalling, transport, secretory activity and cellular multiplication in the germinating urediniospores, suggesting the onset of a plant-fungus dialogue as early as at the germ tube stage. Gene expression related to the production of carbohydrate-active enzymes and accumulation of glycerol in germinating urediniospores and appressoria suggests that combined lytic and physical mechanisms are involved in appressoria-mediated penetration. Besides contributing to the characterisation of molecular processes leading to appressoria-mediated infection by rust fungi, these results point towards the identification of new H. vastatrix candidate virulence factors, with 516 genes predicted to encode secreted proteins.

  11. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  12. Molecular Mapping of Stem Rust Resistance Loci Effective Against the Ug99 Race Group of the Stem Rust Pathogen and Validation of a Single Nucleotide Polymorphism Marker Linked to Stem Rust Resistance Gene Sr28.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Rouse, M N; Wanyera, R; Acevedo, M; Brown-Guedira, G; Bonman, J M

    2017-02-01

    Wheat landrace PI 177906 has seedling resistance to stem rust caused by Puccinia graminis f. sp. tritici races TTKSK, TTKST, and BCCBC and field resistance to the Ug99 race group. Parents, 140 recombinant inbred lines, and 138 double haploid (DH) lines were evaluated for seedling resistance to races TTKSK and BCCBC. Parents and the DH population were evaluated for field resistance to Ug99 in Kenya. The 90K wheat single nucleotide polymorphism (SNP) genotyping platform was used to genotype the parents and populations. Goodness-of-fit tests indicated that two dominant genes in PI 177906 conditioned seedling resistance to TTKSK. Two major loci for seedling resistance were consistently mapped to the chromosome arms 2BL and 6DS. The BCCBC resistance was mapped to the same location on 2BL as the TTKSK resistance. Using field data from the three seasons, two major QTL were consistently detected at the same regions on 2BL and 6DS. Based on the mapping result, race specificity, and the infection type observed in PI 177906, the TTKSK resistance on 2BL is likely due to Sr28. One SNP marker (KASP_IWB1208) was found to be predictive for the presence of the TTKSK resistance locus on 2BL and Sr28.

  13. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Molecular and genetic study of wheat rusts. ... Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause ... Breeding resistant cultivars is a long process and requires an accurate picture of the current and future pathogen population. Differentiation of ...

  14. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Artificial rust epidemic was created by spraying the infector rows and experimental material with the mixture of uredinospores of Pst isolates 78S84 and 46S119. Stripe rust assessment was according to the modified Cobb's scale. (Peterson et al. 1948). The RIL population was screened at the seedling stage against leaf rust ...

  15. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  16. An AFLP marker linked to the leaf rust resistance gene LrBi16 and test of allelism with Lr14a on chromosome arm 7BL

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2015-04-01

    Full Text Available Leaf rust (LR, caused by Puccinia triticina, is one of the most widespread diseases of common wheat (Triticum aestivum L. worldwide. The LR resistance gene LrBi16 has been mapped on chromosome arm 7BL in Chinese wheat cultivar Bimai 16 and was closely linked to SSR loci Xcfa2257 and Xgwm344 with genetic distances of 2.8 cM and 2.9 cM, respectively. In the present study, a total of 304 AFLP primer pairs were used to screen Bimai 16 and Thatcher and resistant and susceptible DNA bulks. The polymorphic AFLP marker P-ATT/M-CGC173 bp was used to genotype F2 and F3 populations to identify markers more closely linked to LrBi16. Marker P-ATT/M-CGC173 bp was tightly linked to LrBi16 with a genetic distance of 0.5 cM. As LrBi16 was mapped near the Lr14a locus, 809 F2 plants from the Bimai 16/RL6013 (Lr14a cross were inoculated with the Pt pathotype FHNQ to test the allelism of Lr14a and LrBi16. All of the F2 plants were resistant to FHNQ (IT between; and 2, suggesting that Lr14a and LrBi16 are allelic.

  17. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  18. Formation of single domain magnetite by green rust oxidation promoted by microbial anaerobic nitrate-dependent iron oxidation

    Science.gov (United States)

    Miot, Jennyfer; Li, Jinhua; Benzerara, Karim; Sougrati, Moulay Tahar; Ona-Nguema, Georges; Bernard, Sylvain; Jumas, Jean-Claude; Guyot, François

    2014-08-01

    Biomineralization of magnetite is a central geomicrobiological process that might have played a primordial role over Earth’s history, possibly leaving traces of life in the geological record or controlling trace metal(loid)s and organic pollutants mobility in modern environments. Magnetite biomineralization has been attributed to two main microbial pathways to date (namely magnetotactic bacteria and dissimilatory iron-reducing bacteria). Here, we uncover a new route of magnetite biomineralization involving the anaerobic nitrate-reducing iron(II) oxidizing bacterium Acidovorax sp. strain BoFeN1. Using transmission electron microscopy, scanning transmission X-ray microscopy, transmission Mössbauer spectroscopy and rock magnetic analyses, this strain is shown to promote the transformation of hydroxychloride green rust in equilibrium with dissolved Fe(II) to (1) periplasmic lepidocrocite (γ-FeOOH) and (2) extracellular magnetite, thus leading to strong redox heterogeneities at the nanometer scale. On the one hand, lepidocrocite was associated with protein moieties and exhibited an anisotropic texture, with the elongated axis parallel to the cell wall. On the other hand, magnetite crystals exhibited grain sizes and magnetic properties consistent with stable single domain particles. By comparison, abiotic controls led to a very slow (4 months vs. 2 days in BoFeN1 cultures) and incomplete oxidation of hydroxychloride green rust towards magnetite. As this abiotic magnetite exhibited the same size and magnetic properties (stable single domain particles) as magnetite produced in BoFeN1 cultures, only the co-occurrence of textured Fe(III)-oxides and magnetite, associated with the persistence of organic carbon molecules, might constitute valuable biosignatures to be looked for in the geological record. Our results furthermore contribute to a more complex picture of Fe redox cycling in the environment, providing an additional process of Fe(II)-bearing phase

  19. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat.

    Directory of Open Access Journals (Sweden)

    Long-Xi Yu

    Full Text Available Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn. is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS for identifying loci associated with the Ug99 stem rust resistance (SR in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT. Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat.

  20. Nonhost resistance of rice to rust pathogens.

    Science.gov (United States)

    Ayliffe, Michael; Devilla, Rosangela; Mago, Rohit; White, Rosemary; Talbot, Mark; Pryor, Anthony; Leung, Hei

    2011-10-01

    Rice is atypical in that it is an agricultural cereal that is immune to fungal rust diseases. This report demonstrates that several cereal rust species (Puccinia graminis f. sp tritici, P. triticina, P. striiformis, and P. hordei) can infect rice and produce all the infection structures necessary for plant colonization, including specialized feeding cells (haustoria). Some rust infection sites are remarkably large and many plant cells are colonized, suggesting that nutrient uptake occurs to support this growth. Rice responds with an active, nonhost resistance (NHR) response that prevents fungal sporulation and that involves callose deposition, production of reactive oxygen species, and, occasionally, cell death. Genetic variation for the efficacy of NHR to wheat stem rust and wheat leaf rust was observed. Unlike cereal rusts, the rust pathogen (Melampsora lini) of the dicotyledenous plant flax (Linum usitatissimum) rarely successfully infects rice due to an apparent inability to recognize host-derived signals. Morphologically abnormal infection structures are produced and appressorial-like structures often don't coincide with stomata. These data suggest that basic compatibility is an important determinate of nonhost infection outcomes of rust diseases on cereals, with cereal rusts being more capable of infecting a cereal nonhost species compared with rust species that are adapted for dicot hosts.

  1. Lr67 and Lr34 rust resistance genes have much in common – they confer broad spectrum resistance to multiple pathogens in wheat

    Science.gov (United States)

    2013-01-01

    Background Adult plant rust resistance genes Lr67 and Lr34 confer race non-specific resistance to multiple fungal pathogens of wheat. Induced, susceptible mutants were characterised for both genes. Results Three categories of Lr34 mutants were identified that were either partial susceptible, fully susceptible or hyper-susceptible to stripe rust and leaf rust. The likely impact of the mutational change on the predicted Lr34 protein correlated with differences in response to rust infection. Four independent Lr67 mutants were recovered that were susceptible to stripe rust, leaf rust and stem rust pathogens, including one possible hyper-susceptible Lr67 mutant. Conclusions Detailed study of Lr34 mutants revealed that subtle changes in resistance response to multiple pathogens were correlated with mutational changes in the predicted protein. Recovery of independent Lr67 mutants indicates that as for Lr34, a single gene at the Lr67 locus is likely to confer resistance to multiple pathogens. The infection phenotypes of Lr67 mutants closely resembled that of Lr34 mutants. PMID:23819608

  2. The relationship of leaf rust resistance gene Lr13 and hybrid necrosis gene Ne2m on wheat chromosome 2BS.

    Science.gov (United States)

    Zhang, Peng; Hiebert, Colin W; McIntosh, Robert A; McCallum, Brent D; Thomas, Julian B; Hoxha, Sami; Singh, Davinder; Bansal, Urmil

    2016-03-01

    Genetic and mutational analyses of wheat leaf rust resistance gene Lr13 and hybrid necrosis gene Ne2 m indicated that they are the same gene. Hybrid necrosis in wheat characterized by chlorosis and eventual necrosis of plant tissues in certain wheat hybrids is controlled by the interaction of complementary dominant genes Ne1 and Ne2 located on chromosome arms 5BL and 2BS, respectively. Multiple alleles at each locus can be identified by differences in necrotic phenotypes when varieties are crossed with a fixed accession of the other genotype. Some of at least five Ne2 alleles were described as s (strong), m (medium) and w (weak); alleles of Ne1 were similarly described. Ne2m causes moderate necrosis in hybrids with genotypes having Ne1s. Ne2 is located on chromosome arm 2BS in close proximity to Lr13. Most wheat lines with Ne2m carry Lr13, and all wheat lines with Lr13 appear to carry Ne2m. To further dissect the relationship between Lr13 and Ne2m, more than 350 crosses were made between cv. Spica (Triticum aestivum) or Kubanka (T. durum) carrying Ne1s and recombinant inbred lines or doubled haploid lines from three crosses segregating for Lr13. F1 plants from lines carrying Lr13 crossed with Spica (Ne1s) always showed progressive necrosis; those lacking Lr13 did not. Four wheat cultivars/lines carrying Lr13 were treated with the mutagen EMS. Thirty-five susceptible mutants were identified; eight were distinctly less glaucous and late maturing indicative of chromosome 2B or sub-chromosome loss. Hybrids of phenotypically normal Lr13 mutant plants crossed with Spica did not produce symptoms of hybrid necrosis. Thus, Lr13 and one particular Ne2m allele may be the same gene.

  3. Bioprospecting endophytic bacteria for biological control of coffee leaf rust Bioprospecção de bactérias endofíticas como agentes de biocontrole da ferrugem do cafeeiro

    Directory of Open Access Journals (Sweden)

    Humberto Franco Shiomi

    2006-02-01

    Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea

  4. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  5. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  6. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  7. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  8. A review of soybean rust from a South African perspective

    OpenAIRE

    J. Antony Jarvie

    2010-01-01

    This review article describes the nature of the soybean rust pathogen, its interaction with the soybean host and documents some of the history of soybean rust in South Africa. Soybean rust has affected soybean cropping in parts of South Africa since 2001. The disease causes leaf lesions, which may progress to premature defoliation and ultimately result in grain yield loss in susceptible soybean genotypes. Chemical control measures have been successfully employed to limit commercial yield loss...

  9. Resistência à ferrugem da folha e potencial produtivo em genótipos de trigo Leaf rust resistance and grain yield potential in wheat genotypes

    Directory of Open Access Journals (Sweden)

    João Carlos Felicio

    2008-12-01

    o Paulo, Brazil, during 2003-2005 crop seasons. The evaluation of the genotypes to the causal agent of leaf rust was made at the seedling stage in greenhouse, where the genotypes were individually inoculated with spores of 12 races of Puccinia triticina, which represented the spectrum of pathogen virulence occurring in Brazil and under natural infection out in the field. Grain yield of each genotype was evaluated in the different regions and in a group of experiments, as well as the stability and adaptability. The genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 12 and 14 (BH1146//AA"S"/WIN"S"/3/VEE //DOVE/BUC showed resistance the physiologic races of Puccinia triticina in greenhouse in the seedling stage. The genotypes 4, 5, 8, 12, 13, 16 e 20 and the cultivar IAC 1004 (T. durum presented leaf rust resistance, under natural disease infection conditions. The highest grain yields were obtained by the genotypes 8 (BH1146// AA"S"/WIN"S"/3/BUC/FKL//MYNA/VUL, 7 (BH1146//AA"S"/WIN"S"/3/HANN*2/ PRL and 18 (CMH75.A.66/SERI/ 3/BH1146// AA"S"/WIN"S". Genotype 16 (KAUZ/3/ BH1146//AA"S"/WIN"S" presented the lowest yield.

  10. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  11. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  12. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    Science.gov (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  13. Role of Alternate Hosts in Epidemiology and Pathogen Variation of Cereal Rusts.

    Science.gov (United States)

    Zhao, Jie; Wang, Meinan; Chen, Xianming; Kang, Zhensheng

    2016-08-04

    Cereal rusts, caused by obligate and biotrophic fungi in the genus Puccinia, are important diseases that threaten world food security. With the recent discovery of alternate hosts for the stripe rust fungus (Puccinia striiformis), all cereal rust fungi are now known to be heteroecious, requiring two distinct plant species serving as primary or alternate hosts to complete their sexual life cycle. The roles of the alternate hosts in disease epidemiology and pathogen variation vary greatly from species to species and from region to region because of different climatic and cropping conditions. We focus this review on rust fungi of small grains, mainly stripe rust, stem rust, leaf rust, and crown rust of wheat, barley, oat, rye, and triticale, with emphases on the contributions of alternate hosts to the development and management of rust diseases.

  14. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  15. Aberrant mRNA processing of the maize Rp1-D rust resistance gene in wheat and barley.

    Science.gov (United States)

    Ayliffe, Michael A; Steinau, Martin; Park, Robert F; Rooke, Lee; Pacheco, Maria G; Hulbert, Scot H; Trick, Harold N; Pryor, Anthony J

    2004-08-01

    The maize Rp1-D gene confers race-specific resistance against Puccinia sorghi (common leaf rust) isolates containing a corresponding avrRp1-D avirulence gene. An Rp1-D genomic clone and a similar Rp1-D transgene regulated by the maize ubiquitin promoter were transformed independently into susceptible maize lines and shown to confer Rp1-D resistance, demonstrating that this resistance can be transferred as a single gene. Transfer of these functional transgenes into wheat and barley did not result in novel resistances when these plants were challenged with isolates of wheat stem rust (P. graminis), wheat leaf rust (P. triticina), or barley leaf rust (P. hordei). Regardless of the promoter employed, low levels of gene expression were observed. When constitutive promoters were used for transgene expression, a majority of Rp1-D transcripts were truncated in the nucleotide binding site-encoding region by premature polyadenylation. This aberrant mRNA processing was unrelated to gene function because an inactive version of the gene also generated such transcripts. These data demonstrate that resistance gene transfer between species may not be limited only by divergence of signaling effector molecules and pathogen avirulence ligands, but potentially also by more fundamental gene expression and transcript processing limitations.

  16. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  17. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  18. Amino acid uptake in rust fungi

    Directory of Open Access Journals (Sweden)

    Christine eStruck

    2015-02-01

    Full Text Available The plant pathogenic rust fungi colonize leaf tissue and feed off their host plants without killing them. Certain economically important species of different genera such as Melampsora, Phakopsora, Puccinia or Uromyces are extensively studied for resolving the mechanisms of the obligate biotrophy. As obligate parasites rust fungi only can complete their life cycle on living hosts where they grow through the leaf tissue by developing an extended network of intercellular hyphae from which intracellular haustoria are differentiated. Haustoria are involved in key functions of the obligate biotrophic lifestyle: suppressing host defense responses and acquiring nutrients. This review provides a survey of rust fungi nitrogen nutrition with special emphasis on amino acid uptake. A variety of sequences of amino acid transporter genes of rust fungi have been published; however, transport activity of only three in planta highly up-regulated amino acid permeases have been characterized. Functional and immunohistochemical investigations have shown the specificity and localization of these transporters. Sequence data of various genome projects allowed identification of numerous rust amino acid tranporter genes. An in silico analysis reveals that these genes can be classified into different transporter families. In addition, genetic and molecular data of amino acid transporters have provided new insights in the corresponding metabolic pathways.

  19. A review of soybean rust from a South African perspective

    Directory of Open Access Journals (Sweden)

    J. Antony Jarvie

    2010-01-01

    Full Text Available This review article describes the nature of the soybean rust pathogen, its interaction with the soybean host and documents some of the history of soybean rust in South Africa. Soybean rust has affected soybean cropping in parts of South Africa since 2001. The disease causes leaf lesions, which may progress to premature defoliation and ultimately result in grain yield loss in susceptible soybean genotypes. Chemical control measures have been successfully employed to limit commercial yield losses in South Africa; however, controlling the effects of this disease through host-resistance or tolerance mechanisms remains a long-term goal.

  20. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  1. Modelos de ponto crítico para estimar danos causados pela ferrugem da folha da aveia branca Critical yield models to estimate the damage caused by leaf rust in white oat

    Directory of Open Access Journals (Sweden)

    Erlei Melo Reis

    2008-09-01

    Full Text Available Em experimentos conduzidos no campo, nas safras agrícolas de 1995 e 1996, gerou-se o gradiente da intensidade da ferrugem da folha da aveia branca, cultivar UPF 13, pela aplicação nos órgãos aéreos de doses crescentes do fungicida triadimenol. As equações das funções de dano foram obtidas pela correlação entre o rendimento de grãos e a incidência da doença em diferentes estádios fenológicos da cultura. Na safra de 1995 as equações obtidas foram R= 2.103,5 - 17,983I e R= 2.404,6 - 12,832I, respectivamente para alongamento e emborrachamento, e em 1996, R= 3.889,2 - 27,871I e R= 5.366,4 - 20,999I, respectivamente para emborrachamento e floração (R= rendimento de grãos e I= incidência foliar. Estas equações, contendo o coeficiente de dano, permitem calcular o limiar de dano econômico (LDE tomado como critério indicador do momento para o início do controle químico da ferrugem da folha da aveia. As reduções no rendimento de grãos, no peso do hectolitro e no peso de mil sementes, atingiram, respectivamente 57,13%, 16,64% e 21,49% na safra 1995 e 19,79%, 13,39% e 16,33%, na safra 1996.In field experiments carried out in the 1995 and 1996 growing seasons, the gradient of leaf rust intensity on the white oat cultivar UPF 13 was generated by spraying the above ground plant parts of the crop with different rates of the fungicide triadimenol. Damage equations were obtained relating grain yield and disease incidence at different growing stages. In the 1995 growing season the equations were: R= 2,103.5 -17.983I and R= 2,404.6 - 12.832I, for elongation and boot stage, respectively, and for 1996, R= 3,889.2 - 27.871I and R= 5,366.4 - 20.999I (where R= grain yield; I= disease as foliar incidence, for booting and flowering stages respectively. These equations, having the damage coefficient, may be used to calculate the economic damage threshold (LDE as a criterion to indicate the moment for the fungicide application to control leaf

  2. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  3. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  4. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  5. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  6. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea.

    Science.gov (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan

    2016-12-01

    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  7. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  8. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  9. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  10. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  11. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  12. Demonstration of pathotype specificity in stem rust of perennial ryegrass.

    Science.gov (United States)

    Pfender, W

    2009-10-01

    Rust diseases cause significant damage in forage and seed crops of perennial ryegrass (Lolium perenne), which is highly heterozygous and heterogeneous and thus presents difficulty in genetic analysis. There has been no definitive demonstration of the existence of pathotypes for stem rust or other rusts of perennial ryegrass, although experiments with crown rust (Puccinia coronata) of this host are strongly suggestive of pathotype specificity. We made single-pustule isolates of P. graminis subsp. graminicola, and applied them individually to a set of genetically diverse, clonally propagated individuals of L. perenne. There were clear examples of different patterns of virulence among isolates across the different plant clones, including qualitative and quantitative differences in resistance. These data demonstrate the existence of pathotype specificity in stem rust of L. perenne, information which will be useful in breeding for disease resistance.

  13. Functional design space of single-veined leaves: role of tissue hydraulic properties in constraining leaf size and shape.

    Science.gov (United States)

    Zwieniecki, Maciej A; Boyce, C Kevin; Holbrook, N Michele

    2004-10-01

    Morphological diversity of leaves is usually quantified with geometrical characters, while in many cases a simple set of biophysical parameters are involved in constraining size and shape. One of the main physiological functions of the leaf is transpiration and thus one can expect that leaf hydraulic parameters can be used to predict potential morphologies, although with the caveat that morphology in turn influences physiological parameters including light interception and boundary layer thickness and thereby heat transfer and net photosynthesis. An iterative model was used to determine the relative sizes and shapes that are functionally possible for single-veined leaves as defined by their ability to supply the entire leaf lamina with sufficient water to prevent stomatal closure. The model variables include the hydraulic resistances associated with vein axial and radial transport, as well as with water movement through the mesophyll and the leaf surface. The four parameters included in the model are sufficient to define a hydraulic functional design space that includes all single-veined leaf shapes found in nature, including scale-, awl- and needle-like morphologies. This exercise demonstrates that hydraulic parameters have dissimilar effects: surface resistance primarily affects leaf size, while radial and mesophyll resistances primarily affect leaf shape. These distinctions between hydraulic parameters, as well as the differential accessibility of different morphologies, might relate to the convergent evolutionary patterns seen in a variety of fossil lineages concerning overall morphology and anatomical detail that frequently have evolved in linear and simple multi-veined leaves.

  14. Wheat Stripe Rust

    OpenAIRE

    Pace, Mike; Israelsen, Clark; Evans, Kent; Barnhill, James

    2008-01-01

    Stripe rust, or yellow rust, is primarily a foliar fungal disease of wheat, although it can infect spike and stem tissues. If the pathogen infects the spike (head) it causes extensive quality and grain yield loss. The disease is caused by the fungus Puccinia striiformis f. sp. tritici. The fungus can only survive and reproduce on wheat. It survives from one season to the next on volunteer plants.

  15. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  16. Analyzing Genetic Diversity for Virulence and Resistance Phenotypes in Populations of Stem Rust (Puccinia graminis f. sp. secalis) and Winter Rye (Secale cereale).

    Science.gov (United States)

    Miedaner, Thomas; Schmitt, Ann-Kristin; Klocke, Bettina; Schmiedchen, Brigitta; Wilde, Peer; Spieß, Hartmut; Szabo, Lilla; Koch, Silvia; Flath, Kerstin

    2016-11-01

    Stem rust (Puccinia graminis f. sp. secalis) leads to considerable yield losses in rye-growing areas with continental climate, from Eastern Germany to Siberia. For implementing resistance breeding, it is of utmost importance to (i) analyze the diversity of stem rust populations in terms of pathotypes (= virulence combinations) and (ii) identify resistance sources in winter rye populations. We analyzed 323 single-uredinial isolates mainly collected from German rye-growing areas across 3 years for their avirulence/virulence on 15 rye inbred differentials. Out of these, 226 pathotypes were detected and only 56 pathotypes occurred more than once. This high diversity was confirmed by a Simpson index of 1.0, a high Shannon index (5.27), and an evenness index of 0.97. In parallel, we investigated stem rust resistance among and within 121 heterogeneous rye populations originating mainly from Russia, Poland, Austria, and the United States across 3 to 15 environments (location-year combinations). While German rye populations had an average stem rust severity of 49.7%, 23 nonadapted populations were significantly (P stem rust severity ranging from 3 to 40%. Out of these, two modern Russian breeding populations and two old Austrian landraces were the best harboring 32 to 70% fully resistant plants across 8 to 10 environments. These populations with the lowest disease severity in adult-plant stage in the field also displayed resistance in leaf segment tests. In conclusion, stem rust populations are highly diverse and the majority of resistances in rye populations seems to be race specific.

  17. Concerted action of two avirulent spore effectors activates Reaction to Puccinia graminis 1 (Rpg1)-mediated cereal stem rust resistance

    Science.gov (United States)

    The barley stem rust resistance gene Reaction to Puccinia graminis 1 (Rpg1), encoding a receptor-like kinase, confers durable resistance to the stem rust pathogen Puccinia graminis f. sp. tritici. The fungal urediniospores form adhesion structures with the leaf epidermal cells within 1 h of inocula...

  18. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  19. Specificity of a Rust Resistance Suppressor on 7DL in the Spring Wheat Cultivar Canthatch.

    Science.gov (United States)

    Talajoor, Mina; Jin, Yue; Wan, Anmin; Chen, Xianming; Bhavani, Sridhar; Tabe, Linda; Lagudah, Evans; Huang, Li

    2015-04-01

    The spring wheat 'Canthatch' has been shown to suppress stem rust resistance genes in the background due to the presence of a suppressor gene located on the long arm of chromosome 7D. However, it is unclear whether the suppressor also suppresses resistance genes against leaf rust and stripe rust. In this study, we investigated the specificity of the resistance suppression. To determine whether the suppression is genome origin specific, chromosome location specific, or rust species or race specific, we introduced 11 known rust resistance genes into the Canthatch background, including resistance to leaf, stripe, or stem rusts, originating from A, B, or D genomes and located on different chromosome homologous groups. F1 plants of each cross were tested with the corresponding rust race, and the infection types were scored and compared with the parents. Our results show that the Canthatch 7DL suppressor only suppressed stem rust resistance genes derived from either the A or B genome, and the pattern of the suppression is gene specific and independent of chromosomal location.

  20. Evaporation and wetted area of single droplets on waxy and hairy leaf surfaces.

    Science.gov (United States)

    Zhu, H; Yu, Y; Ozkan, H E; Derksen, R C; Krause, C R

    2008-01-01

    Understanding the evaporation of pesticide droplets and wetting of Leaf surfaces can increase foliar application efficiency and reduce pesticide use. Evaporation time and wetted area of single pesticide droplets on hairy and waxy geranium leaf surfaces were measured under the controlled conditions for five droplet sizes and three relative humidities. The sprays used to form droplets included water, a nonionic colloidal polymer drift retardant, an alkyl polyoxyethylene surfactant, and an insecticide. Adding the surfactant into spray mixtures greatly increased droplet wetted area on the surfaces while droplet evaporation time was greatly reduced. Adding the drift retardant into spray mixture slightly increased the droplet evaporation time and the wetted area. Also, droplets had Longer evaporation times on waxy leaves than on hairy leaves for all droplet diameters and all relative humidity conditions. Increasing relative humidity could increase the droplet evaporation time greatly but did not change the the wetted area. The droplet evaporation time and wetted area increased exponentially as the droplet size increased. Therefore, droplet size, surface characteristics of the target, relative humidity, and chemical composition of the spray mixtures (water alone, pesticide, additives) should be included as important factors that affect the efficacy and efficiency of pesticide applications.

  1. Seed treatment for control leaf spot diseases of spring wheat

    Directory of Open Access Journals (Sweden)

    Barbara Krzyzińska

    2012-12-01

    Full Text Available In the years 2001 and 2002 at the Institute of Plant Protection Branch in Sooenicowice research work was performed on seed treatment with fungicides against leaf diseases of spring wheat cv. Ismena caused by pathogenic fungi: Blumeria graminis, Phaeasphaeria nodorum, Puccinia recondita i Pyrenophora tritici-repentis. Two variants of protection were included in the experiment: seed dressing with fungicides or seed dressing and single application of foliar spray at GS 49. At early growth stages of spring wheat a very high biological activity against powdery mildew, septoria leaf spot, brown rust and tan spot was recorded for seed dressing containing triticonazole+prochloraz. In the case of triadimenol+imazalil+fuberidazole only a weak, but long-lasting effect against brown rust and septoria leaf spot was observed. Leaf infection as well as 1000 grain mass and yield, in the experimental combination with using triticonazole+prochloraz were on the same level as in the experimental variant where after seed dressing with triadimenol+imazalil+fuberidazole plots were sprayed with tridemorf+epoxykonazole at GS 49. It was concluded that seed dressing preparation containing triticonazole+prochloraz constituted a good base for protection of spring wheat against foliar diseases.

  2. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    A wheat rust toolbox was developed in the frame of the Borlaug Global Rust Initiative (BGRI) to support the early warning and monitoring of stem rust on a global scale. The toolbox consists of a number of databases and web applications for data management, quality control, dissemination and display...... of interactive maps; including information on surveillance (disease data over years and across countries for all three rusts) and graphs and maps indicating the distribution of UG99 and related pathotypes. Graphs and maps are integrated with, and disseminated, via the Rust SPORE web portal at FAO (http://www.fao.org/agriculture/crops/rust/stem/rust......-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...

  3. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  4. Commandra Blister Rust

    Science.gov (United States)

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  5. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  6. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  7. Prospects for advancing defense to cereal rusts through genetical genomics.

    Science.gov (United States)

    Ballini, Elsa; Lauter, Nick; Wise, Roger

    2013-01-01

    Rusts are one of the most severe threats to cereal crops because new pathogen races emerge regularly, resulting in infestations that lead to large yield losses. In 1999, a new race of stem rust, Puccinia graminis f. sp. tritici (Pgt TTKSK or Ug99), was discovered in Uganda. Most of the wheat and barley cultivars grown currently worldwide are susceptible to this new race. Pgt TTKSK has already spread northward into Iran and will likely spread eastward throughout the Indian subcontinent in the near future. This scenario is not unique to stem rust; new races of leaf rust (Puccinia triticina) and stripe rust (Puccinia striiformis) have also emerged recently. One strategy for countering the persistent adaptability of these pathogens is to stack complete- and partial-resistance genes, which requires significant breeding efforts in order to reduce deleterious effects of linkage drag. These varied resistance combinations are typically more difficult for the pathogen to defeat, since they would be predicted to apply lower selection pressure. Genetical genomics or expression Quantitative Trait Locus (eQTL) analysis enables the identification of regulatory loci that control the expression of many to hundreds of genes. Integrated deployment of these technologies coupled with efficient phenotyping offers significant potential to elucidate the regulatory nodes in genetic networks that orchestrate host defense responses. The focus of this review will be to present advances in genetical genomic experimental designs and analysis, particularly as they apply to the prospects for discovering partial disease resistance alleles in cereals.

  8. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis

    OpenAIRE

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D.; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J.; Hern?ndez-Pinz?n, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D. G.; Ward, Eric R.; Steffenson, Brian J.

    2017-01-01

    Key message We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Abstract Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relat...

  9. Identification of the varietal origin of processed loose-leaf tea based on analysis of a single leaf by SNP nanofluidic array

    Directory of Open Access Journals (Sweden)

    Wanping Fang

    2016-08-01

    Full Text Available Tea is an important cash crop, representing a $40 billion-a-year global market. Differentiation of the tea market has resulted in increasing demand for tea products that are sustainably and responsibly produced. Tea authentication is important because of growing concerns about fraud involving premium tea products. Analytical technologies are needed for protection and value enhancement of high-quality brands. For loose-leaf teas, the challenge is that the authentication needs to be established on the basis of a single leaf, so that the products can be traced back to the original varieties. A new generation of molecular markers offers an ideal solution for authentication of processed agricultural products. Using a nanofluidic array to identify variant SNP sequences, we tested genetic identities using DNA extracted from single leaves of 14 processed commercial tea products. Based on the profiles of 60 SNP markers, the genetic identity of each tea sample was unambiguously identified by multilocus matching and ordination analysis. Results for repeated samples of multiple tea leaves from the same products (using three independent DNA extractions showed 100% concordance, showing that the nanofluidic system is a reliable platform for generating tea DNA fingerprints with high accuracy. The method worked well on green, oolong, and black teas, and can handle a large number of samples in a short period of time. It is robust and cost-effective, thus showing high potential for practical application in the value chain of the tea industry.

  10. Genetics and mapping of seedling resistance to Ug99 stem rust in Canadian wheat cultivars 'Peace' and 'AC Cadillac'.

    Science.gov (United States)

    Hiebert, Colin W; Fetch, Tom G; Zegeye, Taye; Thomas, Julian B; Somers, Daryl J; Humphreys, D Gavin; McCallum, Brent D; Cloutier, Sylvie; Singh, Davinder; Knott, Doug R

    2011-01-01

    Stem rust (caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.) has re-emerged as a threat to wheat production with the evolution of new pathogen races, namely TTKSK (Ug99) and its variants, in Africa. Deployment of resistant wheat cultivars has provided long-term control of stem rust. Identification of new resistance genes will contribute to future cultivars with broad resistance to stem rust. The related Canadian cultivars Peace and AC Cadillac show resistance to Ug99 at the seedling stage and in the field. The purpose of this study was to elucidate the inheritance and genetically map resistance to Ug99 in these two cultivars. Two populations were produced, an F(2:3) population from LMPG/AC Cadillac and a doubled haploid (DH) population from RL6071/Peace. Both populations showed segregation at the seedling stage for a single stem rust resistance (Sr) gene, temporarily named SrCad. SrCad was mapped to chromosome 6DS in both populations with microsatellite markers and a marker (FSD_RSA) that is tightly linked to the common bunt resistance gene Bt10. FSD_RSA was the closest marker to SrCad (≈ 1.6 cM). Evaluation of the RL6071/Peace DH population and a second DH population, AC Karma/87E03-S2B1, in Kenya showed that the combination of SrCad and leaf rust resistance gene Lr34 provided a high level of resistance to Ug99-type races in the field, whereas in the absence of Lr34 SrCad conferred moderate resistance. A survey confirmed that SrCad is the basis for all of the seedling resistance to Ug99 in Canadian wheat cultivars. While further study is needed to determine the relationship between SrCad and other Sr genes on chromosome 6DS, SrCad represents a valuable genetic resource for producing stem rust resistant wheat cultivars.

  11. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  12. DWDM Transmission with LEAF and RDF Structure in 40 Gb/s Single MZM with RZ-DPSK Modulation

    Science.gov (United States)

    Lin, Hsiu-Sheng; Lai, Po-Chou

    2017-06-01

    We propose the experiment transport of 48 Chs 40 Gb/s dense wavelength division multiplexing (DWDM) system that uses larger effective area fiber (LEAF) in combination with reverse dispersion fiber (RDF), which is a dispersion compensation device, in C band (1,530-1,560 nm) and L band (1,570-1,610 nm) wavelength range to solve the dispersion program. The single Mach-Zehnder modulation (MZM) format with erbium-doped fiber amplifier (EDFA) configuration to generate return-to-zero differential phase-shift keying (RZ-DPSK) modulation signal can compensate dispersion impairment in 48×40 Gb/s DWDM system. The proposed 48×40 Gb/s DWDM system successfully employs single MZM RZ-DPSK modulation format to reduce modulation complex configuration with EDFA to promote the power signal and using LEAF and RDF in 28 spans over 3,360 km ultra-long-haul fiber transmission successfully.

  13. 78 FR 27855 - Black Stem Rust; Additions of Rust-Resistant Species and Varieties

    Science.gov (United States)

    2013-05-13

    .... APHIS-2012-0108] Black Stem Rust; Additions of Rust-Resistant Species and Varieties AGENCY: Animal and... stem rust quarantine and regulations by adding two varieties to the list of rust-resistant Berberis species and varieties and one variety to the list of rust-resistant Mahonia species and varieties. This...

  14. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  15. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  16. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  17. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  19. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.

    Science.gov (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A

    2017-07-01

    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  20. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao

    2008-01-01

    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  1. Intensidade da ferrugem asiática (Phakopsora pachyrhizi H. Sydow & P. Sydow da soja [Glycine max (L. Merr.] nas cultivares Conquista, Savana e Suprema sob diferentes temperaturas e períodos de molhamento foliar The effects of temperature and leaf wetness periods on the development of soybean rust in the cultivars Consquista, Savana and Suprema

    Directory of Open Access Journals (Sweden)

    Marcelo Carvalho Alves

    2007-09-01

    temperatura e molhamento foliar.The asian rust (Phakopsora pachyrhizi Sydow which has been reported in areas of tropical and subtropical climates around the world, causes significant soybean [Glycine max (L. Merr.] yield reduction. The disease progress is influenced by biotic factors as interaction pathogen-host and abiotic factors of the environment. The objective of this work was to study the effects of temperature and leaf wetness period in the asian rust progress in the cultivars Conquista, Savana and Suprema. The experiment was conducted at the Department of Plant Pathology at Federal University of Lavras, in growth chamber at temperatures of 15, 20, 25 and 30 °C and leaf wetness periods of 0,6, 12, 18 and 24 hours. The plants were inoculated by spraying a suspension of inoculum of P. pachyrhizi at concentration of 10(4 urediniospores.mL-1. Severity and incidence data were integrated by the area under disease progress curve for severity (AUDPCS and incidence (AUDPCI. Non-linear regression models were adjusted for the disease severity (AUDPCS and incidence (AUDPCI. Volume under the response surface of temperature and leaf wetness was calculated for incidence (VURSI and severity (VURSS to detect differences between cultivars. Higher soybean rust intensity occurred with leaf wetness above 15 hours and temperatures close to 20 ºC, for the three tested cultivars. Temperatures above 30 ºC and below 15 ºC reduced the disease progress. Disease intensity was reduced in leaf wetness below 6 hours. All cultivars were susceptible, but higher VURSI and VURSS occurred in Conquista cultivar, followed by Savana and Suprema cultivars. Disease intensity was not statistically different between Savana and Suprema cultivars. Temperature and leaf wetness were different among cultivars for AUDPCI.

  2. Prospects for Advancing Defense to Cereal Rusts through Genetical Genomics

    Directory of Open Access Journals (Sweden)

    Elsa eBallini

    2013-05-01

    Full Text Available Rusts are one of the most severe threats to cereal crops because new pathogen races emerge regularly, resulting in infestations that lead to large yield losses. In 1999, a new race of stem rust, Puccinia graminis f. sp. tritici (Pgt TTKSK or Ug99, was discovered in Uganda. Most of the wheat and barley cultivars grown currently worldwide are susceptible to this new race. Pgt TTKSK has already spread northward into Iran and will likely spread eastward throughout the Indian subcontinent in the near future. This scenario is not unique to stem rust; new races of leaf rust (Puccinia triticina and stripe rust (Puccinia striiformis have also emerged recently. One strategy for countering the persistent adaptability of these pathogens is to stack complete- and partial-resistance genes, which requires significant breeding efforts in order to reduce deleterious effects of linkage drag. These varied resistance combinations are typically more difficult for the pathogen to defeat, since they would be predicted to apply lower selection pressure. Genetical genomics or expression Quantitative Trait Locus (eQTL analysis enables the identification of regulatory loci that control the expression of many to hundreds of genes. Integrated deployment of these technologies coupled with efficient phenotyping offers significant potential to elucidate the regulatory nodes in genetic networks that orchestrate host defense responses. The focus of this review will be to present advances in genetical genomic experimental designs and analysis, particularly as they apply to the prospects for discovering partial disease resistance alleles in cereals.

  3. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  4. Fighting Asian soybean rust

    Directory of Open Access Journals (Sweden)

    Caspar eLangenbach

    2016-06-01

    Full Text Available Phakopsora pachyrhizi is a biotrophic fungus provoking Asian soybean rust (SBR disease. SBR poses a major threat to global soybean production. Though several resistance genes provided soybean immunity to certain P. pachyrhizi races, the pathogen swiftly overcame this resistance. Therefore, fungicides are the only current means to control SBR. However, insensitivity to fungicides is soaring in P. pachyrhizi and, therefore, alternative measures are needed for SBR control. In this article, we discuss the different approaches for fighting SBR and their potential, disadvantages, and advantages over other measures. These encompass conventional breeding for SBR resistance, transgenic approaches, exploitation of transcription factors, secondary metabolites, and antimicrobial peptides, RNAi/HIGS, and biocontrol strategies. It seems that an integrating approach exploiting different measures is likely to provide the best possible means for the effective control of SBR.

  5. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...-0035] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection... direct final rule notified the public of our intention to amend the black stem rust quarantine and regulations by adding 21 varieties to the list of rust-resistant Berberis species or cultivars and 2 varieties...

  6. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...-0088] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four varieties to the list of rust-resistant Berberis species or cultivars. We did not receive any written...

  7. 75 FR 54461 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-09-08

    .... APHIS-2010-0088] Black Stem Rust; Additions of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Direct final rule. SUMMARY: We are amending the black stem rust quarantine and regulations by adding four varieties to the list of rust-resistant Berberis species or cultivars...

  8. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.

    Science.gov (United States)

    Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G

    2016-01-01

    Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.

  9. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  10. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    Science.gov (United States)

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. Growth-chamber studies demonstrated wheat rust control at multiple plant growth stages with a glyphosate spray dose typically recommended for weed control. Rust control was absent in formulation controls without glyphosate, dependent on systemic glyphosate concentrations in leaf tissues, and not mediated through induction of four common systemic acquired resistance genes. A field test with endemic stripe rust inoculum confirmed the activities of glyphosate pre- and postinfestation. Preliminary greenhouse studies also demonstrated that application of glyphosate in glyphosate-resistant soybeans suppressed Asian soybean rust, caused by Phakopsora pachyrhizi. PMID:16293685

  11. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Science.gov (United States)

    Saunders, Diane G O; Win, Joe; Cano, Liliana M; Szabo, Les J; Kamoun, Sophien; Raffaele, Sylvain

    2012-01-01

    Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i) contain a secretion signal, (ii) are encoded by in planta induced genes, (iii) have similarity to haustorial proteins, (iv) are small and cysteine rich, (v) contain a known effector motif or a nuclear localization signal, (vi) are encoded by genes with long intergenic regions, (vii) contain internal repeats, and (viii) do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  12. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  13. Using Hierarchical Clustering of Secreted Protein Families to Classify and Rank Candidate Effectors of Rust Fungi

    Science.gov (United States)

    Saunders, Diane G. O.; Win, Joe; Cano, Liliana M.; Szabo, Les J.; Kamoun, Sophien; Raffaele, Sylvain

    2012-01-01

    Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i) contain a secretion signal, (ii) are encoded by in planta induced genes, (iii) have similarity to haustorial proteins, (iv) are small and cysteine rich, (v) contain a known effector motif or a nuclear localization signal, (vi) are encoded by genes with long intergenic regions, (vii) contain internal repeats, and (viii) do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components. PMID:22238666

  14. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  15. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  16. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  17. Detection of soybean rust contamination in soy leaves by FTIR photoacoustic spectroscopy

    Science.gov (United States)

    Andrade, L. H. C.; Freitas, P. G.; Mantovani, B. G.; Figueiredo, M. S.; Lima, R. A.; Lima, S. M.; Rangel, M. A. S.; Mussury, R. M.

    2008-01-01

    In this work the Photoacoustic Infrared Spectroscopy from 4000 to 400 cm-1 was applied, by the first time to our knowledge, to diagnostic the soy bean rust or Asian rust contamination on soy leafs caused by the fungi Phakopsora pachyrhizi. The obtained results shown that a premature, fast and precise diagnosis can be achieved using this technique before it can be detect by the conventional visual method. The early identification of the fungi infection avoid massive lost in the soy production and decrease the intense use of fungicide whose is necessary when the infection is in advanced stagy.

  18. Phakopsora pachyrhizi, the causal agent of Asian soybean rust.

    Science.gov (United States)

    Goellner, Katharina; Loehrer, Marco; Langenbach, Caspar; Conrath, Uwe; Koch, Eckhard; Schaffrath, Ulrich

    2010-03-01

    The plant pathogenic basidiomycete fungi Phakopsora pachyrhizi and Phakopsora meibomiae cause rust disease in soybean plants. Phakopsora pachyrhizi originated in Asia-Australia, whereas the less aggressive P. meibomiae originated in Latin America. In the New World, P. pachyrhizi was first reported in the 1990s to have spread to Hawaii and, since 2001, it has been found in South America. In 2004, the pathogen entered continental USA. This review provides detailed information on the taxonomy and molecular biology of the pathogen, and summarizes strategies to combat the threat of this devastating disease. Phakopsora pachyrhizi Syd. & P. Syd; uredial anamorph: Malupa sojae (syn. Uredo sojae); Domain Eukaryota; Kingdom Fungi; Phylum Basidiomycota; Order Uredinales; Class Urediniomycetes; Family Phakopsoraceae; Genus Phakopsora (http://www.indexfungorum.org). The nomenclature of rust spores and spore-producing structures used within this review follows Agrios GN (2005) Plant Pathology, 5th edn. London: Elsevier/Academic Press. In the field, P. pachyrhizi infects leaf tissue from a broad range (at least 31 species in 17 genera) of leguminous plants. Infection of an additional 60 species in other genera has been achieved under laboratory conditions. At the beginning of the disease, small, tan-coloured lesions, restricted by leaf veins, can be observed on infected soybean leaves. Lesions enlarge and, 5-8 days after initial infection, rust pustules (uredia, syn. uredinia) become visible. Uredia develop more frequently in lesions on the lower surface of the leaf than on the upper surface. The uredia open with a round ostiole through which uredospores are released.

  19. A consensus map for Ug99 stem rust resistance loci in wheat.

    Science.gov (United States)

    Yu, Long-Xi; Barbier, Hugues; Rouse, Matthew N; Singh, Sukhwinder; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2014-07-01

    This consensus map of stem rust genes, QTLs, and molecular markers will facilitate the identification of new resistance genes and provide a resource of in formation for development of new markers for breeding wheat varieties resistant to Ug99. The global effort to identify new sources of resistance to wheat stem rust, caused by Puccinia graminis f. sp. tritici race group Ug99 has resulted in numerous studies reporting both qualitative genes and quantitative trait loci. The purpose of our study was to assemble all available information on loci associated with stem rust resistance from 21 recent studies on Triticum aestivum L. (bread wheat) and Triticum turgidum subsp. durum desf. (durum wheat). The software LPmerge was used to construct a stem rust resistance loci consensus wheat map with 1,433 markers incorporating Single Nucleotide Polymorphism, Diversity Arrays Technology, Genotyping-by-Sequencing as well as Simple Sequence Repeat marker information. Most of the markers associated with stem rust resistance have been identified in more than one population. Several loci identified in these populations map to the same regions with known Sr genes including Sr2, SrND643, Sr25 and Sr57 (Lr34/Yr18/Pm38), while other significant markers were located in chromosome regions where no Sr genes have been previously reported. This consensus map provides a comprehensive source of information on 141 stem rust resistance loci conferring resistance to stem rust Ug99 as well as linked markers for use in marker-assisted selection.

  20. Superação da resistência qualitativa da cultivar de trigo "BRS 194" por uma nova raça de Puccinia triticina Breakdown of qualitative leaf rust resistance in the wheat cultivar 'BRS 194' by a new race of Puccinia triticina

    Directory of Open Access Journals (Sweden)

    Márcia Soares Chaves

    2009-02-01

    Full Text Available A população de Puccinia triticina, agente causal da ferrugem da folha do trigo, é extremamente dinâmica na região do Cone Sul da América do Sul, onde o surgimento de novas raças é freqüente. A cultivar de trigo "BRS 194" foi a segunda variedade com maior disponibilidade de sementes para plantio no Rio Grande do Sul e em Santa Catarina em 2005, por apresentar características como rusticidade, elevado rendimento de grãos e resistência qualitativa a todas as raças de P. triticina ocorrentes no Brasil e em outros países da América do Sul. Em 2005, pústulas de ferrugem da folha foram observadas sobre plantas desta cultivar, tanto em lavouras quanto em campos experimentais, indicando a possível superação de sua resistência. O objetivo deste trabalho foi identificar a raça de P. triticina presente em amostras oriundas de "BRS 194" e verificar se esta se tratava de uma nova virulência do patógeno, a qual teria superado sua resistência. Oito amostras de ferrugem provenientes da cultivar "BRS 194" foram enviadas em 2005 à Embrapa Trigo, Passo Fundo, Rio Grande do Sul, para isolamento e identificação por meio da Série Internacional de Hospedeiros Diferenciais específica para este patógeno. Todas as amostras apresentaram a mesma combinação de virulência, a qual correspondeu ao código MFP-CT, conforme o Sistema Norte-Americano de nomenclatura do patógeno. Esta foi a primeira vez que este código foi detectado no Brasil, caracterizando o surgimento de uma nova raça de P. triticina virulenta à "BRS 194". Outras cultivares de trigo, também amplamente semeadas, foram inoculadas com a nova raça, sendo que algumas foram suscetíveis e outras resistentes. Entre as cultivares resistentes estão "Fundacep 30" e "IPR 84", as quais permanecem também resistentes a todas as raças do patógeno ocorrentes no Brasil.The population of Puccinia triticina, the causal agent of wheat leaf rust, is extremely dynamic in the South Cone

  1. Wavelet-Based Rust Spectral Feature Set (WRSFs: A Novel Spectral Feature Set Based on Continuous Wavelet Transformation for Tracking Progressive Host–Pathogen Interaction of Yellow Rust on Wheat

    Directory of Open Access Journals (Sweden)

    Yue Shi

    2018-03-01

    Full Text Available Understanding the progression of host–pathogen interaction through time by hyperspectral features is vital for tracking yellow rust (Puccinia striiformis development, one of the major diseases of wheat. However, well-designed features are still open issues that impact the performance of relevant models to nondestructively detect pathological progress of wheat rust. The aim of this paper is (1 to propose a novel wavelet-based rust spectral feature set (WRSFs to uncover wheat rust-related processes; and (2 to evaluate the performance and robustness of the proposed WRSFs and models for retrieving the progression of host–pathogen interaction and tracking rust development. A hyperspectral dataset was collected by analytical spectral devices (ASD spectroradiometer and Headwall spectrograph, along with corresponding physiological measurements of chlorophyll index (CHL, nitrogen balance index (NBI, anthocyanin index (ANTH, and percentile dry matter (PDM from the 7th to 41st day after inoculation (dai under controlled conditions. The resultant findings suggest that the progression of yellow rust on wheat is better characterized by the proposed WRSFs (R2 > 0.7. The WRSFs-based PLSR model provides insight into specific leaf biophysical variations in the rust pathological progress. To evaluate the efficiency of the proposed WRSFs on yellow rust discrimination during different infestation stages, the identified WRSFs and vegetation indices (VIs were fed into linear discriminant analysis (LDA and support vector machine (SVM classification frames. The WRSFs in conjunction with a SVM classifier can obtain better performance than that of LDA method and the VIs-based models. Overall, synthesizing the biophysical analysis, retrieving accuracy, and classification performance, we recommend the proposed WRSFs for monitoring the progression of the host–pathogen interaction of yellow rust on wheat cross various hyperspectral sensors.

  2. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Science.gov (United States)

    Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio

    2016-01-01

    Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  3. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Emanuela Ventrella

    Full Text Available Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture.

  4. Solanum tuberosum and Lycopersicon esculentum Leaf Extracts and Single Metabolites Affect Development and Reproduction of Drosophila melanogaster

    Science.gov (United States)

    Ventrella, Emanuela; Adamski, Zbigniew; Chudzińska, Ewa; Miądowicz-Kobielska, Mariola; Marciniak, Paweł; Büyükgüzel, Ender; Büyükgüzel, Kemal; Erdem, Meltem; Falabella, Patrizia; Scrano, Laura; Bufo, Sabino Aurelio

    2016-01-01

    Glycoalkaloids are secondary metabolites commonly found in Solanaceae plants. They have anti-bacterial, anti-fungal and insecticidal activities. In the present study we examine the effects of potato and tomato leaf extracts and their main components, the glycoalkaloids α-solanine, α-chaconine and α-tomatine, on development and reproduction of Drosophila melanogaster wild-type flies at different stages. Parental generation was exposed to five different concentrations of tested substances. The effects were examined also on the next, non-exposed generation. In the first (exposed) generation, addition of each extract reduced the number of organisms reaching the pupal and imaginal stages. Parent insects exposed to extracts and metabolites individually applied showed faster development. However, the effect was weaker in case of single metabolites than in case of exposure to extracts. An increase of developmental rate was also observed in the next, non-exposed generation. The imagoes of both generations exposed to extracts and pure metabolites showed some anomalies in body size and malformations, such as deformed wings and abdomens, smaller black abdominal zone. Our results further support the current idea that Solanaceae can be an impressive source of molecules, which could efficaciously be used in crop protection, as natural extract or in formulation of single pure metabolites in sustainable agriculture. PMID:27213896

  5. The forced sound transmission of finite single leaf walls using a variational technique.

    Science.gov (United States)

    Brunskog, Jonas

    2012-09-01

    The single wall is the simplest element of concern in building acoustics, but there still remain some open questions regarding the sound insulation of this simple case. The two main reasons for this are the effects on the excitation and sound radiation of the wall when it has a finite size, and the fact that the wave field in the wall is consisting of two types of waves, namely forced waves due to the exciting acoustic field, and free bending waves due to reflections in the boundary. The aim of the present paper is to derive simple analytical formulas for the forced part of the airborne sound insulation of a single homogeneous wall of finite size, using a variational technique based on the integral-differential equation of the fluid loaded wall. The so derived formulas are valid in the entire audible frequency range. The results are compared with full numerical calculations, measurements and alternative theory, with reasonable agreement.

  6. The forced sound transmission of finite single leaf walls using a variational technique

    DEFF Research Database (Denmark)

    Brunskog, Jonas

    2012-01-01

    The single wall is the simplest element of concern in building acoustics, but there still remain some open questions regarding the sound insulation of this simple case. The two main reasons for this are the effects on the excitation and sound radiation of the wall when it has a finite size......, and the fact that the wave field in the wall is consisting of two types of waves, namely forced waves due to the exciting acoustic field, and free bending waves due to reflections in the boundary. The aim of the present paper is to derive simple analytical formulas for the forced part of the airborne sound...... insulation of a single homogeneous wall of finite size, using a variational technique based on the integral-differential equation of the fluid loaded wall. The so derived formulas are valid in the entire audible frequency range. The results are compared with full numerical calculations, measurements...

  7. Archaeophytopathology of Global Soybean Rust

    Science.gov (United States)

    Phakopsora pachyrhizi and P. meibomiae are two rust species that infect soybean (Glycine max). A number of other hosts support the uredinial growth of these Phakopsora, including Pachyrhizus erosus, Pueraria lobata, and Vigna unguiculata, but no aecial host is known. Traditionally, these two species...

  8. Fusiform Rust of Southern Pines

    Science.gov (United States)

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  9. Proteins in intercellular washing fluid from noninoculated and rust-affected leaves of wheat and barley.

    Science.gov (United States)

    Holden, D W; Rohringer, R

    1985-08-01

    Proteins in intercellular washing fluid (IWF) from wheat (Triticum aestivum) and barley (Hordeum vulgare) leaves were separated by two-dimensional isoelectric focusing-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (CBB) or silver. Intracellular protein from the cut ends of leaves accounted for only a small proportion of total protein in IWF from wheat leaves. When these were heavily infected with the stem rust fungus (Puccinia graminis f. sp. tritici) and grown at 19 degrees C, four infection-related CBB-stainable proteins were detected in IWF.To compare IWF proteins from wheat and barley leaves infected with the same pathogen, conditions were established that permitted luxuriant growth of stem rust of wheat in barley (exposure to chloroform before inoculation and maintenance at 25 degrees C thereafter). Under these conditions, at least 10 infection-related silver-stainable proteins were detected in IWF from infected wheat in addition to the more than 50 that were of host origin. The electrophoretic properties of 8 of the infection-related proteins were the same as those of 8 infection-related proteins in IWF from barley.IWF from wheat and barley grown under these conditions was analyzed for Concanavalin A-binding glycoproteins immobilized on nitrocellulose membrane replicas made from gels. Of the many infection-related glycoproteins that were detected in IWF from stem rust-affected wheat, approximately 20 occupied the same positions as those from stem rust-affected barley. The glycoprotein pattern of IWF prepared from wheat leaves grown at 19 degrees C and infected with the leaf rust fungus (P. recondita f. sp. tritici) was markedly different to that of IWF from the same host infected with the stem rust fungus. We conclude that IWF from rust-affected cereal leaves may be a useful source of surface or extracellular proteins from the parasitic mycelium.

  10. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.

    2008-01-01

    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  11. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  12. Multiple genotypes within aecial clusters in Puccinia graminis and Puccinia coronata: improved understanding of the biology of cereal rust fungi.

    Science.gov (United States)

    Berlin, Anna; Samils, Berit; Andersson, Björn

    2017-01-01

    Cereal rust fungi ( Puccinia spp.) are among the most economically important plant pathogens. These fungi have a complex life cycle, including five spore stages and two hosts. They infect one grass host on which they reproduce clonally and cause the cereal rust diseases, while the alternate host is required for sexual reproduction. Although previous studies clearly demonstrate the importance of the alternate host in creating genetic diversity in cereal rust fungi, little is known about the amount of novel genotypes created in each successful completion of a sexual reproduction event. In this study, single sequence repeat markers were used to study the genotypic diversity within aecial clusters by genotyping individual aecial cups. Two common cereal rusts, Puccinia graminis causing stem rust and Puccinia coronata the causal agent of crown rust were investigated. We showed that under natural conditions, a single aecial cluster usually include several genotypes, either because a single pycnial cluster is fertilized by several different pycniospores, or because aecia within the cluster are derived from more than one fertilized adjoining pycnial cluster, or a combination of both. Our results imply that although sexual events in cereal rust fungi in most regions of the world are relatively rare, the events that occur may still significantly contribute to the genetic variation within the pathogen populations.

  13. Durable resistance to wheat stem rust needed.

    Science.gov (United States)

    Ayliffe, Michael; Singh, Ravi; Lagudah, Evans

    2008-04-01

    The recent outbreak of a new wheat stem rust race capable of parasitizing many commercial wheat cultivars highlights the need for durable disease resistance in crop plants. More advanced breeding approaches using quantitative disease resistance genes and resistance gene pyramids are being used to combat wheat stem rust and other diseases, though widespread adoption of these breeding methodologies is needed to maintain resistance efficacy. Advances in understanding the molecular basis of plant disease resistance at both host and nonhost levels offers further possibilities for stem rust resistance using biotechnological approaches. However, truly durable resistance to wheat stem rust and other phytopathogens seems an unlikely prospect in the face of continually evolving pathogen populations.

  14. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  15. Genomic Patterns of Positive Selection at the Origin of Rust Fungi.

    Science.gov (United States)

    Silva, Diogo N; Duplessis, Sebastien; Talhinhas, Pedro; Azinheira, Helena; Paulo, Octávio S; Batista, Dora

    2015-01-01

    Understanding the origin and evolution of pathogenicity and biotrophic life-style of rust fungi has remained a conundrum for decades. Research on the molecular mechanisms responsible for rust fungi evolution has been hampered by their biotrophic life-style until the sequencing of some rust fungi genomes. With the availability of multiple whole genomes and EST data for this group, it is now possible to employ genome-wide surveys and investigate how natural selection shaped their evolution. In this work, we employed a phylogenomics approach to search for positive selection and genes undergoing accelerated evolution at the origin of rust fungi on an assembly of single copy genes conserved across a broad range of basidiomycetes. Up to 985 genes were screened for positive selection on the phylogenetic branch leading to rusts, revealing a pervasive signal of positive selection throughout the data set with the proportion of positively selected genes ranging between 19.6-33.3%. Additionally, 30 genes were found to be under accelerated evolution at the origin of rust fungi, probably due to a mixture of positive selection and relaxation of purifying selection. Functional annotation of the positively selected genes revealed an enrichment in genes involved in the biosynthesis of secondary metabolites and several metabolism and transporter classes.

  16. Derivation of host and pathogen genotypes in the fusiform rust pathosystem on slash pine using a complimentary genetics model and diallel data

    Science.gov (United States)

    H.E. Stelzel; Robert L. Doudrick; Thomas L. Kubisiak

    1997-01-01

    Seedlings from 20, full-sib families five-parent slash pine diallel were inoculated using two, single urediniospore-derived cultures of the fusiform rust fungus on two different dates during the 1994 growing season. Presence or absence of fusiform rust galls was recorded for each inoculated seedling at nine months post-inoculation and percent infection levels for each...

  17. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  18. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  19. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  20. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  1. Single-leaf partial meniscectomy in extensive horizontal tears of the discoid lateral meniscus: Does decreased peripheral meniscal thickness affect outcomes? (Mean four-year follow-up).

    Science.gov (United States)

    Lee, Se-Won; Chun, Yong-Min; Choi, Chong-Hyuk; Kim, Sung-Jae; Jung, Min; Han, Joon-Woo; Kim, Sung-Hwan

    2016-06-01

    To evaluate whether single-leaf partial meniscectomy in horizontal tears along the entire discoid lateral meniscus has any advantages in clinical and radiological results compared with other meniscectomies in discoid lateral meniscus. A total of 145 patients with a horizontal tear pattern in symptomatic lateral discoid meniscus were retrospectively reviewed. Twenty-seven patients had undergone full-extent single-leaf partial meniscectomy (group A), 60 had undergone conventional partial meniscectomy (saucerization) maintaining peripheral meniscal height (group B), and 58 patients had undergone total meniscectomy (group C). Each patient was evaluated with the Lysholm knee score, International Knee Documentation Committee (IKDC) subjective grading, and modified Kellgren-Lawrence grade in plain radiography at their last follow-up. Group C had inferior functional results to groups A and B on the Lysholm knee score and IKDC subjective score. There was no significant difference between groups A and B. Group C fared significantly worse than groups A and B (p=0.003, pmeniscus tears, the full-extent single-leaf partial meniscectomy group had no adverse results compared with the total meniscectomy group and was not significantly different compared to the conventional partial meniscectomy group. Cohort study. Level III, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  3. Rust resistance in Arabic Coffee cultivars in northern Paraná

    Directory of Open Access Journals (Sweden)

    Leandro Del Grossi

    2013-02-01

    Full Text Available The objective of the study was to evaluate the resistance to rust in coffee cultivars developed by research institutes of Brazil in Paraná state. Resistance to the local leaf rust races was assessed in high disease intensity field conditions at Londrina and Congonhinhas in 2009 and 2010.The cultivars were developed by the EPAMIG/UFV, IAPAR, IAC and MAPA/Procafé. The resistant standard 'IAPAR 59' and the susceptible standards Catuaí Vermelho IAC 144' and 'Bourbon Amarelo' were used. A randomized block design with three replications and plots with 10 plants was used. A scale from 1 to 5 based on the rust intensity was used to evaluate the resistance. The Catiguá MG 1, Catiguá MG 2, IAPAR 59, IPR 98, IPR 104, Palma II, Paraíso H-419-10-6-2-5-1, Paraíso H-419-10-6-2-10-1, Paraíso H-419-10-6-2-12-1, Pau Brasil MG 1 and Sacramento MG 1 cultivars presented complete resistance to rust at Londrina and Congonhinhas. The cultivars derived from the Catucaí germplasm were susceptible or showed different levels of partial resistance. Partial resistance to the rust was observed in several coffees derived from "Hibrido de Timor". 'Acauã' and 'Obatã IAC 1669-20' presented complete resistance at Londrina, but at Congonhinhas, they were partially resistant, indicating that different rust races have occurred at these two locations.

  4. Historic Rust College: Fulfilling a Mission.

    Science.gov (United States)

    Hoffman, Carl

    1989-01-01

    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  5. Rust-Bio: a fast and safe bioinformatics library

    NARCIS (Netherlands)

    J. Köster (Johannes)

    2015-01-01

    textabstractWe present Rust-Bio, the first general purpose bioinformatics library for the innovative Rust programming language. Rust-Bio leverages the unique combination of speed, memory safety and high-level syntax offered by Rust to provide a fast and safe set of bioinformatics algorithms and data

  6. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures.

    Science.gov (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel

    2015-11-01

    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  7. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  8. Study Of Rust Preventive Characteristics Of Rust Preventive Oil From Polarization Curve Measurement

    Directory of Open Access Journals (Sweden)

    Iwashima D.

    2015-06-01

    Full Text Available Fe-Cu-C sintered steels are widely used as powder materials, because of its small volumetric shrinkage. However, Cu, which acts as cathode enhance formation of rust Fe2O3·xH2O during fabrication. To prevent formation of Fe2O3·xH2O rust preventive oils are widely used. High viscosity of those rust preventive oils decrease workability. While, low viscosity degrade rust preventive performance. Therefore, it is necessary to develop new rust preventive oils with contradictory properties of low viscosity and superior rust prevention. In this study, we developed technique to quantitatively evaluate rust prevention ability by measuring polarization curve through thin corrosive solution on Fe-Cu-C sintered steels coated with rust preventive oils. The electrochemical measurements were carried out in corrosive solution of 0.35 mass % NaCl. Using a double capillary was added dropwise to the specimen. From the experimental, it is possible to evaluate the corrosion rate quantitatively in the surface of specimen, which was coated with rust preventive oil through thin corrosive solution. From the measurement results, Corrosion rate is reduced by coating the rust preventive oil. Especially, corrosion rate of the specimen coated with oil that showed best performance indicated 10000 times better than that of without oil ones. Zn addition negative correlation between corrosion rate and period of potential oscillation.

  9. Genetic analysis of seedling resistance to crown rust in five diploid oat (Avena strigosa) accessions.

    Science.gov (United States)

    Cabral, A L; Park, R F

    2016-02-01

    Crown rust, caused by Puccinia coronata Corda f. sp. avenae Eriks., is a serious menace in oats, for which resistance is an effective means of control. Wild diploid oat accessions are a source of novel resistances that first need to be characterised prior to introgression into locally adapted oat cultivars. A genetic analysis of resistance to crown rust was carried out in three diverse diploid oat accessions (CIav6956, CIav9020, PI292226) and two cultivars (Saia and Glabrota) of A. strigosa. A single major gene conditioning resistance to Australian crown rust pathotype (Pt) 0000-2 was identified in each of the three accessions. Allelism tests suggested that these genes are either the same, allelic, or tightly linked with less than 1 % recombination. Similarly, a single gene was identified in Glabrota, and possibly two genes in Saia; both cultivars previously reported to carry two and three crown rust resistance genes, respectively. The identified seedling resistance genes could be deployed in combination with other resistance gene(s) to enhance durability of resistance to crown rust in hexaploid oat. Current diploid and hexaploid linkage maps and molecular anchor markers (simple sequence repeat [SSR] and diversity array technology [DArT] markers) should facilitate their mapping and introgression into hexaploid oat.

  10. Effect of the Stage of Infection by Rust on Yield of French Beans

    International Nuclear Information System (INIS)

    Mwangi, M.; Mutitu, E.W.; Mukunya, D.M.; Seif, A.A.

    1999-01-01

    The most critical periods of infection of French beans were planted at two sites--Kabete, where temperatures are cool and Naivasha, where it is warmer. They were inoculated with the rust pathogen at six different stages of growth and diseases incidence and severity progress monitored. The stages were (V 2 ) primary leaf, (V 3 ) first trifoliate leaf, (V 4 ) third trifoliate leaf, (R 5 ) pre-flowering, (R 6 ) flowering and (R 7 ) pod formation stage. total pod yield were also determined for each treatment. Results showed that the stage of infection influenced yield and the area under the disease progress curve (AUDPC). Infections spread fastest and attacked more foliage on plants inoculated at growth stage V 4 (third trifoliate) and R 5 (pre-flowering). Infection increased quickly to more than 90% on many trifoliate leaves of plants inoculated at stages V 3 and R 5 and defoliation followed within six to seven weeks. The area under disease progress curve (AUDPC) was over 10 units for plants inoculated before the pre-flowering stage (R 5 ) stage as compared to 2.03 units in the protected control plants. Plants inoculated after stage R 6 (flowering) did not develop infection to any significant levels. The highest yield reduction of 25.5% was realized from French beans inoculated at the third trifoliate leaf (stage V 4 ) while a reduction of 22.9 was realised from beans inoculated at the pre-flowering stage (R 5 ). The study showed that infection of French beans by rust reduced yield significantly when it occurred during or after the opening of the third trifoliate leaf and before flowering. It is recommended that chemicals to manage rust where it is prevalent should be applied at the third trifoliate stage of growth and before flowering

  11. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  12. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.

    2005-01-01

    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  13. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... Wheat variety HD2733 is a high yielding variety released for cultivation under timely sown irrigated ... The polymerase chain reaction (PCR)wascarried outin 10µl reaction volumes with 25 ng of genomic DNA, 1.0 ... 72ºC for 10 min.The amplified products were resolved on MetaPhorTM (Lonza) agarose gel.

  14. Relationships between measures of reflectance and health leaf area, soybean rust severity and soybean yield/ Relação entre medidas de refletância e área foliar sadia, severidade da ferrugem asiática e produtividade da cultura da soja

    Directory of Open Access Journals (Sweden)

    Cláudia Vieira Godoy

    2007-08-01

    Full Text Available The aim of this research was to verify if some measures of reflectance could detect variations in the healthy leaf area which could be used as parameter to estimate damages in the production due to soybean rust, and to determine the influence of the disease on photosinthetic efficiency of plants under field conditions. The experiment was lead in the experimental area of Embrapa, in Londrina, PR. The experimental design was randomly blocks, with eight treatments (different fungicide application times with four replications. The fungicide used was azoxistrobin + ciproconazole (60+24 g i.a./ha + mineral oil (0.5%. The reflectance readings were made at eight wave lengths, between 460 and 810 nm, with intervals of 50 nm. It was estimated the Normalized Difference Vegetation Index (NDVI, where NDVI=(810-660/ (810+660. The yield presented linear increments (P O objetivo do trabalho foi verificar se as medidas de refletância detectavam variações na área foliar sadia a fim de serem utilizadas como parâmetros para estimar danos na produção decorrentes da ferrugem asiática, bem como determinar a influência da doença na eficiência fotossintética das plantas em condições de campo. O experimento foi conduzido na área experimental pertencente à Embrapa Soja, no município de Londrina, PR, utilizou-se a cultivar de soja BRS 154. O delineamento experimental utilizado foi de blocos ao acaso, com oito tratamentos (diferentes estádios de início da aplicação do fungicida com quatro repetições O produto utilizado foi azoxistrobin + ciproconazole (60+24 g i.a./ha + óleo mineral (0,5%. As leituras de refletância foram feitas em oito comprimentos de onda, de 460 a 810 nm, em intervalos de 50 nm. Calculou-se o Índice Vegetativo de Diferença Normalizada (NDVI, onde NDVI=(810-660/(810+660. A produção apresentou incremento linear (p < 0,01 com a Duração da Área Foliar Sadia (HAD (r2=37,7%, com a Absorção da Radiação Solar pela Área Foliar

  15. Interacting elevated CO2 and tropospheric O3 predisposes aspen (Populus tremuloides Michx.) to infection by rust (Melampsora medusa f. sp. tremuloidae).

    Science.gov (United States)

    D.F. Karnosky; Kevin E. Percy; Bixia Xiang; Brenda Callan; Asko Noormets; Blanka Mankovska; Anthony Hopkin; Jaak Sober; Wendy Jones; R.E. Dickson; J.G. Isebrands

    2002-01-01

    We investigated the interaction of elevated CO2 and/or (Ozone) O3 on the occurrence and severity of aspen leaf rust (Malampsora medusae Thuem. f. sp. tremuloidae) on trembling aspen (Populus tremuloides MIchx.) Furthermore, we examined the role of changes in...

  16. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  17. Unravelling and managing fusiform rust disease: a model approach for coevolved forest tree pathosystems.

    Science.gov (United States)

    CD Nelson; TL Kubisiak; HV Amerson

    2010-01-01

    Fusiform rust disease remains the most destructive disease in pine plantations in the southern United States. Our ongoing research is designed to identify, map, and clone the interacting genes of the host and pathogen. Several resistance (R) genes have been identified and genetically mapped using informative pine families and single-spore isolate inoculations. In...

  18. Proteomic analysis of germinating urediniospores of Phakopsora pachyrhizi, causal agent of Asian soybean rust.

    Science.gov (United States)

    Luster, Douglas G; McMahon, Michael B; Carter, Melissa L; Fortis, Laurie L; Nuñez, Alberto

    2010-10-01

    Phakopsora pachyrhizi is an obligate pathogen that causes Asian soybean rust. Asian soybean rust has an unusually broad host range and infects by direct penetration through the leaf cuticle. In order to understand the early events in the infection process, it is important to identify and characterize proteins in P. pachyrhizi. Germination of the urediniospore is the first stage in the infection process and represents a critical life stage applicable to studies with this obligate pathogen. We have applied a 2-DE and MS approach to identify 117 proteins from the National Center of Biotechnology Information nonredundant protein database and a custom database of Basidiomycota EST sequences. Proteins with roles in primary metabolism, energy transduction, stress, cellular regulation and signaling were identified in this study. This data set is accessible at http://world-2dpage.expasy.org/repository/database=0018.

  19. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  20. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum

    Directory of Open Access Journals (Sweden)

    Ahmad H. Sallam

    2017-10-01

    Full Text Available Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1, losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB and foreign (TTKSK aka isolate Ug99 pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici, Pgt and one isolate (92-MN-90 of the rye stem rust pathogen (P. graminis f. sp. secalis, Pgs. Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis. A genome-wide association study (GWAS was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley.

  1. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  2. Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.

    Science.gov (United States)

    Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J

    2017-10-05

    Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.

  3. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  4. Aspects of durable resistance in wheat to yellow rust

    NARCIS (Netherlands)

    Danial, D.L.

    1994-01-01

    In Kenya, the number of virulence factors of the yellow rust populations showed a considerable increase and a wide variability. Selecting for complete to near complete resistance to yellow rust and other cereal rust diseases, was followed by a rapid erosion of resistance.

    Partial

  5. Frequency of comandra blister rust infection episodes on lodgepole pine

    Science.gov (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor

    2002-01-01

    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  6. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  7. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  8. 77 FR 65840 - Chrysanthemum White Rust Regulatory Status and Restrictions

    Science.gov (United States)

    2012-10-31

    ... Inspection Service 7 CFR Part 319 [Docket No. APHIS-2012-0001] RIN 0579-AD67 Chrysanthemum White Rust... should amend our process for responding to domestic chrysanthemum white rust (CWR) outbreaks and the... whether and how we should amend our process for responding to domestic chrysanthemum white rust (CWR...

  9. EXTRACTS OF CANDEIA (Eremanthus erythropappus (DC. MacLeish IN THE INHIBITION IN VITRO OF Cylindrocladium scoparium AND FOUR RUST SPECIES

    Directory of Open Access Journals (Sweden)

    Maria Eloísa Salustiano

    2006-06-01

    Full Text Available The study aimed at studying leaf extracts and essential oils of Eremanthus erythropappus on spore germination offour rust species: Puccinia psidii, Hemileia vastatrix, Phakopsora pachyrhizi and Cerotelium fici, and on mycelial growth ofCilindrocladium scoparium. The fungitoxic effect of the extracts used led to absence of urediniospore germination in all rustetiologic agents tested. Mycelial growth inhibition of C. fici was higher with methanol extract (52%, subsequently reducting sporeproduction. Treatments with tea at 10% and essential oil at 1% reduced mycelial growth (25% for both treatments and sporeproduction (28% and 34%, respectively. Therefore, Eremanthus erythropappus extracts shoud be studied for controlling rust andC. scoparium in eucalyptus.

  10. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  11. High genetic homogeneity points to a single introduction event responsible for invasion of Cotton leaf curl Multan virus and its associated betasatellite into China.

    Science.gov (United States)

    Du, Zhenguo; Tang, Yafei; He, Zifu; She, Xiaoman

    2015-10-07

    Cotton leaf curl Multan virus (CLCuMuV) is a Whitefly Transmitted Geminivirus (WTG) endemic to the India subcontinent and is notorious as a causal agent of cotton leaf curl disease (CLCuD), a major constraint to cotton production in south Asia. We found CLCuMuV infecting Hibiscus rosa-sinensis in Guangzhou, China in 2006. The spread and evolution of the invading CLCuMuV were monitored in the following nine years. CLCuMuV spread rapidly in the last nine years and became established in Southern China. It infects at least five malvaceous plant species, H. rosa-sinensis, H. esculentus, Malvaiscus arboreus, Gossypium hirsutum and H. cannabinus. Complete nucleotide sequences of 34 geographically and/or temporally distinct CLCuMuV isolates were determined and analyzed together with six other publicly available genomes of CLCuMuV occurring in China. The 40 CLCuMuV isolates were found to share > 99 % nucleotide sequence identity with each other. In all cases tested, the CLCuMuVs were associated with a CLCuMuB. The 36 CLCuMuBs (30 sequenced by us) shared > 98 % nucleotide sequence identity. The high genetic homogeneity of CLCuMuV and CLCuMuB in China suggests the establishment of them from a single founder event.

  12. Rust in Plumeria spp. (Apocynaceae in the State of Mato Grosso do Sul, Brazil.

    Directory of Open Access Journals (Sweden)

    Cassia de Carvalho

    2014-11-01

    Full Text Available Frangipani (Plumeria spp. is a plant widely used in urban ornamentation, due to its hardiness, easy handling and exuberance of its flowers. Plumeria spp. Leaves were collected in Dourados, MS, Brazil, with typical symptoms and signs of the presence of rust: powdery yellowish uredinias in the abaxial and chlorotic and necrotic spots on the adaxial surface of the leaves, sometimes resulting in leaf abscission. The present study aims to record the occurrence of the disease in the State of Mato Grosso do Sul. Microscopic observations and measurements of uredinospores and teliospores confirmed that the fungus infecting plants was Coleosporium plumeriae.

  13. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...... to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those...... of synthetic GRCO3, the green rust familymemberwherecarbonate and water occupy the interlayer between the iron-hydroxide layers. The method was then tested on samples taken from an artesian well and a deep underground experimental station, both within the Fe(II)/Fe(III) redox zone. In both cases, GRCO3 could...

  14. Effector-mining in the poplar rust fungus Melampsora larici populina secretome

    Directory of Open Access Journals (Sweden)

    Cecile eLorrain

    2015-12-01

    Full Text Available The poplar leaf rust fungus, Melampsora larici-populina has been established as a tree-microbe interaction model. Understanding the molecular mechanisms controlling infection by pathogens appears essential for durable management of tree plantations. In biotrophic plant parasites, effectors are known to condition host cell colonization. Thus, investigation of candidate secreted effector proteins is a major goal in the poplar-poplar rust interaction. Unlike oomycetes, fungal effectors do not share conserved motifs and candidate prediction relies on a set of a priori criteria established from reported bona fide effectors. Secretome prediction, genome-wide analysis of gene families and transcriptomics of M. larici-populina have led to catalogues of more than a thousand secreted proteins. Automatized effector mining pipelines hold great promise for rapid and systematic identification and prioritization of candidate secreted effector proteins for functional characterization. In this review, we report on and discuss the current status of the poplar rust fungus secretome and prediction of candidate effectors in this species.

  15. Identification of genes involved in stem rust resistance from wheat mutant D51 with the cDNA-AFLP technique.

    Science.gov (United States)

    Yin, Jing; Wang, Guangjin; Xiao, Jialei; Ma, Fengming; Zhang, Hongji; Sun, Yan; Diao, Yanling; Huang, Jinghua; Guo, Qiang; Liu, Dongjun

    2010-02-01

    Wheat (Triticum aestivum L.) stem rust caused by Puccinia graminis f. sp. tritici is one of the main diseases of wheat worldwide. Wheat mutant line D51, which was derived from the highly susceptible cultivar L6239, shows resistance to the prevailing races 21C3CPH, 21C3CKH, and 21C3CTR of P. graminis f. sp. tritici in China. In this study, we used the cDNA-AFLP technology to identify the genes that are likely involved in the stem rust resistance. EcoRI/MseI selective primers were used to generate approximately 1920 DNA fragments. Seventy five differentially transcribed fragments (3.91%) were identified by comparing the samples of 21C3CPH infected D51 with infected L6239 or uninfected D51. Eleven amplified cDNA fragments were sequenced. Eight showed significant similarity to known genes, including TaLr1 (leaf rust resistance gene), wlm24 (wheat powdery mildew resistance gene), stress response genes and ESTs of environment stress of tall fescue. These identified genes are involved in plant defense response and stem rust resistance and need further research to determine their usefulness in breeding new resistance cultivars.

  16. Development of a disposable and highly sensitive paper-based immunosensor for early diagnosis of Asian soybean rust.

    Science.gov (United States)

    Miranda, Barbara S; Linares, Elisângela M; Thalhammer, Stefan; Kubota, Lauro T

    2013-07-15

    Soybean is one of the most important crops and plays a key role in the whole food chain production. Soybean crops are very susceptible to the fungus Phakopsora Pachyrhizi, the agent responsible by the Asian soybean rust. The spore of the fungus is easily disseminated by wind with adequate environment, leaf wetness, high humidity and temperatures, the crop can be totally lost within few days. A high sensitive, specific and easy test is the key for early diagnosing the soybean rust and therefore save the crop. Here we present a paper-based immunosensor for early stage diagnosis of soybean rust that can be performed by unskilled operators on-site. Nitrocellulose membrane was chosen as the substrate to stick the antigen due to its high binding properties. Polyclonal antibodies labeled with fluorescent nanoparticles were employed as the recognizers. An analytical curve with spiked samples shows a linear response range from 0.0032 to 3.2 μg/mL. This immunosensor presents a very low detection limit of 2.2 ng/mL, which corresponds approximately to 8-12 spores/mL. The paper-based sensor reachs the detection range of ELISA and PCR based test systems, and outranges the available commercial test kits by two order of magnitude. We believe this immunosensor has a great potential as a point-of-care device for the early diagnosis of Asian soybean rust. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.).

    Science.gov (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H

    2015-06-01

    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  18. Nested Association Mapping of Stem Rust Resistance in Wheat Using Genotyping by Sequencing.

    Directory of Open Access Journals (Sweden)

    Prabin Bajgain

    Full Text Available We combined the recently developed genotyping by sequencing (GBS method with joint mapping (also known as nested association mapping to dissect and understand the genetic architecture controlling stem rust resistance in wheat (Triticum aestivum. Ten stem rust resistant wheat varieties were crossed to the susceptible line LMPG-6 to generate F6 recombinant inbred lines. The recombinant inbred line populations were phenotyped in Kenya, South Africa, and St. Paul, Minnesota, USA. By joint mapping of the 10 populations, we identified 59 minor and medium-effect QTL (explained phenotypic variance range of 1% - 20% on 20 chromosomes that contributed towards adult plant resistance to North American Pgt races as well as the highly virulent Ug99 race group. Fifteen of the 59 QTL were detected in multiple environments. No epistatic relationship was detected among the QTL. While these numerous small- to medium-effect QTL are shared among the families, the founder parents were found to have different allelic effects for the QTL. Fourteen QTL identified by joint mapping were also detected in single-population mapping. As these QTL were mapped using SNP markers with known locations on the physical chromosomes, the genomic regions identified with QTL could be explored more in depth to discover candidate genes for stem rust resistance. The use of GBS-derived de novo SNPs in mapping resistance to stem rust shown in this study could be used as a model to conduct similar marker-trait association studies in other plant species.

  19. Nested Association Mapping of Stem Rust Resistance in Wheat Using Genotyping by Sequencing.

    Science.gov (United States)

    Bajgain, Prabin; Rouse, Matthew N; Tsilo, Toi J; Macharia, Godwin K; Bhavani, Sridhar; Jin, Yue; Anderson, James A

    2016-01-01

    We combined the recently developed genotyping by sequencing (GBS) method with joint mapping (also known as nested association mapping) to dissect and understand the genetic architecture controlling stem rust resistance in wheat (Triticum aestivum). Ten stem rust resistant wheat varieties were crossed to the susceptible line LMPG-6 to generate F6 recombinant inbred lines. The recombinant inbred line populations were phenotyped in Kenya, South Africa, and St. Paul, Minnesota, USA. By joint mapping of the 10 populations, we identified 59 minor and medium-effect QTL (explained phenotypic variance range of 1% - 20%) on 20 chromosomes that contributed towards adult plant resistance to North American Pgt races as well as the highly virulent Ug99 race group. Fifteen of the 59 QTL were detected in multiple environments. No epistatic relationship was detected among the QTL. While these numerous small- to medium-effect QTL are shared among the families, the founder parents were found to have different allelic effects for the QTL. Fourteen QTL identified by joint mapping were also detected in single-population mapping. As these QTL were mapped using SNP markers with known locations on the physical chromosomes, the genomic regions identified with QTL could be explored more in depth to discover candidate genes for stem rust resistance. The use of GBS-derived de novo SNPs in mapping resistance to stem rust shown in this study could be used as a model to conduct similar marker-trait association studies in other plant species.

  20. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.

    2016-01-01

    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  1. FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME

    Directory of Open Access Journals (Sweden)

    RAFAEL MENEZES SILVA DE FREITAS

    2016-01-01

    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  2. Major transcriptome reprogramming underlies floral mimicry induced by the rust fungus Puccinia monoica in Boechera stricta.

    Directory of Open Access Journals (Sweden)

    Liliana M Cano

    Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.

  3. Single pot synthesized gold nanoparticles using Hippophae rhamnoides leaf and berry extract showed shape-dependent differential nanobiotechnological applications.

    Science.gov (United States)

    Sharma, Bhavana; Deswal, Renu

    2018-04-04

    A facile one-pot green synthesis of gold nanoparticles (AuNPs) with different geometries was achieved using an underutilized Himalayan bioresource Hippophae rhamnoides. Aqueous leaf (LE) and berry extracts (BE) showed rapid synthesis of monodispersed spherical LEAuNPs (27 ± 3.2 nm) and anisotropic BEAuNPs (55 ± 4.5 nm) within 2 and 15 min, respectively. The Fourier-transform infrared (FTIR) spectroscopy showed involvement of polyphenolics/flavonoids in AuNPs reduction. LE AuNPs (IC 50 49 µg) exhibited higher antioxidant potential than BE AuNPs (IC 50 57 µg). Both BE nanotriangles and LE nanospheres exhibited cytotoxicity against Jurkat cell lines. These nanocatalysts also exhibited effective (80-99%) reductive degradation of structurally different carcinogenic azo dyes. Kinetic studies revealed that BE nanotriangles exhibited higher catalytic efficiency (14-67%) than LE nanospheres suggesting shape-dependent regulation of biological activities. The gas chromatography-mass spectrometry (GC-MS) analysis confirmed conversion of toxic methyl orange dye to non-toxic intermediates. Probable degradation mechanism involving adsorption and catalytic reduction of azo bonds was proposed. The present synthesis protocol provided a facile and energy saving procedure for rapid synthesis of highly stable nanoparticles with significant antioxidant and anticancer potential. This is the first report of H. rhamnoides-mediated green synthesis of multipurpose AuNPs as antioxidant, anticancer and nanocatalytic agents for treatment of dye contaminated waste water and future therapeutic applications.

  4. Quantitative trait loci (QTLs) for resistance to gray leaf spot and ...

    African Journals Online (AJOL)

    Gray leaf spot and common rust diseases can greatly reduce grain yield of maize in susceptible genotypes by between 10 and 70% on average. Control of these diseases through conventional measures has been quite ineffective and difficult to sustain. The most feasible way to control them is by breeding and deploying ...

  5. Effect of soybean leaf and plant age on susceptibility to initiation of infection by Phakopsora pachyrhizi

    Science.gov (United States)

    Although previous studies have been conducted to determine the relationship of plant and leaf age to susceptibility to soybean rust, this relationship still is unresolved. Some studies suggest that as plants reach the flowering stage they become more susceptible to initiation of infection. However, ...

  6. substitution line for resistance to stripe rust

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... c Indian Academy of Sciences. RESEARCH ARTICLE. Molecular cytogenetic characterization of a new wheat Secale africanum. 2R a. (2D) substitution line for resistance to stripe rust. MENGPING LEI, GUANGRONG LI, SUFEN ZHANG, CHENG LIU and ZUJUN YANG. ∗. School of Life Science and ...

  7. Epidemiology of bean rust in Ethiopia

    NARCIS (Netherlands)

    Habtu, A.

    1994-01-01

    Field and greenhouse experiments were conducted to study the epidemiology of rust ( Uromyces appendiculatus ) on beans ( Phaseolus vulgaris L.) in Ethiopia. The experiments were conducted under low input conditions reflecting

  8. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.

    1989-01-01

    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  9. Progresso temporal da ferrugem e redução sobre a área foliar e os componentes do rendimento de grãos em soja Temporal progress of rust and reduced leaf area and yield components in soybean grain

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-04-01

    em experimento de campo com 64 parcelas (2.7 x 5 m da cultivar Glycine max L. (Nidera 5909 RG, estabelecida em 05/12/09. Para gerar gradientes de doença utilizaram-se dois fungicidas (tebuconazol e epoxiconazol + piraclostrobina, em uma, duas ou três aplicações em estádios fonológicos diferentes. A doença foi quantificada por número de lesões e urédias, posteriormente convertido para severidade (%. Quantificou-se também o índice de área foliar ao final do enchimento de grãos e os componentes do rendimento após a colheita. A severidade média final da ferrugem superou 50%. As diferenças em severidade entre os estratos da planta foram influenciadas pela quantidade inicial de doença, uma vez que as taxas de progresso, determinadas pelos modelos logístico e de Gompertz, foram semelhantes entre os estratos (0.13 a 0.14 para o logístico e 0.10 a 0.11 para Gompertz. O índice de área foliar (IAF foi de apenas 1.96 nas plantas não tratadas, contra 4.40 no tratamento com quatro aplicações de epoxiconazol + piraclostrobina. Programas de controle iniciados em estádio fonológico V9, com duas ou três aplicações, diferiram da testemunha em IAF. O número de legumes e grãos por planta, assim como grãos por legume não variaram entre os tratamentos. Só houve diferença no peso de grãos do estrato superior, quando os fungicidas foram aplicados duas ou três vezes a partir de estádio fonológico V9.The harvest of the year 2009-10 of soybean crop in Southern Brazil occurred under higher intensity of soybean rust (Phakopsora pachyrhizi Sydow y Sydow, which allowed studies on disease progress and crop reduction. A field experiment with 64 plots (2.7 x 5 m of the cultivar Glycine max L. (Nidera 5909 RG sown on 5/Dec/2009 was used for the evaluations. Disease gradients were obtained by spraying the fungicides tebuconazol or epoxiconazol + pyraclostrobin once, twice or three times, at different plant growth stages. Disease progress was assessed as number of

  10. Possibility of cereals protection against rusts by resistant breeding method

    Directory of Open Access Journals (Sweden)

    Czesław Zamorski

    2013-12-01

    Full Text Available In the years 1999-2001 field trials were run on susceptibility of wheat and triticale genotypes to infection by three rust fungi (Puccinia recondita, Puccinia graminis, Puccinia striiformis. The results of the observation of the infection level in following years have been similar. Among genotypes of winter wheat, breeding lines susceptible to Puccinia striiformis infection were rare, but among spring wheat 50% of genotypes were susceptible to yellow rust infection. A much higher level of sensitivity than in the case of winter wheat has been found in winter triticale genotypes. Wheat genotypes were distinguished by the high sensitivity to Puccinia graminis infection, only a few breeding lines were resistant to stem rust. The susceptibility of wheat to brown rust (Puccinia recondita was a common feature. Triticale genotypes compared to wheat were affected significantly less and majority of them exhibited high level of resistant to brown rust. The use of the breeding method has justification in control yellow rust of winter wheat. Recommended cultivars are almost all fully resistant to Puccinia striiformis infection. The application of this method in selection of spring wheat and triticale is in large past limited. Some of the registered cultivars of spring wheat and triticale are very susceptible to yellow rust. Using the breeding method to protect wheat from stem rust and brown rust is of little practical benefit in our county at this moment. But it can be effecive to control stem and brown rusts of triticale.

  11. Effect of Puccinia silphii on Yield Components and Leaf Physiology in Silphium integrifolium: Lessons for the Domestication of a Perennial Oilseed Crop

    Directory of Open Access Journals (Sweden)

    M. Kathryn Turner

    2018-03-01

    Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.

  12. Ultrastructure of the Rust Fungus Puccinia miscanthi in the Teliospore Stage Interacting with the Biofuel Plant Miscanthus sinensis

    Directory of Open Access Journals (Sweden)

    Ki Woo Kim

    2015-09-01

    Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.

  13. In situ detection of a fungal glycoprotein-elicitor in stem rust-infected susceptible and resistant wheat using immunogold electron microscopy.

    Science.gov (United States)

    Marticke, K H; Reisener, H J; Fischer, R; Hippe-Sanwald, S

    1998-08-01

    Immunoelectron microscopy (IEM) was used to analyze the compatible and incompatible host-pathogen interaction between the obligate, biotroph stem rust (Puccinia graminis f.sp. tritici; Pgt) and primary leaves of wheat (Triticum aestivum L.). The investigation was focused on the subcellular localization of a fungal elicitor glycoprotein of stem rust (Pgt-elicitor). Uredospores as well as fungal infection structures of stem rust on wheat leaves were probed with a specific monoclonal antibody, in order to determine the in situ distribution pattern of the antigen. Binding to the anti-elicitor antibody was observed over the cell wall and the germ pore of germinating uredospores. Immunogold staining was found over the infection structures of stem rust within the wheat leaf tissue of both the compatible and incompatible plant-pathogen interaction. Distinct cell wall layers of the intercellular mycelium, of the haustorial mother cells, as well as of the haustoria were clearly labeled. Gold particles were also detected over the intercellular space and the extrahaustorial matrix in between the extrahaustorial membrane and the haustorial cell wall which indicated a release of elicitor molecules from the fungal cell wall. No labeling was observed over the host cell cytoplasm of the compatible and incompatible interaction, respectively. The immunocytochemical detection of elicitor epitopes over the hyphal cell walls of in vitro grown axenic cultures of P. graminis f.sp. tritici confirmed the occurrence of elicitor molecules in young hyphal material. Elicitor molecules were released by the hyphae of axenic cultures of stem rust in vitro.

  14. Rapid Phenotyping Adult Plant Resistance to Stem Rust in Wheat Grown under Controlled Conditions.

    Science.gov (United States)

    Riaz, Adnan; T Hickey, Lee

    2017-01-01

    Stem rust (SR) or black rust caused by Puccinia graminis f. sp. tritici is one of the most common diseases of wheat (Triticum aestivum L.) crops globally. Among the various control measures, the most efficient and sustainable approach is the deployment of genetically resistant cultivars. Traditionally, wheat breeding programs deployed genetic resistance in cultivars, but unknowingly this is often underpinned by a single seedling resistance gene, which is readily overcome by the pathogen. Nowadays, adult plant resistance (APR) is a widely adopted form of rust resistance because more durable mechanisms often underpin it. However, only a handful of SR APR genes are available, so breeders currently strive to combine seedling and APR genes. Phenotyping adult wheat plants for resistance to SR typically involves evaluation in the field. But establishing a rust nursery can be challenging, and screening is limited to once a year. This slows down research efforts to isolate new APR genes and breeding of genetically resistant cultivars.In this study, we report a protocol for rapid evaluation of adult wheat plants for resistance to stem rust. We demonstrate the technique by evaluating a panel of 16 wheat genotypes consisting of near isogenic lines (NILs) for known Sr genes (i.e., Sr2, Sr33, Sr45, Sr50, Sr55, Sr57, and Sr58) and three landraces carrying uncharacterized APR from the N. I. Vavilov Institute of Plant Genetic Resources (VIR). The method can be completed in just 10 weeks and involves two inoculations: first conducted at seedling stage and a second at the adult stage (using the same plants). The technique can detect APR, such as that conferred by APR gene Sr2, along with pseudo-black chaff (the morphological marker). Phenotyping can be conducted throughout the year, and is fast and resource efficient. Further, the phenotyping method can be applied to screen breeding populations or germplasm accessions using local or exotic races of SR.

  15. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat.

    Science.gov (United States)

    Bansal, Urmil K; Muhammad, Sher; Forrest, Kerrie L; Hayden, Matthew J; Bariana, Harbans S

    2015-10-01

    A new stem rust resistance gene Sr49 was mapped to chromosome 5BL of wheat. Usefulness of the closely linked markers sun209 and sun479 for marker-assisted selection of Sr49 was demonstrated. Landrace AUS28011 (Mahmoudi), collected from Ghardimaou, Tunisia, produced low stem rust response against Australian pathotypes of Puccinia graminis f. sp. tritici (Pgt) carrying virulence for several stem rust resistance genes deployed in modern wheat cultivars. Genetic analysis based on a Mahmoudi/Yitpi F3 population indicated the involvement of a single all-stage stem rust resistance gene and it was temporarily named SrM. Bulked segregant analysis using multiplex-ready SSR technology located SrM on the long arm of chromosome 5B. Since there is no other all-stage stem rust resistance gene located in chromosome 5BL, SrM was permanently designated Sr49. The Mahmoudi/Yitpi F3 population was enhanced to generate F6 recombinant inbred line (RIL) population for detailed mapping of Sr49 using publicly available genomic resources. Markers sun209 and sun479 flanked Sr49 at 1.5 and 0.9 cM distally and proximally, respectively. Markers sun209 and sun479 amplified PCR products different than the Sr49-linked alleles in 146 and 145 common wheat cultivars, respectively. Six and seven cultivars, respectively, carried the resistance-linked marker alleles sun209 148bp and sun479 200bp ; however, none of the cultivars carried both resistance-linked alleles. These results demonstrated the usefulness of these markers for marker-assisted selection of Sr49 in breeding programs.

  16. SU-F-T-629: Effect of Multi-Leaf Collimator (MLC) Width On Plan Quality of Single-Isocenter VMAT Intracranial Stereotactic Radiosurgery for Multiple Metastases

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, J; Thomas, E; Wu, X; Fiveash, J; Popple, R [University Alabama Birmingham, Birmingham, AL (United States)

    2016-06-15

    Purpose: Single-isocenter VMAT has been shown able to create high quality plans for complex intracranial multiple metastasis SRS cases. Linacs capable of the technique are typically outfitted with an MLC that consists of a combination of 5 mm and 10 mm leaves (standard) or 2.5 mm and 5 mm leaves (high-definition). In this study, we test the hypothesis that thinner collimator leaves are associated with improved plan quality. Methods: Ten multiple metastasis cases were identified and planned for VMAT SRS using a 10 MV flattening filter free beam. Plans were created for a standard (std) and a high-definition (HD) MLC. Published values for leaf transmission factor and dosimetric leaf gap were utilized. All other parameters were invariant. Conformity (plan and individual target), moderate isodose spill (V50%), and low isodose spill (mean brain dose) were selected for analysis. Results: Compared to standard MLC, HD-MLC improved overall plan conformity (median: Paddick CI-HD = 0.83, Paddick CI-std = 0.79; p = 0.004 and median: RTOG CI-HD =1.18, RTOG CI-std =1.24; p = 0.01 ), improved individual lesion conformity (median: Paddick CI-HD,i =0.77, Paddick CI-std,i =0.72; p < 0.001 and median: RTOG CI-HD,i = 1.28, RTOG CI-std,i =1.35; p < 0.001), improved moderate isodose spill (median: V50%-HD = 37.0 cc, V50%-std = 45.7 cc; p = 0.002), and improved low dose spill (median: dmean-HD = 2.90 Gy, dmean-std = 3.19 Gy; p = 0.002). Conclusion: For the single-isocenter VMAT SRS of multiple metastasis plans examined, use of HD-MLC modestly improved conformity, moderate isodose, and low isodose spill compared to standard MLC. However, in all cases we were able to generate clinically acceptable plans with the standard MLC. More work is need to further quantify the difference in cases with higher numbers of small targets and to better understand any potential clinical significance. This research was supported in part by Varian Medical Systems.

  17. SU-F-T-629: Effect of Multi-Leaf Collimator (MLC) Width On Plan Quality of Single-Isocenter VMAT Intracranial Stereotactic Radiosurgery for Multiple Metastases

    International Nuclear Information System (INIS)

    Kraus, J; Thomas, E; Wu, X; Fiveash, J; Popple, R

    2016-01-01

    Purpose: Single-isocenter VMAT has been shown able to create high quality plans for complex intracranial multiple metastasis SRS cases. Linacs capable of the technique are typically outfitted with an MLC that consists of a combination of 5 mm and 10 mm leaves (standard) or 2.5 mm and 5 mm leaves (high-definition). In this study, we test the hypothesis that thinner collimator leaves are associated with improved plan quality. Methods: Ten multiple metastasis cases were identified and planned for VMAT SRS using a 10 MV flattening filter free beam. Plans were created for a standard (std) and a high-definition (HD) MLC. Published values for leaf transmission factor and dosimetric leaf gap were utilized. All other parameters were invariant. Conformity (plan and individual target), moderate isodose spill (V50%), and low isodose spill (mean brain dose) were selected for analysis. Results: Compared to standard MLC, HD-MLC improved overall plan conformity (median: Paddick CI_HD = 0.83, Paddick CI_std = 0.79; p = 0.004 and median: RTOG CI_HD =1.18, RTOG CI_std =1.24; p = 0.01 ), improved individual lesion conformity (median: Paddick CI_HD,i =0.77, Paddick CI_std,i =0.72; p < 0.001 and median: RTOG CI_HD,i = 1.28, RTOG CI_std,i =1.35; p < 0.001), improved moderate isodose spill (median: V50%_HD = 37.0 cc, V50%_std = 45.7 cc; p = 0.002), and improved low dose spill (median: dmean_HD = 2.90 Gy, dmean_std = 3.19 Gy; p = 0.002). Conclusion: For the single-isocenter VMAT SRS of multiple metastasis plans examined, use of HD-MLC modestly improved conformity, moderate isodose, and low isodose spill compared to standard MLC. However, in all cases we were able to generate clinically acceptable plans with the standard MLC. More work is need to further quantify the difference in cases with higher numbers of small targets and to better understand any potential clinical significance. This research was supported in part by Varian Medical Systems.

  18. Concerted action of two avirulent spore effectors activates Reaction to Puccinia graminis 1 (Rpg1)-mediated cereal stem rust resistance.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Drader, Tom; Lawrence, Paulraj K; Yin, Chuntao; Hulbert, Scot; Steber, Camille M; Steffenson, Brian J; Szabo, Les J; von Wettstein, Diter; Kleinhofs, Andris

    2011-08-30

    The barley stem rust resistance gene Reaction to Puccinia graminis 1 (Rpg1), encoding a receptor-like kinase, confers durable resistance to the stem rust pathogen Puccinia graminis f. sp. tritici. The fungal urediniospores form adhesion structures with the leaf epidermal cells within 1 h of inoculation, followed by hyphae and haustorium formation. The RPG1 protein is constitutively expressed and not phosphorylated. On inoculation with avirulent urediniospores, it is phosphorylated in vivo within 5 min and subsequently degraded. Application of arginine-glycine-aspartic acid peptide loops prevented the formation of adhesion structures for spore attachment, the phosphorylation of RPG1, and germination of the viable spores. Arginine-glycine-aspartic acid affinity chromatography of proteins from the ungerminated avirulent rust spores led to the purification and identification of a protein with fibronectin type III and breast cancer type 1 susceptibility protein domains and a vacuolar protein sorting-associated protein 9 with a coupling of ubiquitin to endoplasmic reticulum degradation domain. Both proteins are required to induce in vivo phosphorylation and degradation of RPG1. Combined application of both proteins caused hypersensitive reaction on the stem rust-resistant cultivar Morex but not on the susceptible cultivar Steptoe. Expression studies indicated that mRNA of both genes are present in ungerminated urediniospores and are constitutively transcribed in sporelings, infected leaves, and haustoria in the investigated avirulent races. Evidence is presented that RPG1, in yeast, interacts with the two protein effectors from the urediniospores that activate cooperatively the stem rust resistance protein RPG1 long before haustoria formation.

  19. Stem rust of small grains and grasses caused by Puccinia graminis.

    Science.gov (United States)

    Leonard, Kurt J; Szabo, Les J

    2005-03-01

    shown to infect 74 species in 34 genera in artificial inoculations of seedlings, but only 28 of those species belonging to eight genera were known to be natural hosts of the fungus. Other formae speciales of P. graminis have narrower host ranges than P. graminis f. sp. tritici. Disease symptoms: Infections in cereals or grasses occur mainly on stems and leaf sheaths, but occasionally they may be found on leaf blades and glumes as well. The first macroscopic symptom is usually a small chlorotic fleck, which appears a few days after infection. About 8-10 days after infection, a pustule several millimetres long and a few millimetres wide is formed by rupture of the host epidermis from pressure of a mass of brick-red urediniospores produced in the infection. These uredinial pustules are generally linear or diamond shaped and may enlarge up to 10 mm long. The powdery masses of urediniospores appear similar to rust spots on a weathered iron surface. With age, the infection ceases production of brick-red urediniospores and produces a layer of black teliospores in their place, causing the stems of heavily infected plants to appear blackened late in the season.

  20. Effect of solar radiation on severity of soybean rust.

    Science.gov (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J

    2012-08-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  1. Phylogenetic studies in Ravenelia esculenta and related rust fungi

    OpenAIRE

    Gandhe, K. R.; Kuvalekar, Aniket

    2007-01-01

    Ravenelia esculenta Naras. and Thium. is a rust fungus, which infects mostly thorns, inflorescences, flowers and fruits of Acacia eburnea Willd. Aecial stages of the rust produce hypertrophy in infected parts. DNA of the rust fungus was isolated from aeciospores by ‘freeze thaw’ method. 18S rDNA was amplified and sequenced by automated DNA sequencer. BLAST of the sequence at NCBI retrieved 96 sequences producing significant alignments. Multiple sequence alignment of these sequences was done b...

  2. Effects of Nitrogen Addition on Leaf Decomposition of Single-Species and Litter Mixture in Pinus tabulaeformis Forests

    Directory of Open Access Journals (Sweden)

    Jinsong Wang

    2015-12-01

    Full Text Available The litter decomposition process is closely correlated with nutrient cycling and the maintenance of soil fertility in the forest ecosystem. In particular, the intense environmental concern about atmospheric nitrogen (N deposition requires a better understanding of its influence on the litter decomposition process. This study examines the responses of single-species litter and litter mixture decomposition processes to N addition in Chinese pine (Pinus tabulaeformis Carr. ecosystems. Chinese pine litter, Mongolian oak (Quercus mongolica Fisch. ex Ledeb. litter, and a pine–oak mixture were selected from a plantation and a natural forest of Chinese pine. Four N addition treatments, i.e., control (N0: 0 kg N ha−1·year−1, low-N (N1: 5 kg N ha−1·year−1, medium-N (N2: 10 kg N ha−1·year−1, and high-N (N3: 15 kg N ha−1·year−1, were applied starting May 2010. In the plantation, N addition significantly stimulated the decomposition of the Chinese pine litter. In the natural forest, N addition had variable effects on the decomposition of single-species litter and the litter mixture. A stimulatory effect of the high-N treatment on the Chinese pine litter decomposition could be attributed to a decrease in the substrate C:N ratio. However, an opposite effect was found for the Mongolian oak litter decomposition. The stimulating effect of N addition on the Chinese pine litter may offset the suppressive effect on the Mongolian oak litter, resulting in a neutral effect on the litter mixture. These results suggest that the different responses in decomposition of single-species litter and the litter mixture to N addition are mainly attributed to litter chemical composition. Further investigations are required to characterize the effect of long-term high-level N addition on the litter decomposition as N deposition is likely to increase rapidly in the region where this study was conducted.

  3. Genomic Prediction of Genetic Values for Resistance to Wheat Rusts

    Directory of Open Access Journals (Sweden)

    Leonardo Ornella

    2012-11-01

    Full Text Available Durable resistance to the rust diseases of wheat ( L. can be achieved by developing lines that have race-nonspecific adult plant resistance conferred by multiple minor slow-rusting genes. Genomic selection (GS is a promising tool for accumulating favorable alleles of slow-rusting genes. In this study, five CIMMYT wheat populations evaluated for resistance were used to predict resistance to stem rust ( and yellow rust ( using Bayesian least absolute shrinkage and selection operator (LASSO (BL, ridge regression (RR, and support vector regression with linear or radial basis function kernel models. All parents and populations were genotyped using 1400 Diversity Arrays Technology markers and different prediction problems were assessed. Results show that prediction ability for yellow rust was lower than for stem rust, probably due to differences in the conditions of infection of both diseases. For within population and environment, the correlation between predicted and observed values (Pearson’s correlation [ρ] was greater than 0.50 in 90% of the evaluations whereas for yellow rust, ρ ranged from 0.0637 to 0.6253. The BL and RR models have similar prediction ability, with a slight superiority of the BL confirming reports about the additive nature of rust resistance. When making predictions between environments and/or between populations, including information from another environment or environments or another population or populations improved prediction.

  4. SSR markers associated to early leaf spot disease resistance through selective genotyping and single marker analysis in groundnut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Adama Zongo

    2017-09-01

    Full Text Available Groundnut (Arachis hypogaea L. is an important oilseed and food crop of the world. Breeding for disease resistance is one of major objectives in groundnut breeding. Early leaf spot (ELS is one of the major destructive diseases worldwide and in West Africa, particularly in Burkina Faso causing significant yield losses. Conventional breeding approaches have been employed to develop improved varieties resistant to ELS. Molecular dissection of resistance traits using QTL analysis can improve the efficiency of resistance breeding. In the present study, an ELS susceptible genotype QH243C and an ELS resistant genotype NAMA were crossed and the F2 population genotypic and F3 progenies phenotypic data were used for marker-trait association analysis. Parents were surveyed with 179 simple sequence repeat (SSR markers out of which 103 SSR markers were found to be polymorphic between the parents. These polymorphic markers were utilized to genotype the F2 population followed by marker-trait analysis through single marker analysis (SMA and selective genotyping of the population using 23 resistant and 23 susceptible genotypes. The SMA revealed 13 markers while the selective genotyping method identified 8 markers associated with ELS resistance. Four markers (GM1911, GM1883, GM1000 and Seq13E09 were found common between the two trait mapping methods. These four markers could be employed in genomics-assisted breeding for selection of ELS resistant genotypes in groundnut breeding.

  5. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  6. Tolerance of Loblolly Pines to Fusiform Rust

    Science.gov (United States)

    Charles H. Walkinshaw; James P. Barnett

    1995-01-01

    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  7. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio

    2018-03-01

    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  8. Effects of Simplicillium lanosoniveum on Phakopsora pachyrhizi, the soybean rust pathogen, and its use as a biological control agent.

    Science.gov (United States)

    Ward, N A; Robertson, C L; Chanda, A K; Schneider, R W

    2012-08-01

    The fungus Simplicillium lanosoniveum was isolated from soybean leaves infected with Phakopsora pachyrhizi, the soybean rust pathogen, in Louisiana and Florida. The fungus did not grow or become established on leaf surfaces until uredinia erupted, but when soybean rust signs and symptoms were evident, S. lanosoniveum colonized leaves within 3 days and sporulated within 4 days. Development of new uredinia was suppressed by about fourfold when S. lanosoniveum colonized uredinia. In the presence of S. lanosoniveum, uredinia became increasingly red-brown, and urediniospores turned brown and germinated at very low rates. Assays using quantitative real time polymerase chain reaction revealed that the fungus colonized leaf surfaces when plants were infected with P. pachyrhizi, either in a latent stage of infection or when symptoms were present. However, when plants were inoculated before infection, there was no increase of DNA of S. lanosoniveum, suggesting that the pathogen must be present in order for the antagonist to become established on soybean leaf surfaces. We documented significantly lower amounts of DNA of P. pachyrhizi and lower disease severity when soybean leaves were colonized with S. lanosoniveum. These studies documented the mycophilic and disease-suppressive nature of S. lanosoniveum.

  9. short communication sources of stem rust resistance in ethiopian ...

    African Journals Online (AJOL)

    Administrator

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat ... for their response to stem rust (Puccinia graminis f. sp. trictici) infection under greenhouse condition at Kulumsa. Agricultural .... are the phenotypic expression of host-pathogen interaction.

  10. Stem rust spores elicit rapid RPG1 phosphorylation

    Science.gov (United States)

    Stem rust threatens cereal production worldwide. Understanding the mechanism by which durable resistance genes, such as Rpg1, function is critical. We show that the RPG1 protein is phosphorylated within 5 min by exposure to spores from avirulent but not virulent races of stem rust. Transgenic mutant...

  11. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  12. White pines, blister rust, and management in the Southwest

    Science.gov (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler

    2009-01-01

    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  13. Genetic analysis of resistance to soybean rust disease | Kiryowa ...

    African Journals Online (AJOL)

    Soybean rust (Phakopsora pachyrhizi Sydow.) causes the most damage of all the pathogens known to attack soybean (Glycine max. Merril). A study was conducted in Uganda to estimate the magnitude of genetic parameters controlling soybean rust resistance and to estimate narrow sense heritability of the resistance.

  14. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  15. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  16. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  17. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  18. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  19. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to identify sources of resistance to the major pathotypes of stem rust prevalent in some countries of Eastern Africa. Three hundred and six elite breeding lines, selected and advanced at the Wheat Regional Centre of Excellence ...

  20. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Science.gov (United States)

    Zhang, Zijin; Chen, Jieming; Su, Yongying; Liu, Hanmei; Chen, Yanger; Luo, Peigao; Du, Xiaogang; Wang, Dan; Zhang, Huaiyu

    2015-01-01

    LHY (late elongated hypocotyl) is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization) cDNA library-induced stripe rust pathogen (CYR32) in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like). Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing) technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  1. TaLHY, a 1R-MYB Transcription Factor, Plays an Important Role in Disease Resistance against Stripe Rust Fungus and Ear Heading in Wheat.

    Directory of Open Access Journals (Sweden)

    Zijin Zhang

    Full Text Available LHY (late elongated hypocotyl is an important gene that regulates and controls biological rhythms in plants. Additionally, LHY is highly expressed in the SSH (suppression subtractive hybridization cDNA library-induced stripe rust pathogen (CYR32 in our previous research. To identify the function of the LHY gene in disease resistance against stripe rust, we used RACE-PCR technology to clone TaLHY in the wheat variety Chuannong19. The cDNA of TaLHY is 3085 bp long with an open reading frame of 1947 bp. TaLHY is speculated to encode a 70.3 kDa protein of 648 amino acids , which has one typical plant MYB-DNA binding domain; additionally, phylogenetic tree shows that TaLHY has the highest homology with LHY of Brachypodium distachyon(BdLHY-like. Quantitative fluorescence PCR indicates that TaLHY has higher expression in the leaf, ear and stem of wheat but lower expression in the root. Infestation of CYR32 can result in up-regulated expression of TaLHY, peaking at 72 h. Using VIGS (virus-induced gene silencing technology to disease-resistant wheat in the fourth leaf stage, plants with silenced TaLHY cannot complete their heading stage. Through the compatible interaction with the stripe rust physiological race CYR32, Chuannong 19 loses its immune capability toward the stripe rust pathogen, indicating that TaLHY may regulate and participate in the heading of wheat, as well as the defense responses against stripe rust infection.

  2. Direct and indirect effects of chemical treatment against poplar rust attacks

    Directory of Open Access Journals (Sweden)

    Giorcelli A

    2012-06-01

    Full Text Available Some quantitative consequences of poplar rust attacks (Melampsora larici-populina and M. allii-populina were analysed, both in absence and in presence of some preventive chemical treatments. Their effectiveness was previously assessed only partially and without evaluations of plant behaviour in the following vegetative season. Three IBS systemic triazoles (tebuconazole, cyproconazole and epoxyconazole, the translaminar cytotropic mandipropamid and a mixture of cyproconazole and azoxystrobin (methoxyacrilate similar to strobilurines were tested on one-year plantlets of the susceptible clone ’€˜Neva’ (Populus ×canadensis. The products were sprayed twice in August 2010, the second treatment twenty days after the first one. The leaf area covered by uredinia was assessed in several dates from the beginning of August until the end of September, as well as the percentage of still living leaves on the plant (last ten days of October. In May 2011, the average leaf surface of side shoots close to the top of the crown and the Chlorophyll Content Index (CCI were measured. The tested fungicides dramatically reduced the infections, except mandipropamid which showed no effectiveness. Tebuconazole and cyproconazole, either alone or in mixture with azoxystrobin, have offered the best performance (at the end of September, less than 10% of leaf surface covered by uredinia vs. over 50% of the control and mandipropamid treatment, followed by epoxyconazole that is anyway satisfying (about 15% of surface covered by uredinia. The systemic properties of these fungicides allowed a preventive action on leaves sprouted after both of the treatments as well, thus uredinium eruption was limited to 20% of leaf surface instead 40% on the test thesis. The same effectiveness ranking was reiterated for the percentage of still living leaves on the plant at the end of October (about 45% vs. 4% of the control test and, during the following season, for the average leaf

  3. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  4. Resistance to rust ( Puccinia psidii Winter) in eucalyptus: mode of inheritance and mapping of a major gene with RAPD markers.

    Science.gov (United States)

    Junghans, D T; Alfenas, A C; Brommonschenkel, S H; Oda, S; Mello, E J; Grattapaglia, D

    2003-12-01

    Rust is one of the most-damaging eucalypt diseases in Brazil and is considered a potential threat to eucalypt plantations worldwide. To determine the mode of inheritance of resistance in the Eucalyptus grandis- Puccinia psidii pathosystem, ten full-sib families, generated from crosses between susceptible and resistant trees, were inoculated with a single-pustule isolate of the pathogen and rust severity was scored. The observed segregation ratios in segregating families suggested major gene control of rust resistance, although clearly incomplete penetrance, variable expressivity and minor genes are also involved in the global rust-resistance response. To identify markers linked to the resistance locus, screening of RAPD polymorphisms was conducted using bulked segregant analysis in a large full-sib family. A linkage group was built around the Ppr1 gene ( P. psidii resistance gene 1) encompassing six RAPD markers, with a genetic window spanning 5 cM with the two most-closely linked flanking markers. Besides these two flanking markers, RAPD marker AT9/917 co-segregated with Ppr1 without a single recombinant in 994 meioses. This tightly linked marker should prove useful for marker-assisted introgression and will provide an initial lead for a positional cloning effort of this resistance allele. This is the first report of a disease resistance gene identified in Eucalyptus, and one of the few examples of the involvement of a major gene in a non-coevolved pathosystem.

  5. A green method of diaphragm spring's anti-rusting with high quality and efficiency

    Science.gov (United States)

    Huang, Xinming; Hua, Wenlin

    2017-10-01

    This paper introduces a green method of diaphragm spring's anti-rusting, which is of high quality, high efficiency and low consumption. It transforms the phosphating way of anti-rusting to physical anti-rusting that directly coat anti-rusting oil on the surface of the spring, and transforms the manual-oiling or oil-immersion to fully-automatically ultrasonic oiling. Hence, this method will completely change the way of diaphgragm spring's anti-rusting.

  6. Evaluation of Genetic Diversity and Host Resistance to Stem Rust in USDA NSGC Durum Wheat Accessions.

    Science.gov (United States)

    Chao, Shiaoman; Rouse, Matthew N; Acevedo, Maricelis; Szabo-Hever, Agnes; Bockelman, Harold; Bonman, J Michael; Elias, Elias; Klindworth, Daryl; Xu, Steven

    2017-07-01

    The USDA-ARS National Small Grains Collection (NSGC) maintains germplasm representing global diversity of small grains and their wild relatives. To evaluate the utility of the NSGC durum wheat ( L. ssp. ) accessions, we assessed genetic diversity and linkage disequilibrium (LD) patterns in a durum core subset containing 429 lines with spring growth habit originating from 64 countries worldwide. Genetic diversity estimated using wheat single-nucleotide polymorphism (SNP) markers showed considerable diversity captured in this collection. Average LD decayed over a genetic distance to within 3 cM at = 0.2, with a fast LD decay for markers linked at >5 cM. We evaluated accessions for resistance to wheat stem rust, caused by a fungal pathogen, Pers. Pers. f. sp. Eriks. and E. Henn (), using races from both eastern Africa and North America, at seedling and adult plant stages. Five accessions were identified as resistant to all stem rust pathogen races evaluated. Genome-wide association analysis detected 17 significant associations at the seedling stage with nine likely corresponding to , , and and the remaining potentially being novel genes located on six chromosomes. A higher frequency of resistant accessions was found at the adult plant stage than at the seedling stage. However, few significant associations were detected possibly a result of strong G × E interactions not properly accounted for in the mixed model. Nonetheless, the resistant accessions identified in this study should provide wheat breeders with valuable resources for improving stem rust resistance. Copyright © 2017 Crop Science Society of America.

  7. White pine blister rust resistance in limber pine: evidence for a major gene.

    Science.gov (United States)

    Schoettle, A W; Sniezko, R A; Kegley, A; Burns, K S

    2014-02-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections from >100 limber pine trees confirm that genetic segregation of a stem symptom-free trait to blister rust is consistent with inheritance by a single dominant resistance (R) gene, and the resistance allele appears to be distinct from the R allele in western white pine. Following previous conventions, we are naming the R gene for limber pine "Cr4." The frequency of the Cr4 allele across healthy and recently invaded populations in the Southern Rocky Mountains was unexpectedly high (5.0%, ranging from 0 to 13.9%). Cr4 is in equilibrium, suggesting that it is not a product of a recent mutation and may have other adaptive significance within the species, possibly related to other abiotic or biotic stress factors. The identification of Cr4 in native populations of limber pine early in the invasion progress in this region provides useful information for predicting near-term impacts and structuring long-term management strategies.

  8. Genome-wide association study of stem rust resistance in a world collection of cultivated barley.

    Science.gov (United States)

    Case, Austin J; Bhavani, Sridhar; Macharia, Godwin; Steffenson, Brian J

    2018-01-01

    QTL conferring a 14-40% reduction in adult plant stem rust severity to multiple races of Pgt were found on chromosome 5H and will be useful in barley breeding. Stem rust, caused by Puccinia graminis f. sp. tritici (Pgt) is an important disease of barley. The resistance gene Rpg1 has protected the crop against stem rust losses for over 70 years in North America, but is not effective against the African Pgt race TTKSK (and its variants) nor the domestic race QCCJB. To identify resistance to these Rpg1-virulent races, the Barley iCore Collection, held by the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection was evaluated for adult plant resistance (APR) and seedling resistance to race TTKSK and APR to race QCCJB and the Pgt TTKSK composite of races TTKSK, TTKST, TTKTK, and TTKTT. Using a genome-wide association study approach based on 6224 single nucleotide polymorphic markers, seven significant loci for stem rust resistance were identified on chromosomes 1H, 2H, 3H, and 5H. The most significant markers detected were 11_11355 and SCRI_RS_177017 at 71-75 cM on chromosome 5H, conferring APR to QCCJB and TTKSK composite. Significant markers were also detected for TTKSK seedling resistance on chromosome 5H. All markers detected on 5H were independent of the rpg4/Rpg5 complex at 152-168 cM. This study verified the importance of the 11_11355 locus in conferring APR to races QCCJB and TTKSK and suggests that it may be effective against other races in the Ug99 lineage.

  9. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.

    Science.gov (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang

    2018-01-01

    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  10. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  11. Host jumps shaped the diversity of extant rust fungi (Pucciniales).

    Science.gov (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2016-02-01

    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  12. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India.

    Science.gov (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu

    2016-06-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  13. Identification of a robust molecular marker for the detection of the stem rust resistance gene Sr45 in common wheat.

    Science.gov (United States)

    Periyannan, Sambasivam; Bansal, Urmil; Bariana, Harbans; Deal, Karin; Luo, Ming-Cheng; Dvorak, Jan; Lagudah, Evans

    2014-04-01

    Fine mapping of the Ug99 effective stem rust resistance gene Sr45 introgressed into common wheat from the D -genome goatgrass Aegilops tauschii. Stem rust resistance gene Sr45, discovered in Aegilops tauschii, the progenitor of the D -genome of wheat, is effective against commercially important Puccinia graminis f. sp. tritici races prevalent in Australia, South Africa and the Ug99 race group. A synthetic hexaploid wheat (RL5406) generated by crossing Ae. tauschii accession RL5289 (carrying Sr45 and the leaf rust resistance gene Lr21) with a tetraploid experimental line 'TetraCanthatch' was previously used as the source in the transfer of these rust resistance genes to other hexaploid cultivars. Previous genetic studies on hexaploid wheats mapped Sr45 on the short arm of chromosome 1D with the following gene order: centromere-Sr45-Sr33-Lr21-telomere. To identify closely linked markers, we fine mapped the Sr45 region in a large mapping population generated by crossing CS1D5406 (disomic substitution line with chromosome 1D of RL5406 substituted for Chinese Spring 1D) with Chinese Spring. Closely linked markers based on 1DS-specific microsatellites, expressed sequence tags and AFLP were useful in the delineation of the Sr45 region. Sequences from an AFLP marker amplified a fragment that was linked with Sr45 at a distance of 0.39 cM. The fragment was located in a bacterial artificial chromosome clone of contig (ctg)2981 of the Ae. tauschii accession AL8/78 physical map. A PCR marker derived from clone MI221O11 of ctg2981 amplified 1DS-specific sequence that harboured an 18-bp indel polymorphism that specifically tagged the Sr45 carrying haplotype. This new Sr45 marker can be combined with a previously reported marker for Lr21, which will facilitate selecting Sr45 and Lr21 in breeding populations.

  14. Orange rust in sugarcane: molecular identification in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Carla Vanessa Borges Castro

    2013-09-01

    Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.

  15. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both......Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...

  16. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit

    Science.gov (United States)

    The chlorophyll gives the green color in plants. Any mutations in chloroplhyll biosynthesis or regulation may result in colr changes. Leaf color mutants are common in higher plants, which can be used as markers in crop breeding or as a tool in understanding regulatory mechanisms in chlorophyll biosy...

  17. Characterization and comparative analysis of the genome of Puccinia sorghi Schwein, the causal agent of maize common rust.

    Science.gov (United States)

    Rochi, Lucia; Diéguez, María José; Burguener, Germán; Darino, Martín Alejandro; Pergolesi, María Fernanda; Ingala, Lorena Romina; Cuyeu, Alba Romina; Turjanski, Adrián; Kreff, Enrique Domingo; Sacco, Francisco

    2018-03-01

    Rust fungi are one of the most devastating pathogens of crop plants. The biotrophic fungus Puccinia sorghi Schwein (Ps) is responsible for maize common rust, an endemic disease of maize (Zea mays L.) in Argentina that causes significant yield losses in corn production. In spite of this, the Ps genomic sequence was not available. We used Illumina sequencing to rapidly produce the 99.6Mbdraft genome sequence of Ps race RO10H11247, derived from a single-uredinial isolate from infected maize leaves collected in the Argentine Corn Belt Region during 2010. High quality reads were obtained from 200bppaired-end and 5000bpmate-paired libraries and assembled in 15,722 scaffolds. A pipeline which combined an ab initio program with homology-based models and homology to in planta enriched ESTs from four cereal pathogenic fungus (the three sequenced wheat rusts and Ustilago maydis) was used to identify 21,087 putative coding sequences, of which 1599 might be part of the Ps RO10H11247 secretome. Among the 458 highly conserved protein families from the euKaryotic Orthologous Groups (KOG) that occur in a wide range of eukaryotic organisms, 97.5% have at least one member with high homology in the Ps assembly (TBlastN, E-value⩽e-10) covering more than 50% of the length of the KOG protein. Comparative studies with the three sequenced wheat rust fungus, and microsynteny analysis involving Puccinia striiformis f. sp. tritici (Pst, wheat stripe rust fungus), support the quality achieved. The results presented here show the effectiveness of the Illumina strategy for sequencing dikaryotic genomes of non-model organisms and provides reliable DNA sequence information for genomic studies, including pathogenic mechanisms of this maize fungus and molecular marker design. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. HOW to Identify and Control Stem Rusts of Jack Pine

    Science.gov (United States)

    Kathryn Robbins; Dale K. Smeltzer; D. W. French

    Damage to jack pine caused by rust fungi includes growth reduction, cankers, death (by girdling or wind breakage), and creation of entryways for other fungi and insects. Seedlings and saplings are more seriously affected than older trees.

  19. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    an integrated set of datasets on both pathogen and host at the global scale. The Global Cereal Rust Monitoring System (GCRMS), created under the Durable Rust resistance in Wheat (DRRW) project, represents a unique and increasingly comprehensive resource of rust information. A suite of tools are now available....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  20. Two distinct classes of QTL determine rust resistance in sorghum.

    Science.gov (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David

    2014-12-31

    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  1. Association mapping of stem rust race TTKSK resistance in US barley breeding germplasm.

    Science.gov (United States)

    Zhou, H; Steffenson, B J; Muehlbauer, Gary; Wanyera, Ruth; Njau, Peter; Ndeda, Sylvester

    2014-06-01

    Loci conferring resistance to the highly virulent African stem rust race TTKSK were identified in advanced barley breeding germplasm and positioned to chromosomes 5H and 7H using an association mapping approach. African races of the stem rust pathogen (Puccinia graminis f. sp. tritici) are a serious threat to barley production worldwide because of their wide virulence. To discover and characterize resistance to African stem rust race TTKSK in US barley breeding germplasm, over 3,000 lines/cultivars were assessed for resistance at the seedling stage in the greenhouse and also the adult plant stage in the field in Kenya. Only 12 (0.3 %) and 64 (2.1 %) lines exhibited a resistance level comparable to the resistant control at the seedling and adult plant stage, respectively. To map quantitative trait loci (QTL) for resistance to race TTKSK, an association mapping approach was conducted, utilizing 3,072 single nucleotide polymorphism (SNP) markers. At the seedling stage, two neighboring SNP markers (0.8 cM apart) on chromosome 7H (11_21491 and 12_30528) were found significantly associated with resistance. The most significant one found was 12_30528; thus, the resistance QTL was named Rpg-qtl-7H-12_30528. At the adult plant stage, two SNP markers on chromosome 5H (11_11355 and 12_31427) were found significantly associated with resistance. This resistance QTL was named Rpg-qtl-5H-11_11355 for the most significant marker identified. Adult plant resistance is of paramount importance for stem rust. The marker associated with Rpg-qtl-5H-11_11355 for adult plant resistance explained only a small portion of the phenotypic variation (0.02); however, this QTL reduced disease severity up to 55.0 % under low disease pressure and up to 21.1 % under heavy disease pressure. SNP marker 11_11355 will be valuable for marker-assisted selection of adult plant stem rust resistance in barley breeding.

  2. Determination of Response of Some Bread Wheat Varieties Against Leaf Diseases Under Ecological Conditions of Düzce in the Western Black Sea Region

    Directory of Open Access Journals (Sweden)

    Nedim Altın

    2017-07-01

    Full Text Available This study was conducted to determine the response of 19 bread wheat varieties to natural infection of leaf diseases under ecological conditions of Düzce in the Western Black Sea Region. The trial was established in accordance with randomized block with four replications and the seeds were planted on 17.11.2015. The wheat varities were observed for the associated diseases including septoria leaf spot disease (caused by Septoria tritici during milking stage, yellow rust disease (caused by Puccinia striiformis at the end of the flowering period, brown rust disease (caused by Puccinia recondita at the beginning of milking stage. The disease severity were assessed in the field conditions according to natural contamination. According to determined diseases severity, the most sensitive variety against septoria leaf spot disease was “Bereket” with 60%, while the most tolerant variety was “Aslı” with 14%. The most sensitive variety against yellow rust disease was “Tekirdağ” with 45.4%, while the most tolerant variety was “Midas” with 0.6%. The most sensitive variety against brown rust disease was “Tahirova” with 22%, while the most tolerant variety was “Midas” with 0.2%. The results indicated that promising wheat varieties for future breeding studies were: Aldane, Aslı, Konya 2002, Köprü, Masaccio and Tosunbey (against septoria leaf spot disease, Aslı, Esperia, Kate A1, Karasunya Odeska, Masaccio and Midas (against yellow rust disease, Aldane, Aslı, Bereket, Köprü, Masaccio, Midas and Tekirdağ (against brown rust disease.

  3. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    International Nuclear Information System (INIS)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.

    2003-01-01

    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  4. Corrosion in drinking water pipes: the importance of green rusts.

    Science.gov (United States)

    Swietlik, Joanna; Raczyk-Stanisławiak, Urszula; Piszora, Paweł; Nawrocki, Jacek

    2012-01-01

    Complex crystallographic composition of the corrosion products is studied by diffraction methods and results obtained after different pre-treatment of samples are compared. The green rusts are found to be much more abundant in corrosion scales than it has been assumed so far. The characteristic and crystallographic composition of corrosion scales and deposits suspended in steady waters were analyzed by X-ray diffraction (XRD). The necessity of the examination of corrosion products in the wet conditions is indicated. The drying of the samples before analysis is shown to substantially change the crystallographic phases originally present in corrosion products. On sample drying the unstable green rusts is converted into more stable phases such as goethite and lepidocrocite, while the content of magnetite and siderite decreases. Three types of green rusts in wet materials sampled from tubercles are identified. Unexpectedly, in almost all corrosion scale samples significant amounts of the least stable green rust in chloride form was detected. Analysis of corrosion products suspended in steady water, which remained between tubercles and possibly in their interiors, revealed complex crystallographic composition of the sampled material. Goethite, lepidocrocite and magnetite as well as low amounts of siderite and quartz were present in all samples. Six different forms of green rusts were identified in the deposits separated from steady waters and the most abundant was carbonate green rust GR(CO(3)(2-))(I). Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  6. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula

    OpenAIRE

    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas

    2011-01-01

    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  7. Rust fungi on some poaceous weeds of wheat crops in Pakistan

    OpenAIRE

    NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI

    2013-01-01

    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  8. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping.

    Science.gov (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M

    2015-01-01

    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  9. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Science.gov (United States)

    Amanda L. Pendleton; Katherine E. Smith; Nicolas Feau; Francis M. Martin; Igor V. Grigoriev; Richard Hamelin; C.Dana Nelson; J.Gordon Burleigh; John M. Davis

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops . A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen...

  10. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  11. Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).

    Science.gov (United States)

    Hernádez, José R; Aime, M Catherine; Newbry, Brad

    2004-07-01

    A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.

  12. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  13. Breeding wheat mutant Longfu 03D51 with resisting stem rust and genetic analyzation of resisting disease and RAPD maker

    International Nuclear Information System (INIS)

    Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun

    2007-01-01

    Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)

  14. The development of quick, robust, quantitative phenotypic assays for describing the host-nonhost landscape to stripe rust.

    Science.gov (United States)

    Dawson, Andrew M; Bettgenhaeuser, Jan; Gardiner, Matthew; Green, Phon; Hernández-Pinzón, Inmaculada; Hubbard, Amelia; Moscou, Matthew J

    2015-01-01

    Nonhost resistance is often conceptualized as a qualitative separation from host resistance. Classification into these two states is generally facile, as they fail to fully describe the range of states that exist in the transition from host to nonhost. This poses a problem when studying pathosystems that cannot be classified as either host or nonhost due to their intermediate status relative to these two extremes. In this study, we investigate the efficacy of the Poaceae-stripe rust (Puccinia striiformis Westend.) interaction for describing the host-nonhost landscape. First, using barley (Hordeum vulgare L.) and Brachypodium distachyon (L.) P. Beauv. We observed that macroscopic symptoms of chlorosis and leaf browning were associated with hyphal colonization by P. striiformis f. sp. tritici, respectively. This prompted us to adapt a protocol for visualizing fungal structures into a phenotypic assay that estimates the percent of leaf colonized. Use of this assay in intermediate host and intermediate nonhost systems found the frequency of infection decreases with evolutionary divergence from the host species. Similarly, we observed that the pathogen's ability to complete its life cycle decreased faster than its ability to colonize leaf tissue, with no incidence of pustules observed in the intermediate nonhost system and significantly reduced pustule formation in the intermediate host system as compared to the host system, barley-P. striiformis f. sp. hordei. By leveraging the stripe rust pathosystem in conjunction with macroscopic and microscopic phenotypic assays, we now hope to dissect the genetic architecture of intermediate host and intermediate nonhost resistance using structured populations in barley and B. distachyon.

  15. The development of quick, robust, quantitative phenotypic assays for describing the host-nonhost landscape to stripe rust

    Directory of Open Access Journals (Sweden)

    Andrew Marc Dawson

    2015-10-01

    Full Text Available Nonhost resistance is often conceptualized as a qualitative separation from host resistance. Classification into these two states is generally facile, as they fail to fully describe the range of states that exist in the transition from host to nonhost. This poses a problem when studying pathosystems that cannot be classified as either host or nonhost due to their intermediate status relative to these two extremes. In this study, we investigate the efficacy of the Poaceae-stripe rust (Puccinia striiformis Westend. interaction for describing the host-nonhost landscape. First, using barley (Hordeum vulgare L. and Brachypodium distachyon (L. P. Beauv. we observed that macroscopic symptoms of chlorosis and leaf browning were associated with hyphal colonization by P. striiformis f. sp. tritici, respectively. This prompted us to adapt a protocol for visualizing fungal structures into a phenotypic assay that estimates the percent of leaf colonized. Use of this assay in intermediate host and intermediate nonhost systems found the frequency of infection decreases with evolutionary divergence from the host species. Similarly, we observed that the pathogen’s ability to complete its life cycle decreased faster than its ability to colonize leaf tissue, with no incidence of pustules observed in the intermediate nonhost system and significantly reduced pustule formation in the intermediate host system as compared to the host system, barley-P. striiformis f. sp. hordei. By leveraging the stripe rust pathosystem in conjunction with macroscopic and microscopic phenotypic assays, we now hope to dissect the genetic architecture of intermediate host and intermediate nonhost resistance using structured populations in barley and B. distachyon.

  16. Characterization of Arsenic Contamination on Rust from Ton Containers

    Energy Technology Data Exchange (ETDEWEB)

    Gary S. Groenewold; Recep Avci; Robert V. Fox; Muhammedin Deliorman; Jayson Suo; Laura Kellerman

    2013-01-01

    The speciation and spatial distribution of arsenic on rusted steel surfaces affects both measurement and removal approaches. The chemistry of arsenic residing in the rust of ton containers that held the chemical warfare agents bis(2-chloroethyl)sulfide (sulfur mustard) and 2-chlorovinyldichloroarsine (Lewisite) is of particular interest, because while the agents have been decontaminated, residual arsenic could pose a health or environmental risk. The chemistry and distribution of arsenic in rust samples was probed using imaging secondary ion mass spectrometry (SIMS), X-ray photoelectron spectroscopy (XPS), Auger electron spectroscopy, and scanning electron microscopy/energy dispersive X-ray spectroscopy (SEM/EDX). Arsenic in the +3 and or +5 oxidation state is homogeneously distributed at the very top-most layer of the rust samples, and is intimately associated with iron. Sputter depth profiling followed by SIMS and XPS shows As at a depth of several nm, in some cases in a reduced form. The SEM/EDX experiments show that As is present at a depth of several microns, but is inhomogeneously distributed; most locations contained oxidized As at concentrations of a few percent, however several locations showed very high As in a metallic form. These results indicate that the rust material must be removed if the steel containers are to be cleared of arsenic.

  17. Painting rusted steel: The role of aluminum phosphosilicate

    International Nuclear Information System (INIS)

    Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.

    2013-01-01

    Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer

  18. Why do leaf-tying caterpillars abandon their leaf ties?

    Directory of Open Access Journals (Sweden)

    Michelle Sliwinski

    2013-09-01

    Full Text Available Leaf-tying caterpillars act as ecosystem engineers by building shelters between overlapping leaves, which are inhabited by other arthropods. Leaf-tiers have been observed to leave their ties and create new shelters (and thus additional microhabitats, but the ecological factors affecting shelter fidelity are poorly known. For this study, we explored the effects of resource limitation and occupant density on shelter fidelity and assessed the consequences of shelter abandonment. We first quantified the area of leaf material required for a caterpillar to fully develop for two of the most common leaf-tiers that feed on white oak, Quercus alba. On average, Psilocorsis spp. caterpillars consumed 21.65 ± 0.67 cm2 leaf material to complete development. We also measured the area of natural leaf ties found in a Maryland forest, to determine the distribution of resources available to caterpillars in situ. Of 158 natural leaf ties examined, 47% were too small to sustain an average Psilocorsis spp. caterpillar for the entirety of its development. We also manipulated caterpillar densities within experimental ties on potted trees to determine the effects of cohabitants on the likelihood of a caterpillar to leave its tie. We placed 1, 2, or 4 caterpillars in ties of a standard size and monitored the caterpillars twice daily to track their movement. In ties with more than one occupant, caterpillars showed a significantly greater propensity to leave their tie, and left sooner and at a faster rate than those in ties as single occupants. To understand the consequences of leaf tie abandonment, we observed caterpillars searching a tree for a site to build a shelter in the field. This is a risky behavior, as 17% of the caterpillars observed died while searching for a shelter site. Caterpillars that successfully built a shelter traveled 110 ± 20 cm and took 28 ± 7 min to find a suitable site to build a shelter. In conclusion, leaf-tying caterpillars must frequently

  19. SU-E-T-331: Dosimetric Impact of Multileaf Collimator Leaf Width On Stereotactic Radiosurgery (SRS) RapidArc Treatment Plans for Single and Multiple Brain Metastases

    International Nuclear Information System (INIS)

    Hossain, S; Keeling, V; Ahmad, S; Algan, O

    2015-01-01

    Purpose: To determine the effects of multileaf collimator (MLC) leaf width on normal-brain-tissue doses and dose conformity of SRS RapidArc treatment plans for brain tumors. Methods: Ten patients with 24 intracranial tumors (seven with 1–2 and three with 4–6 lesions) were planned using RapidArc for both Varian Millennium 120 MLC (5 mm leaf width) and high definition (HD) MLC (2.5 mm leaf width). Between 2 and 8 arcs were used with two full coplanar arcs and the rest non-coplanar half arcs. 6 MV beams were used and plans were optimized with a high priority to the Normal Tissue Objective (to achieve dose conformity and sharp dose fall-off) and normal brain tissue. Calculation was done using AAA on a 1 mm grid size. The prescription dose ranged from 14–22 Gy. Plans were normalized such that 99% of the target received the prescription dose. Identical beam geometries, optimizations, calculations, and normalizations were used for both plans. Paddick Conformity Index (PCI), V4, V8 and V12 Gy for normal brain tissue and Integral Dose were used for analysis. Results: In all cases, HD MLC plans performed better in sparing normal brain tissue, achieving a higher PCI with a lower Integral Dose. The average PCI for all 24 targets was 0.75±0.23 and 0.70±0.23 (p ≤0.0015) for HD MLC and Millennium MLC plans, respectively. The average ratio of normal brain doses for Millennium MLC to HD MLC plans was 1.30±0.16, 1.27±0.15, and 1.31±0.18 for the V4, V8, and V12, respectively. The differences in normal brain dose for all criteria were statistically significant with p-value < 0.02. On average Millennium MLC plans had a 16% higher integral dose than HD MLC plans. Conclusion: Significantly better dose conformity with reduced volume of normal brain tissue and integral dose was achieved with HD MLC plans compared to Millennium MLC plans

  20. Grain yield losses in yellow-rusted durum wheat estimated using digital and conventional parameters under field conditions

    Directory of Open Access Journals (Sweden)

    Omar Vergara-Diaz

    2015-06-01

    Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.

  1. Utilization of the cropgro-soybean model to estimate yield loss caused by Asian rust in cultivars with different cycle

    Directory of Open Access Journals (Sweden)

    Rafael de Ávila Rodrigues

    2012-01-01

    Full Text Available In recent years, crop models have increasingly been used to simulate agricultural features. The DSSAT (Decision Support System for Agrotechnology Transfer is an important tool in modeling growth; however, one of its limitations is related to the unaccounted-for effect of diseases. Therefore, the goals of this study were to calibrate and validate the CSM CROPGRO-Soybean for the soybean cultivars M-SOY 6101 and MG/BR 46 (Conquista, analyze the performance and the effect of Asian soybean rust on these cultivars under the environmental conditions of Viçosa, Minas Gerais, Brazil. The experimental data for the evaluation, testing, and adjustment of the genetic coefficients for the cultivars, M-SOY 6101 and MG/BR 46 (Conquista, were obtained during the 2006/2007, 2007/2008 and 2009/2010 growing seasons. GLUE (Generalized Likelihood Uncertainty Estimation was used for the estimation of the genetic coefficients, and pedotransfer functions have been utilized to estimate the physical characteristics of the soil. For all of the sowing dates, the early season cultivar, M-SOY 6101, exhibited a lower variance in yield, which represents more stability with regard to the interannual climate variability, i.e., the farmers who use this cultivar will have in 50% of the crop years analyzed, a higher yield than a late-season cultivar. The MG/BR 46 (Conquista cultivar demonstrated a greater probability of obtaining higher yield in years with favorable weather conditions. However, in the presence of the Asian soybean rust, yield is heavily affected. The early cultivar, M-SOY 6101, showed a lower risk of being affected by the rust and consequently exhibited less yield loss considering the scenario D90 (condensation on the leaf surface occurs when the relative humidity is greater than or equal to 90%, for a sowing date of November 14.

  2. Weather and Climate Indicators for Coffee Rust Disease

    Science.gov (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  3. Impact of Moringa oleifera lam. Leaf powder supplementation versus nutritional counseling on the body mass index and immune response of HIV patients on antiretroviral therapy: a single-blind randomized control trial.

    Science.gov (United States)

    Tshingani, Koy; Donnen, Philippe; Mukumbi, Henri; Duez, Pierre; Dramaix-Wilmet, Michèle

    2017-08-22

    To achieve effective antiretroviral therapy (ART) outcomes, adherence to an antiretroviral regimen and a good immunometabolic response are essential. Food insecurity can act as a real barrier to adherence to both of these factors. Many people living with human immunodeficiency virus (PLHIV) treated with ART in the Democratic Republic of the Congo (DRC) are faced with nutritional challenges. A significant proportion are affected by under nutrition, which frequently leads to therapeutic failure. Some HIV care facilities recommend supplementation with Moringa oleifera (M.O.) Lam. leaf powder to combat marginal and major nutritional deficiencies. This study aims to assess the impact of M.O. Lam. leaf powder supplementation compared to nutritional counseling on the nutritional and immune status of PLHIV treated with ART. A single-blind randomized control trial was carried out from May to September 2013 at an outpatient clinic for HIV-infected patients in Kinshasa (DRC). Sixty adult patients who were at stable HIV/AIDS clinical staging 2, 3 or 4 according to the World Health Organization (WHO), and were undergoing ART were recruited. After random allocation, 30 patients in the Moringa intervention group (MG) received the M.O. Lam. leaf powder daily over 6 months, and 30 in the control group (CG) received nutritional counseling over the same period. Changes in the body mass index (BMI) were measured monthly and biological parameters were measured upon admission and at the end of the study for the patients in both groups. The two study groups were similar in terms of long-term nutritional exposure, sociodemographic, socioeconomic, clinical, and biological features. At 6 months follow-up, patients in the MG exhibited a significantly greater increase in BMI and albumin levels than those in the CG. The interaction between the sociodemographic, clinical, and biological characteristics of patients in the two groups was not significant, with the exception of professional

  4. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  5. Genetic Resistance to Rust of Eucalyptus urophylla Progenies

    Directory of Open Access Journals (Sweden)

    André Carignato

    2018-02-01

    Full Text Available ABSTRACT This study assessed the genetic variability in open-pollinated progenies of Eucalyptus urophylla for resistance to rust (Puccinia psidii. The progeny trial was conducted on a statistical randomized block design with 20 progenies, five plants per plot, and nine replications. Analysis of variance showed high genetic variability for the studied trait, with potential for selection gains. The genetic variability of this population provides support to conduct a breeding program with superior individuals for rust resistance, allowing low costs and minimizing the yield losses on eucalyptus plantations.

  6. Markers Linked to Wheat Stem Rust Resistance Gene Sr11 Effective to Puccinia graminis f. sp. tritici Race TKTTF.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Chao, Shiaoman; Olivera, Pablo; Babiker, Ebrahiem M; Abeyo, Bekele; Tadesse, Zerihun; Imtiaz, Muhammad; Talbert, Luther; Blake, Nancy K; Akhunov, Eduard; Pumphrey, Michael O; Jin, Yue; Rouse, Matthew N

    2016-11-01

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici, can cause severe yield losses on susceptible wheat varieties and cultivars. Although stem rust can be controlled by the use of genetic resistance, population dynamics of P. graminis f. sp. tritici can frequently lead to defeat of wheat stem rust resistance genes. P. graminis f. sp. tritici race TKTTF caused a severe epidemic in Ethiopia on Ug99-resistant 'Digalu' in 2013 and 2014. The gene Sr11 confers resistance to race TKTTF and is present in 'Gabo 56'. We identified seven single-nucleotide polymorphism (SNP) markers linked to Sr11 from a cross between Gabo 56 and 'Chinese Spring' exploiting a 90K Infinium iSelect Custom beadchip. Five SNP markers were validated on a 'Berkut'/'Scalavatis' population that segregated for Sr11, using KBioscience competitive allele-specific polymerase chain reaction (KASP) assays. Two of the SNP markers, KASP_6BL_IWB10724 and KASP_6BL_IWB72471, were predictive of Sr11 among wheat genetic stocks, cultivars, and breeding lines from North America, Ethiopia, and Pakistan. These markers can be utilized to select for Sr11 in wheat breeding and to detect the presence of Sr11 in uncharacterized germplasm.

  7. Inheritance of resistance to Ug99 stem rust in wheat cultivar Norin 40 and genetic mapping of Sr42.

    Science.gov (United States)

    Ghazvini, Habibollah; Hiebert, Colin W; Zegeye, Taye; Liu, Sixin; Dilawari, Mridull; Tsilo, Toi; Anderson, James A; Rouse, Matthew N; Jin, Yue; Fetch, Tom

    2012-08-01

    Stem rust, caused by Puccinia graminis f. sp. tritici, is a devastating disease of wheat. The emergence of race TTKSK (Ug99) and new variants in Africa threatens wheat production worldwide. The best method of controlling stem rust is to deploy effective resistance genes in wheat cultivars. Few stem rust resistance (Sr) genes derived from the primary gene pool of wheat confer resistance to TTKSK. Norin 40, which carries Sr42, is resistant to TTKSK and variants TTKST and TTTSK. The goal of this study was to elucidate the inheritance of resistance to Ug99 in Norin 40 and map the Sr gene(s). A doubled haploid (DH) population of LMPG-6/Norin 40 was evaluated for resistance to the race TTKST. Segregation of 248 DH lines fitted a 1:1 ratio (χ (2) 1:1= 0.58, p = 0.45), indicating a single gene in Norin 40 conditioned resistance to Ug99. This was confirmed by an independent F(2:3) population also derived from the cross LMPG-6/Norin 40 where a 1:2:1 ratio (χ (2)1:2:1 = 0.69, p = 0.71) was observed following the inoculation with race TTKSK. Mapping with DNA markers located this gene to chromosome 6DS, the known location of Sr42. PCR marker FSD_RSA co-segregated with Sr42, and simple sequence repeat (SSR) marker BARC183 was closely linked (0.5 cM) to Sr42. A previous study found close linkage between FSD_RSA and SrCad, a temporarily designated gene that also confers resistance to Ug99, thus Sr42 may be the same gene or allelic. Marker FSD_RSA is suitable for marker-assisted selection (MAS) in wheat breeding programs to improve stem rust resistance, including Ug99.

  8. Characterization of a tryptophan 2-monooxygenase gene from Puccinia graminis f. sp. tritici involved in auxin biosynthesis and rust pathogenicity.

    Science.gov (United States)

    Yin, Chuntao; Park, Jeong-Jin; Gang, David R; Hulbert, Scot H

    2014-03-01

    The plant hormone indole-3-acetic acid (IAA) is best known as a regulator of plant growth and development but its production can also affect plant-microbe interactions. Microorganisms, including numerous plant-associated bacteria and several fungi, are also capable of producing IAA. The stem rust fungus Puccinia graminis f. sp. tritici induced wheat plants to accumulate auxin in infected leaf tissue. A gene (Pgt-IaaM) encoding a putative tryptophan 2-monooxygenase, which makes the auxin precursor indole-3-acetamide (IAM), was identified in the P. graminis f. sp. tritici genome and found to be expressed in haustoria cells in infected plant tissue. Transient silencing of the gene in infected wheat plants indicated that it was required for full pathogenicity. Expression of Pgt-IaaM in Arabidopsis caused a typical auxin expression phenotype and promoted susceptibility to the bacterial pathogen Pseudomonas syringae pv. tomato DC3000.

  9. Rust and Thinning Management Effect on Cup Quality and Plant Performance for Two Cultivars of Coffea arabica L.

    Science.gov (United States)

    Echeverria-Beirute, Fabian; Murray, Seth C; Klein, Patricia; Kerth, Chris; Miller, Rhonda; Bertrand, Benoit

    2017-09-29

    Beverage quality is a complex attribute of coffee (Coffea arabica L.). Genotype (G), environment (E), management (M), postharvest processing, and roasting are all involved. However, little is known about how G × M interactions influence beverage quality. We investigated how yield and coffee leaf rust (CLR) disease (caused by Hemileia vastatrix Berk. et Br.) management affect cup quality and plant performance, in two coffee cultivars. Sensory and chemical analyses revealed that 10 of 70 attributes and 18 of 154 chemical volatile compounds were significantly affected by G and M. Remarkably, acetaminophen was found for the first time in roasted coffee and in higher concentrations under more stressful conditions. A principal component analysis described 87% of the variation in quality and plant overall performance. This study is a first step in understanding the complexity of the physiological, metabolic, and molecular changes in coffee production, which will be useful for the improvement of coffee cultivars.

  10. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  11. Mössbauer study of some rust converters

    Science.gov (United States)

    Gancedo, J. R.; Gracia, M.; Francisco, W.; Morcillo, M.; Feliu, S.

    1989-03-01

    The ability “to transform rust” of nine commercial converters has been studied by Mossbauer spectroscopy. This technique fails to prove that all nine but one change the chemical nature of the rust previously formed on mild steel plates. Accelerated salt spray tests demonstrated a significant different performance for the studied products, whose effects range from deleterious to beneficial.

  12. Improvement of wheat in Zambia using incomplete resistance against rusts

    NARCIS (Netherlands)

    Milliano, de W.A.J.

    1983-01-01

    The programme of wheat improvement developed in Zambia used local facilities (finance, personnel, infrastructure), low budget, and few personnel. Incomplete resistance against rusts was used to obtain durable resistance.
    The abiotic conditions, socio-economic status of the farmers,

  13. Molecular Characterization of wheat stem rust races in Kenya

    Science.gov (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  14. Amino acid assisted dehalogenation of carbon tetrachloride by green rust

    DEFF Research Database (Denmark)

    Yin, Weizhao; Strobel, Bjarne W.; Hansen, Hans Chr. Bruun

    2017-01-01

    Layered FeII-FeIII hydroxides (green rusts, GR) are promising reactants for reductive dechlorination of chlorinated solvents due to high reaction rates and the opportunity to inject reactive slurries of the compounds into contaminant plumes. However, it is necessary to develop strategies...

  15. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    MICHAEL

    ABSTRACT: Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was ...

  16. Taxonomy, phylogeny, and coevolution of pines and their stem rusts

    Science.gov (United States)

    C. I. Millar; B. B. Kinloch

    1991-01-01

    We review and reinterpret major events in the evolution of pines and their stem rusts using information from their taxonomy, genetics, biogeography, and fossil history. Understanding of pine evolution has been significantly revised in the last 20 years. Pines appear to have evolved early in the Mesozoic and to have diversified and migrated throughout middle latitudes...

  17. White pine blister rust resistance research in Minnesota and Wisconsin

    Science.gov (United States)

    Andrew David; Paul Berrang; Carrie Pike

    2012-01-01

    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  18. White pines, Ribes, and blister rust: integration and action

    Science.gov (United States)

    R. S. Hunt; B. W. Geils; K. E. Hummer

    2010-01-01

    The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...

  19. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  20. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  1. White pines, Ribes, and blister rust: a review and synthesis

    Science.gov (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt

    2010-01-01

    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  2. White pine blister rust in the interior Mountain West

    Science.gov (United States)

    Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle

    2010-01-01

    White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...

  3. Screening of fungicides for the management of wattle rust ...

    African Journals Online (AJOL)

    % of the revenue from the species obtained from the timber and 15% from the bark. From 2012/13 a wattle rust disease has spread throughout the black wattle plantation area in KwaZulu-Natal and from 2015 it was recorded in southern ...

  4. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)

    Science.gov (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas

    2012-01-01

    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  5. Archaeophytopathology of Phakopsora pachyrhizi, the soybean rust pathogen

    Science.gov (United States)

    Phakopsora pachyrhizi and P. meibomiae are two rust species that infect soybean (Glycine max). Traditionally, these two species are said to differ in geographic distribution, with P. pachyrhizi confined to Asia, Africa & Australia, and P. meibomiae confined to South & Central America. Several herbar...

  6. Registration of eight soybean germplasm lines resistant to soybean rust

    Science.gov (United States)

    Soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi Sydow is a threat to soybean [Glycine max (L.) Merr.] production worldwide. Although SBR has not caused widespread damage in North America, the crop is still threatened by the disease because most cultivars in production are susceptible...

  7. Contribution to Kinetics of Formation of White Rust on Galvanized Steel

    International Nuclear Information System (INIS)

    Han, D. J.; Pyun, Su Il; Hahn, Y. D.

    1981-01-01

    Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion

  8. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  9. Comparisons of visual rust assessments and DNA levels of Phakopsora pachyrhizi in soybean genotypes varying in rust resistance

    Science.gov (United States)

    Soybean resistance to Phakopsora pachyrhizi, the cause of soybean rust, has been characterized by the following three infection types (i) immune response (IM; complete resistance) with no visible lesions, (ii) resistant reaction with reddish brown (RB) lesions (incomplete resistance), and (iii) susc...

  10. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L

    2018-03-21

    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  11. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum).

    Science.gov (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto

    2017-11-01

    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  12. Genome-Wide Linkage Mapping of QTL for Adult-Plant Resistance to Stripe Rust in a Chinese Wheat Population Linmai 2 × Zhong 892.

    Directory of Open Access Journals (Sweden)

    Jindong Liu

    Full Text Available Stripe rust is one of the most devastating diseases of wheat (Triticum aestivum worldwide. Adult-plant resistance (APR is an efficient approach to provide long-term protection of wheat from the disease. The Chinese winter wheat cultivar Zhong 892 has a moderate level of APR to stripe rust in the field. To determine the inheritance of the APR resistance in this cultivar, 273 F6 recombinant inbred lines (RILs were developed from a cross between Linmai 2 and Zhong 892. The RILs were evaluated for maximum disease severity (MDS in two sites during the 2011-2012, 2012-2013 and 2013-2014 cropping seasons, providing data for five environments. Illumina 90k SNP (single nucleotide polymorphism chips were used to genotype the RILs and their parents. Composite interval mapping (CIM detected eight QTL, namely QYr.caas-2AL, QYr.caas-2BL.3, QYr.caas-3AS, QYr.caas-3BS, QYr.caas-5DL, QYr.caas-6AL, QYr.caas-7AL and QYr.caas-7DS.1, respectively. All except QYr.caas-2BL.3 resistance alleles were contributed by Zhong 892. QYr.caas-3AS and QYr.caas-3BS conferred stable resistance to stripe rust in all environments, explaining 6.2-17.4% and 5.0-11.5% of the phenotypic variances, respectively. The genome scan of SNP sequences tightly linked to QTL for APR against annotated proteins in wheat and related cereals genomes identified two candidate genes (autophagy-related gene and disease resistance gene RGA1, significantly associated with stripe rust resistance. These QTL and their closely linked SNP markers, in combination with kompetitive allele specific PCR (KASP technology, are potentially useful for improving stripe rust resistances in wheat breeding.

  13. An evaluation of the rust fungus Gymnoconia nitensas a potential biological control agent for alien Rubus species in Hawaii

    Science.gov (United States)

    Gardner, D.E.; Hodges, C.S.; Killgore, E.; Anderson, R.C.

    1997-01-01

    The rust fungus Gymnoconia nitens infects blackberry (Rubus argutus) systemically in regions of the continental United States, producing bright yellow–orange masses of spores on newly developing floricanes during springtime. In tests to determine the suitability of this rust as a biological control agent for R. penetransin Hawaii, a species now thought to be conspecific with R. argutus,rooted cuttings of the Hawaiian plants were grown at North Carolina State University, inoculated, and observed. Other introduced weedy Rubus spp. in Hawaii, including R. ellipticus, R. rosifolius, and R. glaucus,as well as the two endemic species R. hawaiensis and R. macraei,also were inoculated. No species of Rubusare of commercial importance in Hawaii, but the protection of the native species, of which R. macraei is rare, was of utmost concern. The native Hawaiian species did not survive well in North Carolina in this study, however. Later availability of a plant pathogen containment laboratory in Hawaii enabled similar tests to be conducted at that facility. In addition to the above species, R. spectabilis (salmonberry), a species native to the Pacific Northwest with which the Hawaiian Rubus spp. are thought to share a common ancestor, was inoculated in Hawaii. Infection with G. nitens under natural field conditions becomes apparent only when sporulation occurs on floricanes the second year following infection. However, experimental inoculation led to early responses of chlorotic leaf flecking and puckering, leaf and stem contortion, and stem gall formation, indicating the sensitivity of R. penetrans (=R. argutus), R. hawaiensis, and R. macraei to this rust. Apparent systemic infection also resulted in sporulation on one plant of R. macraei. Ability to attack the endemic species suggests that G. nitens would not be suitable for release in Hawaii as a biological control agent, at least on the islands with populations of the native species.

  14. QTL mapping of slow-rusting, adult plant resistance to race Ug99 of stem rust fungus in PBW343/Muu RIL population.

    Science.gov (United States)

    Singh, Sukhwinder; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Eugenio, Lopez-Vera Eric

    2013-05-01

    Races of stem rust fungus pose a major threat to wheat production worldwide. We mapped adult plant resistance (APR) to Ug99 in 141 lines of a PBW343/Muu recombinant inbred lines (RILs) population by phenotyping them for three seasons at Njoro, Kenya in field trials and genotyping them with Diversity Arrays Technology (DArT) markers. Moderately susceptible parent PBW343 and APR parent Muu displayed mean stem rust severities of 66.6 and 5 %, respectively. The mean disease severity of RILs ranged from 1 to 100 %, with an average of 23.3 %. Variance components for stem rust severity were highly significant (p stem rust where Sr2 and other minor slow rusting resistance genes can confer a higher level of resistance when present together.

  15. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

    Science.gov (United States)

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

    2016-01-01

    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust

  16. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa

    2016-02-01

    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  17. Kinetics of structural rust transformation in environments containing chloride and SO2

    International Nuclear Information System (INIS)

    Rendon, J. L.; Valencia, A.

    2003-01-01

    The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs

  18. Associated callus culture technique for in vitro growth of rust fungi

    OpenAIRE

    A.A. Kuvalekar; K.R. Gandhe

    2010-01-01

    Uromyces hobsoni, a rust fungus, infects Jasminum officinale var. grandiflorum. The infection frequently leads to malformations in tissues, mainly leaves and stems. Disease progression can be assessed morphologically by observing the extent of malformation and occurrence of sporulation. The rust fungi, in general, are obligate parasites, and need a living host to complete their life cycle. The difficulty of in vitro propagation of rust fungi has been a major obstacle in their detailed bioc...

  19. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene

    OpenAIRE

    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.

    2009-01-01

    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  20. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    McIntosh R. A., Yamazaki Y., Dubcovsky J., Rogers W. J., Mor- ris C. F., Somers D. J. et al. 2008 Catalogue of gene symbols for wheat. Proceedings of the 11th International Wheat Genetics. Symposium. Brisbane, Australia. McIntosh R. A., Yamazaki Y., Rogers W. J., Morris C. F. and. Devos K. M. 2010 Catalogue of gene ...

  1. Modelling coffee leaf rust risk in Colombia with climate reanalysis data

    OpenAIRE

    Bebber, Daniel P.; Castillo, ?ngela Delgado; Gurr, Sarah J.

    2016-01-01

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate rean...

  2. An ecophysiological approach to crop losses exemplified in the system wheat, leaf rust, and glume blotch

    NARCIS (Netherlands)

    Wal, van der A.F.

    1975-01-01

    The motive of the author to embark upon the research reported here was the need to develop new concepts to approach the problem of crop losses, and eventually the problem of their prevention by means of disease control and plant breeding. The introduction of ecophysiology as an approach, explained

  3. Common foliar fungi of Populus trichocarpa modify Melampsora rust disease severity.

    Science.gov (United States)

    Busby, Posy E; Peay, Kabir G; Newcombe, George

    2016-03-01

    Nonpathogenic foliar fungi (i.e. endophytes and epiphytes) can modify plant disease severity in controlled experiments. However, experiments have not been combined with ecological studies in wild plant pathosystems to determine whether disease-modifying fungi are common enough to be ecologically important. We used culture-based methods and DNA sequencing to characterize the abundance and distribution of foliar fungi of Populus trichocarpa in wild populations across its native range (Pacific Northwest, USA). We conducted complementary, manipulative experiments to test how foliar fungi commonly isolated from those populations influence the severity of Melampsora leaf rust disease. Finally, we examined correlative relationships between the abundance of disease-modifying foliar fungi and disease severity in wild trees. A taxonomically and geographically diverse group of common foliar fungi significantly modified disease severity in experiments, either increasing or decreasing disease severity. Spatial patterns in the abundance of some of these foliar fungi were significantly correlated (in predicted directions) with disease severity in wild trees. Our study reveals that disease modification is an ecological function shared by common foliar fungal symbionts of P. trichocarpa. This finding raises new questions about plant disease ecology and plant biodiversity, and has applied potential for disease management. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. Functional analysis of the Asian soybean rust resistance pathway mediated by Rpp2.

    Science.gov (United States)

    Pandey, Ajay K; Yang, Chunling; Zhang, Chunquan; Graham, Michelle A; Horstman, Heidi D; Lee, Yeunsook; Zabotina, Olga A; Hill, John H; Pedley, Kerry F; Whitham, Steven A

    2011-02-01

    Asian soybean rust is an aggressive foliar disease caused by the obligate biotrophic fungus Phakopsora pachyrhizi. On susceptible plants, the pathogen penetrates and colonizes leaf tissue, resulting in the formation of necrotic lesions and the development of numerous uredinia. The soybean Rpp2 gene confers resistance to specific isolates of P. pachyrhizi. Rpp2-mediated resistance limits the growth of the pathogen and is characterized by the formation of reddish-brown lesions and few uredinia. Using virus-induced gene silencing, we screened 140 candidate genes to identify those that play a role in Rpp2 resistance toward P. pachyrhizi. Candidate genes included putative orthologs to known defense-signaling genes, transcription factors, and genes previously found to be upregulated during the Rpp2 resistance response. We identified 11 genes that compromised Rpp2-mediated resistance when silenced, including GmEDS1, GmNPR1, GmPAD4, GmPAL1, five predicted transcription factors, an O-methyl transferase, and a cytochrome P450 monooxygenase. Together, our results provide new insight into the signaling and biochemical pathways required for resistance against P. pachyrhizi.

  5. Structure analysis of cation selective Cr-goethite as protective rust of weathering steel

    International Nuclear Information System (INIS)

    Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi

    2005-01-01

    We have performed extended X-ray absorption fine structure (EXAFS) analysis for artificial Cr-goethite to elucidate the local structure around Cr in Cr-goethite. The spectra were obtained using synchrotron radiation X-rays at the Photon Factory in Tsukuba. The first shell contributions were isolated by Fourier filtering EXAFS data, and the inverse Fourier transformed single-shell data were analyzed using a curve fitting method. The results show that Cr is coordinated with (7±1)O 2- ions. The protective characteristics of the Cr-goethite protective rust layer on weathering steel can be interpreted in terms of the O 2- coordination around Cr 3+ resulting in the creation of negative fixed charge in the Cr-goethite particles. (author)

  6. Inhibitive Performance of a Rust Converter on Corrosion of Mild Steel

    Science.gov (United States)

    Zhao, X. D.; Cheng, Y. F.; Fan, W.; Vladimir, C.; Volha, V.; Alla, T.

    2014-11-01

    In this work, a rust converter consisting of two steps of processing solutions was prepared to convert iron rust of the steel surface into a protective conversion film. The performance of the converter was evaluated in both neutral and acidic solutions by various electrochemical measurements, including potentiodynamic polarization curves and electrochemical impedance spectroscopy, and surface characterization. The effect of temperature was investigated. It was found that the rust converter is able to effectively convert the iron rust into a conversion film, serving as a barrier layer to block corrosive species from reaching the steel surface.

  7. QTL analysis of crown rust resistance in perennial ryegrass under conditions of natural and artificial infection

    DEFF Research Database (Denmark)

    Schejbel, Britt; Jensen, Louise Friis Bach; Xing, Yongzhong

    2007-01-01

    Crown rust is an economically devastating disease of perennial ryegrass. Both artificial crown rust inoculations, with the possibility of several selection cycles in one year, as well as marker-assisted selection can be used for more efficient breeding of new resistant cultivars. The objective...... of this study was to map quantitative trait loci (QTL) for response to crown rust infection in perennial ryegrass. In order to identify relevant markers for response to crown rust infection, QTL mapping was performed on a ryegrass mapping population which was evaluated for resistance in the field for two years...

  8. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea

    OpenAIRE

    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego

    2014-01-01

    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  9. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  10. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  11. An analysis of the risk of introduction of additional strains of the rust puccinia psidii Winter ('Ohi'a Rust) to Hawai'i

    Science.gov (United States)

    Loope, Lloyd; La Rosa, Anne Marie

    2010-01-01

    In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant

  12. 16 CFR 23.10 - Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant...

    Science.gov (United States)

    2010-01-01

    ... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust...,” “rust proof,” or any other term of similar meaning to describe an industry product unless all parts of the product will be immune from rust and other forms of corrosion during the life expectancy of the...

  13. Katome: de novo DNA assembler implemented in rust

    Science.gov (United States)

    Neumann, Łukasz; Nowak, Robert M.; Kuśmirek, Wiktor

    2017-08-01

    Katome is a new de novo sequence assembler written in the Rust programming language, designed with respect to future parallelization of the algorithms, run time and memory usage optimization. The application uses new algorithms for the correct assembly of repetitive sequences. Performance and quality tests were performed on various data, comparing the new application to `dnaasm', `ABySS' and `Velvet' genome assemblers. Quality tests indicate that the new assembler creates more contigs than well-established solutions, but the contigs have better quality with regard to mismatches per 100kbp and indels per 100kbp. Additionally, benchmarks indicate that the Rust-based implementation outperforms `dnaasm', `ABySS' and `Velvet' assemblers, written in C++, in terms of assembly time. Lower memory usage in comparison to `dnaasm' is observed.

  14. What can the programming language Rust do for astrophysics?

    Science.gov (United States)

    Blanco-Cuaresma, Sergi; Bolmont, Emeline

    2017-06-01

    The astrophysics community uses different tools for computational tasks such as complex systems simulations, radiative transfer calculations or big data. Programming languages like Fortran, C or C++ are commonly present in these tools and, generally, the language choice was made based on the need for performance. However, this comes at a cost: safety. For instance, a common source of error is the access to invalid memory regions, which produces random execution behaviors and affects the scientific interpretation of the results. In 2015, Mozilla Research released the first stable version of a new programming language named Rust. Many features make this new language attractive for the scientific community, it is open source and it guarantees memory safety while offering zero-cost abstraction. We explore the advantages and drawbacks of Rust for astrophysics by re-implementing the fundamental parts of Mercury-T, a Fortran code that simulates the dynamical and tidal evolution of multi-planet systems.

  15. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  16. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  17. Magnetic property based characterization of rust on weathering steels

    International Nuclear Information System (INIS)

    Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.

    2005-01-01

    The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39

  18. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  19. Phylogenetic studies in Ravenelia esculenta and related rust fungi.

    Science.gov (United States)

    Gandhe, K R; Kuvalekar, Aniket

    2007-09-01

    Ravenelia esculenta Naras. and Thium. is a rust fungus, which infects mostly thorns, inflorescences, flowers and fruits of Acacia eburnea Willd. Aecial stages of the rust produce hypertrophy in infected parts. DNA of the rust fungus was isolated from aeciospores by 'freeze thaw' method. 18S rDNA was amplified and sequenced by automated DNA sequencer. BLAST of the sequence at NCBI retrieved 96 sequences producing significant alignments. Multiple sequence alignment of these sequences was done by ClustalW. Phylogenetic analysis was done by using MEGA 3.1. UPGMA Minimum Evolution tree with bootstrap value of 1000 replicates was constructed using these sequences. From phylogenetic tree it is observed that Ravenelia esculenta and the genus Gymnosporangium share a common ancestry, though Ravenelia esculenta is autoecious on angiosperm and the genus Gymnosporangium is heteroecious with pycnia, aecia on angiosperm and uredia, telia on gymnosperm. Two major clades are recognized which are based on the nature of aecial host (gymnosperm or angiosperm). These clades were also showing shift from pteridophytes to angiosperms as telial hosts. The tree can be interpreted in the other way also where there is separation of 14 families of Uredinales depending upon nature of teliospores, nature of aeciospores and structure of pycnia. These studies determine the phylogenetic position of Ravenelia esculenta among other rust fungi besides broad separation of Uredinales into two clades. These studies also show that there is phylogenetic correlation between molecular and morphological data. This is first report of DNA sequencing and phylogenetic positioning in genus Ravenelia from India.

  20. Influence of lactate ions on the formation of rust

    International Nuclear Information System (INIS)

    Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.

    2007-01-01

    The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH

  1. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)

  2. Variable Temperature Mössbauer Study of Some Rust Converters

    Science.gov (United States)

    Bolívar, F.; Barrero, C. A.; Minotas, J.; Morales, A. L.; Greneche, J.-M.

    2003-06-01

    The conversion properties of 15 different combinations of rust converters have been studied. The results indicate that the rust layer without conversion is composed of spinel phase, akaganeite, magnetically ordered goethite, and lepidocrocite. On the other hand, besides the mentioned iron oxides and oxyhydroxides, the converted-rust layer consists of iron phosphate and iron tannate. Mössbauer spectrometry has allowed us to classify the degree of conversion of the different formulations according to both the tannic acid content and the mixture of the isopropyl and terbutanol alcohol. It was found that there is a specific mixture of alcohol for each tannic concentration for which the power of conversion is greatly enhanced. It is also concluded that non-stoichiometric spinel phase underwent the greater transformation of about 90%, followed by magnetically blocked goethite, in which 30% of it was transformed. In contrast, akaganeite seems to be not noticeably affected by the converters. It was not possible to assess the effect on lepidocrocite.

  3. Barley Leaf Area and Leaf Growth Rates Are Maximized during the Pre-Anthesis Phase

    Directory of Open Access Journals (Sweden)

    Ahmad M. Alqudah

    2015-04-01

    Full Text Available Leaf developmental traits are an important component of crop breeding in small-grain cereals. Surprisingly, little is known about the genetic basis for the differences in barley (Hordeum vulgare L. leaf development. The two barley row-type classes, i.e., two- and six-rowed, show clear-cut differences in leaf development. To quantify these differences and to measure the genetic component of the phenotypic variance for the leaf developmental differences in both row-type classes we investigated 32 representative spring barley accessions (14 two- and 18 six-rowed accessions under three independent growth conditions. Leaf mass area is lower in plants grown under greenhouse (GH conditions due to fewer, smaller, and lighter leaf blades per main culm compared to pot- and soil-grown field plants. Larger and heavier leaf blades of six-rowed barley correlate with higher main culm spike grain yield, spike dry weight, and harvest index; however, smaller leaf area (LA in two-rowed barley can be attributed to more spikes, tillers, and biological yield (aboveground parts. In general, leaf growth rate was significantly higher between awn primordium and tipping stages. Moderate to very high broad-sense heritabilities (0.67–0.90 were found under all growth conditions, indicating that these traits are predominantly genetically controlled. In addition, our data suggests that GH conditions are suitable for studying leaf developmental traits. Our results also demonstrated that LA impacts single plant yield and can be reconsidered in future breeding programs. Six-rowed spike 1 (Vrs1 is the major determinate of barley row-types, the differences in leaf development between two- and six-rowed barleys may be attributed to the regulation of Vrs1 in these two classes, which needs further testing.

  4. 76 FR 13970 - Notice of Request for Extension of Approval of an Information Collection; Black Stem Rust...

    Science.gov (United States)

    2011-03-15

    ...] Notice of Request for Extension of Approval of an Information Collection; Black Stem Rust; Identification Requirements for Addition of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection Service, USDA... black stem rust quarantine and regulations. DATES: We will consider all comments that we receive on or...

  5. Allele characterization of genes required for rpg4-mediated wheat stem rust resistance identifies Rpg5 as the R gene.

    Science.gov (United States)

    Arora, D; Gross, T; Brueggeman, R

    2013-11-01

    A highly virulent form of the wheat stem rust pathogen Puccinia graminis f. sp. tritici race TTKSK is virulent on both wheat and barley, presenting a major threat to world food security. The recessive and temperature-sensitive rpg4 gene is the only effective source of resistance identified in barley (Hordeum vulgare) against P. graminis f. sp. tritici race TTKSK. Efforts to position clone rpg4 localized resistance to a small interval on barley chromosome 5HL, tightly linked to the rye stem rust (P. graminis f. sp. secalis) resistance (R) gene Rpg5. High-resolution genetic analysis and post-transcriptional gene silencing of the genes at the rpg4/Rpg5 locus determined that three tightly linked genes (Rpg5, HvRga1, and HvAdf3) are required together for rpg4-mediated wheat stem rust resistance. Alleles of the three genes were analyzed from a diverse set of 14 domesticated barley lines (H. vulgare) and 8 wild barley accessions (H. vulgare subsp. spontaneum) to characterize diversity that may determine incompatibility (resistance). The analysis determined that HvAdf3 and HvRga1 code for predicted functional proteins that do not appear to contain polymorphisms determining the compatible (susceptible) interactions with the wheat stem rust pathogen and were expressed at the transcriptional level from both resistant and susceptible barley lines. The HvAdf3 alleles shared 100% amino acid identity among all 22 genotypes examined. The P. graminis f. sp. tritici race QCCJ-susceptible barley lines with HvRga1 alleles containing the limited amino acid substitutions unique to the susceptible varieties also contained predicted nonfunctional rpg5 alleles. Thus, susceptibility in these lines is likely due to the nonfunctional RPG5 proteins. The Rpg5 allele analysis determined that 9 of the 13 P. graminis f. sp. tritici race QCCJ-susceptible barley lines contain alleles that either code for predicted truncated proteins as the result of a single nucleotide substitution, resulting in a

  6. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo

    2017-02-01

    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  7. Fine mapping of the Asian soybean rust resistance gene Rpp2 from soybean PI 230970.

    Science.gov (United States)

    Yu, Neil; Kim, Myungsik; King, Zachary R; Harris, Donna K; Buck, James W; Li, Zenglu; Diers, Brian W

    2015-03-01

    Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance ( R ) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defining the exact chromosomal position of ASR resistance genes is critical for improving the effectiveness of marker-assisted selection (MAS) for resistance and for cloning these genes. The objective of this study was to fine map the ASR resistance gene Rpp2 from the plant introduction (PI) 230970. Rpp2 was previously mapped within a 12.9-cM interval on soybean chromosome 16. The fine mapping was initiated by identifying recombination events in F2 and F3 plants using simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that flank the gene. Seventeen recombinant plants were identified and then tested with additional genetic markers saturating the gene region to localize the positions of each recombination. The progeny of these selected plants were tested for resistance to ASR and with SSR markers resulting in the mapping of Rpp2 to a 188.1 kb interval on the Williams 82 reference genome (Glyma.Wm82.a2). Twelve genes including ten toll/interleukin-1 receptor (TIR)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes were predicted to exist in this interval on the Glyma.Wm82.a2.v1 gene model map. Eight of these ten genes were homologous to the Arabidopsis TIR-NBS-LRR gene AT5G17680.1. The identified SSR and SNP markers close to Rpp2 and the candidate gene information presented in this study will be significant resources for MAS and gene cloning research.

  8. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823.

    Science.gov (United States)

    Childs, Silas P; King, Zachary R; Walker, David R; Harris, Donna K; Pedley, Kerry F; Buck, James W; Boerma, H Roger; Li, Zenglu

    2018-01-01

    A novel Rpp gene from PI 605823 for resistance to Phakopsora pachyrhizi was mapped on chromosome 19. Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & P. Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance conditioned by resistance to P. pachyrhizi (Rpp) genes has been found in numerous soybean accessions, and at least 10 Rpp genes or alleles have been mapped to six genetic loci. Identifying additional disease-resistance genes will facilitate development of soybean cultivars with durable resistance. PI 605823, a plant introduction from Vietnam, was previously identified as resistant to US populations of P. pachyrhizi in greenhouse and field trials. In this study, bulked segregant analysis using an F 2 population derived from 'Williams 82' × PI 605823 identified a genomic region associated with resistance to P. pachyrhizi isolate GA12, which had been collected in the US State of Georgia in 2012. To further map the resistance locus, linkage mapping was carried out using single-nucleotide polymorphism markers and phenotypic data from greenhouse assays with an F 2:3 population derived from Williams 82 × PI 605823 and an F 4:5 population derived from '5601T' × PI 605823. A novel resistance gene, Rpp7, was mapped to a 154-kb interval (Gm19: 39,462,291-39,616,643 Glyma.Wm82.a2) on chromosome 19 that is different from the genomic locations of any previously reported Rpp genes. This new gene could be incorporated into elite breeding lines to help provide more durable resistance to soybean rust.

  9. Can microscale meteorological conditions predict the impact of white pine blister rust in Colorado and Wyoming?

    Science.gov (United States)

    William R. Jacobi; Betsy A. Goodrich; Holly S. J. Kearns; Kelly S. Burns; Brian W. Geils

    2011-01-01

    White pine blister rust occurs when there are compatible interactions between susceptible hosts (white pines and Ribes spp.), inoculum (Cronartium ribicola spores), and local weather conditions during infection. The five spore stages of the white pine blister rust (WPBR) fungus have specific temperature and moisture conditions necessary for production, germination, and...

  10. Real-time PCR detection of Puccinia chrysanthemi causing brown rust of chrysanthemum

    Science.gov (United States)

    Fungi responsible for rust diseases are among the most challenging organisms to identify, as many identification keys are based on host identity. In the U.S., numerous rust fungi are quarantine-significant plant pathogens. As such, accurate identification is crucial to prevent the inadvertent introd...

  11. Preliminary evaluation of daylily cultivars for rust resistance in a landscaping setting

    Science.gov (United States)

    A large, established landscape collection of 575 newer cultivars was evaluated for daylily rust which had not been sprayed with fungicides to prevent infection during 2013. The warm, damp summer of 2013 was ideal for spread of daylily rust. A total of 119 of the 575 cultivars received a median ratin...

  12. Responding to the soybean rust epidemic in sub-Saharan Africa: A ...

    African Journals Online (AJOL)

    Soybean rust (Phakopsora pachyrhizi Sydow), a major threat to soybean production, is a new pathogen on the African continent, where it is increasingly threatening soybean production. The fungus is highly variable, and this complicates most disease management strategies. Most research on soybean rust, ...

  13. Differential response by Melaleuca quinquenervia trees to attack by the rust fungus Puccinia psidii in Florida

    Science.gov (United States)

    Melaleuca quinquenervia (melaleuca, paperbark tree) is an exotic invasive tree in Florida, Hawaii, and some Caribbean islands. Puccinia psidii (guava rust-fungus) is a Neotropical rust fungus, reported to attack many species in the Myrtaceae and one genus in the Heteropyxidaceae, both members of the...

  14. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Directory of Open Access Journals (Sweden)

    Maria Carlota eVaz Patto

    2014-11-01

    Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.

  15. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    Aug 6, 2013 ... to rust race CYR26. The gene YrSD in Strube Dickkopf resistant to stripe rust CYR26 using SSR method was located on chromosome 5B. There are four pairs (Wmc640,. Barc59, Wmc783 and Wms497) polymorphic SSR primers on chromosome 5B which produced polymorphic DNA bands between the ...

  16. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    This suggests the presence of nonhypersensitive adult plant stripe rust resistance in the line CSP44. The evaluation of F1, F2 and F3 generations and F6 SSD families from the cross of CSP44 with susceptible wheat cultivar WL711 for stripe rust severity indicated that the resistance in CSP44 is based on two genes showing ...

  17. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)

    Unknown

    Wheat line CSP44, a selection from an Australian bread wheat cultivar Condor, has shown resistance to stripe rust in. India since the last twenty years. Seedlings and adult plants of CSP44 showed susceptible infection types against stripe rust race 46S119 but displayed average terminal disease severity of 2.67 on adult ...

  18. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  19. A new rust disease on wild coffee (Psychotria nervosa) caused by Puccinia mysuruensis sp. nov

    Science.gov (United States)

    Psychotria nervosa, commonly called wild coffee (Rubiaceae) is an important ethno-medicinal plant in India. In 2010 a new rust disease of P. nervosa was observed in three regions of Mysore District, Karnataka (India) with disease incidence ranging from 58% to 63%. Typical symptoms of rust disease we...

  20. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  1. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  2. MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS

    Science.gov (United States)

    Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...

  3. White pine blister rust resistance in limber pine: Evidence for a major gene

    Science.gov (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

    2014-01-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  4. Current and future molecular approaches to investigate the white pine blister rust pathosystem

    Science.gov (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein

    2010-01-01

    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  5. Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.

    Science.gov (United States)

    Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping

    2017-01-01

    While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P  rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P  rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.

  6. Resistance to white pine blister rust in Pinus flexilis and P

    Science.gov (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns

    2010-01-01

    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  7. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  8. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  9. Blister rust in North America: What we have not learned in the past 100 years

    Science.gov (United States)

    Eugene P. Van Arsdel; Brian W. Geils

    2011-01-01

    Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...

  10. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    Abstract: Bread wheat (Triticum aestivum L.) cultivars often succumb to yellow rust (Puccinia striiformis f.sp. tritici Westend.) soon after their release for commercial production, especially in the highlands of south-eastern Ethiopia. Variety diversification may buffer the ever evolving new races of the yellow rust pathogen.

  11. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  12. Effect of orange rust on sugarcane breeding program at canal Point

    Science.gov (United States)

    Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...

  13. Biology and pathology of Ribes and their implications for management of white pine blister rust

    Science.gov (United States)

    P. J. Zambino

    2010-01-01

    Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...

  14. CHEMICAL INTERACTIONS OF ARSENATE, ARSENITE, PHOSPHATE, AND SILICATE WITH IRON (II, III) HYDROXYCARBONATE GREEN RUST

    Science.gov (United States)

    Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...

  15. Long-term changes in fusiform rust incidence in the southeastern United States

    Science.gov (United States)

    KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey

    2015-01-01

    Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...

  16. Rust urine after intense hand drumming is caused by extracorpuscular hemolysis.

    Science.gov (United States)

    Tobal, Diego; Olascoaga, Alicia; Moreira, Gabriela; Kurdián, Melania; Sanchez, Fernanda; Roselló, Maria; Alallón, Walter; Martinez, Francisco Gonzalez; Noboa, Oscar

    2008-07-01

    During Carnival, groups of > or =60 drummers go drumming with their hands and marching for periods of 2 to 4 h. The objective of this study was to determine the frequency and type of urinary abnormalities after candombe drumming and to evaluate possible pathogenic mechanisms. For analysis of pathogenic mechanisms, a group of individuals were prospectively evaluated before and after candombe drumming. Candombe drummers were recruited in January 2006, 1 wk before prolonged drumming. After clinical evaluation, urine and blood samples were obtained before and immediately after drumming. Forty-five healthy individuals (four women and 41 men), median age 31 yr (14 to 56), were evaluated. Predrumming urine and plasma samples were obtained for 30 individuals. Nineteen (42%) of 45 had a previous history of rust urine emission temporally related with candombe drumming. After drumming, 18 of 26 showed urine abnormalities; six of 26 showed rust urine, eight of 26 had microhematuria, and seven of 26 had proteinuria >1 g/L. The candombe drummers who showed rust urine after heavy drumming presented significantly higher levels of lactate dehydrogenase and total bilirubin when compared with those without urine abnormalities. Haptoglobin was significantly lower in the rust urine group. Fragmented red cells were observed in the blood smear of individuals with rust urine. Rust urine after drumming was associated with previous episodes of rust urine and glucosuria. Taken together, these data confirm that rust urine is caused by extracorpuscular hemolysis.

  17. Screening conventional fungicides...control of blister rust on sugar pine in California

    Science.gov (United States)

    Clarence R. Quick

    1967-01-01

    After 5 years, 4 of 14 fungicides tested showed varying pr of development into satisfactory direct control of blister rust. Little promise of systemic control was found. Trees treated were second-growth sugar pine in a mixed conifer forest in eastern Shasta County, California, where blister rust has been intensifying for many years. Most trees received basal-stem...

  18. Identification of unique genetic sources of soybean rust resistance from the USDA germplasm collection

    Science.gov (United States)

    Soybean rust (SBR) is caused by the fungal pathogen Phakopsora pachyrhizi. Thus far, six rust resistance loci (Rpp1, 2, 3, 4, 5, and 6) have been reported. On the basis of field and greenhouse phenotyping assays between 2006 and 2011, we identified 75 SBR-resistant plant introductions (PIs). Crosses...

  19. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M

    2015-04-01

    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  20. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala

    2017-10-01

    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  1. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates.

    Science.gov (United States)

    Nirmala, Jayaveeramuthu; Saini, Jyoti; Newcomb, Maria; Olivera, Pablo; Gale, Sam; Klindworth, Daryl; Elias, Elias; Talbert, Luther; Chao, Shiaoman; Faris, Justin; Xu, Steven; Jin, Yue; Rouse, Matthew N

    2017-10-05

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13 , additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24 However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1 , to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558 , cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13 The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b . Copyright © 2017 Nirmala et al.

  2. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...

  3. Associated callus culture technique for in vitro growth of rust fungi

    Directory of Open Access Journals (Sweden)

    A.A. Kuvalekar

    2010-08-01

    Full Text Available Uromyces hobsoni, a rust fungus, infects Jasminum officinale var. grandiflorum. The infection frequently leads to malformations in tissues, mainly leaves and stems. Disease progression can be assessed morphologically by observing the extent of malformation and occurrence of sporulation. The rust fungi, in general, are obligate parasites, and need a living host to complete their life cycle. The difficulty of in vitro propagation of rust fungi has been a major obstacle in their detailed biochemical and molecular analysis. In this paper, we report successful in vitro culture of rust fungi with induction of callus from infected leaves of host plants which contain initial differentiated structures like haustoria and intercellular hyphae. This ‘associated callus culture’ technique has opened new paths for studying host-pathogen interactions of rust fungi.

  4. Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere

    International Nuclear Information System (INIS)

    Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.

    2008-01-01

    The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere

  5. Mechanical properties of the rust layer induced by impressed current method in reinforced mortar

    International Nuclear Information System (INIS)

    Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.

    2008-01-01

    This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer

  6. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  7. Seagrass leaf element content

    NARCIS (Netherlands)

    Vonk, J.A.; Smulders, Fee O.H.; Christianen, Marjolijn J.A.; Govers, Laura L.

    2017-01-01

    Knowledge on the role of seagrass leaf elements and in particular micronutrients and their ranges is limited. We present a global database, consisting of 1126 unique leaf values for ten elements, obtained from literature and unpublished data, spanning 25 different seagrass species from 28 countries.

  8. Leaf Size in Swietenia

    Science.gov (United States)

    Charles B. Briscoe; F. Bruce. Lamb

    1962-01-01

    A study was made of the putative hybrid of bigleaf and small-leaf mahoganies. Initial measurements indicated that bigleaf mahogany can be distinguished from small-leaf mahogany by gross measurements of leaflets. Isolated mother trees yield typical progeny. Typical mother trees in mixed stands yield like progeny plus, usually, mediumleaf progeny. Mediumleaf mother trees...

  9. Correlation between RUST assessments of fracture healing to structural and biomechanical properties.

    Science.gov (United States)

    Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul

    2018-03-01

    Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  10. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S

    2009-01-01

    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... to the warm temperature regime for all variables. Based on these results and previously published models for stripe rust epidemics, recent severe stripe rust epidemics were most likely enhanced by the pathogen's increased aggressiveness, especially at higher temperature. Furthermore, these results demonstrate...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments...

  11. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition.

    Science.gov (United States)

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi

    2015-04-01

    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  12. Agronomic, leaf anatomy, morphology, endophyte presence and ploidy characterization of accessions of Festuca group rubra collected in northern Spain

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, J. A.; Gutierrez-Villarias, M. I.; Fernandez-Casado, M. A.; Costal-Andrade, L.; Gonzalez-Arraez, E.; Bughrara, S. S.; Afif, E.

    2008-07-01

    Fifteen accessions of Facet's group rubra collected in northern Spain were characterized and grouped into four Festuca taxa on the basis of leaf anatomy, morphology and ploidy; seven were identified as F. heteromalla; two as F. trichophylla ssp. asperifolia; two as F. nigrescens ssp. microphylla and four as F. rubra ssp. pruinosa. All the accessions and one commercial cultivar Wilma (F. nigrescens ssp. nigrescens), used as control, were established at the Mabegondo Agronomical Research Centre, A Coruna (Galicia) in a completely randomised block design with three replicates of 10 plants per accession. The plants were agronomically characterized for seven traits during 2004 and 2005. Cluster analysis was useful in identifying four clusters that described 66.5% of the phenotypic variation. Cluster 1 consisted of nine accessions with early heading, intermediate values of green colour and tolerance to crown rust in autumn and the highest seasonal growth. Cluster 2 contained two accessions with intermediate values of heading, green colour, good tolerance to crown rust in autumn and intermediate seasonal growth. Cluster 3 contained two accessions and the cultivar Wilma, which showed early heading, dark green colour, good tolerance to crown rust in autumn and spring and intermediate seasonal growth. Cluster 4 consisted of two late heading accessions with dark green colour, and the best tolerance to crown rust in autumn and intermediate seasonal growth. Thirteen of the 15 accessions (86.6%) were infected by fungal endophytes, with the degree of infection ranging from 2 to 73%. Additional key words: endophyte, fine fescues, genetic resources, hierarchical clustering, leaf sections, multivariate analysis, turf grass. (Author) 33 refs.

  13. Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust

    Directory of Open Access Journals (Sweden)

    Rosa Laura Andrade Melchor

    Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.

  14. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm.

    Science.gov (United States)

    Mago, R; Bariana, H S; Dundas, I S; Spielmeyer, W; Lawrence, G J; Pryor, A J; Ellis, J G

    2005-08-01

    The use of major resistance genes is the most cost-effective strategy for preventing stem rust epidemics in Australian wheat crops. The long-term success of this strategy is dependent on combining resistance genes that are effective against all predominant races of the pathogen, a task greatly assisted by the use of molecular markers linked to individual resistance genes. The wheat stem rust resistance genes Sr24 and Sr26 (derived from Agropyron elongatum) and SrR and Sr31 (derived from rye) are available in wheat as segments of alien chromosome translocated to wheat chromosomes. Each of these genes provides resistance to all races of wheat stem rust currently found in Australia . We have developed robust PCR markers for Sr24 and Sr26 (this study) and SrR and Sr31 (previously reported) that are applicable across a wide selection of Australian wheat germplasm. Wheat lines have recently become available in which the size of the alien segments containing Sr26, SrR and Sr31 has been reduced. Newly developed PCR-markers can be used to identify the presence of the shorter alien segment in all cases. Assuming that these genes have different gene-for-gene specificities and that the wheat industry will discourage the use of varieties carrying single genes only, the newly developed PCR markers will facilitate the incorporation of two or more of the genes Sr24, Sr26, SrR and Sr31 into wheat lines and have the potential to provide durable control to stem rust in Australia and elsewhere.

  15. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.

    2010-01-01

    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  16. Gene expression analysis in soybean in response to the causal agent of Asian soybean rust (Phakopsora pachyrhizi Sydow) in an early growth stage.

    Science.gov (United States)

    Panthee, D R; Yuan, J S; Wright, D L; Marois, J J; Mailhot, D; Stewart, C N

    2007-10-01

    Asian soybean rust (ASR) caused by Phakopsora pachyrhizi Sydow is a potentially devastating disease posing a serious threat to the soybean industry. Understanding plant host response at the molecular level is certainly important for control of the disease. The main objective of this study was to perform a transcriptome profiling of P. pachyrhizi-exposed young soybean plants (V2 growth stage) using whole genome Affymetrix microarrays of soybean. Three-week-old soybean cv. 5601 T plants at the V2 growth stage were inoculated with P. pachyrhizi, and leaf samples were collected 72 h post inoculation with subsequent microarray analysis performed. A total of 112 genes were found to be differentially expressed from P. pachyrhizi exposure, of which 46 were upregulated, and 66 were downregulated. Most of the differentially expressed genes were general defense and stress-related genes, and 34 of these were unknown. Confirmational real-time reverse transcription-polymerase chain reaction was performed on a subset of 5 out of 112 differentially expressed genes. These results were congruent with the microarray analysis. Our results indicated that low and nonspecific innate response to the pathogen may account for the failure to develop rust resistance in the soybean variety studied. To our knowledge, this is the first microarray analysis of soybean in response to ASR.

  17. SNP assay to detect the ‘Hyuuga’ red-brown lesion resistance gene for Asian soybean rust

    Science.gov (United States)

    Ha, Bo-Keun; Phillips, Daniel V.; Boerma, H. Roger

    2010-01-01

    Asian soybean rust (ASR), caused by Phakopsora pachyrhizi Syd., has the potential to become a serious threat to soybean, Glycine max L. Merr., production in the USA. A novel rust resistance gene, Rpp?(Hyuuga), from the Japanese soybean cultivar Hyuuga has been identified and mapped to soybean chromosome 6 (Gm06). Our objectives were to fine-map the Rpp?(Hyuuga) gene and develop a high-throughput single nucleotide polymorphism (SNP) assay to detect this ASR resistance gene. The integration of recombination events from two different soybean populations and the ASR reaction data indicates that the Rpp?(Hyuuga) locus is located in a region of approximately 371 kb between STS70887 and STS70923 on chromosome Gm06. A set of 32 ancestral genotypes which is predicted to contain 95% of the alleles present in current elite North American breeding populations and the sources of the previously reported ASR resistance genes (Rpp1, Rpp2, Rpp3, Rpp4, Rpp5, and rpp5) were genotyped with five SNP markers. We developed a SimpleProbe assay based on melting curve analysis for SNP06-44058 which is tighly linked to the Rpp?(Hyuuga) gene. This SNP assay can differentiate plants/lines that are homozygous/homogeneous or heterozygous/heterogeneous for the resistant and susceptible alleles at the Rpp?(Hyuuga) locus. PMID:20532750

  18. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati

    2016-04-01

    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  19. Genetic dissection of fusiform rust and pitch canker disease traits in loblolly pine.

    Science.gov (United States)

    Kayihan, Gogce C; Huber, Dudley A; Morse, Alison M; White, Timothy L; Davis, John M

    2005-03-01

    Loblolly pine (Pinus taeda L.) exhibits genetic resistance to fusiform rust disease (incited by the biotrophic fungus, Cronartium quercuum f. sp. fusiforme) and pitch canker disease (incited by the necrotrophic fungus, Fusarium circinatum). In this study, a total of 14,015 loblolly pine cuttings from 1,065 clones were screened in controlled greenhouse conditions to identify phenotypes of clones, families, and parents that guide a genetic dissection of disease traits associated with pitch canker and fusiform rust. A total of 23,373 phenotypic data points were collected for lesion length (pitch canker) and gall score, gall length, and gall width (fusiform rust). We verified heritable fusiform rust and pitch canker traits and calculated parental, clonal, and full-sib family rankings for both diseases. Genetic correlations revealed that traits associated with fusiform rust are genetically distinct from one another, and that the genetic mechanisms underlying pitch canker and fusiform rust resistance are independent. The disease phenotyping described here is a critical step towards identifying specific loci and alleles associated with fusiform rust and pitch canker resistance.

  20. Creation and validation of a simulator for corneal rust ring removal.

    Science.gov (United States)

    Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie

    2017-10-01

    To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

  1. Characterization of Brachypodium distachyon as a nonhost model against switchgrass rust pathogen Puccinia emaculata.

    Science.gov (United States)

    Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S

    2015-05-08

    Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.

  2. Efficacy Of Selected Plant Extracts Against Bean Rust Disease ...

    African Journals Online (AJOL)

    In vivo evaluation of the efficacy of selected plant extracts; Neem (Azadirachta indica A. Juss) derivatives (Neem oil, Neem cake powder and Neem leaf powder) and leaf extracts of pawpaw (Carica papaya L), Tephrosia vogelii, stinging Nettle (Urtica massaica L), Tobacco (Nicotiana tabacum L.) and commercial fungicide: ...

  3. Is leaf dry matter content a better predictor of soil fertility than specific leaf area?

    Science.gov (United States)

    Hodgson, J G; Montserrat-Martí, G; Charles, M; Jones, G; Wilson, P; Shipley, B; Sharafi, M; Cerabolini, B E L; Cornelissen, J H C; Band, S R; Bogard, A; Castro-Díez, P; Guerrero-Campo, J; Palmer, C; Pérez-Rontomé, M C; Carter, G; Hynd, A; Romo-Díez, A; de Torres Espuny, L; Royo Pla, F

    2011-11-01

    Specific leaf area (SLA), a key element of the 'worldwide leaf economics spectrum', is the preferred 'soft' plant trait for assessing soil fertility. SLA is a function of leaf dry matter content (LDMC) and leaf thickness (LT). The first, LDMC, defines leaf construction costs and can be used instead of SLA. However, LT identifies shade at its lowest extreme and succulence at its highest, and is not related to soil fertility. Why then is SLA more frequently used as a predictor of soil fertility than LDMC? SLA, LDMC and LT were measured and leaf density (LD) estimated for almost 2000 species, and the capacity of LD to predict LDMC was examined, as was the relative contribution of LDMC and LT to the expression of SLA. Subsequently, the relationships between SLA, LDMC and LT with respect to soil fertility and shade were described. Although LD is strongly related to LDMC, and LDMC and LT each contribute equally to the expression of SLA, the exact relationships differ between ecological groupings. LDMC predicts leaf nitrogen content and soil fertility but, because LT primarily varies with light intensity, SLA increases in response to both increased shade and increased fertility. Gradients of soil fertility are frequently also gradients of biomass accumulation with reduced irradiance lower in the canopy. Therefore, SLA, which includes both fertility and shade components, may often discriminate better between communities or treatments than LDMC. However, LDMC should always be the preferred trait for assessing gradients of soil fertility uncoupled from shade. Nevertheless, because leaves multitask, individual leaf traits do not necessarily exhibit exact functional equivalence between species. In consequence, rather than using a single stand-alone predictor, multivariate analyses using several leaf traits is recommended.

  4. Genetics and mapping of the R₁₁ gene conferring resistance to recently emerged rust races, tightly linked to male fertility restoration, in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Seiler, G J; Vick, B A; Gulya, T J

    2012-09-01

    Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9

  5. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology.

    Directory of Open Access Journals (Sweden)

    Feng Qin

    Full Text Available Common leaf spot (caused by Pseudopeziza medicaginis, rust (caused by Uromyces striatus, Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana and Cercospora leaf spot (caused by Cercospora medicaginis are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis. After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection, disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features was the optimal model. For this SVM model, the

  6. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology

    Science.gov (United States)

    Qin, Feng; Liu, Dongxia; Sun, Bingda; Ruan, Liu; Ma, Zhanhong; Wang, Haiguang

    2016-01-01

    Common leaf spot (caused by Pseudopeziza medicaginis), rust (caused by Uromyces striatus), Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana) and Cercospora leaf spot (caused by Cercospora medicaginis) are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering) and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis). After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection), disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM) and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features) was the optimal model. For this SVM model, the

  7. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http...

  8. The effect of nitrogen application on the development of rusts on wheat varieties

    Directory of Open Access Journals (Sweden)

    M. E. Haggag

    2014-11-01

    Full Text Available The effect of four different levels of nitrogen fertilization on the severity of rusts on three local Egyptian wheat varieties have been investigated. Nitrogen fertilizer was at the rates 0, 40, 60, and 80 kg nitrogen per feddan. Data obtained indicated that resistance of the varieties did not change while percent severity of postules on susceptible, moderately susceptible and moderately resistant varieties was increased as the level of nitrogen fertilization increased. Heavy doses of nitrogen promoted the size and frequency of postules and hence the rust growth and predisposed the plants to higher infection with rusts.

  9. Effect of black (stem rust (Puccinia Graminis F.SP. Tritici attack to the spike characteristics in Polish wheat (Triticum Polonicum L.

    Directory of Open Access Journals (Sweden)

    H. Stoyanov

    2015-03-01

    Full Text Available Abstract. The obtaining of high yields of crops is directly dependent on the cultivated varieties. In their creation it is essential the selected initial breeding material to possess certain qualities that lead to overcoming the effects of biotic and abiotic stress factors. Common winter wheat is characterized by great diversity of possibilities for combining initial breeding material due to phylogenetic similarity to many species of the genera Triticum, Aegilops, Secale. In creation of synthetic hexaploids (2n = 6x = 42, AABBDD, the choice of tetraploid component involved into the crosses is very important. The species Triticum polonicum (2n = 4x = 28, AABB possesses many valuable features related to its protein content, resistance to brown rust, powdery mildew and septoria leaf blight, but it is susceptible to varying levels of black rust attack. This is a prerequisite a correlation between the attack of the pathogen and some spike indicators that correlate with grain yield to be searched. To determine the relationship between the attack and the specific parameters, 52 accessions of the species Triticum polonicum have been studied in the financial 2012/2013 year, to the following indicators: length of spike, length of spike with awns, number of spikelets, weight of spike, weight of grains per spike, number of grains per spike, weight of 1000 grains, weight of spike after threshing. An evaluation of the infectious type of black rust attack on each accession is recorded according to 9-point scale, and correlation with the average values of each of the spike indicators is reported. To neutralize the influence of the factor 'accession' two specific indexes are calculated as a corrected value of the weight of 1000 grains. The highest and significant correlation was observed between the infectious type and both specific index (-43.2% and -44.6%, and less with the weight of 1000 grains (-41.9%. Insignificant or unreliable is the correlation of the

  10. Reliability of the radiographic union scale in tibial fractures (RUST

    Directory of Open Access Journals (Sweden)

    Fernando Antonio Silva de Azevedo Filho

    Full Text Available ABSTRACT OBJECTIVE: This study aimed to evaluate the inter- and intra observer reproducibility of the radiographic score of consolidation of the tibia shaft fractures. METHODS: Fifty-one sets of radiographs in anteroposterior (AP and profile (P of the tibial shaft treated with intramedullary nail were obtained. The analysis of X-rays was performed in two stages, with a 21-day interval between assessments by a group of nine evaluators. To evaluate the reproducibility of RUST score between the evaluators, the intra-class correlation coefficient (ICC with a 95% confidence interval was used. ICC values range from +1, representing perfect agreement, to -1, complete disagreement. RESULTS: There was a significant correlation among all evaluators: ICC = 0.87 (95% CI 0.81 to 0.91. The intraobserver agreement proved to be substantial with ICC = 0.88 (95% CI 0.85 to 0.91 . CONCLUSION: This study confirms that the RUST scale shows a high degree of reliability and agreement.

  11. Protein modeling of yellow rust disease in wheat

    International Nuclear Information System (INIS)

    Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.

    2017-01-01

    Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)

  12. Induced mutations for tolerance of oats to crown rust

    International Nuclear Information System (INIS)

    Simons, M.D.; Frey, K.J.

    1977-01-01

    Seeds of three oat (Avena sativa and A. abyssinica) strains were treated with ethyl methanesulphonate (EMS), and crown rust (caused by Puccinia coronata var. avenae) tolerance ratios of M 5 -derived lines were compared with untreated checks. Tolerance ratios of mutant lines tended to be distributed in both plus and minus directions. No mutant oat line had a significant increase in grain yield, but many showed significantly depressed yields. With C.I. 6665, only five of 130 mutagen-derived lines were not significantly below the check for grain yield; one of these had significantly improved tolerance. Re-treatment of selected strains from a previous EMS treatment (original cultivar was Clintland-60) gave one M 5 -derived oat line (of 100 tested) that was equal to Clintland-60 in grain yield and sustained no damage from crown rust (i.e. it had a tolerance ratio of 100). EMS treatment of the highly susceptible tetraploid C.I. 2110 resulted in both significantly increased and reduced tolerance. (author)

  13. Strategies for Wheat Stripe Rust Pathogenicity Identified by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Diana P Garnica

    Full Text Available Stripe rust caused by the fungus Puccinia striiformis f.sp. tritici (Pst is a major constraint to wheat production worldwide. The molecular events that underlie Pst pathogenicity are largely unknown. Like all rusts, Pst creates a specialized cellular structure within host cells called the haustorium to obtain nutrients from wheat, and to secrete pathogenicity factors called effector proteins. We purified Pst haustoria and used next-generation sequencing platforms to assemble the haustorial transcriptome as well as the transcriptome of germinated spores. 12,282 transcripts were assembled from 454-pyrosequencing data and used as reference for digital gene expression analysis to compare the germinated uredinospores and haustoria transcriptomes based on Illumina RNAseq data. More than 400 genes encoding secreted proteins which constitute candidate effectors were identified from the haustorial transcriptome, with two thirds of these up-regulated in this tissue compared to germinated spores. RT-PCR analysis confirmed the expression patterns of 94 effector candidates. The analysis also revealed that spores rely mainly on stored energy reserves for growth and development, while haustoria take up host nutrients for massive energy production for biosynthetic pathways and the ultimate production of spores. Together, these studies substantially increase our knowledge of potential Pst effectors and provide new insights into the pathogenic strategies of this important organism.

  14. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103.

    Science.gov (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming

    2018-04-25

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  15. Automated Leaf Tracking using Multi-view Image Sequences of Maize Plants for Leaf-growth Monitoring

    Science.gov (United States)

    Das Choudhury, S.; Awada, T.; Samal, A.; Stoerger, V.; Bashyam, S.

    2017-12-01

    Extraction of phenotypes with botanical importance by analyzing plant image sequences has the desirable advantages of non-destructive temporal phenotypic measurements of a large number of plants with little or no manual intervention in a relatively short period of time. The health of a plant is best interpreted by the emergence timing and temporal growth of individual leaves. For automated leaf growth monitoring, it is essential to track each leaf throughout the life cycle of the plant. Plants are constantly changing organisms with increasing complexity in architecture due to variations in self-occlusions and phyllotaxy, i.e., arrangements of leaves around the stem. The leaf cross-overs pose challenges to accurately track each leaf using single view image sequence. Thus, we introduce a novel automated leaf tracking algorithm using a graph theoretic approach by multi-view image sequence analysis based on the determination of leaf-tips and leaf-junctions in the 3D space. The basis of the leaf tracking algorithm is: the leaves emerge using bottom-up approach in the case of a maize plant, and the direction of leaf emergence strictly alternates in terms of direction. The algorithm involves labeling of the individual parts of a plant, i.e., leaves and stem, following graphical representation of the plant skeleton, i.e., one-pixel wide connected line obtained from the binary image. The length of the leaf is measured by the number of pixels in the leaf skeleton. To evaluate the performance of the algorithm, a benchmark dataset is indispensable. Thus, we publicly release University of Nebraska-Lincoln Component Plant Phenotyping dataset-2 (UNL-CPPD-2) consisting of images of the 20 maize plants captured by visible light camera of the Lemnatec Scanalyzer 3D high throughout plant phenotyping facility once daily for 60 days from 10 different views. The dataset is aimed to facilitate the development and evaluation of leaf tracking algorithms and their uniform comparisons.

  16. A dynamic, web-based resource to identify rust fungi (Pucciniales in southern Africa

    Directory of Open Access Journals (Sweden)

    Alistair R. McTaggart

    2017-09-01

    Full Text Available Rust fungi (Pucciniales are some of the most important plant pathogens that cause diseases of agricultural and tree crops. There are approximately 8,000 described species worldwide. The rust fungi of South Africa were extensively studied by Ethel M. Doidge (1887 – 1965, who listed 468 species. Many nomenclatural and taxonomic changes, together with the discovery of new species and incursions of exotic species, have subsequently outdated Doidge’s monograph. To address this problem, we have developed an interactive Lucid key for the identification of 50 species of rust fungi in 17 genera from countries in southern Africa. The key is dynamic and may be updated in real-time. The Lucid key provides a platform to progressively provide descriptions and images for all rust fungi in southern Africa. Plant pathologists and mycologists are invited to participate in the development of this resource.

  17. Evolution of Akaganeite in Rust Layers Formed on Steel Submitted to Wet/Dry Cyclic Tests

    Directory of Open Access Journals (Sweden)

    Haigang Xiao

    2017-11-01

    Full Text Available The evolution of akaganeite in rust layers strongly impacts the atmospheric corrosion behavior of steel during long-term exposure; however, the factors affecting the evolution of akaganeite and its mechanism of formation are vague. In this work, wet-dry cyclic corrosion tests were conducted to simulate long-term exposure. Quantitative X-ray diffraction analysis was employed to analyze variations in the relative amounts of akaganeite; scanning electron microscopy and electron probe microanalysis were used to study the migration of relevant elements in the rust layer, which could help elucidate the mechanism of akaganeite evolution. The results indicate that the fraction of akaganeite tends to decrease as the corrosion process proceeded, which is a result of the decrease in the amount of soluble chloride available and the ability of the thick rust layer to block the migration of relevant ions. This work also explores the location of akaganeite formation within the rust layer.

  18. REVIEW - Advances on molecular studies of the interaction soybean - Asian rust

    Directory of Open Access Journals (Sweden)

    Aguida Maria Alves Pereira Morales

    2012-01-01

    Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions

  19. Hyperfine interactions and structures of ferrous hydroxide and green rust II in sulfated aqueous media

    International Nuclear Information System (INIS)

    Olowe, A.A.; Genin, J.M.R.; Bauer, P.

    1988-01-01

    A sulfated ferrous hydroxide is obtained by mixing NaOH with melanterite depending on the R = [SO 4 -- ]/[OH - ] ratio and leading by oxidation to the green rust II transient compound. Hyperfine parameters are presented. (orig.)

  20. Nanostructure of protective rust layer on weathering steel examined using synchrotron radiation x-rays

    International Nuclear Information System (INIS)

    Yamashita, Masato; Uchida, Hitoshi; Konishi, Hiroyuki; Mizuki, Jun'ichiro

    2004-01-01

    The X-ray absorption fine structure (XAFS) spectrum of pure goethite around the Fe K absorption edge and that of the protective rust layer formed on weathering steel exposed for 17 years in an atmospheric environment around the Cr K edge, have been examined using synchrotron radiation X-rays. It was found that the rust layer on the weathering steel mainly consisted of Cr-goethite. By examining the fine structure at the Cr K edge and the Fe K edge, we concluded that Cr 3+ in the rust layer is coordinated with O 2- and is positioned in the double chains of vacant sites in the network of FeO 3 (OH) 3 octahedra in the goethite crystal. This Cr 3+ site indicates that the protective effect of the rust layer is due to the dense aggregation of fine crystals of Cr-goethite with cation selectivity. (author)