WorldWideScience

Sample records for single intranasal immunization

  1. Tailorable Trimethyl chitosans as adjuvant for intranasal immunization

    NARCIS (Netherlands)

    Verheul, R.J.

    2010-01-01

    Tailorable Trimethyl Chitosans as Adjuvant for Intranasal Immunization Active vaccination has proven to be the most (cost) effective tool in the fight against infectious diseases. Nowadays, most vaccines are administered via parenteral injection. However, the risk of contaminated needles and need

  2. Influenza virus vaccine live intranasal--MedImmune vaccines: CAIV-T, influenza vaccine live intranasal.

    Science.gov (United States)

    2003-01-01

    submitting a licence application in Europe, a $US27.5 million payment for approval of a refrigerator-stable liquid formulation of FluMist and as much as $US50 million for licensing of FluMist internationally. In July 2003 MedImmune announced that it had received approximately $US28 million in milestone payments during Q2 of 2003 for the approval of FluMist. CSL Ltd of Australia will collaborate on the development, sale and distribution of MedImmune Vaccine's vaccine in Australia, New Zealand and certain countries in the South Pacific. MedImmune is to acquire vaccine research programmes in respiratory syncytial virus and cytomegalovirus from MedImmune Vaccines. The company's primary interest is in FluMist. In May 2002, MedImmune licensed exclusive rights to Crucell's proprietary human cell line PER.C6 for use in its influenza vaccine programmes. On 11 March 2002, American Home Products changed its name and the names of its subsidiaries Wyeth-Ayerst and Wyeth-Lederle to Wyeth. Wyeth's vaccines division is called Wyeth Vaccines. On 29 September 2000, Aviron announced that it had been awarded a $US2.7 million Challenge Grant from NIAID for development of vaccines against pandemic strains of influenza based on FluMist intranasal technology. The cold-adapted live influenza vaccine has been widely evaluated in the US and Japan since 1975 in clinical trials involving several thousand people. Aviron completed phase II clinical trials in adults in the US and phase III trials in US children aged 15-71 months. Additional phase III trials in adults and the elderly are ongoing. Aviron also commenced phase III trials to test the safety of its intranasal live vaccine in children with moderate to severe asthma. The vaccine is delivered using the AccuSpray nasal delivery system by Becton Dickinson, which will supply the system for FluMist through the 2001-2002 influenza season under an agreement with Aviron made in August 1998. On 7 March 2000, Aviron announced that Wyeth-Lederle Vaccines

  3. Intranasal immunization with LACK-DNA promotes protective immunity in hamsters challenged with Leishmania chagasi.

    Science.gov (United States)

    DE Oliveira Gomes, Daniel Claudio; DA Silva Costa Souza, Beatriz Lilian; DE Matos Guedes, Herbert Leonel; Lopes, Ulisses Gazos; Rossi-Bergmann, Bartira

    2011-12-01

    LACK (Leishmania analogue of the receptor kinase C) is a conserved protein in protozoans of the genus Leishmania which is associated with the immunopathogenesis and susceptibility of BALB/c mice to L. major infection. Previously, we demonstrated that intranasal immunization with a plasmid carrying the LACK gene of Leishmania infantum (LACK-DNA) promotes protective immunity in BALB/c mice against Leishmania amazonensis and Leishmania chagasi. In the present study, we investigated the protective immunity achieved in hamsters intranasally vaccinated with 2 doses of LACK-DNA (30 μg). Compared with controls (PBS and pCI-neo plasmid), animals vaccinated with LACK-DNA showed significant reduction in parasite loads in the spleen and liver, increased lymphoproliferative response and increased nitric oxide (NO) production by parasite antigen-stimulated splenocytes. Furthermore, hamsters vaccinated with LACK-DNA presented high IgG and IgG2a serum levels when compared to control animals. Our results showed that intranasal vaccination with LACK-DNA promotes protective immune responses in hamsters and demonstrated the broad spectrum of intranasal LACK-DNA efficacy in different host species, confirming previous results in murine cutaneous and visceral leishmaniasis.

  4. Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice

    Directory of Open Access Journals (Sweden)

    Thomas Katelyn

    2006-06-01

    Full Text Available Abstract Background Immunotherapy for Alzheimer's disease (AD is emerging as a potential treatment. However, a clinical trial (AN1792 was halted after adverse effects occurred in a small subset of subjects, which may have been caused by a T cell-mediated immunological response. In general, aging limits the humoral immune response, therefore, immunogens and vaccination regimes are required that induce a strong antibody response with less potential for an adverse immune response. Method In the current study, we immunized both wildtype and J20 APP-tg mice with a priming injection of Aβ1–40/42, followed by multiple intranasal boosts with the novel immunogen dAβ1–15 (16 copies of Aβ1–15 on a lysine tree, Aβ1–15 peptide or Aβ1–40/42 full length peptide. Results J20 APP-tg mice primed with Aβ1–40/42 subcutaneously and subsequently boosted intranasally with Aβ1–15 peptide did not generate a cellular or humoral immune response. In contrast, J20 APP-tg mice boosted intranasally with dAβ1–15 or full length Aβ1–40/42 produced high levels of anti-Aβ antibodies. Splenocyte proliferation was minimal in mice immunized with dAβ1–15. Wildtype littermates of the J20 APP-tg mice produced higher amounts of anti-Aβ antibodies compared to APP-tg mice but also had low T cell proliferation. The anti-Aβ antibodies were mainly composed of IgG2b and directed to an epitope within the Aβ1–7 region, regardless of the immunogen. Examination of the brain showed a significant reduction in Aβ plaque burden in the J20 APP-tg mice producing antibodies compared to controls. Biochemically, Aβ40 or Aβ42 were also reduced in brain homogenates and elevated in plasma but the changes did not reach significance. Conclusion Our results demonstrate that priming with full length Aβ40/42 followed by boosting with dAβ1–15 but not Aβ1–15 peptide led to a robust humoral immune response with a minimal T cell response in J20 APP-tg mice. In addition, A

  5. Local Th17/IgA immunity correlate with protection against intranasal infection with Streptococcus pyogenes.

    Directory of Open Access Journals (Sweden)

    Rasmus Mortensen

    Full Text Available Streptococcus pyogenes (group A streptococcus, GAS is responsible for a wide array of infections. Respiratory transmission via droplets is the most common mode of transmission but it may also infect the host via other routes such as lesions in the skin. To advance the development of a future vaccine against GAS, it is therefore important to investigate how protective immunity is related to the route of vaccine administration. To explore this, we examined whether a parenterally administered anti-GAS vaccine could protect against an intranasal GAS infection or if this would require locally primed immunity. We foundd that a parenteral CAF01 adjuvanted GAS vaccine offered no protection against intranasal infection despite inducing strong systemic Th1/Th17/IgG immunity that efficiently protected against an intraperitoneal GAS infection. However, the same vaccine administered via the intranasal route was able to induce protection against repeated intranasal GAS infections in a murine challenge model. The lack of intranasal protection induced by the parenteral vaccine correlated with a reduced mucosal recall response at the site of infection. Taken together, our results demonstrate that locally primed immunity is important for the defense against intranasal infection with Streptococcus pyogenes.

  6. Local Th17/IgA immunity correlate with protection against intranasal infection with Streptococcus pyogenes.

    Science.gov (United States)

    Mortensen, Rasmus; Christensen, Dennis; Hansen, Lasse Bøllehuus; Christensen, Jan Pravsgaard; Andersen, Peter; Dietrich, Jes

    2017-01-01

    Streptococcus pyogenes (group A streptococcus, GAS) is responsible for a wide array of infections. Respiratory transmission via droplets is the most common mode of transmission but it may also infect the host via other routes such as lesions in the skin. To advance the development of a future vaccine against GAS, it is therefore important to investigate how protective immunity is related to the route of vaccine administration. To explore this, we examined whether a parenterally administered anti-GAS vaccine could protect against an intranasal GAS infection or if this would require locally primed immunity. We foundd that a parenteral CAF01 adjuvanted GAS vaccine offered no protection against intranasal infection despite inducing strong systemic Th1/Th17/IgG immunity that efficiently protected against an intraperitoneal GAS infection. However, the same vaccine administered via the intranasal route was able to induce protection against repeated intranasal GAS infections in a murine challenge model. The lack of intranasal protection induced by the parenteral vaccine correlated with a reduced mucosal recall response at the site of infection. Taken together, our results demonstrate that locally primed immunity is important for the defense against intranasal infection with Streptococcus pyogenes.

  7. [Comparison of immune response after oral and intranasal immunization with recombinant Lactobacillus casei expressing ETEC F41].

    Science.gov (United States)

    Liu, Jiankui; Wei, Chunhua; Hou, Xilin; Wang, Guihua; Yu, Liyun

    2009-04-01

    In order to represent a promising strategy for mucosal vaccination, oral or intranasal immunization of Specific Pathogen Free (SPF) BALB/c mice were performed. The mucosal immunity, systemic immune and protective immune responses were compared after immunization with the recombinant Lactobacillus casei (L. casei) harboring enterotoxigenic Escherichia coli (ETEC) F41. The recombinant fusion proteins were detected by Western blot. Surface localization of the fusion protein was verified by immunofluorescence microscopy and flow cytometry. Six-week-old female SPF BALB/c mice (160 heads) were divided into 4 groups for immunization and control. Oral and intranasal immunization of mice was performed with the recombinant strain L. casei harboring pLA-F41 or pLA. For oral immunization, the mice were inoculated daily on days 0 to 4, 7 to 11, 21 to 25, and 49 to 53. A lighter schedule was used for nasal immunization (days 0 to 2, 7 to 9, 21 and 49). Specific anti-F41 IgG antibody in the serum and specific anti-F41 secret immunoglobulin A (sIgA) antibody in the lung, intestines, vagina fluid and feces of mice were detected by indirect ELISA. The mice orally or intranasally immunized with pLA-F41/L. casei and pLA/IL. casei were challenged with standard-type ETEC F41 (C83919) (2 x 10(3) LD50). Mice immunized with pLA-F41/L. casei could produce remarkable anti-F41 antibody level. More than 90% survived in oral immunization group whereas more than 85% survived in intranasal immunization group after challenged with C83919, all dead in the control group. Ninety percent of the pups survived in oral immunization group whereas 80% survived in intranasal immunization group after challenged with C83919, but only a 5% survival rate for pups that were either immunized with a control pLA vector or unimmunized. Oral or intranasal immunization with recombinant L. casei displaying ETEC F41 antigens on the surface induced effective and similar systemic and mucosal immune responses against the

  8. Engineering intranasal mRNA vaccines to enhance lymph node trafficking and immune responses.

    Science.gov (United States)

    Li, Man; Li, You; Peng, Ke; Wang, Ying; Gong, Tao; Zhang, Zhirong; He, Qin; Sun, Xun

    2017-12-01

    Intranasal mRNA vaccination provides immediate immune protection against pandemic diseases. Recent studies have shown that diverse forms of polyethyleneimine (PEI) have potent mucosal adjuvant activity, which could significantly facilitate the delivery of intranasal mRNA vaccines. Nevertheless, optimizing the chemical structure of PEI to maximize its adjuvanticity and decrease its toxicity remains a challenge. Here we show that the chemical structure of PEI strongly influences how well nanocomplexes of PEI and mRNA migrate to the lymph nodes and elicit immune responses. Conjugating cyclodextrin (CD) with PEI600 or PEI2k yielded CP (CD-PEI) polymers with different CD/PEI ratios. We analyzed the delivery efficacy of CP600, CP2k, and PEI25k as intranasal mRNA vaccine carriers by evaluating the lymph nodes migration and immune responses. Among these polymers, CP2k/mRNA showed significantly higher in vitro transfection efficiency, stronger abilities to migrate to lymph nodes and stimulate dendritic cells maturation in vivo, which further led to potent humoral and cellular immune responses, and showed lower local and systemic toxicity than PEI25k/mRNA. These results demonstrate the potential of CD-PEI2k/mRNA nanocomplex as a self-adjuvanting vaccine delivery vehicle that traffics to lymph nodes with high efficiency. As we face outbreaks of pandemic diseases such as Zika virus, intranasal mRNA vaccination provides instant massive protection against highly variant viruses. Various polymer-based delivery systems have been successfully applied in intranasal vaccine delivery. However, the influence of molecular structure of the polymeric carriers on the lymph node trafficking and dendritic cell maturation is seldom studied for intranasal vaccination. Therefore, engineering polymer-based vaccine delivery system and elucidating the relationship between molecular structure and the intranasal delivery efficiency are essential for maximizing the immune responses. We hereby

  9. Local Th17/IgA immunity correlate with protection against intranasal infection with Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Mortensen, Rasmus; Christensen, Dennis; Hansen, Lasse Bøllehuus

    2017-01-01

    Streptococcus pyogenes (group A streptococcus, GAS) is responsible for a wide array of infections. Respiratory transmission via droplets is the most common mode of transmission but it may also infect the host via other routes such as lesions in the skin. To advance the development of a future...... that locally primed immunity is important for the defense against intranasal infection with Streptococcus pyogenes....

  10. Intramuscular delivery of adenovirus serotype 5 vector expressing humanized protective antigen induces rapid protection against anthrax that may bypass intranasally originated preexisting adenovirus immunity.

    Science.gov (United States)

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie; Hou, Lihua; Chen, Wei

    2014-02-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 10⁸ infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD₅₀) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax.

  11. Intranasal Immunization of Mice to Avoid Interference of Maternal Antibody against H5N1 Infection.

    Directory of Open Access Journals (Sweden)

    Fenghua Zhang

    Full Text Available Maternally-derived antibodies (MDAs can protect offspring against influenza virus infection but may also inhibit active immune responses. To overcome MDA- mediated inhibition, active immunization of offspring with an inactivated H5N1 whole-virion vaccine under the influence of MDAs was explored in mice. Female mice were vaccinated twice via the intraperitoneal (IP or intranasal (IN route with the vaccine prior to mating. One week after birth, the offspring were immunized twice via the IP or IN route with the same vaccine and then challenged with a lethal dose of a highly homologous virus strain. The results showed that, no matter which immunization route (IP or IN was used for mothers, the presence of MDAs severely interfered with the active immune response of the offspring when the offspring were immunized via the IP route. Only via the IN immunization route did the offspring overcome the MDA interference. These results suggest that intranasal immunization could be a suitable inoculation route for offspring to overcome MDA interference in the defense against highly pathogenic H5N1 virus infection. This study may provide references for human and animal vaccination to overcome MDA-induced inhibition.

  12. PPS nanoparticles as versatile delivery system to induce systemic and broad mucosal immunity after intranasal administration.

    Science.gov (United States)

    Stano, Armando; van der Vlies, André J; Martino, Mikael M; Swartz, Melody A; Hubbell, Jeffrey A; Simeoni, Eleonora

    2011-01-17

    Degradable polymer nanoparticles (NPs, 50 nm) based on polypropylene sulfide (PPS) were conjugated to thiolated antigen and adjuvant proteins by reversible disulfide bonds and evaluated in mucosal vaccination. Ovalbumin was used as a model antigen, and antigen-conjugated NPs were administered intranasally in the mouse. We show penetration of nasal mucosae, transit via M cells, and uptake by antigen-presenting cells in the nasal-associated lymphoid tissue. Ovalbumin-conjugated NPs induced cytotoxic T lymphocytic responses in lung and spleen tissues, as well as humoral response in mucosal airways. Co-conjugation of the TLR5 ligand flagellin further enhanced humoral responses in the airways as well as in the distant vaginal and rectal mucosal compartments and induced cellular immune responses with a Th1 bias, in contrast with free flagellin. The PPS NP platform thus appears interesting as a platform for intranasally-administered mucosal vaccination for inducing broad mucosal immunity. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. Intranasal immunization with novel EspA-Tir-M fusion protein induces protective immunity against enterohemorrhagic Escherichia coli O157:H7 challenge in mice.

    Science.gov (United States)

    Lin, Ruqin; Zhu, Bo; Zhang, Yiduo; Bai, Yang; Zhi, Fachao; Long, Beiguo; Li, Yawen; Wu, Yuhua; Wu, Xianbo; Fan, Hongying

    2017-04-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Due to the risks associated with antibiotic treatment against EHEC O157:H7 infection, vaccines represent a promising method for prevention of EHEC O157:H7 infection. Therefore, we constructed the novel bivalent antigen EspA-Tir-M as a candidate EHEC O157:H7 subunit vaccine. We then evaluated the immunogenicity of this novel EHEC O157:H7 subunit vaccine. Immune responses to the fusion protein administered by intranasal and subcutaneous routes were compared in mice. Results showed higher levels of specific mucosal and systemic antibody responses induced by intranasal as compared to subcutaneous immunization. Intranasal immunization enhanced the concentration of interleukin-4, interleukin-10, and interferon-γ, while subcutaneous immunization enhanced only the latter two. In addition, intranasal immunization protected against EHEC O157:H7 colonization and infection in mice at a rate of 90%.Histopathological analysis revealed that vaccination reduced colon damage, especially when administered intranasally. In contrast, subcutaneous immunization elicited a weak immune response and exhibited a low protection rate. These findings demonstrate that intranasal immunization with the fusion protein induces both humoral and cellular immune (Th1/Th2) responses in mice. The novel EspA-Tir-M novel fusion protein therefore represents a promising subunit vaccine against EHEC O157:H7 infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Preparation of ESAT-6 Nanoparticles and Evaluation of Humoral Immunity after Intranasal Administration

    Directory of Open Access Journals (Sweden)

    H Najminezhad

    2013-01-01

    Full Text Available Introduction: Among several tuberculosis vaccine candidates for replacement of BCG, ESAT-6 protein has a special role. Since mycobacterium tuberculosis infection most often attacks the lungs, intranasal rout can be regarded as appropriate methods for tuberculosis vaccines and drug delivery. One of the appropriate systems for intranasal vaccine delivery is using biodegradable nanoparticles. Among biodegradable polymers, chitosan polymer has great features to increase the response of immunity system. This study aimed to investigate the specific humoral immune response of mice model after encapsulation of recombinant ESAT-6 antigen in chitosan nanoparticles. Methods: The chitosan nanoparticles containing ESAT-6 antigen were synthesized by ionic gelation. Nanoparticle properties including morphology, particle size, zeta potential, encapsulation rates, and protein release were measured in vitro. The immunization was performed through the nose for 3 times on days 0 and 14 and 28. 2 weeks after last administration, blood samples were collected and specific IgG titers were measured by indirect ELISA. Results: The nanoparticles synthesized had appropriate properties. The mean size of resulting nanoparticles was 242.8 nm by excellent antigen loading capacity (95.23 %. The vitro release of antigen from nanoparticles after 200 hours was detected as 67.5%. The Level of IgG antibody showed significant increase in the group that had received chitosan nanoparticles containing ESAT-6 compared with other groups. Conclusion: ESAT-6 protein was encapsulated in chitosan nanoparticles successfully. Administration of chitosan nanoparticles can be a suitable method for administration of humoral immunity antigens of Mycobacterium tuberculosis through intranasal rout.

  15. Intranasal immunization with influenza VLPs incorporating membrane-anchored flagellin induces strong heterosubtypic protection.

    Directory of Open Access Journals (Sweden)

    Bao-Zhong Wang

    2010-11-01

    Full Text Available We demonstrated previously that the incorporation of a membrane-anchored form of flagellin into influenza virus-like particles (VLPs improved the immunogenicity of VLPs significantly, inducing partially protective heterosubtypic immunity by intramuscular immunization. Because the efficacy of mucosal vaccination is highly dependent on an adjuvant, and is particularly effective for preventing mucosal infections such as influenza, we determined whether the membrane-anchored flagellin is an efficient adjuvant for VLP vaccines by a mucosal immunization route. We compared the adjuvant effect of membrane-anchored and soluble flagellins for immunization with influenza A/PR8 (H1N1 VLPs by the intranasal route in a mouse model. The results demonstrate that membrane-anchored flagellin is an effective adjuvant for intranasal (IN immunization, inducing enhanced systemic and mucosal antibody responses. High cellular responses were also observed as shown by cytokine production in splenocyte cultures when stimulated with viral antigens. All mice immunized with flagellin-containing VLPs survived challenge with a high lethal dose of homologous virus as well as a high dose heterosubtypic virus challenge (40 LD(50 of A/Philippines/82, H3N2. In contrast, no protection was observed with a standard HA/M1 VLP group upon heterosubtypic challenge. Soluble flagellin exhibited a moderate adjuvant effect when co-administered with VLPs by the mucosal route, as indicated by enhanced systemic and mucosal responses and partial heterosubtypic protection. The membrane-anchored form of flagellin incorporated together with antigen into influenza VLPs is effective as an adjuvant by the mucosal route and unlike standard VLPs, immunization with such chimeric VLPs elicits protective immunity to challenge with a distantly related influenza A virus.

  16. Intranasal vaccination promotes detrimental Th17-mediated immunity against influenza infection.

    Directory of Open Access Journals (Sweden)

    Asher Maroof

    2014-01-01

    Full Text Available Influenza disease is a global health issue that causes significant morbidity and mortality through seasonal epidemics. Currently, inactivated influenza virus vaccines given intramuscularly or live attenuated influenza virus vaccines administered intranasally are the only approved options for vaccination against influenza virus in humans. We evaluated the efficacy of a synthetic toll-like receptor 4 agonist CRX-601 as an adjuvant for enhancing vaccine-induced protection against influenza infection. Intranasal administration of CRX-601 adjuvant combined with detergent split-influenza antigen (A/Uruguay/716/2007 (H3N2 generated strong local and systemic immunity against co-administered influenza antigens while exhibiting high efficacy against two heterotypic influenza challenges. Intranasal vaccination with CRX-601 adjuvanted vaccines promoted antigen-specific IgG and IgA antibody responses and the generation of polyfunctional antigen-specific Th17 cells (CD4(+IL-17A(+TNFα(+. Following challenge with influenza virus, vaccinated mice transiently exhibited increased weight loss and morbidity during early stages of disease but eventually controlled infection. This disease exacerbation following influenza infection in vaccinated mice was dependent on both the route of vaccination and the addition of the adjuvant. Neutralization of IL-17A confirmed a detrimental role for this cytokine during influenza infection. The expansion of vaccine-primed Th17 cells during influenza infection was also accompanied by an augmented lung neutrophilic response, which was partially responsible for mediating the increased morbidity. This discovery is of significance in the field of vaccinology, as it highlights the importance of both route of vaccination and adjuvant selection in vaccine development.

  17. Immune Responses of Dairy Cattle to Parainfluenza-3 Virus in Intranasal Infectious Bovine Rhinotracheitis-Parainfluenza-3 Virus Vaccines

    OpenAIRE

    Burroughs, A.L.; Morrill, J.L.; Bostwick, J.L.; Ridley, R.K.; Fryer, H.C.

    1982-01-01

    Two hundred and fifty dairy heifers were vaccinated at three to six months of age with an intranasal infectious bovine rhinotracheitis-parainfluenza-3 vaccine. Eighteen additional heifers were tested prior to vaccination and again three to four weeks after vaccination. Neither cell-mediated nor humoral immunity was significantly raised to parainfluenza-3 virus in either group of cattle.

  18. Intramuscular Priming and Intranasal Boosting Induce Strong Genital Immunity Through Secretory IgA in Minipigs Infected with Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Lorenzen, Emma; Follmann, Frank; Bøje, Sarah

    2015-01-01

    International efforts in developing a vaccine against Chlamydia trachomatis have highlighted the need for novel immunization strategies for the induction of genital immunity. In this study, we evaluated an intramuscular (IM) prime/intranasal boost vaccination strategy in a Göttingen Minipig model...... with a reproductive system very similar to humans. The vaccine was composed of C. trachomatis subunit antigens formulated in the Th1/Th17 promoting CAF01 adjuvant. IM priming immunizations with CAF01 induced a significant cell-mediated interferon gamma and interleukin 17A response and a significant systemic high......-titered neutralizing IgG response. Following genital challenge, intranasally boosted groups mounted an accelerated, highly significant genital IgA response that correlated with enhanced bacterial clearance on day 3 post infection. By detecting antigen-specific secretory component (SC), we showed that the genital Ig...

  19. Vaccination with Toxoplasma lysate antigen and CpG oligodeoxynucleotides: comparison of immune responses in intranasal versus intramuscular administrations.

    Science.gov (United States)

    EL-Malky, Mohamed A; Al-Harthi, Saeed A; Mohamed, Raafat T; EL Bali, Mohamed A; Saudy, Niveen S

    2014-06-01

    Toxoplasma gondii (T. gondii) is one of the most successful intracellular protozoan parasites on earth and highly prevalent in most warm-blooded vertebrates. There are no drugs that target the chronic cyst stage of this infection; therefore, development of an effective vaccine would be an important advance in disease control. Oligodeoxynucleotides (ODN) which contain immunostimulatory CG motifs (CpG ODN) can promote T-helper 1 (Th1) responses, an adjuvant activity that is desirable for vaccination against intracellular pathogen. In this study, we compare the immune responses of Toxoplasma susceptible C57BL/6 mice following intranasal and intramuscular vaccination with Toxoplasma lysate antigen (TLA) with or without CpG ODN as adjuvant. Immunized and control non-immunized mice were challenged with 85 cyst of the moderately virulent Beverley strain of T. gondii. Intranasal vaccination gave significantly a higher protection compared to other groups as indicated by prolonged survival and significantly reduced brain cyst burden (P intramuscular vaccination enhanced humoral immunity towards a type Th1 pattern characterized by a significant increase of specific IgG and Ig2a. Our results suggest that intranasal administration of CpG/TLA would provide a stable, pronounced, and effective vaccine against toxoplasmosis through stimulation of Th1 cellular immunity and mucosal IgA.

  20. Intranasal immunization with a formalin-inactivated human influenza A virus whole-virion vaccine alone and intranasal immunization with a split-virion vaccine with mucosal adjuvants show similar levels of cross-protection.

    Science.gov (United States)

    Okamoto, Shigefumi; Matsuoka, Sumiko; Takenaka, Nobuyuki; Haredy, Ahmad M; Tanimoto, Takeshi; Gomi, Yasuyuki; Ishikawa, Toyokazu; Akagi, Takami; Akashi, Mitsuru; Okuno, Yoshinobu; Mori, Yasuko; Yamanishi, Koichi

    2012-07-01

    The antigenicity of seasonal human influenza virus changes continuously; thus, a cross-protective influenza vaccine design needs to be established. Intranasal immunization with an influenza split-virion (SV) vaccine and a mucosal adjuvant induces cross-protection; however, no mucosal adjuvant has been assessed clinically. Formalin-inactivated intact human and avian viruses alone (without adjuvant) induce cross-protection against the highly pathogenic H5N1 avian influenza virus. However, it is unknown whether seasonal human influenza formalin-inactivated whole-virion (WV) vaccine alone induces cross-protection against strains within a subtype or in a different subtype of human influenza virus. Furthermore, there are few reports comparing the cross-protective efficacy of the WV vaccine and SV vaccine-mucosal adjuvant mixtures. Here, we found that the intranasal human influenza WV vaccine alone induced both the innate immune response and acquired immune response, resulting in cross-protection against drift variants within a subtype of human influenza virus. The cross-protective efficacy conferred by the WV vaccine in intranasally immunized mice was almost the same as that conferred by a mixture of SV vaccine and adjuvants. The level of cross-protective efficacy was correlated with the cross-reactive neutralizing antibody titer in the nasal wash and bronchoalveolar fluids. However, neither the SV vaccine with adjuvant nor the WV vaccine induced cross-reactive virus-specific cytotoxic T-lymphocyte activity. These results suggest that the intranasal human WV vaccine injection alone is effective against variants within a virus subtype, mainly through a humoral immune response, and that the cross-protection elicited by the WV vaccine and the SV vaccine plus mucosal adjuvants is similar.

  1. Intranasal Immunization with Pressure Inactivated Avian Influenza Elicits Cellular and Humoral Responses in Mice.

    Directory of Open Access Journals (Sweden)

    Shana P C Barroso

    Full Text Available Influenza viruses pose a serious global health threat, particularly in light of newly emerging strains, such as the avian influenza H5N1 and H7N9 viruses. Vaccination remains the primary method for preventing acquiring influenza or for avoiding developing serious complications related to the disease. Vaccinations based on inactivated split virus vaccines or on chemically inactivated whole virus have some important drawbacks, including changes in the immunogenic properties of the virus. To induce a greater mucosal immune response, intranasally administered vaccines are highly desired as they not only prevent disease but can also block the infection at its primary site. To avoid these drawbacks, hydrostatic pressure has been used as a potential method for viral inactivation and vaccine production. In this study, we show that hydrostatic pressure inactivates the avian influenza A H3N8 virus, while still maintaining hemagglutinin and neuraminidase functionalities. Challenged vaccinated animals showed no disease signs (ruffled fur, lethargy, weight loss, and huddling. Similarly, these animals showed less Evans Blue dye leakage and lower cell counts in their bronchoalveolar lavage fluid compared with the challenged non-vaccinated group. We found that the whole inactivated particles were capable of generating a neutralizing antibody response in serum, and IgA was also found in nasal mucosa and feces. After the vaccination and challenge we observed Th1/Th2 cytokine secretion with a prevalence of IFN-γ. Our data indicate that the animals present a satisfactory immune response after vaccination and are protected against infection. Our results may pave the way for the development of a novel pressure-based vaccine against influenza virus.

  2. Protective effect of intranasal immunization with Neospora caninum membrane antigens against murine neosporosis established through the gastrointestinal tract.

    Science.gov (United States)

    Ferreirinha, Pedro; Dias, Joana; Correia, Alexandra; Pérez-Cabezas, Begoña; Santos, Carlos; Teixeira, Luzia; Ribeiro, Adília; Rocha, António; Vilanova, Manuel

    2014-02-01

    Neospora caninum is an Apicomplexa parasite that in the last two decades was acknowledged as the main pathogenic agent responsible for economic losses in the cattle industry. In the present study, the effectiveness of intranasal immunization with N. caninum membrane antigens plus CpG adjuvant was assessed in a murine model of intragastrically established neosporosis. Immunized mice presented a lower parasitic burden in the brain on infection with 5 × 10(7) tachyzoites, showing that significant protection was achieved by this immunization strategy. Intestinal IgA antibodies raised by immunization markedly agglutinated live N. caninum tachyzoites whereas previous opsonization with IgG antibodies purified from immunized mice sera reduced parasite survival within macrophage cells. Although an IgG1 : IgG2a ratio neosporosis and indicate that parasite-specific mucosal and circulating antibodies have a protective role against this parasitic infection. © 2013 John Wiley & Sons Ltd.

  3. Effects of single dose intranasal oxytocin on social cognition in schizophrenia.

    Science.gov (United States)

    Davis, Michael C; Lee, Junghee; Horan, William P; Clarke, Angelika D; McGee, Mark R; Green, Michael F; Marder, Stephen R

    2013-07-01

    Deficits in social cognition are common in schizophrenia and predict poor community functioning. Given the current limitations of psychosocial treatments and the lack of pharmacological treatments for social cognitive deficits, the development of novel therapeutic agents could greatly enhance functional recovery in schizophrenia. This study evaluated whether a single dose of intranasal oxytocin acutely improves social cognitive functioning in schizophrenia. Twenty-three male veterans with schizophrenia completed baseline assessments of social cognition that were divided into lower-level (facial affect perception, social perception, detection of lies) and higher-level (detection of sarcasm and deception, empathy) processes. One week later, patients received the same battery after being randomized to a single dose of 40 IU intranasal oxytocin or placebo. Though the groups did not differ significantly on the social cognition composite score, oxytocin improved performance for the higher-level social cognitive tasks (Cohen's d=1.0, p=0.045). Subjects were unable to accurately guess which treatment they had received. The improvements found in higher-level social cognition encourage further studies into the therapeutic potential of oxytocin in schizophrenia. Published by Elsevier B.V.

  4. Protective effect of intranasal immunization with Neospora caninum membrane antigens against murine neosporosis established through the gastrointestinal tract

    Science.gov (United States)

    Ferreirinha, Pedro; Dias, Joana; Correia, Alexandra; Pérez-Cabezas, Begoña; Santos, Carlos; Teixeira, Luzia; Ribeiro, Adília; Rocha, António; Vilanova, Manuel

    2014-01-01

    Neospora caninum is an Apicomplexa parasite that in the last two decades was acknowledged as the main pathogenic agent responsible for economic losses in the cattle industry. In the present study, the effectiveness of intranasal immunization with N. caninum membrane antigens plus CpG adjuvant was assessed in a murine model of intragastrically established neosporosis. Immunized mice presented a lower parasitic burden in the brain on infection with 5 × 107 tachyzoites, showing that significant protection was achieved by this immunization strategy. Intestinal IgA antibodies raised by immunization markedly agglutinated live N. caninum tachyzoites whereas previous opsonization with IgG antibodies purified from immunized mice sera reduced parasite survival within macrophage cells. Although an IgG1 : IgG2a ratio < 1 was detected in the immunized mice before and after infection, indicative of a predominant T helper type 1 immune response, no increased production of interferon-γ was detected in the spleen or mesenteric lymph nodes of the immunized mice. Altogether, these results show that mucosal immunization with N. caninum membrane proteins plus CpG adjuvant protect against intragastrically established neosporosis and indicate that parasite-specific mucosal and circulating antibodies have a protective role against this parasitic infection. PMID:24128071

  5. Cross-protection conferred by immunization with an rOmpH-based intranasal fowl cholera vaccine.

    Science.gov (United States)

    Varinrak, Thanya; Poolperm, Pichayanut; Sawada, Takuo; Sthitmatee, Nattawooti

    2017-10-01

    A previous study demonstrated that a recombinant outer membrane protein H (rOmpH)-based intranasal fowl cholera vaccine elicited efficient homologous protection against the Pasteurella multocida strain X-73 (A:1) in chickens. The present study aimed to determine the cross-protectivity against heterologous P. multocida strains. The rOmpH was purified via electroelution and formulated with two kinds of adjuvants. The vaccine formulations in a total volume of 100 µl were 100 µg rOmpH with 3 µg of Escherichia coli enterotoxin B or 10 µg of CpG ODN2007. Chickens were assigned to three experimental groups depending on bacterial strain challenge exposure as well as three control groups. The chickens were immunized intranasally three times at three-week intervals. Challenge exposures were conducted by inoculation with homologous strain X-73 or heterologous strains P-1059 (A:3) or P-1662 (A:4) at four weeks after the final immunization. The specific antibody against rOmpH was produced in vaccinated birds. Sera IgY and secretory IgA antibody titres were significantly increased (P < 0.05) post-immunization. The stimulation index values of the vaccinated groups were significantly different from stimulation index values of the non-vaccinated groups (P < 0.05). Chicken survival rates after exposure to avian P. multocida strains ranged from 70% to 100%. There was no significant difference in protection between two kinds of adjuvants in vaccine formulations. Statistical analysis indicated no significant differences in protection among avian P. multocida strains challenge exposure. We conclude that an in-house rOmpH-based intranasal fowl cholera vaccine produced efficient cross-protectivity against heterologous strains of P. multocida.

  6. Intranasal immunization of the combined lipooligosaccharide conjugates protects mice from the challenges with three serotypes of Moraxella catarrhalis.

    Directory of Open Access Journals (Sweden)

    Dabin Ren

    Full Text Available There are no licensed vaccines available against Moraxella catarrhalis, a significant human respiratory pathogen. Lipooligosaccharide (LOS based conjugate vaccines derived from individual serotype M. catarrhalis only showed partial protection coverage. A vaccine combining LOS conjugates of two or three serotypes might provide a broader protection.Mice were immunized intranasally with the combined conjugates consisting of LOS from serotype A and B or serotype A, B, and C followed by challenge with different M. catarrhalis strains of three serotypes. Mouse lungs, nasal washes, and sera were collected after each challenge for bacterial counts, histological evaluation, cytokine profiles, antibody level and binding activity determinations.Intranasal administration of the combined LOS conjugates not only enhanced pulmonary bacterial clearance of all three serotypes of M. catarrhalis strains in vaccinated mice, but also elevated serotype-specific anti-LOS immunoglobulin (IgA and IgG titers in nasal wash and serum respectively. Mice vaccinated with the combined LOS conjugates also showed increased interferon (IFN-γ, interleukin (IL-12, and IL-4 in the lungs after challenges. Compared to the control group, mice immunized with the combined LOS conjugates also showed reduced lung inflammation after M. catarrhalis infections. The hyperimmune sera induced by the combined conjugates exhibited a broad cross-reactivity toward all three serotypes of M. catarrhalis under transmission electron microscopy.The combined vaccine of serotype A and B LOS conjugates provides protection against most M. catarrhalis strains by eliciting humoral and cellular immune responses.

  7. Plasmid DNA Vaccine Co-Immunisation Modulates Cellular and Humoral Immune Responses Induced by Intranasal Inoculation in Mice.

    Directory of Open Access Journals (Sweden)

    Deborah F L King

    Full Text Available An effective HIV vaccine will likely require induction of both mucosal and systemic cellular and humoral immune responses. We investigated whether intramuscular (IM delivery of electroporated plasmid DNA vaccine and simultaneous protein vaccinations by intranasal (IN and IM routes could be combined to induce mucosal and systemic cellular and humoral immune responses to a model HIV-1 CN54 gp140 antigen in mice.Co-immunisation of DNA with intranasal protein successfully elicited both serum and vaginal IgG and IgA responses, whereas DNA and IM protein co-delivery did not induce systemic or mucosal IgA responses. Cellular IFNγ responses were preserved in co-immunisation protocols compared to protein-only vaccination groups. The addition of DNA to IN protein vaccination reduced the strong Th2 bias observed with IN protein vaccination alone. Luminex analysis also revealed that co-immunisation with DNA and IN protein induced expression of cytokines that promote B-cell function, generation of TFH cells and CCR5 ligands that can reduce HIV infectivity.These data suggest that while IN inoculation alone elicits both cellular and humoral responses, co-administration with homologous DNA vaccination can tailor these towards a more balanced Th1/Th2 phenotype modulating the cellular cytokine profile while eliciting high-levels of antigen-specific antibody. This work provides insights on how to generate differential immune responses within the same vaccination visit, and supports co-immunisation with DNA and protein by a mucosal route as a potential delivery strategy for HIV vaccines.

  8. Intranasal administration of a therapeutic HIV vaccine (Vacc-4x induces dose-dependent systemic and mucosal immune responses in a randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Kristin Brekke

    Full Text Available Vacc-4x, a Gag p24-based therapeutic HIV vaccine, has been shown to reduce viral load set-points after intradermal administration. In this randomized controlled pilot study we investigate intranasal administration of Vacc-4x with Endocine as adjuvant.Safety and immunogenicity were tested in patients on effective ART. They were randomized to low, medium or high dose Vacc-4x or adjuvant alone, administered four times at weekly intervals with no booster. Vacc-4x-specific T cell responses were measured in vitro by proliferation and in vivo by a single DTH skin test at the end of study. Nasal and rectal mucosal secretions were analyzed for Vacc-4x-specific antibodies by ELISA. Immune regulation induced by Vacc-4x was assessed by functional blockade of the regulatory cytokines IL-10 and TGF-β.Vacc-4x proliferative T cell responses increased only among the vaccinated (p ≤ 0.031. The low dose group showed the greatest increase in Vacc-4x CD8+T cell responses (p = 0.037 and developed larger DTH (p = 0.005 than the adjuvant group. Rectal (distal Vacc-4x IgA and IgG antibodies also increased (p = 0.043 in this group. In contrast, the high dose generated higher nasal (local Vacc-4x IgA (p = 0.028 and serum IgG (p = 0.030 antibodies than the adjuvant. Irrespective of dose, increased Vacc-4x CD4+T cell responses were associated with low proliferation (r = -0.82, p < 0.001 and high regulation (r = 0.61, p = 0.010 at baseline.Intranasal administration of Vacc-4x with Endocine was safe and induced dose-dependent vaccine-specific T cell responses and both mucosal and systemic humoral responses. The clinical significance of dose, immune regulation and mucosal immunity warrants further investigation.ClinicalTrials.gov NCT01473810.

  9. Intranasal immunization with recombinant HA and mast cell activator C48/80 elicits protective immunity against 2009 pandemic H1N1 influenza in mice.

    Directory of Open Access Journals (Sweden)

    Shu Meng

    Full Text Available BACKGROUND: Pandemic influenza represents a major threat to global health. Vaccination is the most economic and effective strategy to control influenza pandemic. Conventional vaccine approach, despite being effective, has a number of major deficiencies including limited range of protection, total dependence on embryonated eggs for production, and time consuming for vaccine production. There is an urgent need to develop novel vaccine strategies to overcome these deficiencies. METHODOLOGY/PRINCIPAL FINDINGS: The major objective of this work was to develop a novel vaccine strategy combining recombinant haemagglutinin (HA protein and a master cell (MC activator C48/80 for intranasal immunization. We demonstrated in BALB/c mice that MC activator C48/80 had strong adjuvant activity when co-administered with recombinant HA protein intranasally. Vaccination with C48/80 significantly increased the serum IgG and mucosal surface IgA antibody responses against HA protein. Such increases correlated with stronger and durable neutralizing antibody activities, offering protection to vaccinated animals from disease progression after challenge with lethal dose of A/California/04/2009 live virus. Furthermore, protected animals demonstrated significant reduction in lung virus titers, minimal structural alteration in lung tissues as well as higher and balanced production of Th1 and Th2 cytokines in the stimulated splenocytes when compared to those without C48/80. CONCLUSIONS/SIGNIFICANCE: The present study demonstrates that the novel vaccine approach of combining recombinant HA and mucosal adjuvant C48/80 is safe and effective in eliciting protective immunity in mice. Future studies on the mechanism of action of C48/80 and potential combination with other vaccine strategies such as prime and boost approach may help to induce even more potent and broad immune responses against viruses from various clades.

  10. Intranasal Immunization Using Mannatide as a Novel Adjuvant for an Inactivated Influenza Vaccine and Its Adjuvant Effect Compared with MF59.

    Directory of Open Access Journals (Sweden)

    Shu-Ting Ren

    Full Text Available Intranasal vaccination is more potent than parenteral injection for the prevention of influenza. However, because the poor efficiency of antigen uptake across the nasal mucosa is a key issue, immunostimulatory adjuvants are essential for intranasal vaccines. The immunomodulator mannatide or polyactin (PA has been used for the clinical treatment of impaired immunity in China, but its adjuvant effect on an inactivated trivalent influenza vaccine (ITIV via intranasal vaccination is unclear. To explore the adjuvant effect of PA, an inactivated trivalent influenza virus with or without PA or MF59 was instilled intranasally once a week in BALB/c mice. Humoral immunity was assessed by both the ELISA and hemagglutination inhibition (HI methods using antigen-specific antibodies. Splenic lymphocyte proliferation and the IFN-γ level were measured to evaluate cell-mediated immunity. The post-vaccination serum HI antibody geometric mean titers (GMTs for the H1N1 and H3N2 strains, antigen-specific serum IgG and IgA GMTs, mucosal SIgA GMT, splenic lymphocyte proliferation, and IFN-γ were significantly increased in the high-dose PA-adjuvanted vaccine group. The seroconversion rate and the mucosal response for the H3N2 strain were significantly elevated after high-dose PA administration. These adjuvant effects of high-dose PA for the influenza vaccine were comparable with those of the MF59 adjuvant, and abnormal signs or pathological changes were not found in the evaluated organs. In conclusion, PA is a novel mucosal adjuvant for intranasal vaccination with the ITIV that has safe and effective mucosal adjuvanticity in mice and successfully induces both serum and mucosal antibody responses and a cell-mediated response.

  11. Intranasal immunization with a replication-deficient adenoviral vector expressing the fusion glycoprotein of respiratory syncytial virus elicits protective immunity in BALB/c mice

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Yuanhui [Institute of Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 100052 (China); College of Life Sciences and Bioengineering, Beijing Jiaotong University, 3 Shangyuan Residence, Haidian District, Beijing, 100044 (China); He, Jinsheng, E-mail: jshhe@bjtu.edu.cn [College of Life Sciences and Bioengineering, Beijing Jiaotong University, 3 Shangyuan Residence, Haidian District, Beijing, 100044 (China); Department of Immunology, Anhui Medical University, Hefei, Anhui, 230032 (China); Zheng, Xianxian [Department of Immunology, Anhui Medical University, Hefei, Anhui, 230032 (China); Wu, Qiang [Department of Pathology, Anhui Medical University, Hefei, Anhui, 230032 (China); Zhang, Mei; Wang, Xiaobo [Department of Immunology, Anhui Medical University, Hefei, Anhui, 230032 (China); Wang, Yan [Department of Pathology, Anhui Medical University, Hefei, Anhui, 230032 (China); Xie, Can; Tang, Qian; Wei, Wei [Department of Immunology, Anhui Medical University, Hefei, Anhui, 230032 (China); Wang, Min; Song, Jingdong; Qu, Jianguo [Institute of Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 100052 (China); Zhang, Ying; Wang, Xin [College of Life Sciences and Bioengineering, Beijing Jiaotong University, 3 Shangyuan Residence, Haidian District, Beijing, 100044 (China); Hong, Tao [Institute of Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 100052 (China); College of Life Sciences and Bioengineering, Beijing Jiaotong University, 3 Shangyuan Residence, Haidian District, Beijing, 100044 (China)

    2009-04-17

    Human respiratory syncytial virus (RSV) is a serious pediatric pathogen of the lower respiratory tract worldwide. There is currently no clinically approved vaccine against RSV infection. Recently, it has been shown that a replication-deficient first generation adenoviral vector (FGAd), which encodes modified RSV attachment glycoprotein (G), elicits long-term protective immunity against RSV infection in mice. The major problem in developing such a vaccine is that G protein lacks MHC-I-restricted epitopes. However, RSV fusion glycoprotein (F) is a major cytotoxic T-lymphocyte epitope in humans and mice, therefore, an FGAd-encoding F (FGAd-F) was constructed and evaluated for its potential as an RSV vaccine in a murine model. Intranasal (i.n.) immunization with FGAd-F generated serum IgG, bronchoalveolar lavage secretory IgA, and RSV-specific CD8+ T-cell responses in BALB/c mice, with characteristic balanced or mixed Th1/Th2 CD4+ T-cell responses. Serum IgG was significantly elevated after boosting with i.n. FGAd-F. Upon challenge, i.n. immunization with FGAd-F displayed an effective protective role against RSV infection. These results demonstrate FGAd-F is able to induce effective protective immunity and is a promising vaccine regimen against RSV infection.

  12. A single intranasal administration of virus-like particle vaccine induces an efficient protection for mice against human respiratory syncytial virus.

    Science.gov (United States)

    Jiao, Yue-Ying; Fu, Yuan-Hui; Yan, Yi-Fei; Hua, Ying; Ma, Yao; Zhang, Xiu-Juan; Song, Jing-Dong; Peng, Xiang-Lei; Huang, Jiaqiang; Hong, Tao; He, Jin-Sheng

    2017-08-01

    Human respiratory syncytial virus (RSV) is an important pediatric pathogen causing acute viral respiratory disease in infants and young children. However, no licensed vaccines are currently available. Virus-like particles (VLPs) may bring new hope to producing RSV VLP vaccine with high immunogenicity and safety. Here, we constructed the recombinants of matrix protein (M) and fusion glycoprotein (F) of RSV, respectively into a replication-deficient first-generation adenoviral vector (FGAd), which were used to co-infect Vero cells to assemble RSV VLPs successfully. The resulting VLPs showed similar immunoreactivity and function to RSV virion in vitro. Moreover, Th1 polarized response, and effective mucosal virus-neutralizing antibody and CD8 + T-cell responses were induced by a single intranasal (i.n.) administration of RSV VLPs rather than intramuscular (i.m.) inoculation, although the comparable RSV F-specific serum IgG and long-lasting RSV-specific neutralizing antibody were detected in the mice immunized by both routes. Upon RSV challenge, VLP-immunized mice showed increased viral clearance but decreased signs of enhanced lung pathology and fewer eosinophils compared to mice immunized with formalin-inactivated RSV (FI-RSV). In addition, a single i.n. RSV VLP vaccine has the capability to induce RSV-specific long-lasting neutralizing antibody responses observable up to 15 months. Our results demonstrate that the long-term and memory immune responses in mice against RSV were induced by a single i.n. administration of RSV VLP vaccine, suggesting a successful approach of RSV VLPs as an effective and safe mucosal vaccine against RSV infection, and an applicable and qualified platform of FGAd-infected Vero cells for VLP production. Copyright © 2017. Published by Elsevier B.V.

  13. Mucosal Immunity and Protective Efficacy of Intranasal Inactivated Influenza Vaccine Is Improved by Chitosan Nanoparticle Delivery in Pigs

    Directory of Open Access Journals (Sweden)

    Santosh Dhakal

    2018-05-01

    Full Text Available Annually, swine influenza A virus (SwIAV causes severe economic loss to swine industry. Currently used inactivated SwIAV vaccines administered by intramuscular injection provide homologous protection, but limited heterologous protection against constantly evolving field viruses, attributable to the induction of inadequate levels of mucosal IgA and cellular immune responses in the respiratory tract. A novel vaccine delivery platform using mucoadhesive chitosan nanoparticles (CNPs administered through intranasal (IN route has the potential to elicit strong mucosal and systemic immune responses in pigs. In this study, we evaluated the immune responses and cross-protective efficacy of IN chitosan encapsulated inactivated SwIAV vaccine in pigs. Killed SwIAV H1N2 (δ-lineage antigens (KAg were encapsulated in chitosan polymer-based nanoparticles (CNPs-KAg. The candidate vaccine was administered twice IN as mist to nursery pigs. Vaccinates and controls were then challenged with a zoonotic and virulent heterologous SwIAV H1N1 (γ-lineage. Pigs vaccinated with CNPs-KAg exhibited an enhanced IgG serum antibody and mucosal secretory IgA antibody responses in nasal swabs, bronchoalveolar lavage (BAL fluids, and lung lysates that were reactive against homologous (H1N2, heterologous (H1N1, and heterosubtypic (H3N2 influenza A virus strains. Prior to challenge, an increased frequency of cytotoxic T lymphocytes, antigen-specific lymphocyte proliferation, and recall IFN-γ secretion by restimulated peripheral blood mononuclear cells in CNPs-KAg compared to control KAg vaccinates were observed. In CNPs-KAg vaccinated pigs challenged with heterologous virus reduced severity of macroscopic and microscopic influenza-associated pulmonary lesions were observed. Importantly, the infectious SwIAV titers in nasal swabs [days post-challenge (DPC 4] and BAL fluid (DPC 6 were significantly (p < 0.05 reduced in CNPs-KAg vaccinates but not in KAg vaccinates when compared

  14. Effective Respiratory CD8 T-Cell Immunity to Influenza Virus Induced by Intranasal Carbomer-Lecithin-Adjuvanted Non-replicating Vaccines.

    Science.gov (United States)

    Gasper, David J; Neldner, Brandon; Plisch, Erin H; Rustom, Hani; Carrow, Emily; Imai, Hirotaka; Kawaoka, Yoshihiro; Suresh, M

    2016-12-01

    CD8+ cytotoxic T lymphocytes (CTLs) are critical for clearing many viral infections, and protective CTL memory can be induced by vaccination with attenuated viruses and vectors. Non-replicating vaccines are typically potentiated by the addition of adjuvants that enhance humoral responses, however few are capable of generating CTL responses. Adjuplex is a carbomer-lecithin-based adjuvant demonstrated to elicit robust humoral immunity to non-replicating antigens. We report that mice immunized with non-replicating Adjuplex-adjuvanted vaccines generated robust antigen-specific CTL responses. Vaccination by the subcutaneous or the intranasal route stimulated systemic and mucosal CTL memory respectively. However, only CTL memory induced by intranasal vaccination was protective against influenza viral challenge, and correlated with an enhancement of memory CTLs in the airways and CD103+ CD69+ CXCR3+ resident memory-like CTLs in the lungs. Mechanistically, Myd88-deficient mice mounted primary CTL responses to Adjuplex vaccines that were similar in magnitude to wild-type mice, but exhibited altered differentiation of effector cell subsets. Immune potentiating effects of Adjuplex entailed alterations in the frequency of antigen-presenting-cell subsets in vaccine draining lymph nodes, and in the lungs and airways following intranasal vaccination. Further, Adjuplex enhanced the ability of dendritic cells to promote antigen-induced proliferation of naïve CD8 T cells by modulating antigen uptake, its intracellular localization, and rate of processing. Taken together, we have identified an adjuvant that elicits both systemic and mucosal CTL memory to non-replicating antigens, and engenders protective CTL-based heterosubtypic immunity to influenza A virus in the respiratory tract. Further, findings presented in this manuscript have provided key insights into the mechanisms and factors that govern the induction and programming of systemic and protective memory CTLs in the

  15. Effective Respiratory CD8 T-Cell Immunity to Influenza Virus Induced by Intranasal Carbomer-Lecithin-Adjuvanted Non-replicating Vaccines.

    Directory of Open Access Journals (Sweden)

    David J Gasper

    2016-12-01

    Full Text Available CD8+ cytotoxic T lymphocytes (CTLs are critical for clearing many viral infections, and protective CTL memory can be induced by vaccination with attenuated viruses and vectors. Non-replicating vaccines are typically potentiated by the addition of adjuvants that enhance humoral responses, however few are capable of generating CTL responses. Adjuplex is a carbomer-lecithin-based adjuvant demonstrated to elicit robust humoral immunity to non-replicating antigens. We report that mice immunized with non-replicating Adjuplex-adjuvanted vaccines generated robust antigen-specific CTL responses. Vaccination by the subcutaneous or the intranasal route stimulated systemic and mucosal CTL memory respectively. However, only CTL memory induced by intranasal vaccination was protective against influenza viral challenge, and correlated with an enhancement of memory CTLs in the airways and CD103+ CD69+ CXCR3+ resident memory-like CTLs in the lungs. Mechanistically, Myd88-deficient mice mounted primary CTL responses to Adjuplex vaccines that were similar in magnitude to wild-type mice, but exhibited altered differentiation of effector cell subsets. Immune potentiating effects of Adjuplex entailed alterations in the frequency of antigen-presenting-cell subsets in vaccine draining lymph nodes, and in the lungs and airways following intranasal vaccination. Further, Adjuplex enhanced the ability of dendritic cells to promote antigen-induced proliferation of naïve CD8 T cells by modulating antigen uptake, its intracellular localization, and rate of processing. Taken together, we have identified an adjuvant that elicits both systemic and mucosal CTL memory to non-replicating antigens, and engenders protective CTL-based heterosubtypic immunity to influenza A virus in the respiratory tract. Further, findings presented in this manuscript have provided key insights into the mechanisms and factors that govern the induction and programming of systemic and protective memory

  16. Intranasal immunization of baculovirus displayed hemagglutinin confers complete protection against mouse adapted highly pathogenic H7N7 reassortant influenza virus.

    Directory of Open Access Journals (Sweden)

    Subaschandrabose Rajesh Kumar

    Full Text Available BACKGROUND: Avian influenza A H7N7 virus poses a pandemic threat to human health because of its ability for direct transmission from domestic poultry to humans and from human to human. The wide zoonotic potential of H7N7 combined with an antiviral immunity inhibition similar to pandemic 1918 H1N1 and 2009 H1N1 influenza viruses is disconcerting and increases the risk of a putative H7N7 pandemic in the future, underlining the urgent need for vaccine development against this virus. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we developed a recombinant vaccine by expressing the H7N7-HA protein on the surface of baculovirus (Bac-HA. The protective efficacy of the live Bac-HA vaccine construct was evaluated in a mouse model by challenging mice immunized intranasally (i.n. or subcutaneously (s.c. with high pathogenic mouse adapted H7N7 reassorted strain. Although s.c. injection of live Bac-HA induced higher specific IgG than i.n. immunization, the later resulted in an elevated neutralization titer. Interestingly, 100% protection from the lethal viral challenge was only observed for the mice immunized intranasally with live Bac-HA, whereas no protection was achieved in any other s.c. or i.n. immunized mice groups. In addition, we also observed higher mucosal IgA as well as increased IFN-γ and IL-4 responses in the splenocytes of the surviving mice coupled with a reduced viral titer and diminished histopathological signs in the lungs. CONCLUSION: Our results indicated that protection from high pathogenic H7N7 (NL/219/03 virus requires both mucosal and systemic immune responses in mice. The balance between Th1 and Th2 cytokines is also required for the protection against the H7N7 pathogen. Intranasal administration of live Bac-HA induced all these immune responses and protected the mice from lethal viral challenge. Therefore, live Bac-HA is an effective vaccine candidate against H7N7 viral infections.

  17. Immunization with r-Lactococcus lactis expressing outer membrane protein A of Shigella dysenteriae type-1: evaluation of oral and intranasal route of administration.

    Science.gov (United States)

    Yagnik, B; Sharma, D; Padh, H; Desai, P

    2017-02-01

    To evaluate the comparative immunogenic potential of food grade Lactococcus lactis expressing outer membrane protein A (OmpA) of Shigella dysenteriae type-1 (SD-1) when administered either orally or intranasally. OmpA of SD-1 was cloned and expressed first in Escherichia coli and then in L. lactis. Presence of recombinant gene was confirmed by restriction enzyme digestion and immunoblot analysis. Using immobilized metal affinity chromatography, OmpA was purified from recombinant E. coliBL21 (DE3) and subcutaneously administered in BALB/c mice. Detection of OmpA-specific IgG antibodies by enzyme-linked immunosorbent assay (ELISA) confirmed the immunogenicity of OmpA. In order to establish r-L. lactis as a mucosal delivery vehicle, it was administered orally and nasally in BALB/c mice. Serum IgG and faecal IgA were assessed through ELISA to compare the relative potential of immunization routes and immunogenic potential of r-L. lactis. Immunization via the oral route proved superior to intranasal exposure. Recombinant L. lactis expressing OmpA of SD-1 was found to be immunogenic. Oral administration of r-L. lactis elicited higher systemic and mucosal immune response when compared with the nasal route. Using food grade recombinant L. lactis has implications in the development of a prophylactic against multidrug-resistant Shigella, which can be used as a prospective vaccine candidate. Evaluating mucosal routes of immunization demonstrated that the oral route of administration elicited better immune response against OmpA of Shigella. © 2016 The Society for Applied Microbiology.

  18. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus.

    Science.gov (United States)

    Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu

    2016-04-21

    Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses.

  19. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus

    Directory of Open Access Journals (Sweden)

    Xianliang Ji

    2016-04-01

    Full Text Available Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs composed of the hemagglutinin (HA, neuraminidase (NA and matrix protein (M1 of A/Changchun/01/2009 (H1N1 with or without either membrane-anchored cholera toxin B (CTB or ricin toxin B (RTB as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival. Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses.

  20. Comparing the immune response to a novel intranasal nanoparticle PLGA vaccine and a commercial BPI3V vaccine in dairy calves.

    Science.gov (United States)

    Mansoor, Fawad; Earley, Bernadette; Cassidy, Joseph P; Markey, Bryan; Doherty, Simon; Welsh, Michael D

    2015-08-21

    There is a need to improve vaccination against respiratory pathogens in calves by stimulation of local immunity at the site of pathogen entry at an early stage in life. Ideally such a vaccine preparation would not be inhibited by the maternally derived antibodies. Additionally, localized immune response at the site of infection is also crucial to control infection at the site of entry of virus. The present study investigated the response to an intranasal bovine parainfluenza 3 virus (BPI3V) antigen preparation encapsulated in PLGA (poly dl-lactic-co-glycolide) nanoparticles in the presence of pre-existing anti-BPI3V antibodies in young calves and comparing it to a commercially available BPI3V respiratory vaccine. There was a significant (P administration of the nanoparticle vaccine an early immune response was induced that continued to grow until the end of study and was not observed in the other treatment groups. Virus specific serum IgG response to both the nanoparticle vaccine and commercial live attenuated vaccine showed a significant (P local mucosal immunity induced by nanoparticle vaccine has obvious potential if it translates into enhanced protective immunity in the face of virus outbreak.

  1. Mucosal and Systemic Immune Responses to Influenza H7N9 Antigen HA1-2 Co-Delivered Intranasally with Flagellin or Polyethyleneimine in Mice and Chickens.

    Science.gov (United States)

    Song, Li; Xiong, Dan; Song, Hongqin; Wu, Lili; Zhang, Meihua; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

    2017-01-01

    Consecutive cases of human infection with H7N9 influenza viruses since 2013 in China have prompted efforts to develop an effective treatment. Subunit vaccines introduced by intranasal administration can block an infection at its primary site; flagellin (fliC) and polyethyleneimine (PEI) have been shown to be potent adjuvants. We previously generated the hemagglutinin (HA)1-2-fliC fusion protein consisting of the globular head domain (HA1-2; amino acids 62-284) of HA fused with Salmonella typhimurium fliC. In the present study, we investigated its effectiveness of both flagellin and PEI as mucosal adjuvants for the H7N9 influenza subunit vaccine. Mice immunized intranasally with HA1-2-fliC and HA1-2-PEI showed higher HA1-2-specific immunoglobulin (Ig)G and IgA titers in serum, nasal wash, and bronchial alveolar lavage fluid. Moreover, splenocyte activation and proliferation and the number of HA1-2-specific interferon (IFN)-γ- and interleukin (IL)-4-producing splenocytes were markedly increased in the fliC and PEI groups; in the latter, there were more cells secreting IL-4 than IFN-γ, suggesting that fliC induced T helper type (Th)1 and Th2 immune responses, and PEI induced Th2-biased responses, consistent with the serum antibody isotype pattern (IgG1/IgG2a ratio). Furthermore, virus challenge was performed in a chicken model. The results showed that chickens receiving fliC and PEI adjuvant vaccine exhibited robust immune responses leading to a significant reduction in viral loads of throat and cloaca compared to chickens receiving only HA1-2. These findings provide a basis for the development of H7N9 influenza HA1-2 mucosal subunit vaccines.

  2. An adenovirus vectored mucosal adjuvant augments protection of mice immunized intranasally with an adenovirus-vectored foot-and-mouth disease virus subunit vaccine.

    Science.gov (United States)

    Alejo, Diana M; Moraes, Mauro P; Liao, Xiaofen; Dias, Camila C; Tulman, Edan R; Diaz-San Segundo, Fayna; Rood, Debra; Grubman, Marvin J; Silbart, Lawrence K

    2013-04-26

    Foot-and-mouth disease virus (FMDV) is a highly contagious pathogen that causes severe morbidity and economic losses to the livestock industry in many countries. The oral and respiratory mucosae are the main ports of entry of FMDV, so the stimulation of local immunity in these tissues may help prevent initial infection and viral spread. E. coli heat-labile enterotoxin (LT) has been described as one of the few molecules that have adjuvant activity at mucosal surfaces. The objective of this study was to evaluate the efficacy of replication-defective adenovirus 5 (Ad5) vectors encoding either of two LT-based mucosal adjuvants, LTB or LTR72. These vectored adjuvants were delivered intranasally to mice concurrent with an Ad5-FMDV vaccine (Ad5-A24) to assess their ability to augment mucosal and systemic humoral immune responses to Ad5-A24 and protection against FMDV. Mice receiving Ad5-A24 plus Ad5-LTR72 had higher levels of mucosal and systemic neutralizing antibodies than those receiving Ad5-A24 alone or Ad5-A24 plus Ad5-LTB. The vaccine plus Ad5-LTR72 group also demonstrated 100% survival after intradermal challenge with a lethal dose of homologous FMDV serotype A24. These results suggest that Ad5-LTR72 could be used as an important tool to enhance mucosal and systemic immunity against FMDV and potentially other pathogens with a common route of entry. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Evaluation of an intranasal virosomal vaccine against respiratory syncytial virus in mice: effect of TLR2 and NOD2 ligands on induction of systemic and mucosal immune responses.

    Directory of Open Access Journals (Sweden)

    Muhammad Shafique

    Full Text Available INTRODUCTION: RSV infection remains a serious threat to newborns and the elderly. Currently, there is no vaccine available to prevent RSV infection. A mucosal RSV vaccine would be attractive as it could induce mucosal as well as systemic antibodies, capable of protecting both the upper and lower respiratory tract. Previously, we reported on a virosomal RSV vaccine for intramuscular injection with intrinsic adjuvant properties mediated by an incorporated lipophilic Toll-like receptor 2 (TLR2 ligand. However, it has not been investigated whether this virosomal RSV vaccine candidate would be suitable for use in mucosal immunization strategies and if additional incorporation of other innate receptor ligands, like NOD2-ligand, could further enhance the immunogenicity and protective efficacy of the vaccine. OBJECTIVE: To explore if intranasal (IN immunization with a virosomal RSV vaccine, supplemented with TLR2 and/or NOD2-ligands, is an effective strategy to induce RSV-specific immunity. METHODS: We produced RSV-virosomes carrying TLR2 (Pam3CSK4 and/or NOD2 (L18-MDP ligands. We tested the immunopotentiating properties of these virosomes in vitro, using TLR2- and/or NOD2-ligand-responsive murine and human cell lines, and in vivo by assessing induction of protective antibody and cellular responses upon IN immunization of BALB/c mice. RESULTS: Incorporation of Pam3CSK4 and/or L18-MDP potentiates the capacity of virosomes to activate (antigen-presenting cells in vitro, as demonstrated by NF-κB induction. In vivo, incorporation of Pam3CSK4 in virosomes boosted serum IgG antibody responses and mucosal antibody responses after IN immunization. While L18-MDP alone was ineffective, incorporation of L18-MDP in Pam3CSK4-carrying virosomes further boosted mucosal antibody responses. Finally, IN immunization with adjuvanted virosomes, particularly Pam3CSK4/L18-MDP-adjuvanted-virosomes, protected mice against infection with RSV, without priming for enhanced

  4. Use of a Guinea pig-specific transcriptome array for evaluation of protective immunity against genital chlamydial infection following intranasal vaccination in Guinea pigs.

    Science.gov (United States)

    Wali, Shradha; Gupta, Rishein; Veselenak, Ronald L; Li, Yansong; Yu, Jieh-Juen; Murthy, Ashlesh K; Cap, Andrew P; Guentzel, M Neal; Chambers, James P; Zhong, Guangming; Rank, Roger G; Pyles, Richard B; Arulanandam, Bernard P

    2014-01-01

    Guinea pigs have been used as a second animal model to validate putative anti-chlamydial vaccine candidates tested in mice. However, the lack of guinea pig-specific reagents has limited the utility of this animal model in Chlamydia sp. vaccine studies. Using a novel guinea pig-specific transcriptome array, we determined correlates of protection in guinea pigs vaccinated with Chlamydia caviae (C. caviae) via the intranasal route, previously reported by us and others to provide robust antigen specific immunity against subsequent intravaginal challenge. C. caviae vaccinated guinea pigs resolved genital infection by day 3 post challenge. In contrast, mock vaccinated animals continued to shed viable Chlamydia up to day 18 post challenge. Importantly, at day 80 post challenge, vaccinated guinea pigs experienced significantly reduced genital pathology - a sequelae of genital chlamydial infections, in comparison to mock vaccinated guinea pigs. Sera from vaccinated guinea pigs displayed antigen specific IgG responses and increased IgG1 and IgG2 titers capable of neutralizing GPIC in vitro. Th1-cellular/inflammatory immune genes and Th2-humoral associated genes were also found to be elevated in vaccinated guinea pigs at day 3 post-challenge and correlated with early clearance of the bacterium. Overall, this study provides the first evidence of guinea pig-specific genes involved in anti-chlamydial vaccination and illustrates the enhancement of the utility of this animal model in chlamydial pathogenesis.

  5. Oral immunization of mice with gamma-irradiated Brucella neotomae induces protection against intraperitoneal and intranasal challenge with virulent B. abortus 2308.

    Directory of Open Access Journals (Sweden)

    Neha Dabral

    Full Text Available Brucella spp. are Gram-negative, facultative intracellular coccobacilli that cause one of the most frequently encountered zoonosis worldwide. Humans naturally acquire infection through consumption of contaminated dairy and meat products and through direct exposure to aborted animal tissues and fluids. No vaccine against brucellosis is available for use in humans. In this study, we tested the ability of orally inoculated gamma-irradiated B. neotomae and B. abortus RB51 in a prime-boost immunization approach to induce antigen-specific humoral and cell mediated immunity and protection against challenge with virulent B. abortus 2308. Heterologous prime-boost vaccination with B. abortus RB51 and B. neotomae and homologous prime-boost vaccination of mice with B. neotomae led to the production of serum and mucosal antibodies specific to the smooth LPS. The elicited serum antibodies included the isotypes of IgM, IgG1, IgG2a, IgG2b and IgG3. All oral vaccination regimens induced antigen-specific CD4(+ and CD8(+ T cells capable of secreting IFN-γ and TNF-α. Upon intra-peritoneal challenge, mice vaccinated with B. neotomae showed the highest level of resistance against virulent B. abortus 2308 colonization in spleen and liver. Experiments with different doses of B. neotomae showed that all tested doses of 10(9, 10(10 and 10(11 CFU-equivalent conferred significant protection against the intra-peritoneal challenge. However, a dose of 10(11 CFU-equivalent of B. neotomae was required for affording protection against intranasal challenge as shown by the reduced bacterial colonization in spleens and lungs. Taken together, these results demonstrate the feasibility of using gamma-irradiated B. neotomae as an effective and safe oral vaccine to induce protection against respiratory and systemic infections with virulent Brucella.

  6. Oral immunization of mice with gamma-irradiated Brucella neotomae induces protection against intraperitoneal and intranasal challenge with virulent B. abortus 2308.

    Science.gov (United States)

    Dabral, Neha; Martha-Moreno-Lafont; Sriranganathan, Nammalwar; Vemulapalli, Ramesh

    2014-01-01

    Brucella spp. are Gram-negative, facultative intracellular coccobacilli that cause one of the most frequently encountered zoonosis worldwide. Humans naturally acquire infection through consumption of contaminated dairy and meat products and through direct exposure to aborted animal tissues and fluids. No vaccine against brucellosis is available for use in humans. In this study, we tested the ability of orally inoculated gamma-irradiated B. neotomae and B. abortus RB51 in a prime-boost immunization approach to induce antigen-specific humoral and cell mediated immunity and protection against challenge with virulent B. abortus 2308. Heterologous prime-boost vaccination with B. abortus RB51 and B. neotomae and homologous prime-boost vaccination of mice with B. neotomae led to the production of serum and mucosal antibodies specific to the smooth LPS. The elicited serum antibodies included the isotypes of IgM, IgG1, IgG2a, IgG2b and IgG3. All oral vaccination regimens induced antigen-specific CD4(+) and CD8(+) T cells capable of secreting IFN-γ and TNF-α. Upon intra-peritoneal challenge, mice vaccinated with B. neotomae showed the highest level of resistance against virulent B. abortus 2308 colonization in spleen and liver. Experiments with different doses of B. neotomae showed that all tested doses of 10(9), 10(10) and 10(11) CFU-equivalent conferred significant protection against the intra-peritoneal challenge. However, a dose of 10(11) CFU-equivalent of B. neotomae was required for affording protection against intranasal challenge as shown by the reduced bacterial colonization in spleens and lungs. Taken together, these results demonstrate the feasibility of using gamma-irradiated B. neotomae as an effective and safe oral vaccine to induce protection against respiratory and systemic infections with virulent Brucella.

  7. Partial protective effect of intranasal immunization with recombinant Toxoplasma gondii rhoptry protein 17 against toxoplasmosis in mice.

    Directory of Open Access Journals (Sweden)

    Hai-Long Wang

    Full Text Available Toxoplasma gondii (T. gondii is an obligate intracellular protozoan parasite that infects a variety of mammals, including humans. An effective vaccine for this parasite is therefore needed. In this study, RH strain T. gondii rhoptry protein 17 was expressed in bacteria as a fusion with glutathione S-transferase (GST and the recombinant proteins (rTgROP17 were purified via GST-affinity chromatography. BALB/c mice were nasally immunised with rTgROP17, and induction of immune responses and protection against chronic and lethal T. gondii infections were investigated. The results revealed that mice immunised with rTgROP17 produced high levels of specific anti-rTgROP17 IgGs and a mixed IgG1/IgG2a response of IgG2a predominance. The systemic immune response was associated with increased production of Th1 (IFN-γand IL-2 and Th2 (IL-4 cytokines, and enhanced lymphoproliferation (stimulation index, SI in the mice immunised with rTgROP17. Strong mucosal immune responses with increased secretion of TgROP17-specific secretory IgA (SIgA in nasal, vaginal and intestinal washes were also observed in these mice. The vaccinated mice displayed apparent protection against chronic RH strain infection as evidenced by their lower liver and brain parasite burdens (59.17% and 49.08%, respectively than those of the controls. The vaccinated mice also exhibited significant protection against lethal infection of the virulent RH strain (survival increased by 50% compared to the controls. Our data demonstrate that rTgROP17 can trigger strong systemic and mucosal immune responses against T. gondii and that ROP17 is a promising candidate vaccine for toxoplasmosis.

  8. Intramuscular Delivery of Adenovirus Serotype 5 Vector Expressing Humanized Protective Antigen Induces Rapid Protection against Anthrax That May Bypass Intranasally Originated Preexisting Adenovirus Immunity

    OpenAIRE

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie; Hou, Lihua; Chen, Wei

    2014-01-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a s...

  9. Simultaneous immunization against tuberculosis.

    Directory of Open Access Journals (Sweden)

    Elma Z Tchilian

    Full Text Available BCG, the only licensed vaccine against tuberculosis, provides some protection against disseminated disease in infants but has little effect on prevention of adult pulmonary disease. Newer parenteral immunization prime boost regimes may provide improved protection in experimental animal models but are unproven in man so that there remains a need for new and improved immunization strategies.Mice were immunized parenterally, intranasally or simultaneously by both routes with BCG or recombinant mycobacterial antigens plus appropriate adjuvants. They were challenged with Mycobacterium tuberculosis (Mtb and the kinetics of Mtb growth in the lungs measured. We show that simultaneous immunization (SIM of mice by the intranasal and parenteral routes is highly effective in increasing protection over parenteral BCG administration alone. Intranasal immunization induces local pulmonary immunity capable of inhibiting the growth of Mtb in the early phase (the first week of infection, while parenteral immunization has a later effect on Mtb growth. Importantly, these two effects are additive and do not depend on priming and boosting the immune response. The best SIM regimes reduce lung Mtb load by up to 2 logs more than BCG given by either route alone.These data establish SIM as a novel and highly effective immunization strategy for Mtb that could be carried out at a single clinic visit. The efficacy of SIM does not depend on priming and boosting an immune response, but SIM is complementary to prime boost strategies and might be combined with them.

  10. A Comparison of Health Care Resource Utilization and Costs for Patients with Allergic Rhinitis on Single-Product or Free-Combination Therapy of Intranasal Steroids and Intranasal Antihistamines.

    Science.gov (United States)

    Harrow, Brooke; Sedaghat, Ahmad R; Caldwell-Tarr, Amanda; Dufour, Robert

    2016-12-01

    Allergic rhinitis (AR) is a common condition that can be treated with a number of different therapies. Treatments such as intranasal antihistamines (INAs) and intranasal steroids (INSs) are widely used by AR patients. For some allergy sufferers, a combination of therapies, specifically an INA and an INS, is required to address their symptoms. A new treatment, the formulation of azelastine hydrochloride and fluticasone pro-pionate used as a single spray (MP-AzeFlu), has become available for AR patients who need both types of treatment. In this regard, the comparison with the alternative concomitant use of INAs and INSs is of interest. The current study examines the health care resource utilization and costs for each cohort. To examine the resource utilization and costs associated with AR for patients treated with MP-AzeFlu or concurrent therapy with single-ingredient INA and INS sprays (free-combination therapy). A retrospective administrative claims study for commercially insured patients from a large U.S. health plan was performed. Patients with an AR diagnosis and a prescription claim for MP-AzeFlu or free-combination therapy between September 1, 2012, and September 30, 2013, were identified. Patients were aged at least 12 years at index date (first prescription fill for intranasal therapy) and were required to have 12 months pre-index and 6 months post-index of continuous enrollment. Health care resource utilization and costs were assessed for the post-index period. The cohorts were adjusted on baseline demographic and clinical characteristics using inverse propensity treatment weights. Other covariates, prescriber specialty, product switching during the post-index period, and pre-index total costs were included in the regression models measuring outcomes. One clinical characteristic of interest was the presence of asthma as comorbidity. A subset analysis of AR patients with asthma was also performed. All-cause-related pharmacy fills as well as pharmacy, medical

  11. A single immunization with a recombinant canine adenovirus expressing the rabies virus G protein confers protective immunity against rabies in mice

    International Nuclear Information System (INIS)

    Li Jianwei; Faber, Milosz; Papaneri, Amy; Faber, Marie-Luise; McGettigan, James P.; Schnell, Matthias J.; Dietzschold, Bernhard

    2006-01-01

    Rabies vaccines based on live attenuated rabies viruses or recombinant pox viruses expressing the rabies virus (RV) glycoprotein (G) hold the greatest promise of safety and efficacy, particularly for oral immunization of wildlife. However, while these vaccines induce protective immunity in foxes, they are less effective in other animals, and safety concerns have been raised for some of these vaccines. Because canine adenovirus 2 (CAV2) is licensed for use as a live vaccine for dogs and has an excellent efficacy and safety record, we used this virus as an expression vector for the RVG. The recombinant CAV2-RV G produces virus titers similar to those produced by wild-type CAV2, indicating that the RVG gene does not affect virus replication. Comparison of RVG expressed by CAV2-RV G with that of vaccinia-RV G recombinant virus (V-RG) revealed similar amounts of RV G on the cell surface. A single intramuscular or intranasal immunization of mice with CAV2-RVG induced protective immunity in a dose-dependent manner, with no clinical signs or discomfort from the virus infection regardless of the route of administration or the amount of virus

  12. Single-cell technologies to study the immune system.

    Science.gov (United States)

    Proserpio, Valentina; Mahata, Bidesh

    2016-02-01

    The immune system is composed of a variety of cells that act in a coordinated fashion to protect the organism against a multitude of different pathogens. The great variability of existing pathogens corresponds to a similar high heterogeneity of the immune cells. The study of individual immune cells, the fundamental unit of immunity, has recently transformed from a qualitative microscopic imaging to a nearly complete quantitative transcriptomic analysis. This shift has been driven by the rapid development of multiple single-cell technologies. These new advances are expected to boost the detection of less frequent cell types and transient or intermediate cell states. They will highlight the individuality of each single cell and greatly expand the resolution of current available classifications and differentiation trajectories. In this review we discuss the recent advancement and application of single-cell technologies, their limitations and future applications to study the immune system. © 2015 The Authors. Immunology Published by John Wiley & Sons Ltd.

  13. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-03-30

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  14. Rectal single dose immunization of mice with Escherichia coli O157:H7 bacterial ghosts induces efficient humoral and cellular immune responses and protects against the lethal heterologous challenge.

    Science.gov (United States)

    Mayr, Ulrike Beate; Kudela, Pavol; Atrasheuskaya, Alena; Bukin, Eugenij; Ignatyev, Georgy; Lubitz, Werner

    2012-03-01

    Bacterial ghosts (BGs) have been applied through oral, aerogenic, intraocular or intranasal routes for mucosal immunization using a wide range of experimental animals. All these applications required a booster after primary immunization to achieve protective immunity against the lethal challenge. Here we report for the first time that a single rectal dose of BGs produced from enterohaemorrhagic Escherichia coli (EHEC) O157:H7 fully protects mice against a 50% lethal challenge with a heterologous EHEC strain given at day 55. BGs from EHEC O157:H7 were prepared by a combination of protein E-mediated cell lysis and expression of staphylococcal nuclease A guaranteeing the complete degradation of pathogen residual DNA. The lack of genetic material in the EHEC BGs vaccine abolished any potential hazard for horizontal gene transfer of plasmid encoded antibiotic resistance genes or pathogenic islands to the recipient's gut flora. Single rectal immunization using EHEC O157:H7 BGs without any addition of adjuvant significantly stimulated efficient humoral and cellular immune responses, and was equally protective as two immunizations, which indicates the possibility to develop a novel efficacious single dose mucosal EHEC O157:H7 BGs vaccine using a simplified immunization regimen. © 2011 The Authors. Microbial Biotechnology © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  15. Intranasal administration of a proteosome-influenza vaccine is well-tolerated and induces serum and nasal secretion influenza antibodies in healthy human subjects.

    Science.gov (United States)

    Treanor, John; Nolan, Carrie; O'Brien, Diane; Burt, David; Lowell, George; Linden, Janine; Fries, Louis

    2006-01-16

    Two randomized, blinded, active comparator-controlled trials of a prototype monovalent A/Beijing/262/95 (H1N1) - proteosome vaccine delivered by intranasal spray were performed in healthy adults. Overall, the intranasal proteosome-adjuvanted vaccine was well-tolerated with only mild stuffy nose and rhinorrhea seen more frequently in recipients of vaccine than in recipients of intranasal saline, and there were no serious adverse events. The intranasal proteosome-adjuvanted vaccine induced serum hemagglutination inhibiting (HAI) and nasal secretory IgA (sIgA) responses specific for the influenza antigen. Serum HAI responses were most influenced by the dosage level, whereas mucosal sIgA responses, although demonstrable with both single-dose and two-dose vaccine regimens, appeared to be greater in response to two-dose regimens (regardless of dose level). Further evaluation of mucosal influenza immunization using the proteosome adjuvant/delivery system is clearly warranted.

  16. The protoxin Cry1Ac of Bacillus thuringiensis improves the protection conferred by intranasal immunization with Brucella abortus RB51 in a mouse model.

    Science.gov (United States)

    González-González, Edith; García-Hernández, Ana Lilia; Flores-Mejía, Raúl; López-Santiago, Rubén; Moreno-Fierros, Leticia

    2015-02-25

    Brucellosis is a zoonotic disease affecting many people and animals worldwide. Preventing this infection requires improving vaccination strategies. The protoxin Cry1Ac of Bacillus thuringiensis is an adjuvant that, in addition to increasing the immunogenicity of different antigens, has shown to be protective in different models of parasitic infections. The objective of the present study was to test whether the intranasal co-administration of pCry1Ac with the RB51 vaccine strain of Brucella abortus confers protection against an intranasal challenge with the virulent strain B. abortus 2308 in BALB/c mice. The results showed that co-administration of pCry1Ac and RB51, increased the immunoprotection conferred by the vaccine as evidenced by the following: (1) decrease of the splenic bacterial load when challenged intranasally with the virulent strain; (2) greater in vivo cytotoxic activity in response to the transference of previously infected cells; (3) further proliferation of cytotoxic TCD8+ cells in response to stimulation with heat-inactivated bacteria; (4) increased production of TNF-α and IFN-γ; and (5) significant IgG2a response. These results indicate that the use of the Cry1Ac protein as a mucosal adjuvant via the intranasal route can be a promising alternative for improving current RB51 vaccine against brucellosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Impact of Single or Repeated Dose Intranasal Zinc-free Insulin in Young and Aged F344 Rats on Cognition, Signaling, and Brain Metabolism.

    Science.gov (United States)

    Anderson, Katie L; Frazier, Hilaree N; Maimaiti, Shaniya; Bakshi, Vikas V; Majeed, Zana R; Brewer, Lawrence D; Porter, Nada M; Lin, Ai-Ling; Thibault, Olivier

    2017-02-01

    Novel therapies have turned to delivering compounds to the brain using nasal sprays, bypassing the blood brain barrier, and enriching treatment options for brain aging and/or Alzheimer's disease. We conducted a series of in vivo experiments to test the impact of intranasal Apidra, a zinc-free insulin formulation, on the brain of young and aged F344 rats. Both single acute and repeated daily doses were compared to test the hypothesis that insulin could improve memory recall in aged memory-deficient animals. We quantified insulin signaling in different brain regions and at different times following delivery. We measured cerebral blood flow (CBF) using MRI and also characterized several brain metabolite levels using MR spectroscopy. We show that neither acute nor chronic Apidra improved memory or recall in young or aged animals. Within 2 hours of a single dose, increased insulin signaling was seen in ventral areas of the aged brains only. Although chronic Apidra was able to offset reduced CBF with aging, it also caused significant reductions in markers of neuronal integrity. Our data suggest that this zinc-free insulin formulation may actually hasten cognitive decline with age when used chronically. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Influence of anatomy and head position on intranasal drug deposition

    NARCIS (Netherlands)

    Merkus, Paul; Ebbens, Fenna A.; Muller, Barbara; Fokkens, Wytske J.

    2006-01-01

    The objective of this study was to determine the influence of individual anatomical differences on intranasal drug deposition. The data of a comparison of seven different administration techniques in ten healthy volunteers was used in this single-blind crossover pilot study. After intranasal

  19. Infection of the upper respiratory tract with seasonal influenza A(H3N2) virus induces protective immunity in ferrets against infection with A(H1N1)pdm09 virus after intranasal, but not intratracheal, inoculation.

    Science.gov (United States)

    Bodewes, Rogier; Kreijtz, Joost H C M; van Amerongen, Geert; Hillaire, Marine L B; Vogelzang-van Trierum, Stella E; Nieuwkoop, Nella J; van Run, Peter; Kuiken, Thijs; Fouchier, Ron A M; Osterhaus, Albert D M E; Rimmelzwaan, Guus F

    2013-04-01

    The clinical symptoms caused by infection with influenza A virus vary widely and depend on the strain causing the infection, the dose and route of inoculation, and the presence of preexisting immunity. In most cases, seasonal influenza A viruses cause relatively mild upper respiratory tract disease, while sometimes patients develop an acute severe pneumonia. Heterosubtypic immunity induced by previous infections with influenza A viruses may dampen the development of clinical symptoms caused by infection with influenza A viruses of another subtype, as is the case during influenza pandemics. Here we show that ferrets acquire protective immunity after infection of the upper respiratory tract with a seasonal influenza A(H3N2) virus against subsequent infection with influenza A(H1N1)pdm09 virus inoculated by the intranasal route. However, protective heterosubtypic immunity was afforded locally, since the prior infection with the A(H3N2) virus did not provide protection against the development of pneumonia induced after intratracheal inoculation with the A(H1N1)pdm09 virus. Interestingly, some of these animals developed more severe disease than that observed in naïve control animals. These findings are of interest in light of the development of so-called universal influenza vaccines that aim at the induction of cross-reactive T cell responses.

  20. Immune overload: Parental attitudes toward combination and single antigen vaccines.

    Science.gov (United States)

    Hulsey, Ella; Bland, Tami

    2015-05-21

    Parental concerns have led to a recent decline in immunization coverage, resulting in outbreaks of diseases that were once under control in the US. As the CDC vaccination schedule continues to increase in complexity, the number of required injections per office visit increases as well. Some parents perceive that there is trauma associated with the administration of multiple injections, and research shows that having multiple vaccines due in a single visit is associated with delays and lower immunization rates. Combination vaccines make vaccination more efficient by incorporating the antigens of several different diseases into a single injection, but many parents worry that they may overload the child's developing immune system and leave him or her susceptible to secondary infections. This literature review synthesizes current evidence regarding the parental fear of vaccine-induced immune system overload and the fear of vaccine-associated trauma, in an attempt to understand the scope and nature of these fears. Despite the wealth of knowledge about each of these fears individually, it is still unknown which is of greater concern and how this affects parental decision-making. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Single dose CpG immunization protects against a heterosubtypic challenge and generates antigen specific memory T cells

    Directory of Open Access Journals (Sweden)

    Alexander eVogel

    2015-06-01

    Full Text Available Despite extensive research, influenza A virus (IAV remains a major cause of morbidity, mortality, and healthcare expenditure. Emerging pandemics from highly pathogenic IAV strains such as H5N1 and pandemic H1N1 highlight the need for universal, cross-protective vaccines. Current vaccine formulations generate strain-specific neutralizing antibodies primarily against the outer coat proteins hemagglutinin and neuraminidase. In contrast to these highly mutable proteins, internal proteins of IAV are more conserved and are a favorable target for developing vaccines that induce strong T cell responses in addition to humoral immunity. Here, we found that intranasal administration with a single dose of CpG and inactivated x31 (H3N2 reduced viral titers and partially protected mice from a heterosubtypic challenge with a lethal dose of PR8 (H1N1. Early after immunization, vaccinated mice showed increased innate immune activation with high levels of MHCII and CD86 expression on dendritic cells in both the draining lymph nodes and lungs. Three days after immunization, CD4 and CD8 cells in the lung upregulated CD69, suggesting that activated lymphocytes are present at the site of vaccine administration. The ensuing effector Th1 responses were capable of producing multiple cytokines and were present at least 30 days after immunization. Furthermore, functional memory responses were observed, as antigen specific IFN-γ+ and GrB+ cells were detected early after lethal infection. Together, this work provides evidence for using pattern recognition receptor agonists as a mucosal vaccine platform for inducing robust T cell responses capable of protecting against heterologous IAV challenges.

  2. Intranasal immunization of pigs with porcine reproductive and respiratory syndrome virus-like particles plus 2', 3'-cGAMP VacciGrade™ adjuvant exacerbates viremia after virus challenge.

    Science.gov (United States)

    Van Noort, Alexandria; Nelsen, April; Pillatzki, Angela E; Diel, Diego G; Li, Feng; Nelson, Eric; Wang, Xiuqing

    2017-04-12

    Porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failure in pregnant sows and acute respiratory disease in young pigs. It is a leading infectious agent of swine respiratory complex, which has significant negative economic impact on the swine industry. Commercial markets currently offer both live attenuated and killed vaccines; however, increasing controversy exists about their efficacy providing complete protection. Virus-like particles (VLPs) possess many desirable features of a potent vaccine candidate and have been proven to be highly immunogenic and protective against virus infections. Here we explored the efficacy of PRRSV VLPs together with the use of a novel 2', 3'-cGAMP VacciGrade™ adjuvant. Animals were immunized twice intranasally with phosphate buffered saline (PBS), PRRSV VLPs, or PRRSV VLPs plus 2', 3'-cGAMP VacciGrade™ at 2 weeks apart. Animals were challenged with PRRSV-23983 at 2 weeks post the second immunization. PRRSV specific antibody response and cytokines were measured. Viremia, clinical signs, and histological lesions were evaluated. PRRSV N protein specific antibody was detected in all animals at day 10 after challenge, but no significant difference was observed among the vaccinated and control groups. Surprisingly, a significantly higher viremia was observed in the VLPs and VLPs plus the adjuvant groups compared to the control group. The increased viremia is correlated with a higher interferon-α induction in the serum of the VLPs and the VLPs plus the adjuvant groups. Intranasal immunizations of pigs with PRRSV VLPs and VLPs plus the 2', 3'-cGAMP VacciGrade™ adjuvant exacerbates viremia. A higher level of interferon-α production, but not interferon-γ and IL-10, is correlated with enhanced virus replication. Overall, PRRSV VLPs and PRRSV VLPs plus the adjuvant fail to provide protection against PRRSV challenge. Different dose of VLPs and alternative route of vaccination such as intramuscular

  3. Single cell transcriptional analysis reveals novel innate immune cell types

    Directory of Open Access Journals (Sweden)

    Linda E. Kippner

    2014-06-01

    Full Text Available Single-cell analysis has the potential to provide us with a host of new knowledge about biological systems, but it comes with the challenge of correctly interpreting the biological information. While emerging techniques have made it possible to measure inter-cellular variability at the transcriptome level, no consensus yet exists on the most appropriate method of data analysis of such single cell data. Methods for analysis of transcriptional data at the population level are well established but are not well suited to single cell analysis due to their dependence on population averages. In order to address this question, we have systematically tested combinations of methods for primary data analysis on single cell transcription data generated from two types of primary immune cells, neutrophils and T lymphocytes. Cells were obtained from healthy individuals, and single cell transcript expression data was obtained by a combination of single cell sorting and nanoscale quantitative real time PCR (qRT-PCR for markers of cell type, intracellular signaling, and immune functionality. Gene expression analysis was focused on hierarchical clustering to determine the existence of cellular subgroups within the populations. Nine combinations of criteria for data exclusion and normalization were tested and evaluated. Bimodality in gene expression indicated the presence of cellular subgroups which were also revealed by data clustering. We observed evidence for two clearly defined cellular subtypes in the neutrophil populations and at least two in the T lymphocyte populations. When normalizing the data by different methods, we observed varying outcomes with corresponding interpretations of the biological characteristics of the cell populations. Normalization of the data by linear standardization taking into account technical effects such as plate effects, resulted in interpretations that most closely matched biological expectations. Single cell transcription

  4. Single event upset immunity of strontium bismuth tantalate ferroelectric memories

    International Nuclear Information System (INIS)

    Benedetto, J.M.; Derbenwick, G.F.; Cuchiaro, J.D.

    1999-01-01

    An embedded 1Kbit non-volatile (NV) serial memory manufactured with strontium bismuth tantalate (SBT) ferroelectric (FE) technology was shown to be immune to effects of heavy ion irradiation. The memories did not lose any data in the non-volatile mode when exposed to xenon (maximum effective LET of 128 MeV-cm 2 /mg and a total fluence of 1.5 x 10 7 ions/cm 2 ). The ferroelectric memories also did not exhibit any loss in the ability to rewrite new data into the memory bits, indicating that no significant degradation of the FE dipoles occurred as a result of the heavy ion exposure. The fast read/write times of FE memories also means that single event gate rupture is unlikely to occur in this technology

  5. Intranasal vaccination with replication defective adenovirus-5 encoding influenza hemagglutinin elicits protective immunity to homologous challenge and partial protection to heterologous challenge in pigs

    Science.gov (United States)

    Influenza A virus (IAV) is widely circulating in the swine population and causes significant economic loss. To combat IAV infection the swine industry utilizes adjuvanted whole inactivated virus (WIV) vaccines. These vaccines can provide sterilizing immunity towards homologous virus but often have l...

  6. An adenovirus vectored mucosal adjuvant augments protection of mice immunized intranasally with an adenovirus-vectored foot-and-mouth disease virus subunit vaccine

    Science.gov (United States)

    Foot-and-mouth disease virus (FMDV) is a highly contagious pathogen that causes severe morbidity and economic losses to the livestock industry in many countries. The oral and respiratory mucosae are the main ports of entry of FMDV, so the stimulation of local immunity in these tissues may help preve...

  7. Intranasal delivery of influenza subunit vaccine formulated with GEM particles as an adjuvant

    NARCIS (Netherlands)

    Saluja, Vinay; Amorij, Jean P; van Roosmalen, Maarten L; Leenhouts, Kees; Huckriede, Anke; Hinrichs, Wouter L J; Frijlink, Henderik W

    Nasal administration of influenza vaccine has the potential to facilitate influenza control and prevention. However, when administered intranasally (i.n.), commercially available inactivated vaccines only generate systemic and mucosal immune responses if strong adjuvants are used, which are often

  8. Use of a Guinea Pig-Specific Transcriptome Array for Evaluation of Protective Immunity against Genital Chlamydial Infection following Intranasal Vaccination in Guinea Pigs.

    Science.gov (United States)

    2014-12-11

    Iavazzo C, Athanasiou S, Falagas ME (2007) Single-dose azithromycin versus erythromycin or amoxicillin for Chlamydia trachomatis infection during...Influence on the antiinfectious resistance in rabbits and guinea pigs experimentally infected by Francisella tularensis and Pseudomonas aeruginosa

  9. CT of intranasal pleomorphic adenoma

    Energy Technology Data Exchange (ETDEWEB)

    Clark, M.; Fatterpekar, G.M.; Mukherji, S.K.; Buenting, J. [Department of Radiology, 3324 Infirmary CB F 7510, University of North Carolina, School of Medicine, Chapel Hill, NC 27599-7510 (United States)

    1999-08-01

    Intranasal pleomorphic adenoma is rare. We report the CT features this tumor in a 41-year-old woman who presented to us with right nasal obstruction and a 2-day history of epistaxis. (orig.) With 3 figs., 9 refs.

  10. Intranasal delivery of antipsychotic drugs.

    Science.gov (United States)

    Katare, Yogesh K; Piazza, Justin E; Bhandari, Jayant; Daya, Ritesh P; Akilan, Kosalan; Simpson, Madeline J; Hoare, Todd; Mishra, Ram K

    2017-06-01

    Antipsychotic drugs are used to treat psychotic disorders that afflict millions globally and cause tremendous emotional, economic and healthcare burdens. However, the potential of intranasal delivery to improve brain-specific targeting remains unrealized. In this article, we review the mechanisms and methods used for brain targeting via the intranasal (IN) route as well as the potential advantages of improving this type of delivery. We extensively review experimental studies relevant to intranasal delivery of therapeutic agents for the treatment of psychosis and mental illnesses. We also review clinical studies in which intranasal delivery of peptides, like oxytocin (7 studies) and desmopressin (1), were used as an adjuvant to antipsychotic treatment with promising results. Experimental animal studies (17) investigating intranasal delivery of mainstream antipsychotic drugs have revealed successful targeting to the brain as suggested by pharmacokinetic parameters and behavioral effects. To improve delivery to the brain, nanotechnology-based carriers like nanoparticles and nanoemulsions have been used in several studies. However, human studies assessing intranasal delivery of mainstream antipsychotic drugs are lacking, and the potential toxicity of nanoformulations used in animal studies has not been explored. A brief discussion of future directions anticipates that if limitations of low aqueous solubility of antipsychotic drugs can be overcome and non-toxic formulations used, IN delivery (particularly targeting specific tissues within the brain) will gain more importance moving forward given the inherent benefits of IN delivery in comparison to other methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Enhancement of Intranasal Vaccination in Mice with Deglycosylated Chain A Ricin by LTR72, a Novel Mucosal Adjuvant

    Science.gov (United States)

    2006-03-15

    in developing and applying adjuvants that can enhance mucosal immunity. Parenteral administration of aluminum (alum) hydroxide or phosphate (the... intramuscular immunization. Infect Immun 1999;67:4276–9. [16] O’Hagen DT, Rappuoli R. Novel delivery systems for intranasal immunization with inactivated

  12. Intranasal H5N1 vaccines, adjuvanted with chitosan derivatives, protect ferrets against highly pathogenic influenza intranasal and intratracheal challenge.

    Directory of Open Access Journals (Sweden)

    Alex J Mann

    Full Text Available We investigated the protective efficacy of two intranasal chitosan (CSN and TM-CSN adjuvanted H5N1 Influenza vaccines against highly pathogenic avian Influenza (HPAI intratracheal and intranasal challenge in a ferret model. Six groups of 6 ferrets were intranasally vaccinated twice, 21 days apart, with either placebo, antigen alone, CSN adjuvanted antigen, or TM-CSN adjuvanted antigen. Homologous and intra-subtypic antibody cross-reacting responses were assessed. Ferrets were inoculated intratracheally (all treatments or intranasally (CSN adjuvanted and placebo treatments only with clade 1 HPAI A/Vietnam/1194/2004 (H5N1 virus 28 days after the second vaccination and subsequently monitored for morbidity and mortality outcomes. Clinical signs were assessed and nasal as well as throat swabs were taken daily for virology. Samples of lung tissue, nasal turbinates, brain, and olfactory bulb were analysed for the presence of virus and examined for histolopathological findings. In contrast to animals vaccinated with antigen alone, the CSN and TM-CSN adjuvanted vaccines induced high levels of antibodies, protected ferrets from death, reduced viral replication and abrogated disease after intratracheal challenge, and in the case of CSN after intranasal challenge. In particular, the TM-CSN adjuvanted vaccine was highly effective at eliciting protective immunity from intratracheal challenge; serologically, protective titres were demonstrable after one vaccination. The 2-dose schedule with TM-CSN vaccine also induced cross-reactive antibodies to clade 2.1 and 2.2 H5N1 viruses. Furthermore ferrets immunised with TM-CSN had no detectable virus in the respiratory tract or brain, whereas there were signs of virus in the throat and lungs, albeit at significantly reduced levels, in CSN vaccinated animals. This study demonstrated for the first time that CSN and in particular TM-CSN adjuvanted intranasal vaccines have the potential to protect against significant

  13. Single-cell Analysis of Lambda Immunity Regulation

    DEFF Research Database (Denmark)

    Bæk, Kristoffer Torbjørn; Svenningsen, Sine Lo; Eisen, Harvey

    2003-01-01

    We have examined expression of the ¿cI operon in single cells via a rexgfp substitution. Although average fluorescence agreed with expectations for expression of ¿-repressor, fluorescence fluctuated greatly from cell-to-cell. Fluctuations in repressor concentration are not predicted by previous m...

  14. Intranasal sedatives in pediatric dentistry.

    Science.gov (United States)

    AlSarheed, Maha A

    2016-09-01

    To identify the intranasal (IN) sedatives used to achieve conscious sedation during dental procedures amongst children. A literature review was conducted by identifying relevant studies through searches on Medline. Search included IN of midazolam, ketamine, sufentanil, dexmedetomidine, clonidine, haloperidol, and loranzepam. Studies included were conducted amongst individuals below 18 years, published in English, and were not restricted by year. Exclusion criteria were articles that did not focus on pediatric dentistry.  Twenty studies were included. The most commonly used sedatives were midazolam, followed by ketamine and sufentanil. Onset of action for IN midazolam was 5-15 minutes (min), however, IN ketamine was faster (mean 5.74 min), while both IN sufentanil (mean 20 min) and IN dexmedetomidine (mean 25 min) were slow in comparison. Midazolam was effective for modifying behavior in mild to moderately anxious children, however, for more invasive or prolonged procedures, stronger sedatives, such as IN ketamine, IN sufentanil were recommended. In addition, ketamine fared better in overall success rate (89%) when compared with IN midazolam (69%). Intranasal dexmedetomidine was only used as pre-medication amongst children. While its' onset of action is longer when compared with IN midazolam, it produced deeper sedation at the time of separation from the parent and at the time of anesthesia induction. Intranasal midazolam, ketamine, and sufentanil are effective and safe for conscious sedation, while intranasal midazolam, dexmedetomidine, and sufentanil have proven to be effective premedications.

  15. Intranasal sedatives in pediatric dentistry

    Science.gov (United States)

    AlSarheed, Maha A.

    2016-01-01

    Objectives: To identify the intranasal (IN) sedatives used to achieve conscious sedation during dental procedures amongst children. Methods: A literature review was conducted by identifying relevant studies through searches on Medline. Search included IN of midazolam, ketamine, sufentanil, dexmedetomidine, clonidine, haloperidol and loranzepam. Studies included were conducted amongst individuals below 18 years, published in English, and were not restricted by year. Exclusion criteria were articles that did not focus on pediatric dentistry. Results: Twenty studies were included. The most commonly used sedatives were midazolam, followed by ketamine and sufentanil. Onset of action for IN midazolam was 5-15 minutes (min), however, IN ketamine was faster (mean 5.74 min), while both IN sufentanil (mean 20 min) and IN dexmedetomidine (mean 25 min) were slow in comparison. Midazolam was effective for modifying behavior in mild to moderately anxious children, however, for more invasive or prolonged procedures, stronger sedatives, such as IN ketamine, IN sufentanil were recommended. In addition, ketamine fared better in overall success rate (89%) when compared with IN midazolam (69%). Intranasal dexmedetomidine was only used as pre-medication amongst children. While its’ onset of action is longer when compared with IN midazolam, it produced deeper sedation at the time of separation from the parent and at the time of anesthesia induction. Conclusion: Intranasal midazolam, ketamine and sufentanil are effective and safe for conscious sedation, while intranasal midazolam, dexmedetomidine and sufentanil have proven to be effective premedications. PMID:27570849

  16. Deposition of intranasal glucocorticoids--preliminary study.

    Science.gov (United States)

    Rapiejko, Piotr; Sosnowski, Tomasz R; Sova, Jarosław; Jurkiewicz, Dariusz

    2015-01-01

    Intranasal glucocorticoids are the treatment of choice in the therapy of rhinitis. The differences in efficiency of particular medications proven by therapeutic index may result from differences in composition of particular formulations as well as from diverse deposition in nasal cavities. Intranasal formulations of glucocorticoids differ in volume of a single dose in addition to variety in density, viscosity and dispenser nozzle structure. The aim of this report was to analyze the deposition of most often used intranasal glucocorticoids in the nasal cavity and assessment of the usefulness of a nose model from a 3D printer reflecting anatomical features of a concrete patient. Three newest and most often used in Poland intranasal glucocorticoids were chosen to analysis; mometasone furoate (MF), fluticasone propionate (FP) and fluticasone furoate (FF). Droplet size distribution obtained from the tested formulations was determined by use of a laser aerosol spectrometer Spraytec (Malvern Instruments, UK). The model of the nasal cavity was obtained using a 3D printer. The printout was based upon a tridimensional reconstruction of nasal cavity created on the basis of digital processing of computed tomography of paranasal sinuses. The deposition of examined medications was established by a method of visualization combined with image analysis using commercial substance which colored itself intensively under the influence of water being the dominant ingredient of all tested preparations. On the basis of obtained results regions of dominating deposition of droplets of intranasal medication on the wall and septum of the nasal cavity were compared. Droplet size of aerosol of tested intranasal medications typically lies within the range of 25-150 µm. All tested medications deposited mainly on the anterior part of inferior turbinate. FP preparation deposited also on the anterior part of the middle nasal turbinate, marginally embracing a fragment of the central part of this

  17. Long-term immunity in young adults after a single dose of inactivated Hepatitis A vaccines.

    Science.gov (United States)

    Orr, Nadav; Klement, Eyal; Gillis, David; Sela, Tamar; Kayouf, Raid; Derazne, Estela; Grotto, Itamar; Balicer, Ran; Huerta, Michael; Aviram, Lisa; Ambar, Ruhama; Epstein, Yoram; Heled, Yuval; Cohen, Dani

    2006-05-15

    We evaluated in a prospective study the immune response of naïve subjects to a single dose of inactivated Hepatitis A vaccine. Ninety-seven percent of the vaccinees sero-converted 1 month after vaccination and 93% were still positive 2 years later. All of the vaccinees had a strong booster response 2 years after the single dose. Avaxim was more immunogenic than Vaqta for the primary dose (p = 0.01 for sero-positivity, p<0.001 for antibody level) but no differences were found after boosting with Avaxim. Performance of intense physical activity during the first month after a single vaccine dose was associated with lower antibody levels (p = 0.004). This study indicates that a single dose of inactivated HAV vaccine elicits protective immune memory for at least 2 years.

  18. Acute Physiological and Behavioral Effects of Intranasal Methamphetamine in Humans

    Science.gov (United States)

    Hart, Carl L; Gunderson, Erik W; Perez, Audrey; Kirkpatrick, Matthew G; Thurmond, Andrew; Comer, Sandra D; Foltin, Richard W

    2016-01-01

    Intranasal methamphetamine abuse has increased dramatically in the past decade, yet only one published study has investigated its acute effects under controlled laboratory conditions. Thus, the current study examined the effects of single-dose intranasal methamphetamine administration on a broad range of behavioral and physiological measures. Eleven nontreatment-seeking methamphetamine abusers (two females, nine males) completed this four-session, in-patient, within-participant, double-blind study. During each session, one of four intranasal methamphetamine doses (0, 12, 25, and 50 mg/70 kg) was administered and methamphetamine plasma concentrations, cardiovascular, subjective, and psychomotor/cognitive performance effects were assessed before drug administration and repeatedly thereafter. Following drug administration, methamphetamine plasma concentrations systematically increased for 4 h postdrug administration then declined. Methamphetamine dose dependently increased cardiovascular measures and ‘positive’ subjective effects, with peaks occurring approximately 5–15 min after drug administration, when plasma levels were still ascending. In addition, cognitive performance on less complicated tasks was improved by all active methamphetamine doses, whereas performance on more complicated tasks was improved only by the intermediate doses (12 and 25 mg). These results show that intranasal methamphetamine produced predictable effects on multiple behavioral and physiological measures before peak plasma levels were observed. Of interest is the dissociation between methamphetamine plasma concentrations with cardiovascular measures and positive subjective effects, which might have important implications for potential toxicity after repeated doses. PMID:17851535

  19. Nanogel antigenic protein-delivery system for adjuvant-free intranasal vaccines

    Science.gov (United States)

    Nochi, Tomonori; Yuki, Yoshikazu; Takahashi, Haruko; Sawada, Shin-Ichi; Mejima, Mio; Kohda, Tomoko; Harada, Norihiro; Kong, Il Gyu; Sato, Ayuko; Kataoka, Nobuhiro; Tokuhara, Daisuke; Kurokawa, Shiho; Takahashi, Yuko; Tsukada, Hideo; Kozaki, Shunji; Akiyoshi, Kazunari; Kiyono, Hiroshi

    2010-07-01

    Nanotechnology is an innovative method of freely controlling nanometre-sized materials. Recent outbreaks of mucosal infectious diseases have increased the demands for development of mucosal vaccines because they induce both systemic and mucosal antigen-specific immune responses. Here we developed an intranasal vaccine-delivery system with a nanometre-sized hydrogel (`nanogel') consisting of a cationic type of cholesteryl-group-bearing pullulan (cCHP). A non-toxic subunit fragment of Clostridium botulinum type-A neurotoxin BoHc/A administered intranasally with cCHP nanogel (cCHP-BoHc/A) continuously adhered to the nasal epithelium and was effectively taken up by mucosal dendritic cells after its release from the cCHP nanogel. Vigorous botulinum-neurotoxin-A-neutralizing serum IgG and secretory IgA antibody responses were induced without co-administration of mucosal adjuvant. Importantly, intranasally administered cCHP-BoHc/A did not accumulate in the olfactory bulbs or brain. Moreover, intranasally immunized tetanus toxoid with cCHP nanogel induced strong tetanus-toxoid-specific systemic and mucosal immune responses. These results indicate that cCHP nanogel can be used as a universal protein-based antigen-delivery vehicle for adjuvant-free intranasal vaccination.

  20. Coccyx fractures treated with intranasal calcitonin.

    Science.gov (United States)

    Foye, Patrick M; Shupper, Peter; Wendel, Ian

    2014-01-01

    Treating pain associated with acute coccyx fractures can be challenging. Intranasal calcitonin has been used to treat acute pain after vertebral fracture, and may even accelerate fracture healing. However, intranasal calcitonin has never previously been published as part of the treatment of acute coccyx fractures. To examine a series of cases in which intranasal calcitonin was used to treat coccydynia related to coccyx fractures. Case series and literature review. Outpatient university-based coccyx pain center. After use of intranasal calcitonin, pain levels decreased, adverse events were minimal, and the medication was generally well tolerated. As this is not a randomized control trial, the patients treated with intranasal calcitonin were not compared to a control group. Additionally, the sample size of 8 patients is relatively small. We propose that clinicians consider use of intranasal calcitonin for the treatment of pain due to acute coccyx fractures.

  1. Intranasal insulin therapy: the clinical realities

    DEFF Research Database (Denmark)

    Hilsted, J; Madsbad, Sten; Hvidberg, A

    1995-01-01

    To evaluate metabolic control and safety parameters (hypoglycaemia frequency and nasal mucosa physiology), 31 insulin-dependent diabetic patients were treated with intranasal insulin at mealtimes for 1 month and with subcutaneous fast-acting insulin at meals for another month in an open, crossover...... was low, since intranasal insulin doses were approximately 20 times higher than subcutaneous doses. The frequency of hypoglycaemia was similar during intranasal and subcutaneous insulin therapy, and nasal mucosa physiology was unaffected after intranasal insulin. We conclude that due to low...

  2. Update on Intranasal Medications in Rhinosinusitis.

    Science.gov (United States)

    Snidvongs, Kornkiat; Thanaviratananich, Sanguansak

    2017-07-01

    This review describes beneficial effects and adverse events of various intranasal medications in treating rhinosinusitis. Application of intranasal steroids has been described in treating all subtypes of adult rhinosinusitis, but reports are limited in pediatrics and mostly in acute pediatric subgroups resulted in benefits While saline irrigation is effective for patients with chronic rhinosinusitis without polyps and in pediatric acute rhinosinusitis, there is no evidence yet for saline drips and sprays. Application of intranasal antifungals and nasal irrigation with surfactant brings more harm than benefits. There is no evidence supporting the use of intranasal antibiotics. We also review influence of devices, methods, and patient head position on nasal and paranasal sinus drug delivery.

  3. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual

  4. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against things like measles, ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  5. Intranasal Inactivated Influenza Vaccines: a Reasonable Approach to Improve the Efficacy of Influenza Vaccine?

    Science.gov (United States)

    Tamura, Shin-Ichi; Ainai, Akira; Suzuki, Tadaki; Kurata, Takeshi; Hasegawa, Hideki

    2016-01-01

    Influenza is a contagious, acute respiratory disease caused by the influenza virus. The mucosal lining in the host respiratory tract is not only the site of virus infection, but also the site of defense; it is at this site that the host immune response targets the virus and protects against reinfection. One of the most effective methods to prevent influenza is to induce specific antibody (Ab) responses in the respiratory tract by vaccination. Two types of influenza vaccines, intranasal live attenuated influenza virus (LAIV) vaccines and parenteral (injectable) inactivated vaccines, are currently used worldwide. These vaccines are approved by the European Medicines Agency (EMA) and the US Food and Drug Administration. Live attenuated vaccines induce both secretory IgA (S-IgA) and serum IgG antibodies (Abs), whereas parenteral vaccines induce only serum IgG Abs. However, intranasal administration of inactivated vaccines together with an appropriate adjuvant induces both S-IgA and IgG Abs. Several preclinical studies on adjuvant-combined, nasal-inactivated vaccines revealed that nasal S-IgA Abs, a major immune component in the upper respiratory tract, reacted with homologous virus hemagglutinin (HA) and were highly cross-reactive with viral HA variants, resulting in protection and cross-protection against infection by both homologous and variant viruses, respectively. Serum-derived IgG Abs, which are present mainly in the lower respiratory tract, are less cross-reactive and cross-protective. In addition, our own clinical trials have shown that nasal-inactivated whole virus vaccines, including a built-in adjuvant (single-stranded RNA), induced serum hemagglutination inhibition (HI) Ab titers that fulfilled the EMA criteria for vaccine efficacy. The nasal-inactivated whole virus vaccines also induced high levels of nasal HI and neutralizing Ab titers, although we have not yet evaluated the nasal HI titers due to the lack of official criteria to establish efficacy based

  6. Comparison of dexmedetomidine versus midazolam for intranasal ...

    African Journals Online (AJOL)

    not cause mucosal stimulation, making it suitable for intranasal administration in paediatric patients.9,10. Objective. The aim of this study was to compare the effect of dexmedetomidine versus midazolam for intranasal premedication in children posted for elective surgery on preoperative anxiety, sedation, heart rate.

  7. Persistence of Immunity Acquired after a Single Dose of Rubella Vaccine in Japan.

    Science.gov (United States)

    Okafuji, Takao; Okafuji, Teruo; Nakayama, Tetsuo

    2016-05-20

    To date, Takahashi, Matsuura, and TO-336 strains of live-attenuated rubella vaccine have been used in Japan. Japan implemented a single-dose rubella vaccination program until 2006. However, few reports are available on the persistence of immunity after this vaccination program. We collected 276 serum samples from January 2009 to December 2011 at Okafuji Pediatric Clinic and assessed the immune status of these samples against rubella virus during 1-10 years after vaccination with a single dose of Takahashi rubella vaccine. Regional outbreak of rubella did not occur during 1999-2011. The collected serum samples were tested for antibodies against the rubella virus by performing a standard hemagglutination inhibition (HAI) test. Our results showed that all the tested serum samples contained antibodies against the rubella virus 10 years after the vaccination. Geometric mean titer of HAI antibodies was 1:180 and decreased to 1:68 at 10 years after the vaccination. The levels of HAI antibodies decreased logarithmically with time after the vaccination. In conclusion, vaccine-acquired immunity after vaccination with a single dose of live-attenuated Takahashi rubella vaccine was retained for at least 10 years when rubella was under regional control.

  8. Relationship between single-event upset immunity and fabrication processes of recent memories

    International Nuclear Information System (INIS)

    Nemoto, N.; Shindou, H.; Kuboyama, S.; Matsuda, S.; Itoh, H.; Okada, S.; Nashiyama, I.

    1999-01-01

    Single-Event upset (SEU) immunity for commercial devices were evaluated by irradiation tests using high-energy heavy ions. We show test results and describe the relationship between observed SEU and structures/fabrication processes. We have evaluated single-even upset (SEU) tolerance of recent commercial memory devices using high energy heavy ions in order to find relationship between SEU rate and their fabrication process. It was revealed that the change of the process parameter gives much effect for the SEU rate of the devices. (authors)

  9. Immune response of gilts to single and double infection with porcine epidemic diarrhea virus.

    Science.gov (United States)

    Srijangwad, Anchalee; Stott, Christopher James; Temeeyasen, Gun; Senasuthum, Raweewan; Chongcharoen, Wanchai; Tantituvanont, Angkana; Nilubol, Dachrit

    2017-07-01

    Immune response of gilts following single and double infection with porcine epidemic diarrhea virus (PEDV) at gilt acclimatization and prepartum were investigated. One hundred PEDV-naïve gilts were divided into two groups: negative (Neg) and feedback (FB) groups. Antibody responses in serum, colostrum, and milk samples were measured by IgG/IgA ELISA and virus neutralization assay (VN). Fecal shedding was investigated using RT-PCR. In summary, a single infection at gilt acclimatization resulted in slightly increased serum antibody titers as determined by VN assay and IgG ELISA, but not by IgA ELISA. Viral RNA was detected in fecal samples up to 6 days post-exposure. A double infection at prepartum resulted in significantly increased IgA and VN titers in milk samples compared to the single-infection group. No fecal shedding was detected following the double infection.

  10. Residual effects of intranasal methamphetamine on sleep, mood, and performance

    Science.gov (United States)

    Perez, Audrey; Kirkpatrick, Matthew G.; Gunderson, Erik W.; Marrone, Gina; Silver, Rae; Foltin, Richard W.; Hart, Carl L.

    2008-01-01

    Although intranasal methamphetamine abuse has increased, there are no published data investigating the residual effects of the drug under controlled conditions. Thus, the current study examined the residual effects of single-dose intranasal methamphetamine administration on a broad range of behavioral and physiological measures. Non-treatment seeking methamphetamine abusers (n = 11) completed this two-week, in-patient, within-participant, double-blind study. The study consisted of 4 two-day blocks of sessions; each block was separated by at least 24 hrs. At approximately 1000 hrs, on the first day of each block, participants received one of four intranasal methamphetamine doses (0, 12, 25, 50 mg/70 kg). Lights were turned out at 2300 hrs that evening and sleep measures were assessed. On the morning of the second day of each block, methamphetamine plasma levels, cardiovascular measures, mood, subjective reports of the previous evening's sleep, and psychomotor performance were assessed to determine residual drug effects. The larger methamphetamine doses (25 and 50 mg) markedly disrupted subjective measures of that night's sleep and some indices of next-day mood, but only the largest dose (50 mg) dose decreased objective measures of that night's sleep and increased next-day physiological measures. Methamphetamine did not produce any negative residual effects on early next-day performance. Future studies should assess methamphetamine-related residual effects following repeated doses administered over consecutive days. PMID:18078723

  11. Life-threatening infectious diseases of childhood: single-gene inborn errors of immunity?

    Science.gov (United States)

    Alcaïs, Alexandre; Quintana-Murci, Lluis; Thaler, David S; Schurr, Erwin; Abel, Laurent; Casanova, Jean-Laurent

    2010-12-01

    The hypothesis that inborn errors of immunity underlie infectious diseases is gaining experimental support. However, the apparent modes of inheritance of predisposition or resistance differ considerably among diseases and among studies. A coherent genetic architecture of infectious diseases is lacking. We suggest here that life-threatening infectious diseases in childhood, occurring in the course of primary infection, result mostly from individually rare but collectively diverse single-gene variations of variable clinical penetrance, whereas the genetic component of predisposition to secondary or reactivation infections in adults is more complex. This model is consistent with (i) the high incidence of most infectious diseases in early childhood, followed by a steady decline; (ii) theoretical modeling of the impact of monogenic or polygenic predisposition on the incidence distribution of infectious diseases before reproductive age; (iii) available molecular evidence from both monogenic and complex genetics of infectious diseases in children and adults; (iv) current knowledge of immunity to primary and secondary or latent infections; (v) the state of the art in the clinical genetics of noninfectious pediatric and adult diseases; and (vi) evolutionary data for the genes underlying single-gene and complex disease risk. With the recent advent of new-generation deep resequencing, this model of single-gene variations underlying severe pediatric infectious diseases is experimentally testable. © 2010 New York Academy of Sciences.

  12. Development and evaluation of chitosan microspheres for tetanus, diphtheria and divalent vaccines: a comparative study of subcutaneous and intranasal administration in mice.

    Science.gov (United States)

    Hashem, Fahima M; Fahmy, Sahar A; El-Sayed, Aly M; Al-Sawahli, Majid M

    2013-01-01

    There is a need to use the new technologies to induce immunity with minimum number of vaccination sessions to ensure compliance with reducing cost. To develop single shot vaccines of tetanus, diphtheria and divalent toxoids microsphere's formulations and to induce their immune response after intranasal and subcutaneous administration in mice. The microspheres were prepared using different concentrations of chitosan. Microsphere's morphology, particle size analysis, encapsulation efficiency and antigen integrity were performed and the best formulations were selected for in vitro and in vivo testing in mice. The developed microspheres have a yield percent of 70.3-91.5%. In vitro release of antigens indicated that tetanus release was increased up to 75 and 81% post T5 and TD5 formulations respectively, whereas diphtheria cumulative release increased up to 74 and 69% post D3 and TD5, respectively. Antibody levels produced were lower than that obtained from alum adsorbed vaccine but higher than the minimum level required to induce immunogenicity (>0.01 IU/mL). The subcutaneous route of administration was superior over the intranasal route in producing higher antibody levels. Chitosan microspheres were developed successfully and prove that chitosan represents a good candidate for vaccines delivery.

  13. Intranasal Coadministration of the Cry1Ac Protoxin with Amoebal Lysates Increases Protection against Naegleria fowleri Meningoencephalitis

    Science.gov (United States)

    Rojas-Hernández, Saúl; Rodríguez-Monroy, Marco A.; López-Revilla, Rubén; Reséndiz-Albor, Aldo A.; Moreno-Fierros, Leticia

    2004-01-01

    Cry1Ac protoxin has potent mucosal and systemic adjuvant effects on antibody responses to proteins or polysaccharides. In this work, we examined whether Cry1Ac increased protective immunity against fatal Naegleria fowleri infection in mice, which resembles human primary amoebic meningoencephalitis. Higher immunoglobulin G (IgG) than IgA anti-N. fowleri responses were elicited in the serum and tracheopulmonary fluids of mice immunized by the intranasal or intraperitoneal route with N. fowleri lysates either alone or with Cry1Ac or cholera toxin. Superior protection against a lethal challenge with 5 × 104 live N. fowleri trophozoites was achieved for immunization by the intranasal route. Intranasal immunization of N. fowleri lysates coadministered with Cry1Ac increased survival to 100%; interestingly, immunization with Cry1Ac alone conferred similar protection to that achieved with amoebal lysates alone (60%). When mice intranasally immunized with Cry1Ac plus lysates were challenged with amoebae, both IgG and IgA mucosal responses were rapidly increased, but only the increased IgG response persisted until day 60 in surviving mice. The brief rise in the level of specific mucosal IgA does not exclude the role that this isotype may play in the early defense against this parasite, since higher IgA responses were detected in nasal fluids of mice intranasally immunized with lysates plus either Cry1Ac or cholera toxin, which, indeed, were the treatments that provided the major protection levels. In contrast, serum antibody responses do not seem to be related to the protection level achieved. Both acquired and innate immune systems seem to play a role in host defense against N. fowleri infection, but further studies are required to elucidate the mechanisms involved in protective effects conferred by Cry1Ac, which may be a valuable tool to improve mucosal vaccines. PMID:15271892

  14. Economic analysis of the single-dose immunization strategy against hepatitis A in Argentina.

    Science.gov (United States)

    Vizzotti, C; Pippo, T; Urueña, A; Altuna, J; Palópoli, G; Hernández, M L; Artola, M F; Fernández, H; Orellano, P; Cañero-Velasco, M C; Ciocca, M; Ramonet, M; Diosque, M

    2015-05-07

    Vaccination against hepatitis A (HA) was carried out only as part of a limited outbreak control strategy in Argentina until June 2005, when universal immunization in infants was introduced into the national immunization calendar. A single-dose strategy was chosen instead of the standard two-dose schedule used elsewhere. This study aimed to estimate preventive, medical, and non-medical costs related to HA and to compare these costs in the periods before and after mass vaccination. A retrospective analysis estimated treatment costs of HA and unspecified hepatitis cases reported to the National Health Surveillance System from 2000 to 2010. Costs related to immunization, fulminant hepatitis (FH), liver transplantation, and death were projected as well. Using a social perspective and a healthcare system perspective, costs in two 5-year periods were compared: 2000-2004 versus 2006-2010. Finally, we evaluated the impact of different discount rates, FH risk, and exclusion of unspecified hepatitis cases in the sensitivity analysis. Total HA and unspecified hepatitis cases decreased from 157,871 in 2000-2004 to 17,784 in 2006-2010. Medical and non-medical costs decreased from US$11,811,600 and US$30,118,222 to US$1,252,694 and US$4,995,895 in those periods, respectively. Immunization costs increased from US$6,506,711 to US$40,912,132. Total preventive, medical, and non-medical costs decreased from US$48,436,534 to US$47,160,721, representing a 2.6% reduction in total costs between the two periods. When a healthcare system perspective was considered or unspecified hepatitis cases were excluded, total costs were 130.2% and 30.8% higher in 2006-2010 than in the previous period, respectively. After implementation of the universal single-dose vaccination against HA in infants in Argentina, an impressive decline was observed in HA cases, with a decrease in medical and non-medical costs in the first 5 years. The single-dose strategy, which is simpler and less expensive than the

  15. Comparative immune study on cutaneous leishmaniasis patients with single and multiple sores.

    Science.gov (United States)

    Al-Qadhi, Ban Noori; Musa, Israa Salim; Al-Mulla Hummadi, Yassir Mustafa Kamal

    2015-09-01

    Ninety-five Iraqi patients with cutaneous leishmaniasis (CL) caused by Leishmania tropica at AL-Karama Hospital in Baghdad were included in this study. Sixty patients were with single sore and the remaining with multiple sores. The study also included 10 atopic patients and 30 healthy individuals as a control group. Cellular and humoral immune response at different stages of the disease activity (early and late) were evaluated by estimation of serum IFN-γ, IL-4 and total IgE antibodies using ELISA kits while, the detection of specific anti leishmanial IgE antibodies was done manually. Specific IgE antibodies were only detected in early CL (<2 months) patients 68 (71.57 %) while, were not detected in late CL, atopic and healthy controls 30 (100 %). The results also showed a positive relationship between this antibody and the number of sores. Th-2 predominates during the early stage of the disease then shifts to Th-1 that proceed in the late stage, but both cytokines increased in CL patients in comparison to control group. The immune response of CL infection is possibly regulated by both Th-1 and Th-2. Multiple sores patients showed an increase of anti leishmanial IgE (0.120 ± 0.014), total IgE (120.7 ± 39.58 IU/ml), IFN-γ (87.4 ± 30.52 pg/ml) and IL-4 (63.70 ± 20.32 pg/ml) levels than single sore patients with mean value of 0.108 ± 0.14, 92.3 ± 35.23 IU/ml, 47.2 ± 27.80 pg/ml and 51.04 ± 15.0 pg/ml respectively. It can be presented also as ratio of INF-γ/IL-4 = 1.37 which is greater than those for single sore 0.9. These results indicated that the immune response of multiple sores patient's is higher than that with single sores.

  16. Comparison of desmopressin (DDAVP tablet and intranasal spray in the treatment of central diabetes insipidus

    Directory of Open Access Journals (Sweden)

    "Bagher Larijani

    2005-07-01

    Full Text Available Desmoperssin is the drug of choice for treatment of central diabetes insipidus and most commonly it is used as intranasal spray. In this study, efficacy and side effects of oral desmopressin was compared with the intranasal spray. This study was before -after clinical trial on 14 outpatients (9 F, 5 M, age 14 -50 Y with central diabetes insipidus who had been treated with intranasal spray of desmopressin previously. Weight, pulse rate and blood pressure (sitting -standing, biochemical profile, serum electrolytes, 24h urine volume, specific gravity of urine and LFT was measured before and after 1 month study. Starting dose for each patient was one oral tablet of DDAVP (0.1 mg per 8 hours. Paired Samples T-Test was used for data analysis. No clinically significant changes were found as regard to weight, pulse rate, blood pressure, blood chemistry, electrolyte and urinalysis. Single reported adverse effect was headache (43% in tablet group and dyspnea (7% in spray group. Both dosage forms were able to control diurnal polyuria and nocturnal polyuria. The antidiuretic dose - equivalence ratio for intranasal to oral desmopressin was 1: 18. Spray was superior in terms of rapid onset of action and duration of antidiuretic action in 100% and 78% of cases (not significant, respectively. Tablets were more available and much more easily consumed as reported by patients, in 86% (P=0.0006. Treatment with tablets offers a good alternative to the intranasal route, especially in patients with chronic rhinitis or common cold and similar conditions.

  17. Population Pharmacokinetics of Intranasal Scopolamine

    Science.gov (United States)

    Wu, L.; Chow, D. S. L.; Putcha, L.

    2013-01-01

    Introduction: An intranasal gel dosage formulation of scopolamine (INSCOP) was developed for the treatment of Space Motion Sickness (SMS).The bioavailability and pharmacokinetics (PK) was evaluated using data collected in Phase II IND protocols. We reported earlier statistically significant gender differences in PK parameters of INSCOP at a dose level of 0.4 mg. To identify covariates that influence PK parameters of INSCOP, we examined population covariates of INSCOP PK model for 0.4 mg dose. Methods: Plasma scopolamine concentrations versus time data were collected from 20 normal healthy human subjects (11 male/9 female) after a 0.4 mg dose. Phoenix NLME was employed for PK analysis of these data using gender, body weight and age as covariates for model selection. Model selection was based on a likelihood ratio test on the difference of criteria (-2LL). Statistical significance for base model building and individual covariate analysis was set at P less than 0.05{delta(-2LL)=3.84}. Results: A one-compartment pharmacokinetic model with first-order elimination best described INSCOP concentration ]time profiles. Inclusion of gender, body weight and age as covariates individually significantly reduced -2LL by the cut-off value of 3.84(P less than 0.05) when tested against the base model. After the forward stepwise selection and backward elimination steps, gender was selected to add to the final model which had significant influence on absorption rate constant (ka) and the volume of distribution (V) of INSCOP. Conclusion: A population pharmacokinetic model for INSCOP has been identified and gender was a significant contributing covariate for the final model. The volume of distribution and Ka were significantly higher in males than in females which confirm gender-dependent pharmacokinetics of scopolamine after administration of a 0.4 mg dose.

  18. Enhancing the Immune Response to Recombinant Plague Antigens

    Science.gov (United States)

    2007-05-01

    protection against rotavirus infection of mice stimulated by intranasal immunization with chimeric VP4 or VP6 protein. J Virol 1999;73(9):7574–81. [13] Choi...McNeal MM, Rae MN, Bean JA, Ward RL. Antibody-dependent and -independent protection following intranasal immunization of mice with rotavirus particles. J...Williamson ED, Sharp GJ, Eley SM, Vesey PM, Pepper TC, Titball RW, et al. Local and systemic immune response to a microencapsu- lated sub-unit vaccine for

  19. Broadly Neutralizing Activity of Zika Virus-Immune Sera Identifies a Single Viral Serotype

    Directory of Open Access Journals (Sweden)

    Kimberly A. Dowd

    2016-08-01

    Full Text Available Recent epidemics of Zika virus (ZIKV have been associated with congenital malformation during pregnancy and Guillain-Barré syndrome. There are two ZIKV lineages (African and Asian that share >95% amino acid identity. Little is known regarding the ability of neutralizing antibodies elicited against one lineage to protect against the other. We investigated the breadth of the neutralizing antibody response following ZIKV infection by measuring the sensitivity of six ZIKV strains to neutralization by ZIKV-confirmed convalescent human serum or plasma samples. Contemporary Asian and early African ZIKV strains were similarly sensitive to neutralization regardless of the cellular source of virus. Furthermore, mouse immune serum generated after infection with African or Asian ZIKV strains was capable of neutralizing homologous and heterologous ZIKV strains equivalently. Because our study only defines a single ZIKV serotype, vaccine candidates eliciting robust neutralizing antibody responses should inhibit infection of both ZIKV lineages, including strains circulating in the Americas.

  20. Demonstration of analgesic effect of intranasal ketamine and intranasal fentanyl for postoperative pain after pediatric tonsillectomy.

    Science.gov (United States)

    Yenigun, Alper; Yilmaz, Sinan; Dogan, Remzi; Goktas, Seda Sezen; Calim, Muhittin; Ozturan, Orhan

    2018-01-01

    Tonsillectomy is one of the oldest and most commonly performed surgical procedure in otolaryngology. Postoperative pain management is still an unsolved problem. In this study, our aim is to demonstrate the efficacy of intranasal ketamine and intranasal fentanyl for postoperative pain relief after tonsillectomy in children. This randomized-controlled study was conducted to evaluate the effects of intranasal ketamine and intranasal fentanyl in children undergoing tonsillectomy. Tonsillectomy performed in 63 children were randomized into three groups. Group I received: Intravenous paracetamol (10 mg/kg), Group II received intranasal ketamine (1.5 mg/kg ketamine), Group III received intranasal fentanyl (1.5 mcg/kg). The Children's Hospital of Eastern Ontario Pain Scale (CHEOPS) and Wilson sedation scale scores were recorded at 15, 30, 60 min, 2 h, 6hr, 12 h and 24 h postoperatively. Patients were interviewed on the day after surgery to assess the postoperative pain, nightmares, hallucinations, nausea, vomiting and bleeding. Intranasal ketamine and intranasal fentanyl provided significantly stronger analgesic affects compared to intravenous paracetamol administration at postoperative 15, 30, 60 min and at 2, 6, 12 and 24 h in CHEOPS (p fentanyl and intravenous paracetamol in Wilson Sedation Scale (p fentanyl were more effective than paracetamol for postoperative analgesia after pediatric tonsillectomy. Sedative effects were observed in three patients with the group of intranasal ketamine. There was no significant difference in the efficacy of IN Ketamine and IN Fentanyl for post-tonsillectomy pain. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Surgical treatment of a canine intranasal meningoencephalocele.

    Science.gov (United States)

    Martlé, Valentine A; Caemaert, Jacques; Tshamala, Mulenda; Van Soens, Iris; Bhatti, Sofie F M; Gielen, Ingrid; Piron, Koen; Chiers, Koen; Tiemessen, Ilse; Van Ham, Luc M

    2009-06-01

    To report the clinical signs, diagnosis, and surgical treatment of an intranasal meningoencephalocele in a dog. Case report. Female Border collie, 5 months old. A right intranasal meningoencephalocele was identified by computed tomography and magnetic resonance imaging. The lesion was approached by a modified transfrontal craniotomy. Surgical closure of the defect at the level of the cribriform plate and removal of extruded brain tissue resulted in regression of lacrimation and coincided with absence of seizuring. Treatment with phenobarbital was gradually reduced and stopped at 7 months after surgery. At 28 months the dog remained free of seizures. Meningoencephalocele, although rare, can cause seizures in dogs and can be treated surgically. A transfrontal craniotomy with excision of the meningoencephalocele and closure of the defect can be an effective treatment for an intranasal meningoencephalocele in dogs.

  2. Safety and immunogenicity of an intranasal Shigella flexneri 2a Invaplex 50 vaccine.

    Science.gov (United States)

    Riddle, Mark S; Kaminski, Robert W; Williams, Carlos; Porter, Chad; Baqar, Shahida; Kordis, Alexis; Gilliland, Theron; Lapa, Joyce; Coughlin, Melissa; Soltis, Chris; Jones, Erica; Saunders, Jackie; Keiser, Paul B; Ranallo, Ryan T; Gormley, Robert; Nelson, Michael; Turbyfill, K Ross; Tribble, David; Oaks, Edwin V

    2011-09-16

    Shigella flexneri 2a lipopolysaccharide 50 is a nasally delivered subunit vaccine consisting of a macromolecular complex composed of LPS, IpaB, IpaC and IpaD. The current study examined vaccine safety and immunogenicity across a dose range and the clinical performance of a new intranasal delivery device. Volunteers (N=36) were randomized to receive vaccine via the Dolphin™ (Valois of America, Congers, New York) intranasal spray device at one of three doses (240, 480, and 690 μg) on days 0, 14, and 28. Another group (N=8) received the 240 μg dose via pipette. Vaccine safety was actively monitored and antigen-specific humoral and mucosal immune responses were determined. There were no serious adverse events and the majority of adverse events (98%) were mild. Antibody secreting cells (ASC), plasma, and mucosal immune responses to Shigella antigens were detected at all three dose levels with the 690 μg dose inducing the highest magnitude and frequency of responses. Vaccination with comparable doses of Invaplex 50 via the Dolphin™ resulted in higher plasma and ASC immune responses as compared to pipette delivery. In this trial the S. flexneri 2a Invaplex 50 vaccine was safe, well-tolerated and induced robust levels of antigen-specific intestinal IgA and ASC responses. The spray device performed well and offered an advantage over pipette intranasal delivery. Published by Elsevier Ltd.

  3. Efficacy of vaccination strategies against intranasal challenge with Brucella abortus in BALB/c mice.

    Science.gov (United States)

    Surendran, Naveen; Sriranganathan, Nammalwar; Lawler, Heather; Boyle, Stephen M; Hiltbold, Elizabeth M; Heid, Bettina; Zimmerman, Kurt; Witonsky, Sharon G

    2011-03-24

    Brucellosis is a zoonotic disease affecting 500,000 people worldwide annually. Inhalation of aerosol containing a pathogen is one of the major routes of disease transmission in humans. Currently there are no licensed human vaccines available. Brucella abortus strain RB51 is a USDA approved live attenuated vaccine against cattle brucellosis. In a mouse model, strain RB51 over-expressing superoxide dismutase (SOD) administered intraperitoneally (IP) has been shown to be more protective than strain RB51 against an IP challenge with B. abortus pathogenic strain 2308. However, there is lack of information on the ability of these vaccine strains to protect against intranasal challenge. With the long-term goal of developing a protective vaccine for animals and people against respiratory challenge of Brucella spp., we tested a number of different vaccination strategies against intranasal infection with strain 2308. We employed strains RB51 and RB51SOD to assess the efficacy of route, dose, and prime-boost strategies against strain 2308 challenge. Despite using multiple protocols to enhance mucosal and systemic protection, neither rough RB51 vaccine strains provided respiratory protection against intranasal pathogenic Brucella infection. However, intranasal (IN) administration of B. abortus vaccine strain 19 induced significant (p≤0.05) pulmonary clearance of strain 2308 upon IN challenge infection compared to saline. Further studies are necessary to address host-pathogen interaction in the lung microenvironment and elucidate immune mechanisms to enhance protection against aerosol infection. Published by Elsevier Ltd.

  4. Salivary Oxytocin Concentrations in Males following Intranasal Administration of Oxytocin: A Double-Blind, Cross-Over Study.

    Science.gov (United States)

    Daughters, Katie; Manstead, Antony S R; Hubble, Kelly; Rees, Aled; Thapar, Anita; van Goozen, Stephanie H M

    2015-01-01

    The use of intranasal oxytocin (OT) in research has become increasingly important over the past decade. Although researchers have acknowledged a need for further investigation of the physiological effects of intranasal administration, few studies have actually done so. In the present double-blind cross-over study we investigated the longevity of a single 24 IU dose of intranasal OT measured in saliva in 40 healthy adult males. Salivary OT concentrations were significantly higher in the OT condition, compared to placebo. This significant difference lasted until the end of testing, approximately 108 minutes after administration, and peaked at 30 minutes. Results showed significant individual differences in response to intranasal OT administration. To our knowledge this is the largest and first all-male within-subjects design study to demonstrate the impact of intranasal OT on salivary OT concentrations. The results are consistent with previous research in suggesting that salivary OT is a valid matrix for OT measurement. The results also suggest that the post-administration 'wait-time' prior to starting experimental tasks could be reduced to 30 minutes, from the 45 minutes typically used, thereby enabling testing during peak OT concentrations. Further research is needed to ascertain whether OT concentrations after intranasal administration follow similar patterns in females, and different age groups.

  5. Salivary Oxytocin Concentrations in Males following Intranasal Administration of Oxytocin: A Double-Blind, Cross-Over Study.

    Directory of Open Access Journals (Sweden)

    Katie Daughters

    Full Text Available The use of intranasal oxytocin (OT in research has become increasingly important over the past decade. Although researchers have acknowledged a need for further investigation of the physiological effects of intranasal administration, few studies have actually done so. In the present double-blind cross-over study we investigated the longevity of a single 24 IU dose of intranasal OT measured in saliva in 40 healthy adult males. Salivary OT concentrations were significantly higher in the OT condition, compared to placebo. This significant difference lasted until the end of testing, approximately 108 minutes after administration, and peaked at 30 minutes. Results showed significant individual differences in response to intranasal OT administration. To our knowledge this is the largest and first all-male within-subjects design study to demonstrate the impact of intranasal OT on salivary OT concentrations. The results are consistent with previous research in suggesting that salivary OT is a valid matrix for OT measurement. The results also suggest that the post-administration 'wait-time' prior to starting experimental tasks could be reduced to 30 minutes, from the 45 minutes typically used, thereby enabling testing during peak OT concentrations. Further research is needed to ascertain whether OT concentrations after intranasal administration follow similar patterns in females, and different age groups.

  6. Hepatitis A vaccine. A new convenient single-dose schedule with booster when long-term immunization is warranted

    DEFF Research Database (Denmark)

    Victor, J; Knudsen, J D; Nielsen, L P

    1994-01-01

    A total of 162 anti-HAV-negative healthy adults were immunized with a single high dose (1440 ELISA units = 1 ml) of inactivated hepatitis A vaccine and a booster was given at month 6. Antibodies were measured after modification of a commercial ELISA kit, enabling quantification of titres down to 6...

  7. Safety of intranasal human insulin: a review.

    Science.gov (United States)

    Schmid, Vera; Kullmann, Stephanie; Gfrörer, Wieland; Hund, Verena; Hallschmid, Manfred; Lipp, Hans-Peter; Häring, Hans-Ulrich; Preissl, Hubert; Fritsche, Andreas; Heni, Martin

    2018-03-06

    The nasal application of human insulin is frequently used for investigating brain insulin action. It is utilized in studies on the physiological role of insulin in the human brain as well as in therapeutic interventional trials and its effects have been investigated after both acute and long-term administration. This review aimed to assess the safety of intranasal human insulin in human studies and the temporal stability of nasal insulin sprays. The electronic search was performed using MEDLINE. We selected original research on intranasal human insulin without further additives in humans. The studies included could be of any design as long as they used human intranasal insulin as their study product. All outcomes and adverse side effects were excerpted. Thirty-eight studies on 1092 persons with acute application and 18 studies on 832 persons with treatment lasting between 21 days and 9.7 years were identified. No cases of symptomatic hypoglycemia or severe adverse events were reported. Transient local side effects in the nasal area were frequently experienced after intranasal insulin and placebo spray, while other adverse events were less commonly reported. There are no reports of subjects who were excluded due to adverse events. No instances of temporal stability of nasal insulin were reported in the literature. Tests on insulin that had been repacked into spray flasks revealed that it had a chemical stability of up to 57 days. Our retrospective review of published studies on intranasal insulin did not reveal any safety concerns. There is, however, insufficient data to ensure long-term safety of this modality of chronic insulin administration. Improved insulin preparations that cause less nasal irritation would be desirable for future treatment. This article is protected by copyright. All rights reserved.

  8. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  9. Intranasally administered Endocine formulated 2009 pandemic influenza H1N1 vaccine induces broad specific antibody responses and confers protection in ferrets.

    Science.gov (United States)

    Maltais, Anna-Karin; Stittelaar, Koert J; Veldhuis Kroeze, Edwin J B; van Amerongen, Geert; Dijkshoorn, Marcel L; Krestin, Gabriel P; Hinkula, Jorma; Arwidsson, Hans; Lindberg, Alf; Osterhaus, Albert D M E

    2014-05-30

    Influenza is a contagious respiratory disease caused by an influenza virus. Due to continuous antigenic drift of seasonal influenza viruses, influenza vaccines need to be adjusted before every influenza season. This allows annual vaccination with multivalent seasonal influenza vaccines, recommended especially for high-risk groups. There is a need for a seasonal influenza vaccine that induces broader and longer lasting protection upon easy administration. Endocine is a lipid-based mucosal adjuvant composed of endogenous lipids found ubiquitously in the human body. Intranasal administration of influenza antigens mixed with this adjuvant has been shown to induce local and systemic immunity as well as protective efficacy against homologous influenza virus challenge in mice. Here we used ferrets, an established animal model for human influenza virus infections, to further investigate the potential of Endocine as an adjuvant. Intranasal administration of inactivated pandemic H1N1/California/2009 split antigen or whole virus antigen mixed with Endocine induced high levels of serum hemagglutination inhibition (HI) and virus neutralization (VN) antibody titers that were also cross reactive against distant swine viruses of the same subtype. HI and VN antibody titers were already demonstrated after a single nasal immunization. Upon intratracheal challenge with a homologous challenge virus (influenza virus H1N1/The Netherlands/602/2009) immunized ferrets were fully protected from virus replication in the lungs and largely protected against body weight loss, virus replication in the upper respiratory tract and pathological changes in the respiratory tract. Endocine formulated vaccines containing split antigen induced higher HI and VN antibody responses and better protection from body weight loss and virus shedding in the upper respiratory tract than the Endocine formulated vaccine containing whole virus antigen. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All

  10. Therapy of respiratory viral infections with intranasal siRNAs.

    Science.gov (United States)

    Barik, Sailen; Lu, Patrick

    2015-01-01

    Chemically synthesized short interfering RNA (siRNA) has ushered a new era in the application of RNA interference (RNAi) against viral genes. We have paid particular attention to respiratory viruses that wreak heavy morbidity and mortality worldwide. The clinically significant ones include respiratory syncytial virus (RSV), parainfluenza virus (PIV) (two Paramyxoviruses), and influenza virus (an Orthomyxovirus). As the infection by these viruses is clinically restricted to the respiratory tissues, mainly the lungs, the logical route for the application of the siRNA was also the same, i.e., via the nasal route. Following the initial success of single intranasal siRNA against RSV, we now offer two new strategies: (1) second-generation siRNAs, used against the paramyxoviral RNA polymerase large subunit (L), (2) siRNA cocktail with a novel transfection reagent, used against influenza virus. Based on these results, we propose the following consensus for designing intranasal antiviral siRNAs: (a) modified 19-27 nt-long double-stranded siRNAs are functional in the lung, (b) excessive 2'-OMe and 2'-F modifications in either or both strands of these siRNAs reduce efficacy, (c) limited modifications in the sense strand are beneficial, although their precise efficacy may be position-dependent, (d) cocktail of multiple siRNAs can be highly effective against multiple viral strains and subtypes.

  11. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  12. Selection of similar single domain antibodies from two immune VHH libraries obtained from two alpacas by using different selection methods.

    Science.gov (United States)

    Li, Tengfei; Vandesquille, Matthias; Bay, Sylvie; Dhenain, Marc; Delatour, Benoît; Lafaye, Pierre

    2017-08-01

    The two most used methods to select camelid single-domain antibody-fragments (VHHs) are: displaying their repertoires on the surface of filamentous bacteriophages (phage display) or linking them to ribosomes (ribosome display). In this study, we compared specific VHHs isolated from two different immune libraries coming from two different alpacas by using these two selection methods. Three anti-GFAP (glial fibrillary acidic protein) VHHs were derived from an immune library obtained by ribosome display after immunization of one alpaca with purified GFAP, a protein expressed by astroglial cells. In parallel, three other anti-GFAP VHHs were derived from an immune library by phage display after immunization of another alpaca with a human brain tissue extract containing GFAP. All the VHHs were closely related and one VHH was found to be strictly identical in both studies. This highlights the selection pressure exerted by the camelid immune system to shape the paratope of an antibody against a defined antigen. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  13. Protective immune response of oral rabies vaccine in stray dogs, corsacs and steppe wolves after a single immunization.

    Science.gov (United States)

    Zhugunissov, K; Bulatov, Ye; Taranov, D; Yershebulov, Z; Koshemetov, Zh; Abduraimov, Ye; Kondibayeva, Zh; Samoltyrova, A; Amanova, Zh; Khairullin, B; Sansyzbay, A

    2017-11-01

    In this study the safety and protective immunity of an oral rabies vaccine, based on the live, modified rabies virus strain VRC-RZ2, was examined in stray dogs (Canis Sp.), corsacs (Vulpes corsac) and steppe wolves (Canis lupus campestris). In the safety group (dogs, n=6; corsacs, n=3; wolves, n=3) which was vaccinated with a 10-times field dose/animal, no animals showed any signs of disease or changes in behavior or appetite during the period of clinical observation, similar to the animals in the negative control group. Saliva samples taken from animals prior and post (5 th and 10 th days) vaccination failed to demonstrate rabies virus antigen. Observations of immunogenicity in vaccinated carnivores (dogs, corsacs and wolves) during a 180 day period showed the titers of virus neutralizing antibodies (VNA) in the blood sera of vaccinated dogs to be within 0.59-1.37 IU/mL. On 14 days post vaccination (dpv), all the wild carnivores had detectable levels of neutralizing antibodies, with mean titers ranging from 0.50 ± 0.07 IU/mL (for wolves) to 0.59 ± 0.10 IU/mL (for corsacs). Weeks after vaccination, all the vaccinated wolves and corsacs had higher levels of neutralizing antibodies: 0.70 ± 0.10 - 0.71 ± 0.08 IU/mL at 30 dpv, 1.06 ± 0.08 - 1.28 ± 0.21 IU/mL at 60 dpv and 0.41 ± 0.09 - 047 ± 0.06 at 180 dpv. The highest level of VNA (˃1.0 IU/ml) was detected at 60 dpv, in all vaccinated animals. After challenge all vaccinated dogs remained healthy for 180 days. Control animals (unvaccinated dogs) developed symptoms of rabies on day 6 post administration of a virulent virus and died of rabies on days 11-13. Of note, the VNA titers in all the wild carnivores (corsacs and wolves) immunized with VRC-RZ2 were higher than 0.5 IU/ml (0.59 ± 0.11 IU/ml), even as early as 14 days post vaccination. These, presumably protective, titers of antibodies to rabies virus were present in the dogs and wild carnivores examined in this study for at

  14. A single-item global job satisfaction measure is associated with quantitative blood immune indices in white-collar employees.

    Science.gov (United States)

    Nakata, Akinori; Irie, Masahiro; Takahashi, Masaya

    2013-01-01

    Although a single-item job satisfaction measure has been shown to be reliable and inclusive as multiple-item scales in relation to health, studies including immunological data are few. The purpose of this study was to evaluate the validity of single-item job and family life satisfaction based on its association with immune indices. A total of 189 white-collar employees (70% men) underwent a blood draw for the measurement of natural killer (NK), total T, and B cell counts as well as plasma immunoglobulin (Ig) G concentrations and completed single-item job and family life satisfaction measures, respectively. The response options for satisfaction measures were 'dissatisfied' (coded 1) to 'satisfied' (coded 4). Spearman's partial correlations controlling for cofactors revealed that increased job satisfaction was positively associated with NK cells (rsp=0.201, p=0.007) and IgG (rsp=0.178, p=0.018), while family life satisfaction was unrelated to immune indices. Those who reported a combination of low job/low family life satisfaction had significantly lower NK and higher B cell counts than those with a high job/high family life satisfaction. Our study suggests that the single-item summary measure of job satisfaction, but not family life satisfaction, may be a valid tool to evaluate immune status in healthy white-collar employees.

  15. Isotonic saline nasal irrigation is an effective adjunctive therapy to intranasal corticosteroid spray in allergic rhinitis.

    Science.gov (United States)

    Nguyen, Shaun A; Psaltis, Alkis J; Schlosser, Rodney J

    2014-01-01

    This study was designed to determine if the addition of large-volume, low-positive pressure nasal irrigations delivered with isotonic sodium chloride (hereinafter "saline") added to intranasal corticosteroid therapy improves quality of life and objective measures of nasal breathing in patients with allergic rhinitis when compared with intranasal corticosteroid alone. A prospective, unblinded, single-arm pilot study was performed of patients with allergic rhinitis already on intranasal corticosteroid pharmacotherapy. Patients added large-volume low-pressure saline irrigation twice daily for 8 weeks to their ongoing regiment of nasal corticosteroid. Mini-Rhinoconjunctivitis Quality of life Questionnaire (mRQLQ) assessment and nasal peak inspiratory flow (NPIF) were performed at baseline and at 4 and 8 weeks. A total of 40 patients were enrolled. Twice-daily nasal irrigation with isotonic saline significantly (p irrigation with isotonic saline is an effective adjunctive therapy to improve quality of life in patients with allergic rhinitis already on intranasal corticosteroid therapy. This study was a part of the clinical trial NCT01030146 registered at clinicaltrials.gov.

  16. Use of intranasal corticosteroids in adenotonsillar hypertrophy.

    Science.gov (United States)

    Sakarya, E U; Bayar Muluk, N; Sakalar, E G; Senturk, M; Aricigil, M; Bafaqeeh, S A; Cingi, C

    2017-05-01

    This review examined the efficacy of intranasal corticosteroids for improving adenotonsillar hypertrophy. The related literature was searched using PubMed and Proquest Central databases. Adenotonsillar hypertrophy causes mouth breathing, nasal congestion, hyponasal speech, snoring, obstructive sleep apnoea, chronic sinusitis and recurrent otitis media. Adenoidal hypertrophy results in the obstruction of nasal passages and Eustachian tubes, and blocks the clearance of nasal mucus. Adenotonsillar hypertrophy and obstructive sleep apnoea are associated with increased expression of various mediators of inflammatory responses in the tonsils, and respond to anti-inflammatory agents such as corticosteroids. Topical nasal steroids most likely affect the anatomical component by decreasing inspiratory upper airway resistance at the nasal, adenoidal or tonsillar levels. Corticosteroids, by their lympholytic or anti-inflammatory effects, might reduce adenotonsillar hypertrophy. Intranasal corticosteroids reduce cellular proliferation and the production of pro-inflammatory cytokines in a tonsil and adenoid mixed-cell culture system. Intranasal corticosteroids have been used in adenoidal hypertrophy and adenotonsillar hypertrophy patients, decreasing rates of surgery for adenotonsillar hypertrophy.

  17. Frequency of single nucleotide polymorphisms of some immune response genes in a population sample from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Léa Campos de Oliveira

    2011-09-01

    Full Text Available Objective: To present the frequency of single nucleotide polymorphismsof a few immune response genes in a population sample from SãoPaulo City (SP, Brazil. Methods: Data on allele frequencies ofknown polymorphisms of innate and acquired immunity genes werepresented, the majority with proven impact on gene function. Datawere gathered from a sample of healthy individuals, non-HLA identicalsiblings of bone marrow transplant recipients from the Hospital dasClínicas da Faculdade de Medicina da Universidade de São Paulo,obtained between 1998 and 2005. The number of samples variedfor each single nucleotide polymorphism analyzed by polymerasechain reaction followed by restriction enzyme cleavage. Results:Allele and genotype distribution of 41 different gene polymorphisms,mostly cytokines, but also including other immune response genes,were presented. Conclusion: We believe that the data presentedhere can be of great value for case-control studies, to define whichpolymorphisms are present in biologically relevant frequencies and toassess targets for therapeutic intervention in polygenic diseases witha component of immune and inflammatory responses.

  18. Transethmoidal intranasal meningoencephalocele in an adult with recurrent meningitis.

    Science.gov (United States)

    Hasegawa, Takafumi; Sugeno, Naoto; Shiga, Yusei; Takeda, Atsushi; Karibe, Hiroshi; Tominaga, Teiji; Itoyama, Yasuto

    2005-08-01

    Intranasal meningoencephalocele is a rarely encountered congenital malformation. We report a case of transethmoidal intranasal meningoencephalocele in a 52-year old man with recurrent purulent meningitis. After treatment of the acute meningitis, frontal craniotomy followed by the removal of the stalk of the meningoencephalocele and repair of the bony defect was successfully performed. He has had no further meningitis or CSF rhinorrhea post-operatively. Detailed neuroradiological examination and appropriate surgical treatment are important to prevent fatal neurological complications of intranasal meningoencephalocele.

  19. First-in-Human Evaluation of the Safety and Immunogenicity of an Intranasally Administered Replication-Competent Sendai Virus–Vectored HIV Type 1 Gag Vaccine: Induction of Potent T-Cell or Antibody Responses in Prime-Boost Regimens

    Science.gov (United States)

    Nyombayire, Julien; Anzala, Omu; Gazzard, Brian; Karita, Etienne; Bergin, Philip; Hayes, Peter; Kopycinski, Jakub; Omosa-Manyonyi, Gloria; Jackson, Akil; Bizimana, Jean; Farah, Bashir; Sayeed, Eddy; Parks, Christopher L.; Inoue, Makoto; Hironaka, Takashi; Hara, Hiroto; Shu, Tsugumine; Matano, Tetsuro; Dally, Len; Barin, Burc; Park, Harriet; Gilmour, Jill; Lombardo, Angela; Excler, Jean-Louis; Fast, Patricia; Laufer, Dagna S.; Cox, Josephine H.

    2017-01-01

    Background. We report the first-in-human safety and immunogenicity assessment of a prototype intranasally administered, replication-competent Sendai virus (SeV)–vectored, human immunodeficiency virus type 1 (HIV-1) vaccine. Methods. Sixty-five HIV-1–uninfected adults in Kenya, Rwanda, and the United Kingdom were assigned to receive 1 of 4 prime-boost regimens (administered at 0 and 4 months, respectively; ratio of vaccine to placebo recipients, 12:4): priming with a lower-dose SeV-Gag given intranasally, followed by boosting with an adenovirus 35–vectored vaccine encoding HIV-1 Gag, reverse transcriptase, integrase, and Nef (Ad35-GRIN) given intramuscularly (SLA); priming with a higher-dose SeV-Gag given intranasally, followed by boosting with Ad35-GRIN given intramuscularly (SHA); priming with Ad35-GRIN given intramuscularly, followed by boosting with a higher-dose SeV-Gag given intranasally (ASH); and priming and boosting with a higher-dose SeV-Gag given intranasally (SHSH). Results. All vaccine regimens were well tolerated. Gag-specific IFN-γ enzyme-linked immunospot–determined response rates and geometric mean responses were higher (96% and 248 spot-forming units, respectively) in groups primed with SeV-Gag and boosted with Ad35-GRIN (SLA and SHA) than those after a single dose of Ad35-GRIN (56% and 54 spot-forming units, respectively) or SeV-Gag (55% and 59 spot-forming units, respectively); responses persisted for ≥8 months after completion of the prime-boost regimen. Functional CD8+ T-cell responses with greater breadth, magnitude, and frequency in a viral inhibition assay were also seen in the SLA and SHA groups after Ad35-GRIN boost, compared with those who received either vaccine alone. SeV-Gag did not boost T-cell counts in the ASH group. In contrast, the highest Gag-specific antibody titers were seen in the ASH group. Mucosal antibody responses were sporadic. Conclusions. SeV-Gag primed functional, durable HIV-specific T

  20. First-in-Human Evaluation of the Safety and Immunogenicity of an Intranasally Administered Replication-Competent Sendai Virus-Vectored HIV Type 1 Gag Vaccine: Induction of Potent T-Cell or Antibody Responses in Prime-Boost Regimens.

    Science.gov (United States)

    Nyombayire, Julien; Anzala, Omu; Gazzard, Brian; Karita, Etienne; Bergin, Philip; Hayes, Peter; Kopycinski, Jakub; Omosa-Manyonyi, Gloria; Jackson, Akil; Bizimana, Jean; Farah, Bashir; Sayeed, Eddy; Parks, Christopher L; Inoue, Makoto; Hironaka, Takashi; Hara, Hiroto; Shu, Tsugumine; Matano, Tetsuro; Dally, Len; Barin, Burc; Park, Harriet; Gilmour, Jill; Lombardo, Angela; Excler, Jean-Louis; Fast, Patricia; Laufer, Dagna S; Cox, Josephine H

    2017-01-01

     We report the first-in-human safety and immunogenicity assessment of a prototype intranasally administered, replication-competent Sendai virus (SeV)-vectored, human immunodeficiency virus type 1 (HIV-1) vaccine.  Sixty-five HIV-1-uninfected adults in Kenya, Rwanda, and the United Kingdom were assigned to receive 1 of 4 prime-boost regimens (administered at 0 and 4 months, respectively; ratio of vaccine to placebo recipients, 12:4): priming with a lower-dose SeV-Gag given intranasally, followed by boosting with an adenovirus 35-vectored vaccine encoding HIV-1 Gag, reverse transcriptase, integrase, and Nef (Ad35-GRIN) given intramuscularly (S L A); priming with a higher-dose SeV-Gag given intranasally, followed by boosting with Ad35-GRIN given intramuscularly (S H A); priming with Ad35-GRIN given intramuscularly, followed by boosting with a higher-dose SeV-Gag given intranasally (AS H ); and priming and boosting with a higher-dose SeV-Gag given intranasally (S H S H ).  All vaccine regimens were well tolerated. Gag-specific IFN-γ enzyme-linked immunospot-determined response rates and geometric mean responses were higher (96% and 248 spot-forming units, respectively) in groups primed with SeV-Gag and boosted with Ad35-GRIN (S L A and S H A) than those after a single dose of Ad35-GRIN (56% and 54 spot-forming units, respectively) or SeV-Gag (55% and 59 spot-forming units, respectively); responses persisted for ≥8 months after completion of the prime-boost regimen. Functional CD8 + T-cell responses with greater breadth, magnitude, and frequency in a viral inhibition assay were also seen in the S L A and S H A groups after Ad35-GRIN boost, compared with those who received either vaccine alone. SeV-Gag did not boost T-cell counts in the AS H group. In contrast, the highest Gag-specific antibody titers were seen in the AS H group. Mucosal antibody responses were sporadic.  SeV-Gag primed functional, durable HIV-specific T-cell responses and boosted antibody

  1. Kliniske konsekvenser af intranasal insulinbehandling ved insulinkraevende diabetes mellitus

    DEFF Research Database (Denmark)

    Hilsted, J C; Madsbad, S; Rasmussen, M H

    1996-01-01

    Metabolic control, hypoglycaemia frequency and nasal mucosal physiology were evaluated in 31 insulin-dependent diabetics treated with intranasal insulin at mealtimes for one month and with subcutaneous fast-acting insulin for another month in a randomized crossover trial. During both periods...... subcutaneous doses. The frequency of hypoglycemia was similar during intranasal and subcutaneous insulin therapy, and nasal mucosal physiology was unaffected after intranasal insulin. We conclude that due to low bioavailability and to a high rate of therapeutic failure, intranasal insulin treatment...

  2. Assessment of pharmacokinetics and tolerability of intranasal diazepam relative to rectal gel in healthy adults.

    Science.gov (United States)

    Henney, Herbert R; Sperling, Michael R; Rabinowicz, Adrian L; Bream, Gary; Carrazana, Enrique J

    2014-09-01

    Diazepam rectal gel (RG) is currently the only approved rescue therapy for outpatient management of seizure clusters in the United States. There is an unmet medical need for an alternative rescue therapy for seizure clusters that is effective, and more convenient to administer with a socially acceptable method of delivery. An intranasal diazepam formulation has been developed, and this study evaluates the tolerability and bioavailability of diazepam nasal spray (NS) relative to an equivalent dose of diazepam-RG in healthy adults. Twenty-four healthy adults were enrolled in a phase 1, open-label, 3-period crossover study. Plasma diazepam and metabolite concentrations were measured by serial sampling. Dose proportionality for 5- and 20-mg intranasal doses and the bioavailability of 20mg diazepam-NS relative to 20mg diazepam-RG were assessed by maximum plasma concentration (Cmax) and systemic exposure parameters (AUC0-∞ and AUC0-24). The mean Cmax values for 20mg diazepam-NS and 20mg diazepam-RG were 378 ± 106 and 328 ± 152 ng/mL, achieved at 1.0 and 1.5h, respectively. Subjects administered intranasal and rectal gel formulations experienced nasal and rectal leakage, respectively. Diazepam absorption following intranasal administration was consistent but 3 subjects with diazepam-RG had low plasma drug levels at the earliest assessment of 5 min, due to poor retention, and were excluded from analysis. Excluding them, the treatment ratios (20mg diazepam-NS:20mg diazepam-RG) and 90% confidence intervals for diazepam Cmax and AUC0-24 were 0.98 (0.85-1.14) and 0.89 (0.80-0.98), respectively, suggesting that the bioavailability was comparable between the two formulations. Dose proportionality was observed between the lowest and highest dose-strengths of intranasal formulation. Both intranasal and rectal treatments were well tolerated with mild to moderate adverse events. Results suggest that a single-dose of 20mg diazepam-NS is tolerable and comparable in bioavailability

  3. Effects of Intranasal Oxytocin on the Interpretation and Expression of Emotions in Anorexia Nervosa.

    Science.gov (United States)

    Leppanen, J; Cardi, V; Ng, K W; Paloyelis, Y; Stein, D; Tchanturia, K; Treasure, J

    2017-03-01

    Altered social-emotional functioning is considered to play an important role in the development and maintenance of anorexia nervosa (AN). Recently, there has been increasing interest in investigating the role of intranasal oxytocin in social-emotional processing. The present study aimed to investigate the effects of intranasal oxytocin on the interpretation and expression of emotions among people with AN. Thirty women with AN and 29 age-matched healthy women took part in the present study, which used a double-blind, placebo-controlled, cross-over design. The participants received a single dose of 40 IU of intranasal oxytocin in one session and a placebo spray in the other. Fifteen minutes after administration, the participants completed the Reading the Mind in the Eyes Test to assess the interpretation of complex emotions and mental states followed by a video task, which assessed expressions of facial affect when they were viewing humorous and sad film clips. The intranasal oxytocin did not significantly influence the expression or interpretation of emotions in the AN or healthy comparison groups. The AN group expressed significantly less positive emotion, spent more time looking away and reported experiencing a significantly more negative affect in response to the film clips. The finding that intranasal oxytocin had little to no effect on the interpretation or expression of emotions in either group supports the notion that the effects of oxytocin on social-emotional processing are not straightforward and may depend on individual and environmental differences, as well as the emotion being processed. Replication of these findings is necessary to explore the effect of timing on the effects of oxytocin before firm conclusions can be drawn. Nonetheless, these findings add to the steady accumulation of evidence that people with AN have reduced emotional expression and avoidance of emotionally provoking stimuli. © 2017 The Authors. Journal of Neuroendocrinology

  4. Single-Cell RNA Sequencing Reveals T Helper Cells Synthesizing Steroids De Novo to Contribute to Immune Homeostasis

    Directory of Open Access Journals (Sweden)

    Bidesh Mahata

    2014-05-01

    Full Text Available T helper 2 (Th2 cells regulate helminth infections, allergic disorders, tumor immunity, and pregnancy by secreting various cytokines. It is likely that there are undiscovered Th2 signaling molecules. Although steroids are known to be immunoregulators, de novo steroid production from immune cells has not been previously characterized. Here, we demonstrate production of the steroid pregnenolone by Th2 cells in vitro and in vivo in a helminth infection model. Single-cell RNA sequencing and quantitative PCR analysis suggest that pregnenolone synthesis in Th2 cells is related to immunosuppression. In support of this, we show that pregnenolone inhibits Th cell proliferation and B cell immunoglobulin class switching. We also show that steroidogenic Th2 cells inhibit Th cell proliferation in a Cyp11a1 enzyme-dependent manner. We propose pregnenolone as a “lymphosteroid,” a steroid produced by lymphocytes. We speculate that this de novo steroid production may be an intrinsic phenomenon of Th2-mediated immune responses to actively restore immune homeostasis.

  5. A single social defeat transiently suppresses the anti-viral immune response in mice

    NARCIS (Netherlands)

    de Groot, Johanna; Milligen, Florine J. van; Moonen-Leusen, Bernie W.M.; Thomas, Gethin; Koolhaas, Jaap M.

    1999-01-01

    Most of the studies dealing with effects of stress on anti-viral immunity have been carried out with stressors that are of long duration and that bear little relationship to the nature of the species. In this paper, we investigated the effect of a stressor mimicking real-life situations more

  6. Iatrogenic Cushing's syndrome following short-term intranasal steroid use.

    Science.gov (United States)

    Dutta, Deep; Shivaprasad, K S; Ghosh, Sujoy; Mukhopadhyay, Satinath; Chowdhury, Subhankar

    2012-09-01

    Cushing's syndrome (CS) is common after oral steroid use and has also been reported following topical or inhaled use, but it is extremely uncommon after intranasal administration. In this paper, we present the case of a child who developed CS after intranasal application of combined moxifloxacin-dexamethasone eye drops for epistaxis for a period of 3 months. CS caused by ocular preparations of steroids has not been reported previously. This case report highlights the fact that even eye drops can contain high doses of steroids and can lead to CS especially in children and especially if used intranasally. Ocular steroid drops should not be used intranasally. To minimize gastrointestinal absorption and therefore the risk of CS, nasal sprays should be preferred over nasal drops for intranasal steroid application.

  7. Differential activation behavior of dermal dendritic cells underlies the strain-specific Th1 responses to single epicutaneous immunization.

    Science.gov (United States)

    Lee, Chih-Hung; Chen, Jau-Shiuh; Chiu, Hsien-Ching; Hong, Chien-Hui; Liu, Ching-Yi; Ta, Yng-Cun; Wang, Li-Fang

    2016-12-01

    Epicutaneous immunization with allergens is an important sensitization route for atopic dermatitis. We recently showed in addition to the Th2 response following single epicutaneous immunization, a remarkable Th1 response is induced in B6 mice, but not in BALB/c mice, mimicking the immune response to allergens in human non-atopics and atopics. We investigated the underlying mechanisms driving this differential Th1 response between BALB/c and B6 mice. We characterized dermal dendritic cells by flow cytometric analysis. We measured the induced Th1/Th2 responses by measuring the IFN-γ/IL-13 contents of supernatants of antigen reactivation cultures of lymph node cells. We demonstrate that more dermal dendritic cells with higher activation status migrate into draining lymph nodes of B6 mice compared to BALB/c mice. Dermal dendritic cells of B6 mice have a greater ability to capture protein antigen than those of BALB/c mice. Moreover, increasing the activation status or amount of captured antigen in dermal dendritic cells induced a Th1 response in BALB/c mice. Further, differential activation behavior, but not antigen-capturing ability of dermal dendritic cells between BALB/c and B6 mice is dendritic cell-intrinsic. These results show that the differential activation behavior of dermal dendritic cells underlies the strain-specific Th1 responses following single epicutaneous immunization. Furthermore, our findings highlight the potential differences between human atopics and non-atopics and provide useful information for the prediction and prevention of atopic diseases. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  8. Cationic liposome-hyaluronic acid hybrid nanoparticles for intranasal vaccination with subunit antigens.

    Science.gov (United States)

    Fan, Yuchen; Sahdev, Preety; Ochyl, Lukasz J; Akerberg, Jonathan; Moon, James J

    2015-06-28

    Here we report the development of a new cationic liposome-hyaluronic acid (HA) hybrid nanoparticle (NP) system and present our characterization of these NPs as an intranasal vaccine platform using a model antigen and F1-V, a candidate recombinant antigen for Yersinia pestis, the causative agent of plague. Incubation of cationic liposomes composed of DOTAP and DOPE with anionic HA biopolymer led to efficient ionic complexation and formation of homogenous liposome-polymer hybrid NPs, as evidenced by fluorescence resonance energy transfer, dynamic light scattering, and nanoparticle tracking analyses. Incorporation of cationic liposomes with thiolated HA allowed for facile surface decoration of NPs with thiol-PEG, resulting in the formation of DOTAP/HA core-PEG shell nanostructures. These NPs, termed DOTAP-HA NPs, exhibited improved colloidal stability and prolonged antigen release. In addition, cytotoxicity associated with DOTAP liposomes (LC50~0.2mg/ml) was significantly reduced by at least 20-fold with DOTAP-HA NPs (LC50>4mg/ml), as measured with bone marrow derived dendritic cells (BMDCs). Furthermore, NPs co-loaded with ovalbumin (OVA) and a molecular adjuvant, monophosphoryl lipid A (MPLA) promoted BMDC maturation and upregulation of co-stimulatory markers, including CD40, CD86, and MHC-II, and C57BL/6 mice vaccinated with NPs via intranasal route generated robust OVA-specific CD8(+) T cell and antibody responses. Importantly, intranasal vaccination with NPs co-loaded with F1-V and MPLA induced potent humoral immune responses with 11-, 23-, and 15-fold increases in F1-V-specific total IgG, IgG1, and IgG2c titers in immune sera by day 77, respectively, and induced balanced Th1/Th2 humoral immune responses, whereas mice immunized with the equivalent doses of soluble F1-V vaccine failed to achieve sero-conversion. Overall, these results suggest that liposome-polymer hybrid NPs may serve as a promising vaccine delivery platform for intranasal vaccination against Y

  9. Fluticasone furoate: A new intranasal corticosteroid

    Directory of Open Access Journals (Sweden)

    R Kumar

    2012-01-01

    Full Text Available Intranasal corticosteroids are recommended as one of the first-line therapies for the treatment of allergic rhinitis (AR, especially when associated with nasal congestion and recurrent symptoms. Fluticasone furoate is a novel enhanced-affinity glucocorticoid for the treatment of AR approved by the Food and Drug Administration in 2007 and recently introduced in India. Fluticasone furoate nasal spray is indicated for the treatment of the symptoms of seasonal and perennial AR in patients aged two years and older. This review summarizes the clinical data on fluticasone furoate nasal spray and discusses its role in the management of AR. Important attributes of fluticasone furoate include low systemic bioavailability (<0.5%, 24-h symptom relief with once-daily dosing, comprehensive coverage of both nasal and ocular symptoms, safety and tolerability with daily use, and availability in a side-actuated device that makes medication delivery simple and consistent. With these properties, fluticasone furoate nasal spray has the potential to enhance patient satisfaction and compliance, thus making it a good choice amongst available intranasal steroids.

  10. Prognostic Factors for Immune Thrombocytopenia Outcome in Greek Children: A Retrospective Single-Centered Analysis

    OpenAIRE

    Makis, Alexandros; Gkoutsias, Athanasios; Palianopoulos, Theodoros; Pappa, Eleni; Papapetrou, Evangelia; Tsaousi, Christina; Hatzimichael, Eleftheria; Chaliasos, Nikolaos

    2017-01-01

    Immune thrombocytopenia (ITP) in children has a varied course and according to duration is distinguished as newly diagnosed (12) types. Several studies have evaluated the prognostic factors for the progression of the disease, but similar works have yet to be performed in Greece. We aimed to identify prognostic markers for the three forms of the disease in 57 Greek children during a 13-year period. Information regarding age, gender, preceding infection, bleeding type, duration of symptoms and ...

  11. Comparison of Intranasal Outer Membrane Vesicles with Cholera Toxin and Injected MF59C.1 as Adjuvants for Malaria Transmission Blocking Antigens AnAPN1 and Pfs48/45

    Directory of Open Access Journals (Sweden)

    Michael Pritsch

    2016-01-01

    Full Text Available Purified protein vaccines often require adjuvants for efficient stimulation of immune responses. There is no licensed mucosal adjuvant on the market to adequately boost the immune response to purified antigens for intranasal applications in humans. Bacterial outer membrane vesicles (OMV are attractive candidates potentially combining antigenic and adjuvant properties in one substance. To more precisely characterize the potential of Escherichia coli OMV for intranasal vaccination with heterologous antigens, immune responses for AnAPN1 and Pfs48/45 as well as ovalbumin as a reference antigen were assessed in mice. The intranasal adjuvant cholera toxin (CT and parenteral adjuvant MF59C.1 were used in comparison. Vaccinations were administered intranasally or subcutaneously. Antibodies (total IgG and IgM as well as subclasses IgG1, IgG2a, IgG2b, and IgG3 were measured by ELISA. T cell responses (cytotoxic T cells, Th1, Th17, and regulatory T cells were determined by flow cytometry. When OMV were used as adjuvant for intranasal immunization, antibody and cellular responses against all three antigens could be induced, comparable to cholera toxin and MF59C.1. Antigen-specific IgG titres above 1 : 105 could be detected in all groups. This study provides the rationale for further development of OMV as a vaccination strategy in malaria and other diseases.

  12. Effectiveness of intranasal vaccination against Angiostrongylus costaricensis using a serine/threonine phosphatase 2 A synthetic peptide and recombinant antigens.

    Science.gov (United States)

    Solano-Parada, J; Gonzalez-Gonzalez, G; Torró, L M de Pablos; dos Santos, M F Brazil; Espino, A M; Burgos, M; Osuna, A

    2010-07-19

    Intranasal immunization was assayed in C57BL/6 mice against Angiostrongylus costaricensis using a synthetic and a recombinant peptide belonging to the catalytic region of the serine/threonine phosphatase 2 A (PP2A) of the parasite. Immunization was carried out with the synthetic peptide (SP) polymerized either with itself or with the beta fraction of the cholera toxin (CTB) and then enclosed in nanocapsules of phosphatidyl choline, cholesterol and Quil A (ISCOM). Another group of mice was immunized with recombinant peptide. Immunization consisted of two intranasal inoculations at two-week intervals, and the challenge with L3 larvae was made one month after the last vaccination. The effectiveness of immunization was evaluated 30 days after infection by analysis of the number of parasites in the arteries of the immunized mice, as well as by measuring spleen sizes in the experimental groups. The response induced was determined by identifying the isotypes of IgG as well as the IgE and IgA specific antigen response. The interleukins produced by the splenocyte culture of the different groups were assessed after exposing them to the peptide used in the immunization. From our results, 60%, 80%, and 100% protection against the A. costaricensis challenge was achieved in mice immunized with polymerized synthetic peptide in ISCOM, synthetic peptide polymerized with the CTB in ISCOM and inclusion bodies respectively. Splenomegaly was found to be less evident in the immunized mice than in the controls. A significant increase in IFN gamma and IL-17 levels was observed in the group with 100% protection. The results showed that vaccination through the nasal mucosa may constitute a useful method of immunization and result in a protective immune response against A. costaricensis. (c) 2010 Elsevier Ltd. All rights reserved.

  13. Meta-analysis of the effects of intranasal oxytocin on interpretation and expression of emotions.

    Science.gov (United States)

    Leppanen, Jenni; Ng, Kah Wee; Tchanturia, Kate; Treasure, Janet

    2017-07-01

    Accurate interpretation and appropriate expression of emotions are key aspects of social-cognition. Several mental disorders are characterised by transdiagnostic difficulties in these areas and, recently, there has been increasing interest in exploring the effects of oxytocin on social-emotional functioning. This review consists of 33 studies. Fifteen of the studies included people with autism spectrum disorder, schizophrenia, borderline personality disorder, frontotemporal dementia, anorexia nervosa, bulimia nervosa, post-traumatic stress disorder, depression, and opioid and alcohol dependence. We conducted ten meta-analyses examining the effects of intranasal oxytocin on expression of emotions, emotional theory of mind, sensitivity to recognise basic emotions, and recognition of basic emotions. A single dose of intranasal oxytocin significantly improved the recognition of basic emotions, particularly fear, and increased the expression of positive emotions among the healthy individuals. Oxytocin did not significantly influence theory of mind or the expression of negative emotions among the healthy individuals. Finally, intranasal oxytocin did not significantly influence interpretation or expression of emotions among the clinical populations. Copyright © 2017. Published by Elsevier Ltd.

  14. Mucoadhesive microemulsion of ibuprofen: design and evaluation for brain targeting efficiency through intranasal route

    Directory of Open Access Journals (Sweden)

    Surjyanarayan Mandal

    2015-09-01

    Full Text Available This study aimed at designing mucoadhesive microemulsion gel to enhance the brain uptake of Ibuprofen through intranasal route. Ibuprofen loaded mucoadhesive microemulsion (MMEI was developed by incorporating polycarbophil as mucoadhesive polymer into Capmul MCM based optimal microemulsion (MEI and was subjected to characterization, stability, mucoadhesion and naso-ciliotoxicity study. Brain uptake of ibuprofen via nasal route was studied by performing biodistribution study in Swiss albino rats. MEI was found to be transparent, stable and non ciliotoxic with 66.29 ± 4.15 nm, -20.9 ± 3.98 mV and 98.66 ± 1.01% as average globule size, zeta potential and drug content respectively. Transmission Electron Microscopy (TEM study revealed the narrow globule size distribution of MEI. Following single intranasal administration of MMEI and MEI at a dose of 2.86 mg/kg, uptake of ibuprofen in the olfactory bulb was around 3.0 and 1.7 folds compared with intravenous injection of ibuprofen solution (IDS. The ratios of AUC in brain tissues to that in plasma obtained after nasal administration of MMEI were significantly higher than those after intravenous administration of IDS. Findings of the present investigation revealed that the developed mucoadhesive microemulsion gel could be a promising approach for brain targeting of ibuprofen through intranasal route.

  15. Transmission of single HIV-1 genomes and dynamics of early immune escape revealed by ultra-deep sequencing.

    Directory of Open Access Journals (Sweden)

    Will Fischer

    2010-08-01

    Full Text Available We used ultra-deep sequencing to obtain tens of thousands of HIV-1 sequences from regions targeted by CD8+ T lymphocytes from longitudinal samples from three acutely infected subjects, and modeled viral evolution during the critical first weeks of infection. Previous studies suggested that a single virus established productive infection, but these conclusions were tempered because of limited sampling; now, we have greatly increased our confidence in this observation through modeling the observed earliest sample diversity based on vastly more extensive sampling. Conventional sequencing of HIV-1 from acute/early infection has shown different patterns of escape at different epitopes; we investigated the earliest escapes in exquisite detail. Over 3-6 weeks, ultradeep sequencing revealed that the virus explored an extraordinary array of potential escape routes in the process of evading the earliest CD8 T-lymphocyte responses--using 454 sequencing, we identified over 50 variant forms of each targeted epitope during early immune escape, while only 2-7 variants were detected in the same samples via conventional sequencing. In contrast to the diversity seen within epitopes, non-epitope regions, including the Envelope V3 region, which was sequenced as a control in each subject, displayed very low levels of variation. In early infection, in the regions sequenced, the consensus forms did not have a fitness advantage large enough to trigger reversion to consensus amino acids in the absence of immune pressure. In one subject, a genetic bottleneck was observed, with extensive diversity at the second time point narrowing to two dominant escape forms by the third time point, all within two months of infection. Traces of immune escape were observed in the earliest samples, suggesting that immune pressure is present and effective earlier than previously reported; quantifying the loss rate of the founder virus suggests a direct role for CD8 T-lymphocyte responses

  16. Initial Management of Childhood Acute Immune Thrombocytopenia: Single-Center Experience of 32 Years.

    Science.gov (United States)

    Yildiz, Inci; Ozdemir, Nihal; Celkan, Tiraje; Soylu, Selen; Karaman, Serap; Canbolat, Aylin; Dogru, Omer; Erginoz, Ethem; Apak, Hilmi

    2015-01-01

    Immune thrombocytopenia (ITP) is an acute self-limited disease of childhood, mostly resolving within 6 months irrespective of whether therapy is given or not. Treatment options when indicated include corticosteroids, intravenous immune globulin (IVIG), and anti-RhD immunoglobulin. We reviewed our 32 years' experience for first-line therapy of acute ITP. Five hundred forty-one children (mean age: 5.3 years) diagnosed and treated for ITP were evaluated retrospectively. Among 491 acute ITP patients, IVIG was used in 27%, high-dose steroids in 27%, low-dose steroids in 20%, anti-D immunoglobulin G (IgG) in 2%, and no therapy in 22%. When the initial response (platelets >50 × 10(9)/L) to first-line treatment modalities were compared, 89%, 84%, and 78% patients treated by low-dose steroids, high-dose steroids, and IVIG responded to treatment, respectively (P > .05). Mean time to recovery of platelets was 16.8, 3.8, and 3.0 days in patients treated with low-dose steroids, high-dose steroids, and IVIG, respectively (P < .0001). Thrombocytopenia recurred in 23% of low-dose steroid, 39% of high-dose steroid, and in 36% of IVIG (P < .0001) treatment groups. Of 108 patients who were observed alone, 4 (3%) had a recurrence on follow-up and only 2 of these required treatment subsequently. Recurrence was significantly less in no therapy group compared with children treated with 1 of the 3 options of pharmacotherapy (P < .0001). Response rates were similar between patients treated by IVIG and low- and high-dose steroids; however, time to response was slower in patients treated with low-dose steroids compared with IVIG and high-dose steroids.

  17. Intranasal insulin in Alzheimer's disease: Food for thought.

    Science.gov (United States)

    Chapman, Colin D; Schiöth, Helgi B; Grillo, Claudia A; Benedict, Christian

    2017-11-24

    Accumulating evidence suggests that disrupted brain insulin signaling promotes the development and progression of Alzheimer's disease (AD), driving clinicians to target this circuitry. While both traditional and more modern antidiabetics show promise in combating insulin resistance, intranasal insulin appears to be the most efficient method of boosting brain insulin. Furthermore, intranasal delivery elegantly avoids adverse effects from peripheral insulin administration. However, there remain significant open questions regarding intranasal insulin's efficacy, safety, and potential as an adjunct or mono-therapy. Thus, this review aims to critically evaluate the present evidence and future potential of intranasal insulin as a meaningful treatment for AD. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Marketing research on intranasal medicines of domestic market

    Directory of Open Access Journals (Sweden)

    B. S. Burlaka

    2016-12-01

    Full Text Available Modern development of biopharmaceutical research in world science and practice promotes the use of new dosage forms or administration routes of active substances in the human body. Recently, researchers drew attention to the use of non-invasive route of administration that can be used for new drug substances and for existing ones. Non-invasive routes of drugs’ administration have some advantages over invasive one, namely: do not damage the skin, do not require special training and conditions of use, provide the appropriate level of therapeutic efficacy of medicinal products. One of these administration routes of active substances in the human body is the intranasal one. Intranasal formulations have been known for a long time, most of them are widely used for topical treatment of various diseases of the nasal cavity. In recent decades, scientists have positive results on the use of intranasal route for regular use. Nasal medicines for systemic use are also easy to use; they do not cause irritation of the gastrointestinal tract. While intranasal route of administration the active ingredients fall directly into the general circulation and unlike enteral route they escape the first-pass elimination, which prevents the premature destruction of the drug. Objective: marketing research on registered intranasal drugs for local and systemic applications of the domestic market. Materials and Methods: Official data from the Ukrainian State Register of medicines, with details to release forms of the drug, dosage, manufacturer, country of origin and pharmacotherapeutic group has been used as a research material. Results. According to the State Register of medicinal products 226 intranasal drugs of the domestic market are recorded. Conclusions. Marketing research on intranasal drugs for local and systemic applications of the domestic market has been performed. It has been found that vast majority – 94.7% among registered intranasal drugs are the medicines

  19. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    International Nuclear Information System (INIS)

    Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

    2013-01-01

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  20. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    Science.gov (United States)

    Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

    2013-05-01

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  1. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Mott, Brittney [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States); Thamake, Sanjay [Radio-Isotope Therapy of America Foundation (United States); Vishwanatha, Jamboor; Jones, Harlan P., E-mail: harlan.jones@unthsc.edu [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States)

    2013-05-15

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 {+-} 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-{gamma} cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  2. Absorption of clonazepam after intranasal and buccal administration.

    Science.gov (United States)

    Schols-Hendriks, M W; Lohman, J J; Janknegt, R; Korten, J J; Merkus, F W; Hooymans, P M

    1995-01-01

    Serum concentrations of clonazepam after intranasal, buccal and intravenous administration were compared in a cross-over study in seven healthy male volunteers. Each subject received a 1.0 mg dose of clonazepam intranasally and buccally and 0.5 mg intravenously. A Cmax of 6.3 +/- 1.0 ng ml-1 (mean; +/- s.d.) was measured 17.5 min (median) (range 15-20 min) after intranasal administration. A second peak (4.6 +/- 1.3 ng ml-1) caused by oral absorption was seen after 1.7 h (range 0.7-3.0 h). After buccal administration a Cmax of 6.0 +/- 3.0 ng ml-1 was measured after 50 min (range 30-90 min) with a second peak of 6.5 +/- 2.5 ng ml-1 after 3.0 h (range 2.0-4.0 h). Two minutes after i.v. injection of 0.5 mg clonazepam the serum concentration was 27 +/- 18 ng ml-1. It is concluded that intranasal clonazepam is an alternative to buccal administration. However, the Cmax of clonazepam after intranasal administration is not high enough to recommend the intranasal route as an alternative to intravenous injection. PMID:7640154

  3. Non-clinical safety evaluation of intranasal iota-carrageenan.

    Directory of Open Access Journals (Sweden)

    Alexandra Hebar

    Full Text Available Carrageenan has been widely used as food additive for decades and therefore, an extended oral data set is available in the public domain. Less data are available for other routes of administration, especially intranasal administration. The current publication describes the non-clinical safety and toxicity of native (non-degraded iota-carrageenan when applied intranasally or via inhalation. Intranasally applied iota-carrageenan is a topically applied, locally acting compound with no need of systemic bioavailability for the drug's action. Animal experiments included repeated dose local tolerance and toxicity studies with intranasally applied 0.12% iota-carrageenan for 7 or 28 days in New Zealand White rabbits and nebulized 0.12% iota-carrageenan administered to F344 rats for 7 days. Permeation studies revealed no penetration of iota-carrageenan across nasal mucosa, demonstrating that iota-carrageenan does not reach the blood stream. Consistent with this, no relevant toxic or secondary pharmacological effects due to systemic exposure were observed in the rabbit or rat repeated dose toxicity studies. Data do not provide any evidence for local intolerance or toxicity, when carrageenan is applied intranasally or by inhalation. No signs for immunogenicity or immunotoxicity have been observed in the in vivo studies. This is substantiated by in vitro assays showing no stimulation of a panel of pro-inflammatory cytokines by iota-carrageenan. In conclusion, 0.12% iota-carrageenan is safe for clinical use via intranasal application.

  4. Dedicator of cytokinesis 8 mutation related combined immune deficiency: A single centre experience from India

    Directory of Open Access Journals (Sweden)

    Dhwanee Thakkar

    2017-10-01

    Full Text Available The Dedicator of cytokinesis 8 (DOCK8 related combined immune deficiency is a recently discovered entity which differs from the classic STAT3 associated autosomal dominant hyper-IgE syndrome with respect to the genetic origin and the clinical manifestations. It is characterised by increased risk of autoimmunity, malignancy and neurological complications in addition to increased risk of recurrent cutaneous, sinopulmonary and gastrointestinal infections. We report a series 11 children from three families suffering from DOCK8 related combined immunodeficiency. Out of 11 children only 5 were alive at diagnosis and rest 6 were siblings who had died of similar complaints. Among the 5 children only one underwent allogeneic haploidentical stem cell transplant (SCT from his mother but died before engraftment due to infection. Other 4 are alive without SCT but have multiple co-morbidities. A constellation of cutaneous lesions, recurrent sinopulmonary & gastro intestinal infections and allergic manifestations in a child who may have a similar family history should arouse a suspicion of combined immunodeficiency associated with DOCK8 mutation. Early diagnosis in such children can expedite the appropriate management with SCT. Keywords: Combined immunodeficiency, DOCK8, Children

  5. Prognostic Factors for Immune Thrombocytopenia Outcome in Greek Children: A Retrospective Single-Centered Analysis.

    Science.gov (United States)

    Makis, Alexandros; Gkoutsias, Athanasios; Palianopoulos, Theodoros; Pappa, Eleni; Papapetrou, Evangelia; Tsaousi, Christina; Hatzimichael, Eleftheria; Chaliasos, Nikolaos

    2017-01-01

    Immune thrombocytopenia (ITP) in children has a varied course and according to duration is distinguished as newly diagnosed (12) types. Several studies have evaluated the prognostic factors for the progression of the disease, but similar works have yet to be performed in Greece. We aimed to identify prognostic markers for the three forms of the disease in 57 Greek children during a 13-year period. Information regarding age, gender, preceding infection, bleeding type, duration of symptoms and platelets at diagnosis, treatment, disease course, and immunological markers was recorded. 39 children had newly diagnosed, 4 persistent, and 14 chronic disease. Chronic ITP children were more likely to be of age > 10 years ( p = 0.015) and have gradual initiation of the disease ( p = 0.001), platelets > 10 × 10 9 /L ( p = 0.01), and impaired immunological markers ( p < 0.003) compared to newly diagnosed/persistent groups. Recent history of infection was found mainly in the newly diagnosed/persistent group ( p = 0.013). None of the children exhibited severe spontaneous bleeding. Conclusion . Even though ITP in children usually has a self-limited course, with rare serious bleeding complications, the chronic form of the disease is characterized by different predictive parameters, which can be used in clinical practice.

  6. Prognostic Factors for Immune Thrombocytopenia Outcome in Greek Children: A Retrospective Single-Centered Analysis

    Directory of Open Access Journals (Sweden)

    Alexandros Makis

    2017-01-01

    Full Text Available Immune thrombocytopenia (ITP in children has a varied course and according to duration is distinguished as newly diagnosed (12 types. Several studies have evaluated the prognostic factors for the progression of the disease, but similar works have yet to be performed in Greece. We aimed to identify prognostic markers for the three forms of the disease in 57 Greek children during a 13-year period. Information regarding age, gender, preceding infection, bleeding type, duration of symptoms and platelets at diagnosis, treatment, disease course, and immunological markers was recorded. 39 children had newly diagnosed, 4 persistent, and 14 chronic disease. Chronic ITP children were more likely to be of age > 10 years (p=0.015 and have gradual initiation of the disease (p=0.001, platelets > 10 × 109/L (p=0.01, and impaired immunological markers (p<0.003 compared to newly diagnosed/persistent groups. Recent history of infection was found mainly in the newly diagnosed/persistent group (p=0.013. None of the children exhibited severe spontaneous bleeding. Conclusion. Even though ITP in children usually has a self-limited course, with rare serious bleeding complications, the chronic form of the disease is characterized by different predictive parameters, which can be used in clinical practice.

  7. Predictive factors for resolution of childhood immune thrombocytopenia: Experience from a single tertiary center in Thailand.

    Science.gov (United States)

    Chotsampancharoen, Thirachit; Sripornsawan, Pornpun; Duangchoo, Sarapee; Wongchanchailert, Malai; McNeil, Edward

    2017-01-01

    Initial clinical factors that can reliably predict a successful within-1-year resolution of childhood immune thrombocytopenia (ITP) are still unclear. This study aimed to determine factors associated with within-12-month resolution of newly diagnosed childhood ITP. The hospital records of 417 consecutive children aged less than 15 years with ITP were reviewed retrospectively and data related to the initial presentation were noted. Logistic regression analysis was used to determine which presenting features were associated with a favorable outcome within 12 months. Significant clinical and laboratory predictors for resolution of newly diagnosed childhood ITP within 12 months were abrupt onset less than 14 days, age less than 5 years, and platelet count at 4 weeks postdiagnosis of at least 100 × 10 9 l -1 . With these three significant predictors, the rate of within-1-year recovery was more than 97.2%, with a positive predictive value of 97.8% for newly diagnosed childhood ITP. Age less than 5 years, onset of bleeding less than 14 days, and follow-up platelet count at 4 weeks of at least 100 × 10 9 l -1 are significant predictive factors for disease resolution among children with newly diagnosed ITP. © 2016 Wiley Periodicals, Inc.

  8. Hepatitis A vaccine. A new convenient single-dose schedule with booster when long-term immunization is warranted

    DEFF Research Database (Denmark)

    Victor, J; Knudsen, J D; Nielsen, L P

    1994-01-01

    A total of 162 anti-HAV-negative healthy adults were immunized with a single high dose (1440 ELISA units = 1 ml) of inactivated hepatitis A vaccine and a booster was given at month 6. Antibodies were measured after modification of a commercial ELISA kit, enabling quantification of titres down to 6...... mIU ml-1. After 14 days, 96% of vaccinees had positive anti-HAV titres (> 20 mIU ml-1), and after 30 days all vaccinees had seroconverted. The geometric mean titres were 150 mIU ml-1 and 380 mIU ml-1 respectively. The booster dose at month 6 elicited a dramatic (25-fold) increase in antibody titres...

  9. Intranasal Oxytocin Normalizes Amygdala Functional Connectivity in Posttraumatic Stress Disorder.

    Science.gov (United States)

    Koch, Saskia B J; van Zuiden, Mirjam; Nawijn, Laura; Frijling, Jessie L; Veltman, Dick J; Olff, Miranda

    2016-07-01

    The neuropeptide oxytocin (OT) has been suggested as a promising pharmacological agent for medication-enhanced psychotherapy in posttraumatic stress disorder (PTSD) because of its anxiolytic and prosocial properties. We therefore investigated the behavioral and neurobiological effects of a single intranasal OT administration (40 IU) in PTSD patients. We conducted a randomized, placebo-controlled, cross-over resting-state fMRI study in male and female police officers with (n=37, 21 males) and without PTSD (n=40, 20 males). We investigated OT administration effects on subjective anxiety and functional connectivity of basolateral (BLA) and centromedial (CeM) amygdala subregions with prefrontal and salience processing areas. In PTSD patients, OT administration resulted in decreased subjective anxiety and nervousness. Under placebo, male PTSD patients showed diminished right CeM to left ventromedial prefrontal cortex (vmPFC) connectivity compared with male trauma-exposed controls, which was reinstated after OT administration. Additionally, female PTSD patients showed enhanced right BLA to bilateral dorsal anterior cingulate cortex (dACC) connectivity compared with female trauma-exposed controls, which was dampened after OT administration. Although caution is warranted, our findings tentatively suggest that OT has the potential to diminish anxiety and fear expression of the amygdala in PTSD, either via increased control of the vmPFC over the CeM (males) or via decreased salience processing of the dACC and BLA (females). Our findings add to accumulating evidence that OT administration could potentially enhance treatment response in PTSD.

  10. Single CRD containing lectin from Macrobrachium rosenbergii (MrLec) participates in innate immunity against pathogen infections.

    Science.gov (United States)

    Huang, Xin; Li, Wen; Jin, Min; Ma, Fu-Tong; Huang, Ying; Shi, Yan-Ru; Zhao, Ling-Ling; Feng, Jin-Ling; Ren, Qian; Wang, Wen

    2016-04-01

    As a type of pattern-recognition proteins, lectins perform important functions in the innate immunity of crustaceans, including prawns. Although several reports showed that C-type lectin domain family (CLEC) importantly functions in host-pathogen interactions, limited research has focused on CLEC in Macrobrachium rosenbergii. In the present study, a new single CRD containing CLEC (designated as MrLec) was reported in freshwater prawns, M. rosenbergii. The full-length cDNA of MrLec consisted of 1027 bp with an open reading frame of 801 bp, which encoded a peptide of 266 amino acid residues. Genomic sequence for MrLec was also obtained from the M. rosenbergii, which contain 4 exons and 3 introns. MrLec was found to contain a single carbohydrate-recognition domain with an EPN motif. MrLec was ubiquitously distributed in various tissues of a normal prawn, particularly in the hepatopancreas and gills. MrLec expression in the gills was significantly upregulated after a challenge with Vibrio parahaemolyticus and downregulated at 24 h after MrLec RNA interference (MrLec-RNAi). The expression levels of some AMPs, including antilipopolysaccharide factor 1 (Alf1) and lysozyme 2 (Lyso2), also markedly decreased after MrLec-RNAi. Recombinant MrLec can agglutinate (Ca(2+)-dependent) and bind both Gram-negative and Gram-positive bacteria. Results suggested that MrLec participates in the recognition of invading pathogens and functions in the immune response of prawn against pathogen infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Pathogenesis of infection with 2009 pandemic H1N1 influenza virus in isogenic guinea pigs after intranasal or intratracheal inoculation.

    Science.gov (United States)

    Wiersma, Lidewij C M; Vogelzang-van Trierum, Stella E; van Amerongen, Geert; van Run, Peter; Nieuwkoop, Nella J; Ladwig, Mechtild; Banneke, Stefanie; Schaefer, Hubert; Kuiken, Thijs; Fouchier, Ron A M; Osterhaus, Albert D M E; Rimmelzwaan, Guus F

    2015-03-01

    To elucidate the pathogenesis and transmission of influenza virus, the ferret model is typically used. To investigate protective immune responses, the use of inbred mouse strains has proven invaluable. Here, we describe a study with isogenic guinea pigs, which would uniquely combine the advantages of the mouse and ferret models for influenza virus infection. Strain 2 isogenic guinea pigs were inoculated with H1N1pdm09 influenza virus A/Netherlands/602/09 by the intranasal or intratracheal route. Viral replication kinetics were assessed by determining virus titers in nasal swabs and respiratory tissues, which were also used to assess histopathologic changes and the number of infected cells. In all guinea pigs, virus titers peaked in nasal secretions at day 2 after inoculation. Intranasal inoculation resulted in higher virus excretion via the nose and higher virus titers in the nasal turbinates than intratracheal inoculation. After intranasal inoculation, infectious virus was recovered only from nasal epithelium; after intratracheal inoculation, it was recovered also from trachea, lung, and cerebrum. Histopathologic changes corresponded with virus antigen distribution, being largely limited to nasal epithelium for intranasally infected guinea pigs and more widespread in the respiratory tract for intratracheally infected guinea pigs. In summary, isogenic guinea pigs show promise as a model to investigate the role of humoral and cell-mediated immunities to influenza and their effect on virus transmission. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  12. Intranasal Vaccination against Cutaneous Leishmaniasis with a Particulated Leishmanial Antigen or DNA Encoding LACK

    Science.gov (United States)

    Pinto, Eduardo Fonseca; Pinheiro, Roberta Olmo; Rayol, Alice; Larraga, Vicente; Rossi-Bergmann, Bartira

    2004-01-01

    We have previously demonstrated that oral delivery of a disease-promoting particulated antigen of Leishmania amazonensis (LaAg) partially protects mice against cutaneous leishmaniasis. In the present work, we sought to optimize a mucosal vaccine by using the intranasal route for delivery of different antigen preparations, including (i) LaAg, (ii) soluble recombinant p36/LACK leishmanial antigen (LACK), and (iii) plasmid DNA encoding LACK (LACK DNA). BALB/c mice that received two intranasal doses of 10 μg of LaAg and were challenged 1 week postvaccination with L. amazonensis developed delayed but effective control of lesion growth. A diminished parasite burden was accompanied by enhancement of both gamma interferon (IFN-γ) and interleukin-10 levels in the lesion-draining lymph nodes. The vaccine efficacy improved with time. At 4 months postvaccination, when a strong parasite-specific TH1-type response was present in vivo, the infection was controlled for at least 5 months after challenge. In contrast to the particulated LaAg, soluble LACK (10 μg/dose) had no effect. Interestingly, LACK DNA (30 μg/dose), but not empty DNA, promoted rapid and durable protective immunity. Parasite growth was effectively controlled, and at 5 months after challenge LACK-reactive cells in both the mucosal and lesion-draining lymph nodes produced high levels of IFN-γ. These results demonstrate for the first time the feasibility of using the intranasal route for long-lived memory vaccination against cutaneous leishmaniasis with adjuvant-free crude antigens or DNA. PMID:15271911

  13. Intranasal oxytocin effects on social cognition: a critique.

    Science.gov (United States)

    Evans, Simon L; Dal Monte, Olga; Noble, Pamela; Averbeck, Bruno B

    2014-09-11

    The last decade has seen a large number of published findings supporting the hypothesis that intranasally delivered oxytocin (OT) can enhance the processing of social stimuli and regulate social emotion-related behaviors such as trust, memory, fidelity, and anxiety. The use of nasal spray for administering OT in behavioral research has become a standard method, but many questions still exist regarding its action. OT is a peptide that cannot cross the blood-brain barrier, and it has yet to be shown that it does indeed reach the brain when delivered intranasally. Given the evidence, it seems highly likely that OT does affect behavior when delivered as a nasal spray. These effects may be driven by at least three possible mechanisms. First, the intranasally delivered OT may diffuse directly into the CNS where it directly engages OT receptors. Second, the intranasally delivered OT may trigger increased central release via an indirect peripheral mechanism. And third, the indirect peripheral effects may directly lead to behavioral effects via some mechanism other than increased central release. Although intranasally delivered OT likely affects behavior, there are conflicting reports as to the exact nature of those behavioral changes: some studies suggest that OT effects are not always "pro-social" and others suggest effects on social behaviors are due to a more general anxiolytic effect. In this critique, we draw from work in healthy human populations and the animal literature to review the mechanistic aspects of intranasal OT delivery, and to discuss intranasal OT effects on social cognition and behavior. We conclude that future work should control carefully for anxiolytic and gender effects, which could underlie inconsistencies in the existing literature. This article is part of a Special Issue entitled Oxytocin and Social Behav. © 2013 Published by Elsevier B.V.

  14. Decreased rhinovirus shedding after intranasal oxymetazoline application in adults with induced colds compared with intranasal saline.

    Science.gov (United States)

    Winther, Birgit; Buchert, Dagobert; Turner, Ronald B; Hendley, J Owen; Tschaikin, Marion

    2010-01-01

    Intranasal oxymetazoline (OMZ) is used as a decongestant during common colds. Recently, intracellular adhesion molecule (ICAM) 1 receptor expression in vitro has been shown to be diminished by OMZ. ICAM-1 is the major receptor used by rhinovirus to gain entry to human cells. The objective of this study was to assess the effect of OMZ on geometric mean titer of rhinovirus in nasal lavage fluid after rhinovirus inoculation. Volunteers with antibody titers of ≤1:4 to rhinovirus type 39 were enrolled in a randomized, reference-controlled, double-blind study. Beginning 3 hours after intranasal challenge with 100-300 tissue culture infectious dose (TCID)₅₀ of virus, subjects received active 0.05% OMZ (45 μL containing 22.5 μg of OMZ hydrochloride in citrate buffer) or reference control (physiological saline solution [PSS]) three times daily for 5 days. Rhinovirus was detected in fibroblast cultures. Geometric mean viral titer (log₁₀) in 34 rhinovirus-infected subjects receiving OMZ was 1.49 on day 2 compared with 2.24 in the 38 infected subjects receiving PSS (p = 0.04). On day 3, the mean titers were 1.45 and 2.08, respectively. Median length of viral shedding was 3.3 days (OMZ) and 3.4 (PSS). Duration of clinical illness was 6.1 days in both groups. Topical OMZ decreased viral titer on day 2 during experimental rhinovirus infection in normal volunteers.

  15. The efficacy of intranasal antihistamines in the treatment of allergic rhinitis.

    Science.gov (United States)

    Kaliner, Michael A; Berger, William E; Ratner, Paul H; Siegel, Charles J

    2011-02-01

    To discuss the new use of intranasal antihistamines as first-line therapies, compare and contrast this class of medication with the traditionally available medications, and discuss the potential for intranasal antihistamines to provide relief superior to second-generation oral antihistamines. Review articles and original research articles were retrieved from MEDLINE, OVID, PubMed (1950 to November 2009), personal files of articles, and bibliographies of located articles that addressed the topic of interest. Articles were selected for their relevance to intranasal antihistamines and their role in allergic rhinitis. Publications included reviews, treatment guidelines, and clinical studies (primarily randomized controlled trials) of both children and adults. This panel was charged with reviewing the place of intranasal antihistamines in the spectrum of treatment for allergic rhinitis. Intranasal antihistamines have been shown in numerous randomized, placebo-controlled trials to be more efficacious than the oral antihistamines. Although intranasal corticosteroids are considered by some to be superior to intranasal antihistamines, multiple studies have shown an equal effect of the 2 classes of medication. Both intranasal corticosteroids and intranasal antihistamines have been shown to reduce all symptoms of allergic rhinitis. In addition, some intranasal antihistamines have a more rapid onset of action than intranasal corticosteroids. The future of allergy treatment will likely involve a combination of both intranasal corticosteroids and intranasal antihistamines because of the benefits of local administration and their additive effect on efficacy. Copyright © 2011 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  16. Pulmonary exposure to single-walled carbon nanotubes does not affect the early immune response against Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Swedin Linda

    2012-05-01

    Full Text Available Abstract Background Single-walled carbon nanotubes (SWCNT trigger pronounced inflammation and fibrosis in the lungs of mice following administration via pharyngeal aspiration or inhalation. Human exposure to SWCNT in an occupational setting may occur in conjunction with infections and this could yield enhanced or suppressed responses to the offending agent. Here, we studied whether the sequential exposure to SWCNT via pharyngeal aspiration and infection of mice with the ubiquitous intracellular parasite Toxoplasma gondii would impact on the immune response of the host against the parasite. Methods C57BL/6 mice were pre-exposed by pharyngeal administration of SWCNT (80 + 80 μg/mouse for two consecutive days followed by intravenous injection with either 1x103 or 1x104 green fluorescence protein and luciferase-expressing T. gondii tachyzoites. The dissemination of T. gondii was monitored by in vivo bioluminescence imaging in real time for 7 days and by plaque formation. The inflammatory response was analysed in bronchoalveolar lavage (BAL fluid, and by assessment of morphological changes and immune responses in lung and spleen. Results There were no differences in parasite distribution between mice only inoculated with T. gondii or those mice pre-exposed for 2 days to SWCNT before parasite inoculum. Lung and spleen histology and inflammation markers in BAL fluid reflected the effects of SWCNT exposure and T. gondii injection, respectively. We also noted that CD11c positive dendritic cells but not F4/80 positive macrophages retained SWCNT in the lungs 9 days after pharyngeal aspiration. However, co-localization of T. gondii with CD11c or F4/80 positive cells could not be observed in lungs or spleen. Pre-exposure to SWCNT did not affect the splenocyte response to T. gondii. Conclusions Taken together, our data indicate that pre-exposure to SWCNT does not enhance or suppress the early immune response to T. gondii in mice.

  17. FinFET memory cell improvements for higher immunity against single event upsets

    Science.gov (United States)

    Sajit, Ahmed Sattar

    The 21st century is witnessing a tremendous demand for transistors. Life amenities have incorporated the transistor in every aspect of daily life, ranging from toys to rocket science. Day by day, scaling down the transistor is becoming an imperious necessity. However, it is not a straightforward process; instead, it faces overwhelming challenges. Due to these scaling changes, new technologies, such as FinFETs for example, have emerged as alternatives to the conventional bulk-CMOS technology. FinFET has more control over the channel, therefore, leakage current is reduced. FinFET could bridge the gap between silicon devices and non-silicon devices. The semiconductor industry is now incorporating FinFETs in systems and subsystems. For example, Intel has been using them in their newest processors, delivering potential saving powers and increased speeds to memory circuits. Memory sub-systems are considered a vital component in the digital era. In memory, few rows are read or written at a time, while the most rows are static; hence, reducing leakage current increases the performance. However, as a transistor shrinks, it becomes more vulnerable to the effects from radioactive particle strikes. If a particle hits a node in a memory cell, the content might flip; consequently, leading to corrupting stored data. Critical fields, such as medical and aerospace, where there are no second chances and cannot even afford to operate at 99.99% accuracy, has induced me to find a rigid circuit in a radiated working environment. This research focuses on a wide spectrum of memories such as 6T SRAM, 8T SRAM, and DICE memory cells using FinFET technology and finding the best platform in terms of Read and Write delay, susceptibility level of SNM, RSNM, leakage current, energy consumption, and Single Event Upsets (SEUs). This research has shown that the SEU tolerance that 6T and 8T FinFET SRAMs provide may not be acceptable in medical and aerospace applications where there is a very high

  18. Comparison of intranasal corticosteroids and antihistamines in allergic rhinitis: a review of randomized, controlled trials.

    Science.gov (United States)

    Nielsen, Lars P; Dahl, Ronald

    2003-01-01

    For several years there has been discussion of whether first-line pharmacological treatment of allergic rhinitis should be antihistamines or intranasal corticosteroids. No well documented, clinically relevant differences seem to exist for individual nonsedating antihistamines in the treatment of allergic rhinitis. Likewise, the current body of literature does not seem to favor any specific intranasal corticosteroid. When comparing efficacy of antihistamines and intranasal corticosteroids in allergic rhinitis, present data favor intranasal corticosteroids. Interestingly, data do not support antihistamines as superior in treating conjunctivitis associated with allergic rhinitis. Safety data from comparative studies in allergic rhinitis do not indicate differences between antihistamines and intranasal corticosteroids. Combining antihistamines and intranasal corticosteroids in the treatment of allergic rhinitis does not provide additional beneficial effects to intranasal corticosteroids alone. Considering present data, intranasal corticosteroids seem to offer superior relief in allergic rhinitis, when compared with antihistamines.

  19. Glucose recovery after intranasal glucagon during hypoglycaemia in man

    DEFF Research Database (Denmark)

    Hvidberg, A; Djurup, R; Hilsted, J

    1994-01-01

    We compared the hyperglycaemic effect of intranasal and intramuscular (i.m.) administration of glucagon after insulin-induced hypoglycaemia. Twelve healthy subjects were examined twice, receiving on both occasions an intravenous insulin bolus. Somatostatin and propranolol were administered to block...... endogenous glucose counterregulation, and glucose turnover was estimated by a 3-[3H]-glucose infusion. When hypoglycaemia was reached, the subjects received either i.m. glucagon of pancreatic extraction (1 mg) or intranasal genetically engineered glucagon (2 mg). The incremental values for plasma glucose...... concentrations 15 min after intranasal and i.m. administration of glucagon differed marginally. However, after 5 min the glucose appearance rate, as well as the incremental values for plasma glucose, were significantly higher for the i.m. glucagon treatment. The mean time taken for incremental plasma glucose...

  20. Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).

    Science.gov (United States)

    Glickman, L T; Appel, M J

    1981-08-01

    Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.

  1. Iatrogenic Cushing’s syndrome caused by intranasal steroid use

    Science.gov (United States)

    Dursun, Fatma; Kirmizibekmez, Heves

    2017-01-01

    Cushing’s syndrome (CS) is common after oral steroid use and has also been reported following topical or inhaled use, but it is extremely uncommon after intranasal administration. This is the case of a 6-year-old child who developed Cushing’s syndrome after intranasal application of dexamethasone sodium phosphate for a period of 6 months. Pediatricians and other clinical practitioners should be aware that high-dose and long-term nasal steroid administration may cause iatrogenic Cushing’s syndrome characterized by complications of glucocorticoid excess as well as serious and even life-threatening complications of adrenal insufficiency. PMID:28752153

  2. Iatrogenic Cushing's syndrome caused by intranasal steroid use.

    Science.gov (United States)

    Dursun, Fatma; Kirmizibekmez, Heves

    2017-01-01

    Cushing's syndrome (CS) is common after oral steroid use and has also been reported following topical or inhaled use, but it is extremely uncommon after intranasal administration. This is the case of a 6-year-old child who developed Cushing's syndrome after intranasal application of dexamethasone sodium phosphate for a period of 6 months. Pediatricians and other clinical practitioners should be aware that high-dose and long-term nasal steroid administration may cause iatrogenic Cushing's syndrome characterized by complications of glucocorticoid excess as well as serious and even life-threatening complications of adrenal insufficiency.

  3. Particular qualities of intranasal structures conditions in children with type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Layko А.

    2016-03-01

    Full Text Available Objective: To examine particular qualities of the intranasal structures state in children and adolescent patients with type 1 diabetes (T1D. Patients and methods. During the period of 2013–2015 161 patients with type 1 were examined having been treated at the endocrinology department of the National Children's Specialized Hospital OKHMATDET and Children's Hospital №6 (Kyiv. The study group included 138 (85.7% patients with type-1 with the changes of intranasal structures, the control group — 23 (14.3% patients with type-1 with no pathology of upper respiratory tract. Among children of the main group — 92 (66.67% boys and 46 (33.33% girls aged 6–17. All children received clinical and laboratory examination in accordance with the protocols, as well as endoscopy of the nasal cavity, nasopharynx, paranasal sinus computed tomography (if necessary. Results. The most pronounced changes of intranasal structures in children with T1D in the study group were identified in the form of the curvature of the nasal septum (IEF. Endoscopic examination of the nasal cavity and nasopharynx in children of the main group diagnosed the hypertrophy of the inferior turbinate in 54% of patients, acute rhinosinusitis — 12%, chronic adenoids, adenoid vegetations in 10%, polyps — 2%. Microcirculatory disorders according to the nail bed capillaroscopy in patients of the main group were observed 3 times more often than the control group. As a result of bulbar microscopy for children with T1D and IEF vascular changes in a single non-niformity of the caliber of vessels were identified in — 75%, unit sakkulyation venules — 50% maendricus tortuosity of the capillaries — 75%, as well as single-venular anastomoses arteriolo — 37.5%. Intra- and extravascular changes in this group of patients have not been identified. Conclusions. The results of studies in children with T1D indicate the need for timely early diagnosis of the state of intranasal structures and

  4. Single-cell network profiling of peripheral blood mononuclear cells from healthy donors reveals age- and race-associated differences in immune signaling pathway activation.

    Science.gov (United States)

    Longo, Diane M; Louie, Brent; Putta, Santosh; Evensen, Erik; Ptacek, Jason; Cordeiro, James; Wang, Ena; Pos, Zoltan; Hawtin, Rachael E; Marincola, Francesco M; Cesano, Alessandra

    2012-02-15

    A greater understanding of the function of the human immune system at the single-cell level in healthy individuals is critical for discerning aberrant cellular behavior that occurs in settings such as autoimmunity, immunosenescence, and cancer. To achieve this goal, a systems-level approach capable of capturing the response of the interdependent immune cell types to external stimuli is required. In this study, an extensive characterization of signaling responses in multiple immune cell subpopulations within PBMCs from a cohort of 60 healthy donors was performed using single-cell network profiling (SCNP). SCNP is a multiparametric flow cytometry-based approach that enables the simultaneous measurement of basal and evoked signaling in multiple cell subsets within heterogeneous populations. In addition to establishing the interindividual degree of variation within a broad panel of immune signaling responses, the possible association of any observed variation with demographic variables including age and race was investigated. Using half of the donors as a training set, multiple age- and race-associated variations in signaling responses in discrete cell subsets were identified, and several were subsequently confirmed in the remaining samples (test set). Such associations may provide insight into age-related immune alterations associated with high infection rates and diminished protection following vaccination and into the basis for ethnic differences in autoimmune disease incidence and treatment response. SCNP allowed for the generation of a functional map of healthy immune cell signaling responses that can provide clinically relevant information regarding both the mechanisms underlying immune pathological conditions and the selection and effect of therapeutics.

  5. Preclinical evaluation of a replication-deficient intranasal DeltaNS1 H5N1 influenza vaccine.

    Directory of Open Access Journals (Sweden)

    Julia Romanova

    Full Text Available BACKGROUND: We developed a novel intranasal influenza vaccine approach that is based on the construction of replication-deficient vaccine viruses that lack the entire NS1 gene (DeltaNS1 virus. We previously showed that these viruses undergo abortive replication in the respiratory tract of animals. The local release of type I interferons and other cytokines and chemokines in the upper respiratory tract may have a "self-adjuvant effect", in turn increasing vaccine immunogenicity. As a result, DeltaNS1 viruses elicit strong B- and T- cell mediated immune responses. METHODOLOGY/PRINCIPAL FINDINGS: We applied this technology to the development of a pandemic H5N1 vaccine candidate. The vaccine virus was constructed by reverse genetics in Vero cells, as a 5:3 reassortant, encoding four proteins HA, NA, M1, and M2 of the A/Vietnam/1203/04 virus while the remaining genes were derived from IVR-116. The HA cleavage site was modified in a trypsin dependent manner, serving as the second attenuation factor in addition to the deleted NS1 gene. The vaccine candidate was able to grow in the Vero cells that were cultivated in a serum free medium to titers exceeding 8 log(10 TCID(50/ml. The vaccine virus was replication deficient in interferon competent cells and did not lead to viral shedding in the vaccinated animals. The studies performed in three animal models confirmed the safety and immunogenicity of the vaccine. Intranasal immunization protected ferrets and mice from being infected with influenza H5 viruses of different clades. In a primate model (Macaca mulatta, one dose of vaccine delivered intranasally was sufficient for the induction of antibodies against homologous A/Vietnam/1203/04 and heterologous A/Indonesia/5/05 H5N1 strains. CONCLUSION/SIGNIFICANCE: Our findings show that intranasal immunization with the replication deficient H5N1 DeltaNS1 vaccine candidate is sufficient to induce a protective immune response against H5N1 viruses. This approach

  6. A single vaccination with an inactivated bovine respiratory syncytial virus vaccine primes the cellular immune response in calves with maternal antibody

    Directory of Open Access Journals (Sweden)

    Makoschey Birgit

    2010-01-01

    Full Text Available Abstract Background The efficacy of a single dose of an inactivated bovine respiratory syncytial virus (BRSV - Parainfluenaza type 3 (PI3 - Mannheimia haemolytica (Mh combination vaccine, in calves positive for maternal antibodies, was established in a BRSV infection study. Results As expected the single vaccination did not have any effect on the decline of BRSV-specific neutralising or ELISA antibody. The cellular immune system was however primed by the vaccination. In the vaccinated group virus excretion with nasal discharge was reduced, less virus could be re-isolated from lung tissues and the lungs were less affected. Conclusions These results indicate that a single vaccination with an inactivated BRSV vaccine was able to break through the maternal immunity and induce partial protection in very young calves. It can be speculated that the level and duration of protection will improve after the second dose of vaccine is administered. A two-dose basic vaccination schedule is recommended under field conditions.

  7. Single Nutrients and Immunity

    Science.gov (United States)

    1982-02-01

    HA antibody re- sponses. sponse after the administration of Salmonella Rats fed a riboflavin-deficient diet showed pullorum antigens, although no...pools of thymi- rats with severe folic acid deficiency after dine triphosphate and deoxyadenosine tri- inoculation with formalinized R. tiphi in...antigens. with Salmonella typhimurium ( 15 1). Chevalier and Aschkenasy (147) found that Newberne and colleagues (152-155) also a 7% dietary content of

  8. Intranasal Lidocaine in Acute Treatment of Migraine: A Randomized Controlled Trial.

    Science.gov (United States)

    Avcu, Nazire; Doğan, Nurettin Özgür; Pekdemir, Murat; Yaka, Elif; Yılmaz, Serkan; Alyeşil, Cansu; Akalın, Latif Erdem

    2017-06-01

    The study aims to evaluate the efficacy and safety of intranasal lidocaine administration for migraine treatment. This single-center, double-blind, randomized, controlled trial was conducted in a tertiary care emergency department. Included patients met the migraine criteria of the International Headache Society. Patients were randomized to intranasal lidocaine or saline solution; all participants received 10 mg of intravenous metoclopramide. Patient pain intensity was assessed with an 11-point numeric rating scale score. The primary outcome measure was the change in pain scores at 15 minutes; secondary outcomes were changes in pain intensity after pain onset and need for rescue medication. Patients (n=162) were randomized into 2 groups with similar baseline migraine characteristics and numeric rating scale scores. The median reduction in numeric rating scale score at 15 minutes was 3 (interquartile range [IQR] 2 to 5) for the lidocaine group and 2 (IQR 1 to 4) for the saline solution group (median difference=1.0; 95% confidence interval 0.1 to 2.1). The reduction in pain score at 30 minutes was 4 (IQR 3 to 7) for the lidocaine group and 5 (IQR 2 to 7) for the saline solution group (median difference=1.0; 95% confidence interval 0.1 to 2.1). Need for rescue medication did not differ between the groups, and local irritation was the most common adverse event in the lidocaine group. Although intranasal lidocaine was found no more efficacious than normal saline solution in our study, future studies should focus on patients who present earlier after headache onset. Copyright © 2016 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  9. Intranasal infection with Chlamydia abortus induces dose-dependent latency and abortion in sheep.

    Directory of Open Access Journals (Sweden)

    David Longbottom

    Full Text Available Latency is a key feature of the animal pathogen Chlamydia abortus, where infection remains inapparent in the non-pregnant animal and only becomes evident during a subsequent pregnancy. Often the first sign that an animal is infected is abortion occurring late in gestation. Despite this, little is understood of the underlying mechanisms that control latency or the recrudescence of infection that occurs during subsequent pregnancy. The aim of this study was to develop an experimental model of latency by mimicking the natural route of infection through the intranasal inoculation of non-pregnant sheep with C. abortus.Three groups of sheep (groups 1, 2 and 3 were experimentally infected with different doses of C. abortus (5×10(3, 5×10(5 and 5×10(7 inclusion forming units (IFU, respectively prior to mating and monitored over 2 breeding cycles for clinical, microbiological, pathological, immunological and serological outcomes. Two further groups received either negative control inoculum (group 4a,b or were inoculated subcutaneously on day 70 of gestation with 2×10(6 IFU C. abortus (group 5. Animals in groups 1, 2 and 5 experienced an abortion rate of 50-67%, while only one animal aborted in group 3 and none in group 4a,b. Pathological, microbiological, immunological and serological analyses support the view that the maternal protective immune response is influenced by initial exposure to the bacterium.The results show that intranasal administration of non-pregnant sheep with a low/medium dose of C. abortus results in a latent infection that leads in a subsequent pregnancy to infection of the placenta and abortion. In contrast a high dose stimulates protective immunity, resulting in a much lower abortion rate. This model will be useful in understanding the mechanisms of infection underlying latency and onset of disease, as well as in the development of novel therapeutics and vaccines for controlling infection.

  10. Intranasal infection with Chlamydia abortus induces dose-dependent latency and abortion in sheep.

    Science.gov (United States)

    Longbottom, David; Livingstone, Morag; Maley, Stephen; van der Zon, Arjan; Rocchi, Mara; Wilson, Kim; Wheelhouse, Nicholas; Dagleish, Mark; Aitchison, Kevin; Wattegedera, Sean; Nath, Mintu; Entrican, Gary; Buxton, David

    2013-01-01

    Latency is a key feature of the animal pathogen Chlamydia abortus, where infection remains inapparent in the non-pregnant animal and only becomes evident during a subsequent pregnancy. Often the first sign that an animal is infected is abortion occurring late in gestation. Despite this, little is understood of the underlying mechanisms that control latency or the recrudescence of infection that occurs during subsequent pregnancy. The aim of this study was to develop an experimental model of latency by mimicking the natural route of infection through the intranasal inoculation of non-pregnant sheep with C. abortus. Three groups of sheep (groups 1, 2 and 3) were experimentally infected with different doses of C. abortus (5×10(3), 5×10(5) and 5×10(7) inclusion forming units (IFU), respectively) prior to mating and monitored over 2 breeding cycles for clinical, microbiological, pathological, immunological and serological outcomes. Two further groups received either negative control inoculum (group 4a,b) or were inoculated subcutaneously on day 70 of gestation with 2×10(6) IFU C. abortus (group 5). Animals in groups 1, 2 and 5 experienced an abortion rate of 50-67%, while only one animal aborted in group 3 and none in group 4a,b. Pathological, microbiological, immunological and serological analyses support the view that the maternal protective immune response is influenced by initial exposure to the bacterium. The results show that intranasal administration of non-pregnant sheep with a low/medium dose of C. abortus results in a latent infection that leads in a subsequent pregnancy to infection of the placenta and abortion. In contrast a high dose stimulates protective immunity, resulting in a much lower abortion rate. This model will be useful in understanding the mechanisms of infection underlying latency and onset of disease, as well as in the development of novel therapeutics and vaccines for controlling infection.

  11. Intranasal administration of oxytocin: Behavioral and clinical effects, a review

    NARCIS (Netherlands)

    Veening, J.G.; Olivier, B.

    2013-01-01

    The intranasal (IN-) administration of substances is attracting attention from scientists as well as pharmaceutical companies. The effects are surprisingly fast and specific. The present review explores our current knowledge about the routes of access to the cranial cavity. 'Direct-access-pathways'

  12. Kliniske konsekvenser af intranasal insulinbehandling ved insulinkraevende diabetes mellitus

    DEFF Research Database (Denmark)

    Hilsted, J C; Madsbad, S; Rasmussen, M H

    1996-01-01

    Metabolic control, hypoglycaemia frequency and nasal mucosal physiology were evaluated in 31 insulin-dependent diabetics treated with intranasal insulin at mealtimes for one month and with subcutaneous fast-acting insulin for another month in a randomized crossover trial. During both periods...

  13. Equine influenza: evaluation of the humoral immune response through the hemagglutination inhibition and single radial haemolysis, in vaccinated horses with commercial and experimental vaccines

    Directory of Open Access Journals (Sweden)

    Dalva Assunção Portari Mancini

    1996-03-01

    Full Text Available Equine Influenza: evaluation of the humoral immune response through the hemagglutination inhibition and single radial haemolysis, in horses vaccinated with commercial and experimental vaccines. From 4 equine groups, the antibody protection levels against influenza were evaluted through the hemagglutination inhibition and single radial haemolysis. One group of these animals received immunization from 2 doses of influenza vaccine, of experimental preparation, at the Butantan Institute, São Paulo, Brasil (IB. Two other horse groups, regularly vaccinated received the annual booster dose from both commercial and experimental vaccines (IB. A control group remained without vaccination. Differences were observed among the antibody level medians of the serum samples harvested prior and post immunization of those vaccinated animals. No evident differences were detected among the antibody level medians from animals that received annual booster doses, due to the persistence of the protective antibody level, 12 months after the regular immunization. In the control group, the animals showed low antibody levels, for both serum samples. In fact these results suggested the good serologic response of both vaccines, the commercial and the experimental, tested preparations.

  14. Protective immunization with homologous and heterologous antigens against Helicobacter suis challenge in a mouse model.

    Science.gov (United States)

    Flahou, Bram; Hellemans, Ann; Meyns, Tom; Duchateau, Luc; Chiers, Koen; Baele, Margo; Pasmans, Frank; Haesebrouck, Freddy; Ducatelle, Richard

    2009-02-25

    Helicobacter (H.) suis colonizes the stomach of more than 60% of slaughter pigs and is also of zoonotic importance. Recently, this bacterium was isolated in vitro, enabling the use of pure cultures for research purposes. In this study, mice were immunized intranasally or subcutaneously with whole bacterial cell lysate of H. suis or the closely related species H. bizzozeronii and H. cynogastricus, and subsequently challenged with H. suis. Control groups consisted of non-immunized and non-challenged mice (negative control group), as well as of sham-immunized mice that were inoculated with H. suis (positive control group). Urease tests on stomach tissue samples at 7 weeks after challenge infection were negative in all negative control mice, all intranasally immunized mice except one, and in all and 3 out of 5 animals of the H. cynogastricus and H. suis subcutaneously immunized groups, respectively. H. suis DNA was detected by PCR in the stomach of all positive control animals and all subcutaneously immunized/challenged animals. All negative control animals and some intranasally immunized/challenged mice were PCR-negative. In conclusion, immunization using antigens derived from the same or closely related bacterial species suppressed gastric colonization with H. suis, but complete protection was only achieved in a minority of animals following intranasal immunization.

  15. Oxytocin Intranasal Administration Affects Neural Networks Upstream of GNRH Neurons.

    Science.gov (United States)

    Salehi, Mohammad Saied; Khazali, Homayoun; Mahmoudi, Fariba; Janahmadi, Mahyar

    2017-08-01

    The last decade has witnessed a surge in studies on the clinical applications of intranasal oxytocin as a method of enhancing social interaction. However, the molecular and cellular mechanisms underlying its function are not completely understood. Since oxytocin is involved in the regulation of hypothalamic-pituitary-gonadal axis by affecting the gonadotropin-releasing hormone (GNRH) system, the present study addressed whether intranasal application of oxytocin has a role in affecting GNRH expression in the male rat hypothalamus. In addition, we assessed expression of two excitatory (kisspeptin and neurokinin B) and two inhibitory (dynorphin and RFamide-related peptide-3) neuropeptides upstream of GNRH neurons as a possible route to relay oxytocin information. Here, adult male rats received 20, 40, or 80 μg oxytocin intranasally once a day for 10 consecutive days, and then, the posterior (PH) and anterior hypothalamus (AH) dissected for evaluation of target genes. Using qRT-PCR, we found that oxytocin treatment increased Gnrh mRNA levels in both the PH and AH. In addition, oxytocin at its highest dose increased kisspeptin expression in the AH by around 400%, whereas treatments, dose dependently decreased kisspeptin mRNA in the PH. The expression of neurokinin B was increased from the basal levels following the intervention. Furthermore, although intranasal-applied oxytocin decreased hypothalamic RFamide-related peptide-3 mRNA level, the dynorphin mRNA was not affected. These observations are consistent with the hypothesis that applications of intranasal oxytocin can affect the GNRH system.

  16. Protective efficacy of a single immunization with capripoxvirus-vectored recombinant peste des petits ruminants vaccines in presence of pre-existing immunity.

    Science.gov (United States)

    Caufour, Philippe; Rufael, Tesfaye; Lamien, Charles Euloge; Lancelot, Renaud; Kidane, Menbere; Awel, Dino; Sertse, Tefera; Kwiatek, Olivier; Libeau, Geneviève; Sahle, Mesfin; Diallo, Adama; Albina, Emmanuel

    2014-06-24

    Sheeppox, goatpox and peste des petits ruminants (PPR) are highly contagious ruminant diseases widely distributed in Africa, the Middle East and Asia. Capripoxvirus (CPV)-vectored recombinant PPR vaccines (rCPV-PPR vaccines), which have been developed and shown to protect against both Capripox (CP) and PPR, would be critical tools in the control of these important diseases. In most parts of the world, these disease distributions overlap each other leaving concerns about the potential impact that pre-existing immunity against either disease may have on the protective efficacy of these bivalent rCPV-PPR vaccines. Currently, this question has not been indisputably addressed. Therefore, we undertook this study, under experimental conditions designed for the context of mass vaccination campaigns of small ruminants, using the two CPV recombinants (Kenya sheep-1 (KS-1) strain-based constructs) developed previously in our laboratory. Pre-existing immunity was first induced by immunization either with an attenuated CPV vaccine strain (KS-1) or the attenuated PPRV vaccine strain (Nigeria 75/1) and animals were thereafter inoculated once subcutaneously with a mixture of CPV recombinants expressing either the hemagglutinin (H) or the fusion (F) protein gene of PPRV (10(3) TCID50/animal of each). Finally, these animals were challenged with a virulent CPV strain followed by a virulent PPRV strain 3 weeks later. Our study demonstrated full protection against CP for vaccinated animals with prior exposure to PPRV and a partial protection against PPR for vaccinated animals with prior exposure to CPV. The latter animals exhibited a mild clinical form of PPR and did not show any post-challenge anamnestic neutralizing antibody response against PPRV. The implications of these results are discussed herein and suggestions made for future research regarding the development of CPV-vectored vaccines. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  18. Biodegradable nanoparticle-entrapped vaccine induces cross-protective immune response against a virulent heterologous respiratory viral infection in pigs.

    Directory of Open Access Journals (Sweden)

    Varun Dwivedi

    Full Text Available Biodegradable nanoparticle-based vaccine development research is unexplored in large animals and humans. In this study, we illustrated the efficacy of nanoparticle-entrapped UV-killed virus vaccine against an economically important respiratory viral disease of pigs called porcine reproductive and respiratory syndrome virus (PRRSV. We entrapped PLGA [poly (lactide-co-glycolides] nanoparticles with killed PRRSV antigens (Nano-KAg and detected its phagocytosis by pig alveolar macrophages. Single doses of Nano-KAg vaccine administered intranasally to pigs upregulated innate and PRRSV specific adaptive responses. In a virulent heterologous PRRSV challenge study, Nano-KAg vaccine significantly reduced the lung pathology and viremia, and the viral load in the lungs. Immunologically, enhanced innate and adaptive immune cell population and associated cytokines with decreased secretion of immunosuppressive mediators were observed at both mucosal sites and blood. In summary, we demonstrated the benefits of intranasal delivery of nanoparticle-based viral vaccine in eliciting cross-protective immune response in pigs, a potential large animal model.

  19. HLA-G mediated immune regulation is impaired by a single amino acid exchange in the alpha 2 domain.

    Science.gov (United States)

    Celik, Alexander A; Simper, Gwendolin S; Huyton, Trevor; Blasczyk, Rainer; Bade-Döding, Christina

    2018-03-29

    The trade-off from HLA class I expression to HLA-G expression support the immune evasion of malignant cells. The essential role of the virtually invariant HLA-G in immune tolerance, tumor immunology and its expression frequency in immune privileged tissues is known; however the specific importance of allelic subtypes in immune responses is still not well understood. HLA-G ∗ 01:01, ∗ 01:03 and ∗ 01:04 are the most prevalent allelic variants differing at residues 31 and 110, respectively. In cytotoxicity assays applying K562 cells transduced with the HLA-G variants as targets and NK cells as effectors the differential protective potential of HLA-G variants was analyzed. Their peptide profiles were determined utilizing soluble HLA technology. An increased protective potential of HLA-G ∗ 01:04 could be observed. All variants exhibit a unique peptide repertoire with marginal overlap, while G ∗ 01:04 differs in its peptide anchor profile substantially. The functional differences between HLA-G subtypes could be explained by the constraint of the bound peptides, modifying the pHLA-G accessible surface. For the first time a contribution of amino acid alterations within the HLA-G heavy chain for peptide selection and NK cell recognition could be observed. These results will be a step towards understanding immune tolerance and will guide towards personalized immune therapeutic strategies. Copyright © 2018. Published by Elsevier Inc.

  20. Comparable sensitivity of postmenopausal and young women to the effects of intranasal insulin on food intake and working memory.

    Science.gov (United States)

    Krug, Rosemarie; Benedict, Christian; Born, Jan; Hallschmid, Manfred

    2010-12-01

    We have previously shown that enhancing brain insulin signaling by intranasal administration of a single dose of the hormone acutely reduces food intake in young men but not women, whereas its improving effects on spatial and working memory are restricted to young women. Against the background of animal studies suggesting that low estrogen concentrations are a prerequisite for the anorexigenic impact of central nervous insulin, we extended our foregoing study by assessing intranasal insulin effects in postmenopausal women with comparatively low estrogen concentrations, expecting them to be more sensitive than young women to the anorexigenic effects of the hormone. In a within-subject, double-blind comparison performed at the University of Lübeck, 14 healthy postmenopausal women (body mass index, 23.71±0.6 kg/m2; age, 57.61±1.14 yr) were intranasally administered 160 IU regular human insulin or vehicle. Subjects performed a working memory task (digit span) and a hippocampus-dependent visuospatial memory task. Subsequently, free-choice food intake from an ad libitum breakfast buffet was measured. Contrary to expectations, results in postmenopausal women mirrored those found in young women (22.44±0.63 yr), i.e. insulin administration did not affect food intake (P>0.46), but did enhance performance in the prefrontal cortex-dependent working memory task (P<0.05). Low estrogen levels as present in postmenopausal women do not modulate the effects of intranasal insulin in females, suggesting that in humans as opposed to rats, estrogen signaling does not critically alter central nervous system sensitivity to the effects of insulin on energy homeostasis and cognition.

  1. Design and construction of immune phage antibody library against Tetanus neurotoxin: Production of single chain antibody fragments.

    Science.gov (United States)

    Sadreddini, Sanam; Seifi-Najmi, Mehrnosh; Ghasemi, Babollah; Kafil, Hossein Samadi; Alinejad, Vahideh; Sadreddini, Sevil; Younesi, Vahid; Jadidi-Niaragh, Farhad; Yousefi, Mehdi

    2015-12-23

    Tetanus neurotoxin (TeNT) is composed of a light (LC) and heavy chain (HC) polypeptides, released by anaerobic bacterium Clostridium tetani and can cause fatal life-threatening infectious disease. Toxin HC and LC modules represents receptor binding and zinc metalloprotease activity, respectively. The passive administration of animal-derived antibodies against tetanus toxin has been considered as the mainstay therapy for years. However, this treatment is associated with several adverse effects due to the presence of anti-isotype antibodies. In the present study, we have produced the fully human single chain antibody fragments (HuScFv) from two human antibody phage display libraries. Twenty-four different HuscFvs were isolated from two anti TeNT immune libraries. Our produced human ScFv (HuScFv) were converted to IgG platform and analyzed regarding their specific reactivity to TeNT. All of the selected scFvs have the same VL but different VH. Three HuscFvs from the first library (TTX15, 51, 75) and two HuscFvs from the second library (TTX16, 20) were chosen to convert to IgG1 using pOptiVEC and pcDNA3.3 systems. Production of IgG1 from transfected DG44 and binding capacity of them to tetanus toxin and toxoid were measured by ELISA. ELISA results showed no detectable production of TTX16 and TTX20 IgG1. Although, TTX51 and TTX75 were converted and produced as IgG1, no reactivity to tetanus toxin and toxoid was observed. However, TTX15 was successfully produced as whole IgG1 platform with reactivity to both tetanus toxin and toxoid. The latter would be an appropriate replacement for conventional polyclonal antibodies if would meet the further characterization including specificity determination, affinity measurement and toxin neutralizing assays. Our results demonstrated production of functional IgG1 derived from TTX15 scFv and might be an appropriate replacement for polyclonal Tetabulin but it needs further characterization.

  2. Evaluation of the LTK63 adjuvant effect on cellular immune ...

    African Journals Online (AJOL)

    Subsequently MVNP synthetic peptides spanning the length of the N protein were used with a proliferation assay to identify the T cell epitopes. Results: Splenocytes from mice immunized intranasally with rMVNP plus LT or LTK63, showed strong dose dependent proliferative responses to both the MVNP and MV. However ...

  3. Targeting glioblastoma via intranasal administration of Ff bacteriophages.

    Science.gov (United States)

    Dor-On, Eyal; Solomon, Beka

    2015-01-01

    Bacteriophages (phages) are ubiquitous viruses that control the growth and diversity of bacteria. Although they have no tropism to mammalian cells, accumulated evidence suggests that phages are not neutral to the mammalian macro-host and can promote immunomodulatory and anti-tumorigenic activities. Here we demonstrate that Ff phages that do not display any proteins or peptides could inhibit the growth of subcutaneous glioblastoma tumors in mice and that this activity is mediated in part by lipopolysaccharide molecules attached to their virion. Using the intranasal route, a non-invasive approach to deliver therapeutics directly to the CNS, we further show that phages rapidly accumulate in the brains of mice and could attenuate progression of orthotopic glioblastoma. Taken together, this study provides new insight into phages non-bacterial activities and demonstrates the feasibility of delivering Ff phages intranasally to treat brain malignancies.

  4. Protective immunity against mouse upper genital tract pathology correlates with high IFNγ but low IL-17 T cell and anti-secretion protein antibody responses induced by replicating chlamydial organisms in the airway

    Science.gov (United States)

    Lu, Chunxue; Zeng, Hao; Li, Zhihong; Lei, Lei; Yeh, I-Tien; Wu, Yimou; Zhong, Guangming

    2011-01-01

    To search for optimal immunization conditions for inducing protective immunity against upper genital tract pathologies caused by chlamydial intravaginal infection, we compared protection efficacy in mice immunized intranasally or intramuscularly with live or inactivated C. muridarum organisms. Mice immunized intranasally with live organisms developed strong protection against both vaginal shedding of infectious organisms and upper genital tract pathologies. The protection correlated with a robust antigen-specific T cell response with high IFNγ but low IL-17. Although a significant level of IL-5 was also detected, these mice maintained an overall Th1-dorminant immunity following immunization and challenge infection. On the contrary, mice immunized intranasally with inactivated organisms or intramuscularly with live or inactivated organisms produced high levels of IL-17 and still developed significant upper genital tract pathologies. High titers of antibodies against chlamydial secretion antigens were detected only in mice immunized intranasally with live organisms but not mice in other groups, suggesting that the intranasally inoculated live organisms were able to undergo replication and immune responses to the chlamydial secretion proteins may contribute to protective immunity. These observations have provided important information on how to develop subunit vaccines for inducing protective immunity against urogenital infection with C. trachomatis organisms. PMID:22079265

  5. Protective immunity against mouse upper genital tract pathology correlates with high IFNγ but low IL-17 T cell and anti-secretion protein antibody responses induced by replicating chlamydial organisms in the airway.

    Science.gov (United States)

    Lu, Chunxue; Zeng, Hao; Li, Zhihong; Lei, Lei; Yeh, I-Tien; Wu, Yimou; Zhong, Guangming

    2012-01-05

    To search for optimal immunization conditions for inducing protective immunity against upper genital tract pathologies caused by chlamydial intravaginal infection, we compared protection efficacy in mice immunized intranasally or intramuscularly with live or inactivated Chlamydia muridarum organisms. Mice immunized intranasally with live organisms developed strong protection against both vaginal shedding of infectious organisms and upper genital tract pathologies. The protection correlated with a robust antigen-specific T cell response with high IFNγ but low IL-17. Although a significant level of IL-5 was also detected, these mice maintained an overall Th1-dorminant immunity following immunization and challenge infection. On the contrary, mice immunized intranasally with inactivated organisms or intramuscularly with live or inactivated organisms produced high levels of IL-17 and still developed significant upper genital tract pathologies. High titers of antibodies against chlamydial secretion antigens were detected only in mice immunized intranasally with live organisms but not mice in other groups, suggesting that the intranasally inoculated live organisms were able to undergo replication and immune responses to the chlamydial secretion proteins may contribute to protective immunity. These observations have provided important information on how to develop subunit vaccines for inducing protective immunity against urogenital infection with Chlamydia trachomatis organisms. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Intranasal Insulin for Improving Cognitive Function in Multiple Sclerosis

    Science.gov (United States)

    2017-10-01

    people with MS. The study will also evaluate the impact of intranasal insulin on measures of oxidative stress , axonal injury, cellular stress ...impaired cognitive function, which is common and present in over 60% of individuals with MS. Attention, memory , executive functioning, and especially... memory . Insulin is present at high levels in the brain and when these levels are decreased, there may be learning and memory impairments. Moreover

  7. Pharmaceutical Product Development: Intranasal Scopolamine (INSCOP) Metered Dose Spray

    Science.gov (United States)

    Putcha, Lakshmi; Crady, Camille; Putcha, Lakshmi

    2012-01-01

    Motion sickness (MS) has been a problem associated with space flight, the modern military and commercial air and water transportation for many years. Clinical studies have shown that scopolamine is the most effective medication for the prevention of motion sickness (Dornhoffer et al, 2004); however, the two most common methods of administration (transdermal and oral) have performance limitations that compromise its utility. Intranasal administration offers a noninvasive treatment modality, and has been shown to counter many of the problems associated with oral and transdermal administration. With the elimination of the first pass effect by the liver, intranasal delivery achieves higher and more reliable bioavailability than an equivalent oral dose. This allows for the potential of enhanced efficacy at a reduced dose, thus minimizing the occurrence of untoward side effects. An Intranasal scopolamine (INSCOP) gel formulation was prepared and tested in four ground-based clinical trials under an active Investigational New Drug (IND) application with the Food and Drug Administration (FDA). Although there were early indicators that the intranasal gel formulation was effective, there were aspects of formulation viscosity and the delivery system that were less desirable. The INSCOP gel formulation has since been reformulated into an aqueous spray dosage form packaged in a precise, metered dose delivery system; thereby enhancing dose uniformity, increased user satisfaction and palatability, and a potentially more rapid onset of action. Recent reports of new therapeutic indications for scopolamine has prompted a wide spread interest in new scopolamine dosage forms. The novel dosage form and delivery system of INSCOP spray shows promise as an effective treatment for motion sickness targeted at the armed forces, spaceflight, and commercial sea, air, and space travel markets, as well as prospective psychotherapy for mental and emotional disorders.

  8. Gene therapy prospects--intranasal delivery of therapeutic genes.

    Science.gov (United States)

    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

    2012-01-01

    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  9. Intranasal glukagon til behandling af hypoglykaemi. En fremtidig behandlingsmulighed

    DEFF Research Database (Denmark)

    Carstens, S; Andersen, I; Gustafsson, Ida

    1994-01-01

    Nearly 10% of IDDM patients receiving conventional insulin treatment and about three times as many in intensive insulin therapy yearly experience severe hypoglycaemia (requiring external assistance) The conventional treatment of severe hypoglycaemia is glucagon given intramuscularly by a relative...... or glucose administered intravenously by a physician. These are however not optimal treatments. Obtaining intravenous access requires a medical doctor and glucagon injection is not always properly done by family members. Glucagon administered intranasally has been proven to raise blood glucose levels...

  10. Intranasal Insulin: A Novel Treatment for Gulf War Multisymptom Illness

    Science.gov (United States)

    2017-10-01

    different doses of intranasal insulin on other symptoms that are characteristic of or associated with CMI (e.g., fatigue, pain, sleep quality ...and mood and sleep problems (Proctor et al., 1998; Sullivan et al., 2003). Despite the passage of time, the symptom complex persists for many...paramount importance to identify effective, safe, and tolerable treatments for Gulf War CMI. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17

  11. Intranasal Midazolam May Prevent Gagging Reflex: a Case Report

    Directory of Open Access Journals (Sweden)

    Meral Arslan Malkoc

    2013-10-01

    Full Text Available Background: Gagging can become a conditioned response that makes dental treatment difficult or impossible for both the individual and the dentist. The aim of this study is to report a 50 year old female and two children (15 and 11 years old with exaggerated gag reflex referred to Faculty of Dentistry of Selçuk University.Methods: During obtaining records, taking impression procedure was elicited the patients’ hypersensitive gagging reflex. Therefore, it was decided to administer intranasal midazolam to facilitate the taking of accurate dental impressions. After given verbal information about the procedure, 2.5 mg intranasal midazolam (Demizolam, Dem Medikal, Istanbul were applied incrementally in both nostrils.Results: Five minutes later; patients had no gagging reflex and allowed the clinician to take satisfying impressions. No serious adverse effects were observed and the patients remained cooperative during the entire procedure which was completed to the full satisfaction of all involved. The short absorption time and the fast relief process of anaesthetics transferred to the systemic circulatory system are important advantages of nasal application.Conclusions: Intranasal midazolam may be very useful for the treatment of gag reflex probably effecting on the depression of upper airway reflex sensitivity.

  12. Intranasal midazolam may prevent gagging reflex: a case report.

    Science.gov (United States)

    Malkoc, Meral Arslan; Demir, Necla; Ileri, Zehra; Erdur, Aybuke; Apiliogullari, Seza

    2013-01-01

    Gagging can become a conditioned response that makes dental treatment difficult or impossible for both the individual and the dentist. The aim of this study is to report a 50 year old female and two children (15 and 11 years old) with exaggerated gag reflex referred to Faculty of Dentistry of Selçuk University. During obtaining records, taking impression procedure was elicited the patients' hypersensitive gagging reflex. Therefore, it was decided to administer intranasal midazolam to facilitate the taking of accurate dental impressions. After given verbal information about the procedure, 2.5 mg intranasal midazolam (Demizolam, Dem Medikal, Istanbul) were applied incrementally in both nostrils. Five minutes later; patients had no gagging reflex and allowed the clinician to take satisfying impressions. No serious adverse effects were observed and the patients remained cooperative during the entire procedure which was completed to the full satisfaction of all involved. The short absorption time and the fast relief process of anaesthetics transferred to the systemic circulatory system are important advantages of nasal application. Intranasal midazolam may be very useful for the treatment of gag reflex probably effecting on the depression of upper airway reflex sensitivity.

  13. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs

    NARCIS (Netherlands)

    Sullivan, Nancy J.; Geisbert, Thomas W.; Geisbert, Joan B.; Shedlock, Devon J.; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V.; Popernack, Paul M.; Yang, Zhi-Yong; Pau, Maria G.; Roederer, Mario; Koup, Richard A.; Goudsmit, Jaap; Jahrling, Peter B.; Nabel, Gary J.

    2006-01-01

    BACKGROUND: Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or

  14. Intranasal delivery of a bivalent norovirus vaccine formulated in an in situ gelling dry powder.

    Directory of Open Access Journals (Sweden)

    Jordan P Ball

    Full Text Available The global health community is beginning to understand the burden of norovirus-associated disease, which has a significant impact in both developed and developing countries. Norovirus virus like particle (VLP-based vaccines are currently under development and have been shown to elicit systemic and mucosal immune responses when delivered intranasally. In the present study, we describe the use of a dry powder formulation (GelVac™ with an in situ gelling polysaccharide (GelSite™ extracted from Aloe vera for nasal delivery of a bivalent vaccine formulation containing both GI and GII.4 norovirus VLPs. Dose-ranging studies were performed to identify the optimal antigen dosages based on systemic and mucosal immune responses in guinea pigs and determine any antigenic interference. A dose-dependent increase in systemic and mucosal immunogenicity against each of the VLPs were observed as well as a boosting effect for each VLP after the second dosing. A total antigen dose of ≥50 μg of each GI and GII.4 VLPs was determined to be the maximally immunogenic dose in guinea pigs. The immunogenicity results of this bivalent formulation, taken together with previous work on monovalent GelVac™ norovirus vaccine formulation, provides a basis for future development of this norovirus VLP vaccine.

  15. Pathogenesis and host response in Syrian hamsters following intranasal infection with Andes virus.

    Directory of Open Access Journals (Sweden)

    David Safronetz

    2011-12-01

    Full Text Available Hantavirus pulmonary syndrome (HPS, also referred to as hantavirus cardiopulmonary syndrome (HCPS, is a rare but frequently fatal disease caused by New World hantaviruses. In humans HPS is associated with severe pulmonary edema and cardiogenic shock; however, the pathogenesis of this disease remains unclear largely due to a lack of suitable animal models for the study of disease progression. In this study we monitored clinical, virological, pathophysiological parameters and host immunological responses to decipher pathological factors and events in the lethal Syrian hamster model of HPS following intranasal inoculation of Andes virus. Transcriptional profiling of the host gene responses demonstrated a suppression of innate immune responses in most organs analyzed during the early stage of infection, except for in the lung which had low level activation of several pro-inflammatory genes. During this phase Andes virus established a systemic infection in hamsters, with viral antigen readily detectable in the endothelium of the majority of tissues analyzed by 7-8 days post-inoculation. Despite wide-spread infection, histological analysis confirmed pathological abnormalities were almost exclusively found in the lungs. Immediately preceding clinical signs of disease, intense activation of pro-inflammatory and Th1/Th2 responses were observed in the lungs as well as the heart, but not in peripheral organs, suggesting that localized immune-modulations by infection is paramount to pathogenesis. Throughout the course of infection a strong suppression of regulatory T-cell responses was noted and is hypothesized to be the basis of the aberrant immune activations. The unique and comprehensive monitoring of host immune responses to hantavirus infection increases our understanding of the immuno-pathogenesis of HPS and will facilitate the development of treatment strategies targeting deleterious host immunological responses.

  16. Randomized Controlled Feasibility Trial of Intranasal Ketamine Compared to Intranasal Fentanyl for Analgesia in Children with Suspected Extremity Fractures.

    Science.gov (United States)

    Reynolds, Stacy L; Bryant, Kathleen K; Studnek, Jonathan R; Hogg, Melanie; Dunn, Connell; Templin, Megan A; Moore, Charity G; Young, James R; Walker, Katherine Rivera; Runyon, Michael S

    2017-12-01

    We compared the tolerability and efficacy of intranasal subdissociative ketamine to intranasal fentanyl for analgesia of children with acute traumatic pain and investigated the feasibility of a larger noninferiority trial that could investigate the potential opioid-sparing effects of intranasal ketamine. This randomized controlled trial compared 1 mg/kg intranasal ketamine to 1.5 μg/kg intranasal fentanyl in children 4 to 17 years old with acute pain from suspected isolated extremity fractures presenting to an urban Level II pediatric trauma center from December 2015 to November 2016. Patients, parents, treating physicians, and outcome assessors were blinded to group allocation. The primary outcome, a tolerability measure, was the frequency of cumulative side effects and adverse events within 60 minutes of drug administration. The secondary outcomes included the difference in mean pain score reduction at 20 minutes, the proportion of patients achieving a clinically significant reduction in pain in 20 minutes, total dose of opioid pain medication in morphine equivalents/kg/hour (excluding study drug) required during the emergency department (ED) stay, and the feasibility of enrolling children presenting to the ED in acute pain into a randomized trial conducted under U.S. regulations. All patients were monitored until 6 hours after their last dose of study drug or until admission to the hospital ward or operating room. Of 629 patients screened, 87 received the study drug and 82 had complete data for the primary outcome (41 patients in each group). The median (interquartile range) age was 8 (6-11) years and 62% were male. Baseline pain scores were similar among patients randomized to receive ketamine (73 ± 26) and fentanyl (69 ± 26; mean difference [95% CI] = 4 [-7 to 15]). The cumulative number of side effects was 2.2 times higher in the ketamine group, but there were no serious adverse events and no patients in either group required intervention. The most

  17. A single immunization with MVA expressing GnGc glycoproteins promotes epitope-specific CD8+-T cell activation and protects immune-competent mice against a lethal RVFV infection.

    Directory of Open Access Journals (Sweden)

    Elena López-Gil

    Full Text Available BACKGROUND: Rift Valley fever virus (RVFV is a mosquito-borne pathogen causing an important disease in ruminants often transmitted to humans after epizootic outbreaks in African and Arabian countries. To help combat the spread of the disease, prophylactic measures need to be developed and/or improved. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we evaluated the immunogenicity and protective efficacy of recombinant plasmid DNA and modified vaccinia virus Ankara (rMVA vectored vaccines against Rift Valley fever in mice. These recombinant vaccines encoded either of two components of the Rift Valley fever virus: the viral glycoproteins (Gn/Gc or the nucleoprotein (N. Following lethal challenge with live RVFV, mice immunized with a single dose of the rMVA-Gn/Gc vaccine showed no viraemia or clinical manifestation of disease, but mounted RVFV neutralizing antibodies and glycoprotein specific CD8+ T-cell responses. Neither DNA-Gn/Gc alone nor a heterologous prime-boost immunization schedule (DNA-Gn/Gc followed by rMVAGn/Gc was better than the single rMVA-Gn/Gc immunization schedule with regards to protective efficacy. However, the rMVA-Gn/Gc vaccine failed to protect IFNAR(-/- mice upon lethal RVFV challenge suggesting a role for innate responses in protection against RVFV. Despite induction of high titer antibodies against the RVFV nucleoprotein, the rMVA-N vaccine, whether in homologous or heterologous prime-boost schedules with the corresponding recombinant DNA vaccine, only conferred partial protection to RVFV challenge. CONCLUSIONS/SIGNIFICANCE: Given the excellent safety profile of rMVA based vaccines in humans and animals, our data supports further development of rMVA-Gn/Gc as a vaccine strategy that can be used for the prevention of Rift Valley fever in both humans and livestock.

  18. [Pharmacokinetics of α-asarone after intranasal and intravenous administration with PLA-α-asarone nanoparticles].

    Science.gov (United States)

    Lu, Jin; Guo, Li-Wei; Fu, Ting-Ming; Zhu, Guo-Long; Dai, Zhen-Nan; Zhan, Guan-Jun; Chen, Li-Li

    2017-06-01

    PLA-α-asarone nanoparticles were prepared by using organic solvent evaporation method, and their in vivo distribution and brain targeting after intranasal administration were studied as compared with intravenous administration. The results showed that brain targeting coefficient of PLA-α-asarone nanoparticles after intranasal and intravenous administration was 1.65 and 1.16 respectively. The absolute bioavailability, brain-targeting efficiency and the percentage of nasal-brain delivery of PLA-α-asarone nanoparticles were 74.2%, 142.24 and 29.83%, respectively after intranasal administration. The results of fluorescence labeling showed that the fluorescent intensity of coumarin-6 in the brain tissue was the highest after intranasal administration of PLA-α-asarone fluorescent nanoparticles, achieving the purpose of brain-targeted drug delivery. The fluorescent intensity of coumarin-6 in liver tissue after intravenous administration of PLA-α-asarone nanoparticles was much higher than that after intranasal administration, indicating that intranasal administration of PLA-α-asarone nanoparticles could decrease drug-induced hepatotoxicity. In addition, the fluorescent intensity of coumarin-6 in lung tissue was weaker after intranasal administration, which solved the shortcomings of intranasal administration of α-asarone dry powder prepared by airflow pulverization method. In vivo studies indicated that PLA-α-asarone nanoparticles after intranasal administration had a stronger brain targeting as compared with intravenous administration. Copyright© by the Chinese Pharmaceutical Association.

  19. Early Intranasal Vasopressin Administration Impairs Partner Preference in Adult Male Prairie Voles (Microtus ochrogaster).

    Science.gov (United States)

    Simmons, Trenton C; Balland, Jessica F; Dhauna, Janeet; Yang, Sang Yun; Traina, Jason L; Vazquez, Jessica; Bales, Karen L

    2017-01-01

    Research supports a modulatory role for arginine vasopressin (AVP) in the expression of socially motivated behaviors in mammals. The acute effects of AVP administration are demonstrably pro-social across species, providing the justification for an ever-increasing measure of clinical interest over the last decade. Combining these results with non-invasive intranasal delivery results in an attractive system for offering intranasal AVP (IN-AVP) as a therapeutic for the social impairments of children with autism spectrum disorder. But, very little is known about the long-term effects of IN-AVP during early development. In this experiment, we explored whether a single week of early juvenile administration of IN-AVP (low = 0.05 IU/kg, medium = 0.5 IU/kg, high = 5.0 IU/kg) could impact behavior across life in prairie voles. We found increases in fecal boli production during open field and novel object recognition testing for the medium dose in both males and females. Medium-dose females also had significantly more play bouts than control when exposed to novel conspecifics during the juvenile period. Following sexual maturity, the medium and high doses of IN-AVP blocked partner preference formation in males, while no such impairment was found for any of the experimental groups in females. Finally, the high-dose selectively increased adult male aggression with novel conspecifics, but only after extended cohabitation with a mate. Our findings confirm that a single week of early IN-AVP treatment can have organizational effects on behavior across life in prairie voles. Specifically, the impairments in pair-bonding behavior experienced by male prairie voles should raise caution when the prosocial effects of acute IN-AVP demonstrated in other studies are extrapolated to long-term treatment.

  20. Early Intranasal Vasopressin Administration Impairs Partner Preference in Adult Male Prairie Voles (Microtus ochrogaster

    Directory of Open Access Journals (Sweden)

    Trenton C. Simmons

    2017-06-01

    Full Text Available Research supports a modulatory role for arginine vasopressin (AVP in the expression of socially motivated behaviors in mammals. The acute effects of AVP administration are demonstrably pro-social across species, providing the justification for an ever-increasing measure of clinical interest over the last decade. Combining these results with non-invasive intranasal delivery results in an attractive system for offering intranasal AVP (IN-AVP as a therapeutic for the social impairments of children with autism spectrum disorder. But, very little is known about the long-term effects of IN-AVP during early development. In this experiment, we explored whether a single week of early juvenile administration of IN-AVP (low = 0.05 IU/kg, medium = 0.5 IU/kg, high = 5.0 IU/kg could impact behavior across life in prairie voles. We found increases in fecal boli production during open field and novel object recognition testing for the medium dose in both males and females. Medium-dose females also had significantly more play bouts than control when exposed to novel conspecifics during the juvenile period. Following sexual maturity, the medium and high doses of IN-AVP blocked partner preference formation in males, while no such impairment was found for any of the experimental groups in females. Finally, the high-dose selectively increased adult male aggression with novel conspecifics, but only after extended cohabitation with a mate. Our findings confirm that a single week of early IN-AVP treatment can have organizational effects on behavior across life in prairie voles. Specifically, the impairments in pair-bonding behavior experienced by male prairie voles should raise caution when the prosocial effects of acute IN-AVP demonstrated in other studies are extrapolated to long-term treatment.

  1. [The humoral immune response in mice induced by recombinant Lactococcus lactis expressing HIV-1 gag].

    Science.gov (United States)

    Zhao, Xiaofei; Zhang, Cairong; Liu, Xiaojuan; Ma, Zhenghai

    2014-11-01

    To analyze the humoral immune response induced by recombinant Lactococcus lactis expressing HIV-1 gag in mice immunized orally, intranasally, subcutaneously or in the combined way of above three. Fifty BALB/c mice were randomly divided into 5 groups, 10 mice per group. The mice were immunized consecutively three times at two week intervals with 10(9) CFU of recombinant Lactococcus lactis expressing gag through oral, intranasal, subcutaneous administration or the mix of them. The mice that were immunized orally with Lactococcus lactis containing PMG36e served as a control group. The sera of mice were collected before primary immunization and 2 weeks after each immunization to detect the gag specific IgG by ELISA. Compared with the control group, the higher titer of serum gag specific IgG was detected in the four groups immunized with recombinant Lactococcus lactis expressing gag, and it was the highest in the mixed immunization group (PLactococcus lactis expressing gag can induce humoral immune response in mice by oral, intranasal, subcutaneous injection or the mix of them, and the mixed immunization can enhance the immune effects of Lactococcus lactis vector vaccine.

  2. Longitudinal multiparameter single-cell analysis of macaques immunized with pneumococcal protein-conjugated or unconjugated polysaccharide vaccines reveals distinct antigen specific memory B cell repertoires.

    Directory of Open Access Journals (Sweden)

    Bin Jia

    Full Text Available The efficacy of protein-conjugated pneumococcal polysaccharide vaccines has been well characterized for children. The level of protection conferred by unconjugated polysaccharide vaccines remains less clear, particularly for elderly individuals who have had prior antigenic experience through immunization with unconjugated polysaccharide vaccines or natural exposure to Streptococcus pneumoniae.We compared the magnitude, diversity and genetic biases of antigen-specific memory B cells in two groups of adult cynomolgus macaques that were immunized with a 7-valent conjugated vaccine and boosted after five years with either a 13-valent pneumococcal polysaccharide conjugate vaccine (13vPnC or a 23-valent unconjugated pneumococcal polysaccharide vaccine (23vPS using microengraving (a single-cell analysis method and single-cell RT-PCR.Seven days after boosting, the mean frequency of antigen-specific memory B cells was significantly increased in macaques vaccinated with 13vPnC compared to those receiving 23vPS. The 13vPnC-vaccinated macaques also exhibited a more even distribution of antibody specificities to four polysaccharides in the vaccine (PS4, 6B, 14, 23F that were examined. However, single-cell analysis of the antibody variable region sequences from antigen-specific B cells elicited by unconjugated and conjugated vaccines indicated that both the germline gene segments forming the heavy chains and the average lengths of the Complementary Determining Region 3 (CDR3 were similar.Our results confirm that distinctive differences can manifest between antigen-specific memory B cell repertoires in nonhuman primates immunized with conjugated and unconjugated pneumococcal polysaccharide vaccines. The study also supports the notion that the conjugated vaccines have a favorable profile in terms of both the frequency and breadth of the anamnestic response among antigen-specific memory B cells.

  3. Longitudinal multiparameter single-cell analysis of macaques immunized with pneumococcal protein-conjugated or unconjugated polysaccharide vaccines reveals distinct antigen specific memory B cell repertoires.

    Science.gov (United States)

    Jia, Bin; McNeil, Lisa K; Dupont, Christopher D; Tsioris, Konstantinos; Barry, Rachel M; Scully, Ingrid L; Ogunniyi, Adebola O; Gonzalez, Christopher; Pride, Michael W; Gierahn, Todd M; Liberator, Paul A; Jansen, Kathrin U; Love, J Christopher

    2017-01-01

    The efficacy of protein-conjugated pneumococcal polysaccharide vaccines has been well characterized for children. The level of protection conferred by unconjugated polysaccharide vaccines remains less clear, particularly for elderly individuals who have had prior antigenic experience through immunization with unconjugated polysaccharide vaccines or natural exposure to Streptococcus pneumoniae. We compared the magnitude, diversity and genetic biases of antigen-specific memory B cells in two groups of adult cynomolgus macaques that were immunized with a 7-valent conjugated vaccine and boosted after five years with either a 13-valent pneumococcal polysaccharide conjugate vaccine (13vPnC) or a 23-valent unconjugated pneumococcal polysaccharide vaccine (23vPS) using microengraving (a single-cell analysis method) and single-cell RT-PCR. Seven days after boosting, the mean frequency of antigen-specific memory B cells was significantly increased in macaques vaccinated with 13vPnC compared to those receiving 23vPS. The 13vPnC-vaccinated macaques also exhibited a more even distribution of antibody specificities to four polysaccharides in the vaccine (PS4, 6B, 14, 23F) that were examined. However, single-cell analysis of the antibody variable region sequences from antigen-specific B cells elicited by unconjugated and conjugated vaccines indicated that both the germline gene segments forming the heavy chains and the average lengths of the Complementary Determining Region 3 (CDR3) were similar. Our results confirm that distinctive differences can manifest between antigen-specific memory B cell repertoires in nonhuman primates immunized with conjugated and unconjugated pneumococcal polysaccharide vaccines. The study also supports the notion that the conjugated vaccines have a favorable profile in terms of both the frequency and breadth of the anamnestic response among antigen-specific memory B cells.

  4. Immunization against dental caries.

    Science.gov (United States)

    Koga, Toshihiko; Oho, Takahiko; Shimazaki, Yoshihiro; Nakano, Yoshio

    2002-05-15

    Dental caries is one of the most common infectious diseases. Of the oral bacteria, mutans streptococci, such as Streptococcus mutans and S. sobrinus, are considered to be causative agents of dental caries in humans. There have been numerous studies of the immunology of mutans streptococci. To control dental caries, dental caries vaccines have been produced using various cell-surface antigens of these organisms. Progress in recombinant DNA technology and peptide synthesis has been applied to the development of recombinant and synthetic peptide vaccines to control dental caries. Significant protective effects against dental caries have been shown in experimental animals, such as mice, rats and monkeys, which have been subcutaneously, orally, or intranasally immunized with these antigens. Only a few studies, however, have examined the efficacy of dental caries vaccines in humans. Recently, local passive immunization using murine monoclonal antibodies, transgenic plant antibodies, egg-yolk antibodies, and bovine milk antibodies to antigens of mutans streptococci have been used to control the colonization of the organisms and the induction of dental caries in human. Such immunization procedures may be a safer approach for controlling human dental caries than active immunization.

  5. Murine CR1/2 targeted antigenized single-chain antibody fragments induce transient low affinity antibodies and negatively influence an ongoing immune response.

    Science.gov (United States)

    Prechl, József; Molnár, Eszter; Szekeres, Zsuzsanna; Isaák, Andrea; Papp, Krisztián; Balogh, Péter; Erdei, Anna

    2007-01-01

    We have generated a single-chain antibody which recognizes murine CR1/2 and carries a genetically fused influenza hemagglutinin derived peptide. Theoretically such a construct is able to crosslink the B cell antigen receptor and CR1/2 on peptide specific B cells. The construct was able to reach its CR1/2 positive target cells, yet intraperitoneal delivery of the construct elicited an IgM response only slightly exceeding that induced by the free peptide. Providing T cell help by the injection of peptide specific lymphocytes did not alter the response in essence, that is anti-peptide IgG was not detectable even after booster immunizations. When used as a booster vaccine following injection of the peptide in adjuvant, the construct even inhibited the development of IgG1 and IgG3 anti-peptide antibodies. These data indicate that although targeting of antigen to CR1/2 on B cells can enhance transient proliferation or differentiation of antigen specific B cells it cannot induce strong, longlasting humoral immune responses. Furthermore, CR1/2 targeting constructs may negatively influence an ongoing immune reaction.

  6. Association of Single-Nucleotide Polymorphisms in Immune-Related Genes with Development of Dengue Hemorrhagic Fever in a Mexican Population.

    Science.gov (United States)

    Vargas-Castillo, Angélica Berenice; Ruiz-Tovar, Karina; Vivanco-Cid, Héctor; Quiroz-Cruz, Sarai; Escobar-Gutiérrez, Alejandro; Cerna-Cortes, Jorge Francisco; Vaughan, Gilberto; Fonseca-Coronado, Salvador

    2017-11-13

    Single-nucleotide polymorphisms (SNPs) occurring in immune-related genes have been associated with risk or protection for development of dengue, depending on ethnicity. Here, we genotyped seven SNPs located in immune response-related genes to identify their association with severe forms of dengue in patients from an endemic region in Mexico. One hundred and thirty-eight patients with dengue fever (DF), thirty-one dengue hemorrhagic fever (DHF) patients, as well as 304 healthy donors were genotyped by using a TaqMan-based approach. SNP analysis, including rs1800629 (TNF), rs4804803 (CD209), rs2780831 (JAK1), rs1801274 (FCGR2A), rs231775 (CTLA4), rs12979860, and rs8099917 (IFNL3), was performed. The rs1800629 A-allele in the TNF gene was associated with an increased risk of DHF (OR = 3.4, CI = 1.235-9.284 p = 0.0212) whereas SNPs rs4804803, rs2780831, rs1801274, rs231775, rs12979860, and rs8099917 showed no association in this cohort. These results show that allelic variations in TNF can play an important role in the development of DHF. However, the lack of association between all remaining SNPs and DHF suggests that the genetic background might directly modify the role of these immune-related molecules, leading to the milder illness often observed in a Mexican population.

  7. Antigen delivery by filamentous bacteriophage fd displaying an anti-DEC-205 single-chain variable fragment confers adjuvanticity by triggering a TLR9-mediated immune response.

    Science.gov (United States)

    Sartorius, Rossella; D'Apice, Luciana; Trovato, Maria; Cuccaro, Fausta; Costa, Valerio; De Leo, Maria Giovanna; Marzullo, Vincenzo Manuel; Biondo, Carmelo; D'Auria, Sabato; De Matteis, Maria Antonietta; Ciccodicola, Alfredo; De Berardinis, Piergiuseppe

    2015-07-01

    Filamentous bacteriophage fd particles delivering antigenic determinants via DEC-205 (fdsc-αDEC) represent a powerful delivery system that induces CD8(+) T-cell responses even when administered in the absence of adjuvants or maturation stimuli for dendritic cells. In order to investigate the mechanisms of this activity, RNA-Sequencing of fd-pulsed dendritic cells was performed. A significant differential expression of genes involved in innate immunity, co-stimulation and cytokine production was observed. In agreement with these findings, we demonstrate that induction of proinflammatory cytokines and type I interferon by fdsc-αDEC was MYD88 mediated and TLR9 dependent. We also found that fdsc-αDEC is delivered into LAMP-1-positive compartments and co-localizes with TLR9. Thus, phage particles containing a single-strand DNA genome rich in CpG motifs delivered via DEC-205 are able to intercept and trigger the active TLR9 innate immune receptor into late endosome/lysosomes and to enhance the immunogenicity of the displayed antigenic determinants. These findings make fd bacteriophage a valuable tool for immunization without administering exogenous adjuvants. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.

  8. Sensitization of glioblastoma tumor micro-environment to chemo- and immunotherapy by Galectin-1 intranasal knock-down strategy.

    Science.gov (United States)

    Van Woensel, Matthias; Mathivet, Thomas; Wauthoz, Nathalie; Rosière, Rémi; Garg, Abhishek D; Agostinis, Patrizia; Mathieu, Véronique; Kiss, Robert; Lefranc, Florence; Boon, Louis; Belmans, Jochen; Van Gool, Stefaan W; Gerhardt, Holger; Amighi, Karim; De Vleeschouwer, Steven

    2017-04-27

    In this study, we evaluated the consequences of reducing Galectin-1 (Gal-1) in the tumor micro-environment (TME) of glioblastoma multiforme (GBM), via nose-to-brain transport. Gal-1 is overexpressed in GBM and drives chemo- and immunotherapy resistance. To promote nose-to-brain transport, we designed siRNA targeting Gal-1 (siGal-1) loaded chitosan nanoparticles that silence Gal-1 in the TME. Intranasal siGal-1 delivery induces a remarkable switch in the TME composition, with reduced myeloid suppressor cells and regulatory T cells, and increased CD4+ and CD8+ T cells. Gal-1 knock-down reduces macrophages' polarization switch from M1 (pro-inflammatory) to M2 (anti-inflammatory) during GBM progression. These changes are accompanied by normalization of the tumor vasculature and increased survival for tumor bearing mice. The combination of siGal-1 treatment with temozolomide or immunotherapy (dendritic cell vaccination and PD-1 blocking) displays synergistic effects, increasing the survival of tumor bearing mice. Moreover, we could confirm the role of Gal-1 on lymphocytes in GBM patients by matching the Gal-1 expression and their T cell signatures. These findings indicate that intranasal siGal-1 nanoparticle delivery could be a valuable adjuvant treatment to increase the efficiency of immune-checkpoint blockade and chemotherapy.

  9. Rejection of large HPV-16 expressing tumors in aged mice by a single immunization of VacciMax® encapsulated CTL/T helper peptides

    Directory of Open Access Journals (Sweden)

    MacDonald Lisa

    2007-06-01

    Full Text Available Abstract The incidence of cancer increases significantly in later life, yet few pre-clinical studies of cancer immunotherapy use mice of advanced age. A novel vaccine delivery platform (VacciMax®,VM is described that encapsulates antigens and adjuvants in multilamellar liposomes in a water-in-oil emulsion. The therapeutic potential of VM-based vaccines administered as a single dose was tested in HLA-A2 transgenic mice of advanced age (48–58 weeks old bearing large palpable TC1/A2 tumors. The VM-based vaccines contained one or more peptides having human CTL epitopes derived from HPV 16 E6 and E7. VM formulations contained a single peptide, a mixture of four peptides or the same four peptides linked together in a single long peptide. All VM formulations contained PADRE and CpG as adjuvants and ISA51 as the hydrophobic component of the water-in-oil emulsion. VM-formulated vaccines containing the four peptides as a mixture or linked together in one long peptide eradicated 19-day old established tumors within 21 days of immunization. Peptide-specific cytotoxic cellular responses were confirmed by ELISPOT and intracellular staining for IFN-γ producing CD8+ T cells. Mice rendered tumor-free by vaccination were re-challenged in the opposite flank with 10 million HLF-16 tumor cells, another HLA-A2/E6/E7 expressing tumor cell line. None of these mice developed tumors following the re-challenge. In summary, this report describes a VM-formulated therapeutic vaccine with the following unprecedented outcome: a eradication of large tumors (> 700 mm3 b in mice of advanced age c in less than three weeks post-immunization d following a single vaccination.

  10. Rejection of large HPV-16 expressing tumors in aged mice by a single immunization of VacciMax encapsulated CTL/T helper peptides.

    Science.gov (United States)

    Daftarian, Pirouz M; Mansour, Marc; Pohajdak, Bill; Fuentes-Ortega, Antar; Korets-Smith, Ella; Macdonald, Lisa; Weir, Genevieve; Brown, Robert G; Kast, W Martin

    2007-06-07

    The incidence of cancer increases significantly in later life, yet few pre-clinical studies of cancer immunotherapy use mice of advanced age. A novel vaccine delivery platform (VacciMax,VM) is described that encapsulates antigens and adjuvants in multilamellar liposomes in a water-in-oil emulsion. The therapeutic potential of VM-based vaccines administered as a single dose was tested in HLA-A2 transgenic mice of advanced age (48-58 weeks old) bearing large palpable TC1/A2 tumors. The VM-based vaccines contained one or more peptides having human CTL epitopes derived from HPV 16 E6 and E7. VM formulations contained a single peptide, a mixture of four peptides or the same four peptides linked together in a single long peptide. All VM formulations contained PADRE and CpG as adjuvants and ISA51 as the hydrophobic component of the water-in-oil emulsion. VM-formulated vaccines containing the four peptides as a mixture or linked together in one long peptide eradicated 19-day old established tumors within 21 days of immunization. Peptide-specific cytotoxic cellular responses were confirmed by ELISPOT and intracellular staining for IFN-gamma producing CD8+ T cells. Mice rendered tumor-free by vaccination were re-challenged in the opposite flank with 10 million HLF-16 tumor cells, another HLA-A2/E6/E7 expressing tumor cell line. None of these mice developed tumors following the re-challenge. In summary, this report describes a VM-formulated therapeutic vaccine with the following unprecedented outcome: a) eradication of large tumors (> 700 mm3) b) in mice of advanced age c) in less than three weeks post-immunization d) following a single vaccination.

  11. Discovery of 6-Amino-2-{[(1S)-1-methylbutyl]oxy}-9-[5-(1-piperidinyl)pentyl]-7,9-dihydro-8H-purin-8-one (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of Asthma.

    Science.gov (United States)

    Biggadike, Keith; Ahmed, Mahbub; Ball, Doug I; Coe, Diane M; Dalmas Wilk, Deidre A; Edwards, Chris D; Gibbon, Bob H; Hardy, Charlotte J; Hermitage, Stephen A; Hessey, Joanne O; Hillegas, Aimee E; Hughes, Stephen C; Lazarides, Linos; Lewell, Xiao Q; Lucas, Amanda; Mallett, David N; Price, Mark A; Priest, Fiona M; Quint, Diana J; Shah, Poonam; Sitaram, Anesh; Smith, Stephen A; Stocker, Richard; Trivedi, Naimisha A; Tsitoura, Daphne C; Weller, Victoria

    2016-03-10

    Induction of IFNα in the upper airways via activation of TLR7 represents a novel immunomodulatory approach to the treatment of allergic asthma. Exploration of 8-oxoadenine derivatives bearing saturated oxygen or nitrogen heterocycles in the N-9 substituent has revealed a remarkable selective enhancement in IFNα inducing potency in the nitrogen series. Further potency enhancement was achieved with the novel (S)-pentyloxy substitution at C-2 leading to the selection of GSK2245035 (32) as an intranasal development candidate. In human cell cultures, compound 32 resulted in suppression of Th2 cytokine responses to allergens, while in vivo intranasal administration at very low doses led to local upregulation of TLR7-mediated cytokines (IP-10). Target engagement was confirmed in humans following single intranasal doses of 32 of ≥20 ng, and reproducible pharmacological response was demonstrated following repeat intranasal dosing at weekly intervals.

  12. Immunogenicity of a modified-live virus vaccine against bovine viral diarrhea virus types 1 and 2, infectious bovine rhinotracheitis virus, bovine parainfluenza-3 virus, and bovine respiratory syncytial virus when administered intranasally in young calves.

    Science.gov (United States)

    Xue, Wenzhi; Ellis, John; Mattick, Debra; Smith, Linda; Brady, Ryan; Trigo, Emilio

    2010-05-14

    The immunogenicity of an intranasally-administered modified-live virus (MLV) vaccine in 3-8 day old calves was evaluated against bovine viral diarrhea virus (BVDV) types 1 and 2, infectious bovine rhinotracheitis (IBR) virus, parainfluenza-3 (PI-3) virus and bovine respiratory syncytial virus (BRSV). Calves were intranasally vaccinated with a single dose of a multivalent MLV vaccine and were challenged with one of the respective viruses three to four weeks post-vaccination in five separate studies. There was significant sparing of diseases in calves intranasally vaccinated with the MLV vaccine, as indicated by significantly fewer clinical signs, lower rectal temperatures, reduced viral shedding, greater white blood cell and platelet counts, and less severe pulmonary lesions than control animals. This was the first MLV combination vaccine to demonstrate efficacy against BVDV types 1 and 2, IBR, PI-3 and BRSV in calves 3-8 days of age. Copyright 2010 Elsevier Ltd. All rights reserved.

  13. Introduction of a point mutation into an HLA class I single-chain trimer induces enhancement of CTL priming and antitumor immunity

    Directory of Open Access Journals (Sweden)

    Masanori Matsui

    2014-01-01

    Full Text Available We previously discovered one particular HLA-A*02:01 mutant that enhanced peptide-specific cytotoxic T lymphocyte (CTL recognition in vitro compared to wild-type HLA-A*02:01. This mutant contains a single amino acid substitution from histidine to leucine at position 74 (H74L that is located in the peptide-binding groove. To investigate the effect of the H74L mutation on the in vivo CTL priming, we took advantage of the technology of the HLA class I single-chain trimer (SCT in which three components involving a peptide, β2 microglobulin and the HLA class I heavy chain are joined together via flexible linkers. We generated recombinant adenovirus expressing SCT comprised influenza A matrix protein (FMP-derived peptide, β2 microglobulin and the H74L heavy chain. HLA-A*02:01 transgenic mice were immunized with the adenovirus, and the induction of peptide-specific CTLs and antitumor immunity was investigated. It was clearly shown that the H74L mutation enabled the HLA-A*02:01 SCT molecule to dramatically enhance both in vivo priming of FMP-specific CTLs and protection against a lethal challenge of tumor cells expressing FMP. These data present the first evidence that a simple point mutation in the HLA class I heavy chain of SCT is beneficial for improving CTL-based immunotherapy and prophylaxis to control tumors.

  14. Systemic and Mucosal Antibody Responses to Soluble and Nanoparticle-Conjugated Antigens Administered Intranasally

    Directory of Open Access Journals (Sweden)

    Savannah E. Howe

    2016-10-01

    Full Text Available Nanoparticles (NPs are increasingly being used for drug delivery, as well as antigen carriers and immunostimulants for the purpose of developing vaccines. In this work, we examined how intranasal (i.n. priming followed by i.n. or subcutaneous (s.c. boosting immunization affects the humoral immune response to chicken ovalbumin (Ova and Ova conjugated to 20 nm NPs (NP-Ova. We show that i.n. priming with 20 mg of soluble Ova, a dose known to trigger oral tolerance when administered via gastric gavage, induced substantial systemic IgG1 and IgG2c, as well as mucosal antibodies. These responses were further boosted following a s.c. immunization with Ova and complete Freund’s adjuvant (Ova+CFA. In contrast, 100 µg of Ova delivered via NPs induced an IgG1-dominated systemic response, and primed the intestinal mucosa for secretion of IgA. Following a secondary s.c. or i.n. immunization with Ova+CFA or NP-Ova, systemic IgG1 titers significantly increased, and serum IgG2c and intestinal antibodies were induced in mice primed nasally with NP-Ova. Only Ova- and NP-Ova-primed mice that were s.c.-boosted exhibited substantial systemic and mucosal titers for up to 6 months after priming, whereas the antibodies of i.n.-boosted mice declined over time. Our results indicate that although the amount of Ova delivered by NPs was 1000-fold less than Ova delivered in soluble form, the antigen-specific antibody responses, both systemic and mucosal, are essentially identical by 6 months following the initial priming immunization. Additionally, both i.n.- and s.c.-boosting strategies for NP-Ova-primed mice were capable of inducing a polarized Th1/Th2 immune response, as well as intestinal antibodies; however, it is only by using a heterogeneous prime-boost strategy that long-lasting antibody responses were initiated. These results provide valuable insight for future mucosal vaccine development, as well as furthering our understanding of mucosal antibody responses.

  15. Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease

    Science.gov (United States)

    Harmon, Brendan Trevor

    Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof

  16. Protection of mice against the highly pathogenic VVIHD-J by DNA and fowlpox recombinant vaccines, administered by electroporation and intranasal routes, correlates with serum neutralizing activity.

    Science.gov (United States)

    Bissa, Massimiliano; Quaglino, Elena; Zanotto, Carlo; Illiano, Elena; Rolih, Valeria; Pacchioni, Sole; Cavallo, Federica; De Giuli Morghen, Carlo; Radaelli, Antonia

    2016-10-01

    The control of smallpox was achieved using live vaccinia virus (VV) vaccine, which successfully eradicated the disease worldwide. As the variola virus no longer exists as a natural infection agent, mass vaccination was discontinued after 1980. However, emergence of smallpox outbreaks caused by accidental or deliberate release of variola virus has stimulated new research for second-generation vaccine development based on attenuated VV strains. Considering the closely related animal poxviruses that also arise as zoonoses, and the increasing number of unvaccinated or immunocompromised people, a safer and more effective vaccine is still required. With this aim, new vectors based on avian poxviruses that cannot replicate in mammals should improve the safety of conventional vaccines, and protect from zoonotic orthopoxvirus diseases, such as cowpox and monkeypox. In this study, DNA and fowlpox (FP) recombinants that expressed the VV L1R, A27L, A33R, and B5R genes were generated (4DNAmix, 4FPmix, respectively) and tested in mice using novel administration routes. Mice were primed with 4DNAmix by electroporation, and boosted with 4FPmix applied intranasally. The lethal VV IHD-J strain was then administered by intranasal challenge. All of the mice receiving 4DNAmix followed by 4FPmix, and 20% of the mice immunized only with 4FPmix, were protected. The induction of specific humoral and cellular immune responses directly correlated with this protection. In particular, higher anti-A27 antibodies and IFNγ-producing T lymphocytes were measured in the blood and spleen of the protected mice, as compared to controls. VV IHD-J neutralizing antibodies in sera from the protected mice suggest that the prime/boost vaccination regimen with 4DNAmix plus 4FPmix may be an effective and safe mode to induce protection against smallpox and poxvirus zoonotic infections. The electroporation/intranasal administration routes contributed to effective immune responses and mouse survival. Copyright

  17. Iatrogenic Cushing’s Syndrome Following Short-Term Intranasal Steroid Use

    Science.gov (United States)

    Dutta, Deep; KS, Shivaprasad; Ghosh, Sujoy; Mukhopadhyay, Satinath; Chowdhury, Subhankar

    2012-01-01

    Cushing’s syndrome (CS) is common after oral steroid use and has also been reported following topical or inhaled use, but it is extremely uncommon after intranasal administration. In this paper, we present the case of a child who developed CS after intranasal application of combined moxifloxacin-dexamethasone eye drops for epistaxis for a period of 3 months. CS caused by ocular preparations of steroids has not been reported previously. This case report highlights the fact that even eye drops can contain high doses of steroids and can lead to CS especially in children and especially if used intranasally. Ocular steroid drops should not be used intranasally. To minimize gastrointestinal absorption and therefore the risk of CS, nasal sprays should be preferred over nasal drops for intranasal steroid application.Key words: Cushing’s syndrome, eye drops, dexamethasone, epistaxis Conflict of interest:None declared. PMID:22985615

  18. Comparison of intranasal azelastine to intranasal fluticasone propionate for symptom control in moderate-to-severe seasonal allergic rhinitis.

    Science.gov (United States)

    Carr, Warner W; Ratner, Paul; Munzel, Ullrich; Murray, Ruth; Price, David; Canonica, G Walter; Mullol, Joaquim; Virchow, J Christian; Lieberman, Phil; Meltzer, Eli; Bachert, Claus

    2012-01-01

    Intranasal corticosteroids are considered the most effective therapy for moderate-to-severe seasonal allergic rhinitis (SAR) and recommended first line in guidelines. It is uncertain whether intranasal antihistamines have comparable efficacy. This study was designed to compare the efficacy of azelastine (AZE; 137 μg/spray) and fluticasone propionate (FP; 50 μg/spray), both given as 1 spray/nostril bid (i.e., approved dosing regimen in the United States), in SAR via a post hoc analysis of data from a previously published direct-comparison study. Six hundred ten moderate-to-severe SAR patients (≥12 years old) were randomized into a double-blind, placebo-controlled, parallel-group trial. The primary efficacy variable was change from baseline in reflective total nasal symptom score (rTNSS (morning and evening), over 14 days. Reflective total ocular symptom score (rTOSS) was a key secondary variable. Reflective total of seven symptom scores (rT7SS [nasal plus ocular symptoms]) and time to ≥50% reduction from baseline in these key parameters were also analyzed. AZE and FP reduced rTNSS from baseline by a similar degree (-3.25 versus -3.84; p = 0.2014). Patients experienced comparable improvement in rTOSS (-2.62 versus -2.17; p = 0.2371) and rT7SS (-5.83 versus -6.05; p = 0.7820). FP was superior to AZE in alleviating rhinorrhea (-1.15 versus -0.87; p = 0.0433), but AZE showed comparable efficacy for all other nasal and ocular symptoms. There was no clinically or statistically significant difference between AZE (-1.17) and FP (-1.43) for reduction in the overall rhinitis quality of life questionnaire score (although FP, but not AZE, significantly differed from placebo). A similar proportion of patients in the AZE and FP groups achieved a 50% reduction in rTNSS. However, more AZE patients (53.0%) exhibited a 50% reduction in rTOSS by day 14 versus FP (39.6%), and ≤3 days faster (p = 0.028). Intranasal AZE (137 micrograms/spray) and intranasal FP (50 micrograms

  19. Mucosal vaccination with formalin-inactivated avian metapneumovirus subtype C does not protect turkeys following intranasal challenge.

    Science.gov (United States)

    Kapczynski, Darrell R; Perkins, Laura L; Sellers, Holly S

    2008-03-01

    Studies were performed to determine if mucosal vaccination with inactivated avian metapneumovirus (aMPV) subtype C protected turkey poults from clinical disease and virus replication following mucosal challenge. Decreases in clinical disease were not observed in vaccinated groups, and the vaccine failed to inhibit virus replication in the tracheas of 96% of vaccinated birds. Histopathologically, enhancement of pulmonary lesions following virus challenge was associated with birds receiving the inactivated aMPV vaccine compared to unvaccinated birds. As determined by an enzyme-linked immunosorbent assay (ELISA), all virus-challenged groups increased serum immunoglobulin (Ig) G and IgA antibody production against the virus following challenge; however, the unvaccinated aMPV-challenged group displayed the highest increases in virus-neutralizing antibody. On the basis of these results it is concluded that intranasal vaccination with inactivated aMPV does not induce protective immunity, reduce virus shedding, or result in decreased histopathologic lesions.

  20. Use of Direct Otoscope for Intranasal Examination After Dacryocystorhinostomy.

    Science.gov (United States)

    Yazici, Bulent; Sabur, Huri; Orucov, Nesimi

    2016-01-01

    To evaluate whether the use of a direct otoscope in the nose is an effective method to observe the nasolacrimal anastomosis site after dacryocystorhinostomy. In 75 eyes undergoing external dacryocystorhinostomy, the lacrimal irrigation test was performed and fluorescein solution was instilled in the conjunctival sac. After applying topical anesthetics and decongestant, a direct otoscope was inserted in the middle meatus and directed toward the medial canthus. In 69 eyes (92%), intranasal lacrimal examination with the otoscope could be performed. In 6 eyes (8%), the otoscope could not be adequately advanced in the nose because of middle meatal stenosis (n = 5 eyes) or intolerance to the intranasal examination (n = 1). In 66 (96%) of 69 eyes, concordant with the results of the lacrimal irrigation test, the presence or absence of fluorescein dye flow in the nose was observed. In this examination, the main features that were useful in locating the anastomotic area were (1) the use of fluorescein dye, (2) motility of the nasal mucosa that was synchronized with eyelid movements, (3) appearance of mucosal hole or internal orifice in the nasal wall, and (4) dye or air-fluid bubble emergence upon blinking or finger pressure over the sac region. Direct otoscope can be effectively used in the nose for examining the nasolacrimal anastomosis in patients undergoing dacryocystorhinostomy.

  1. Comparison of immune response of Pacific white shrimp, Litopenaeus vannamei, after multiple and single infections with WSSV and Vibrio anguillarum

    Science.gov (United States)

    Our previous study demonstrated that Pacific white shrimp (Litopenaeus vannamei) infected by multiple pathogens showed higher mortality and death occurred more quickly than those infected by a single pathogen [1]. For better understanding the defense mechanism against white spot syndrome virus (WSSV...

  2. Intranasal delivery of cholera toxin induces th17-dominated T-cell response to bystander antigens.

    Directory of Open Access Journals (Sweden)

    Jee-Boong Lee

    Full Text Available Cholera toxin (CT is a potent vaccine adjuvant, which promotes mucosal immunity to protein antigen given by nasal route. It has been suggested that CT promotes T helper type 2 (Th2 response and suppresses Th1 response. We here report the induction of Th17-dominated responses in mice by intranasal delivery of CT. This dramatic Th17-driving effect of CT, which was dependent on the B subunit, was observed even in Th1 or Th2-favored conditions of respiratory virus infection. These dominating Th17 responses resulted in the significant neutrophil accumulation in the lungs of mice given CT. Both in vitro and in vivo treatment of CT induced strongly augmented IL-6 production, and Th17-driving ability of CT was completely abolished in IL-6 knockout mice, indicating a role of this cytokine in the Th17-dominated T-cell responses by CT. These data demonstrate a novel Th17-driving activity of CT, and help understand the mechanisms of CT adjuvanticity to demarcate T helper responses.

  3. Polysaccharide specific monoclonal antibodies provide passive protection against intranasal challenge with Burkholderia pseudomallei.

    Science.gov (United States)

    AuCoin, David P; Reed, Dana E; Marlenee, Nicole L; Bowen, Richard A; Thorkildson, Peter; Judy, Barbara M; Torres, Alfredo G; Kozel, Thomas R

    2012-01-01

    Burkholderia pseudomallei is a Gram-negative bacillus that is the causative agent of melioidosis. The bacterium is inherently resistant to many antibiotics and mortality rates remain high in endemic areas. The lipopolysaccharide (LPS) and capsular polysaccharide (CPS) are two surface-associated antigens that contribute to pathogenesis. We previously developed two monoclonal antibodies (mAbs) specific to the CPS and LPS; the CPS mAb was shown to identify antigen in serum and urine from melioidosis patients. The goal of this study was to determine if passive immunization with CPS and LPS mAbs alone and in combination would protect mice from a lethal challenge with B. pseudomallei. Intranasal (i.n.) challenge experiments were performed with B. pseudomallei strains 1026b and K96423. Both mAbs provided significant protection when administered alone. A combination of mAbs was protective when low doses were administered. In addition, combination therapy provided a significant reduction in spleen colony forming units (cfu) compared to results when either the CPS or LPS mAbs were administered alone.

  4. Polysaccharide specific monoclonal antibodies provide passive protection against intranasal challenge with Burkholderia pseudomallei.

    Directory of Open Access Journals (Sweden)

    David P AuCoin

    Full Text Available Burkholderia pseudomallei is a Gram-negative bacillus that is the causative agent of melioidosis. The bacterium is inherently resistant to many antibiotics and mortality rates remain high in endemic areas. The lipopolysaccharide (LPS and capsular polysaccharide (CPS are two surface-associated antigens that contribute to pathogenesis. We previously developed two monoclonal antibodies (mAbs specific to the CPS and LPS; the CPS mAb was shown to identify antigen in serum and urine from melioidosis patients. The goal of this study was to determine if passive immunization with CPS and LPS mAbs alone and in combination would protect mice from a lethal challenge with B. pseudomallei. Intranasal (i.n. challenge experiments were performed with B. pseudomallei strains 1026b and K96423. Both mAbs provided significant protection when administered alone. A combination of mAbs was protective when low doses were administered. In addition, combination therapy provided a significant reduction in spleen colony forming units (cfu compared to results when either the CPS or LPS mAbs were administered alone.

  5. Evaluating the immunogenicity of an intranasal vaccine against nicotine in mice using the Adjuvant Finlay Proteoliposome (AFPL1

    Directory of Open Access Journals (Sweden)

    Nya L. Fraleigh

    2016-08-01

    Full Text Available Tobacco smoking is recognized as a global pandemic resulting in 6 million deaths per year. Despite a variety of anti-smoking products available to aid with tobacco cessation, the majority of people who attempt to quit smoking relapse within 6 months due to the addictive nature of nicotine. An immunotherapy approach could offer a promising treatment option by inducing a potent selective antibody response against nicotine in order to block its distribution to the brain and its addictive effects in the central nervous system. Our nicotine vaccine candidate was administered intranasally using the Neisseria meningitidis serogroup B Adjuvant Finlay Proteoliposome 1 (AFPL1 as a part of the delivery system. This system was designed to generate a robust immune response by stimulating IL-1β production through Toll-like receptor 4 (TLR4, a potent mechanism for mucosal immunity. The vaccine induced high antibody titers in mice sera in addition to inducing mucosal antibodies. The efficacy of our vaccine was demonstrated using in vivo challenge experiments with radioactive [3H]-nicotine, followed by an analysis of nicotine distribution in the lung, liver, blood and brain. Our results were encouraging as the nicotine concentration in the brain tissue of mice vaccinated with our candidate vaccine was four times lower than in non-vaccinated controls; suggesting that the anti-nicotine antibodies were able to block nicotine from crossing the blood brain barrier. In summary, we have developed a novel nicotine vaccine for the treatment of tobacco addiction by intranasal administration and also demonstrated that the AFPL1 can be used as a potential adjuvant for this vaccine design.

  6. Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

    Science.gov (United States)

    Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

    2013-09-01

    Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Divergent immune responses and disease outcomes in piglets immunized with inactivated and attenuated H3N2 swine influenza vaccines in the presence of maternally-derived antibodies

    Science.gov (United States)

    Vaccine-associated enhanced respiratory disease (VAERD) can occur in pigs immunized with whole-inactivated influenza virus (WIV) vaccine and subsequently infected with an antigenically divergent virus of the same HA subtype. Live-attenuated influenza virus (LAIV) vaccines administered intranasally h...

  8. Ribosome display of combinatorial antibody libraries derived from mice immunized with heat-killed Xylella fastidiosa and the selection of MopB-specific single-chain antibodies.

    Science.gov (United States)

    Azizi, Armaghan; Arora, Arinder; Markiv, Anatoliy; Lampe, David J; Miller, Thomas A; Kang, Angray S

    2012-04-01

    Pierce's disease is a devastating lethal disease of Vitus vinifera grapevines caused by the bacterium Xylella fastidiosa. There is no cure for Pierce's disease, and control is achieved predominantly by suppressing transmission of the glassy-winged sharpshooter insect vector. We present a simple robust approach for the generation of panels of recombinant single-chain antibodies against the surface-exposed elements of X. fastidiosa that may have potential use in diagnosis and/or disease transmission blocking studies. In vitro combinatorial antibody ribosome display libraries were assembled from immunoglobulin transcripts rescued from the spleens of mice immunized with heat-killed X. fastidiosa. The libraries were used in a single round of selection against an outer membrane protein, MopB, resulting in the isolation of a panel of recombinant antibodies. The potential use of selected anti-MopB antibodies was demonstrated by the successful application of the 4XfMopB3 antibody in an enzyme-linked immunosorbent assay (ELISA), a Western blot assay, and an immunofluorescence assay (IFA). These immortalized in vitro recombinant single-chain antibody libraries generated against heat-killed X. fastidiosa are a resource for the Pierce's disease research community that may be readily accessed for the isolation of antibodies against a plethora of X. fastidiosa surface-exposed antigenic molecules.

  9. Dietary Bacillus subtilis FPTB13 and chitin, single or combined, modulate systemic and cutaneous mucosal immunity and resistance of catla, Catla catla (Hamilton) against edwardsiellosis.

    Science.gov (United States)

    Sangma, Timothy; Kamilya, Dibyendu

    2015-12-01

    Effects of dietary administration of Bacillus subtilis FPTB13 and chitin, single or combined, on the systemic immunity, mucosal immunity and resistance of catla (Catla catla) against Edwardsiella tarda infection were investigated. The probiotic attributes of B. subtilis was tested by conducting antagonism study, safety in catla, in vitro immunomodulation and dietary immunomodulation. Results of these studies indicated the probiotic potential of the strain. From the preliminary dietary immunomodulation study, a dose of 10(9) B. subtilis cells g(-1) was selected for inclusion into diets for subsequent experiments. Experimental diets were prepared by adding B. subtilis (10(9) cells g(-1)), chitin (2%) and their combination to the basal diet. Different systemic and mucosal immunological parameters viz. oxygen radical production, myeloperoxidase content, lysozyme activity, total protein content and alkaline phosphatase activity showed significant enhancement (peffect in catla. The results also collectively suggest the usefulness of applying a combined probiotic and immunostimulant supplemented diet to achieve greater benefits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  11. Splenectomy vs. rituximab as a second-line therapy in immune thrombocytopenic purpura: a single center experience.

    Science.gov (United States)

    Al Askar, Ahmed S; Shaheen, Naila A; Al Zahrani, Mohsen; Al Otaibi, Mohammed G; Al Qahtani, Bader S; Ahmed, Faris; Al Zughaibi, Mohand; Kamran, Ismat; Mendoza, May Anne; Khan, Altaf

    2018-01-01

    Immune thrombocytopenic purpura (ITP) is a common hematological disease treated primarily by corticosteroids. The aim of the present study was to compare response rate between patients, underwent splenectomy vs. rituximab as second-line therapy. Adult patients diagnosed with ITP who did not respond to corticosteroids or relapsed during the period 1990-2014 were included in a quasi-experimental study. Categorical variables were compared using Fisher exact test. Response to treatment was compared using logistic regression. Data were analyzed using SAS V9.2. One-hundred and forty-three patients with ITP were identified through medical records. Of 62 patients treated, 30 (48.38%) required second-line therapy. 19 (63%) patients received rituximab, and 11 (37%) underwent splenectomy. Platelets at diagnosis were not different between study groups (p = 0.062). Splenectomy group patients were younger (p = 0.011). Response to second-line therapy showed no significant difference between two groups (OR 2.03, 95% CI (0.21-22.09), p = 0.549). Results did not show a statistically significant difference in platelet counts over time between treatment groups (p = 0.101). When used exclusively as a second-line therapy for steroid-refractory ITP, the response rate was not statistically different between rituximab and splenectomy. However, further large studies are needed to assess the response rates for these treatment modalities as a second-line therapy.

  12. Immune and stress mediators in response to bilateral adnexectomy: comparison of single-port access and conventional laparoscopy in a porcine model.

    Science.gov (United States)

    Gracia, Meritxell; Sisó, Cristian; Martínez-Zamora, M Àngels; Sarmiento, Laura; Lozano, Francisco; Arias, Maria Teresa; Beltrán, Joan; Balasch, Juan; Carmona, Francisco

    2014-01-01

    To evaluate systemic markers of immune and stress responses after bilateral adnexectomy performed using 2 different laparoscopic techniques in pigs. Prospective comparative study (Canadian Task Force classification II-2). University teaching hospital, research hospital, and tertiary care center. Twenty female Yorkshire pigs undergoing laparoscopic surgery. Animals underwent bilateral salpingo-oophorectomy (ovary and fallopian tube extraction), performed via conventional laparoscopy (n = 10) or the single-port access approach (n = 10). Injury provokes an acute-phase response, primarily produced by cytokines. The inflammatory response has been well described for major surgery and for conventional laparoscopy; however, little information is currently available for single-port laparoscopy, and none in the gynecologic field. This is the first study to compare serum cytokine interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-α) concentrations at baseline and in the early postoperative period (2, 4, and 20 hours) after bilateral salpingo-oophorectomy performed via conventional laparoscopy (n = 10) or single-port access (n = 10) in a porcine model. The stress response was measured using glucose and cortisol concentrations and the animals' response to surgery via a 6-category observation-based behavior test. Both IL-6 and TNF-α concentrations peaked at 4 hours after surgery, and were significantly lower in the single-port access group (p = .02) than in the conventional laparoscopy group (p = .02). In addition, in the single-port access group, concentrations of stress markers were slightly lower at all intervals recorded and were statistically significant at 2 hours after the operation for glucose concentration (mean [SD], 164.50 [26.73] mg/dL for conventional laparoscopy vs 86.50 [17.93] mg/dL for single-port access; p = .02). Evidence of improved inflammatory and stress responses was recorded in the minimally invasive single-port group. More clinical

  13. Intranasal oxytocin versus placebo in the treatment of adults with autism spectrum disorders: a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Anagnostou Evdokia

    2012-12-01

    Full Text Available Abstract Background There are no effective medications for the treatment of social cognition/function deficits in autism spectrum disorder (ASD, and adult intervention literature in this area is sparse. Emerging data from animal models and genetic association studies as well as early, single-dose intervention studies suggest that the oxytocin system may be a potential therapeutic target for social cognition/function deficits in ASD. The primary aim of this study was to examine the safety/therapeutic effects of intranasal oxytocin versus placebo in adults with ASD, with respect to the two core symptom domains of social cognition/functioning and repetitive behaviors. Methods This was a pilot, randomized, double-blind, placebo-controlled, parallel design trial of intranasal oxytocin versus placebo in 19 adults with ASD (16 males; 33.20 ± 13.29 years. Subjects were randomized to 24 IU intranasal oxytocin or placebo in the morning and afternoon for 6 weeks. Measures of social function/cognition (the Diagnostic Analysis of Nonverbal Accuracy and repetitive behaviors (Repetitive Behavior Scale Revised were administered. Secondary measures included the Social Responsiveness Scale, Reading-the-Mind-in-the-Eyes Test and the Yale Brown Obsessive Compulsive Scale – compulsion subscale and quality of life (World Health Organization Quality of Life Questionnaire – emotional/social subscales. Full-information maximum-likelihood parameter estimates were obtained and tested using mixed-effects regression analyses. Results Although no significant changes were detected in the primary outcome measures after correcting for baseline differences, results suggested improvements after 6 weeks in measures of social cognition (Reading-the-Mind-in-the-Eyes Test, p = 0.002, d = 1.2, and quality of life (World Health Organization Quality of Life Questionnaire – emotion, p = 0.031, d = 0.84, both secondary measures. Oxytocin was well tolerated and no serious adverse

  14. Humidification of inspired oxygen is increased with pre-nasal cannula, compared to intranasal cannula.

    Science.gov (United States)

    Dellweg, Dominic; Wenze, Markus; Hoehn, Ekkehard; Bourgund, Olaf; Haidl, Peter

    2013-08-01

    Oxygen therapy is usually combined with a humidification device, to prevent mucosal dryness. Depending on the cannula design, oxygen can be administered pre- or intra-nasally (administration of oxygen in front of the nasal ostia vs cannula system inside the nasal vestibulum). The impact of cannula design on intra-nasal humidity, however, has not been investigated to date. First, to develop a system, that samples air from the nasal cavity and analyzes the humidity of these samples. Second, to investigate nasal humidity during pre-nasal and intra-nasal oxygen application, with and without humidification. We first developed and validated a sampling and analysis system to measure humidity from air samples. By means of this system we measured inspiratory air samples from 12 subjects who received nasal oxygen with an intra-nasal and pre-nasal cannula at different flows, with and without humidification. The sampling and analysis system showed good correlation to a standard hygrometer within the tested humidity range (r = 0.99, P humidification (P = .001, P humidification. With the addition of humidification we observed no significant change in humidity at any flow, and independent of pre- or intranasal oxygen administration. Pre-nasal administration of dry oxygen achieves levels of intranasal humidity similar to those achieved by intranasal administration in combination with a bubble through humidifier. Pre-nasal oxygen simplifies application and may reduce therapy cost.

  15. Intranasal fentanyl for pain control: current status with a focus on patient considerations

    Directory of Open Access Journals (Sweden)

    Eric Prommer

    2011-03-01

    Full Text Available Eric Prommer, Lisa ThompsonDivision of Hematology/Oncology, Mayo Clinic College of Medicine, Mayo Clinic Hospital, Scottsdale, AZ, USAAbstract: Of several newer delivery systems under development and investigation for the administration of opioids, the intranasal route has received a substantial amount of attention. Intranasal administration is a convenient form of delivery that is applicable to several opioids. It has the potential for self-administration, combined with a rapid onset of action, allowing for patient-controlled analgesia. In clinical practice, intranasal administration has been found to be a reliable drug delivery method that is familiar to patients. Intranasal opioids have proven to be useful in both in-hospital and out-of-hospital pain management settings. Fentanyl, a highly lipophilic step 3 opioid, has been evaluated for intranasal administration. The purpose of this review is to examine the role of the nasal route of opioid administration and examine the evidence base for the use of fentanyl intranasally.Keywords: fentanyl, intranasal, pain, breakthrough pain

  16. Clinical outcome of childhood chronic immune thrombocytopenia: A 38-year experience from a single tertiary center in Thailand.

    Science.gov (United States)

    Chotsampancharoen, Thirachit; Sripornsawan, Pornpun; Duangchoo, Sarapee; Wongchanchailert, Malai; McNeil, Edward

    2017-11-01

    There is limited information on long-term follow-up and prognostic factors for remission among children diagnosed with chronic immune thrombocytopenia (ITP). The aim of this study was to determine clinical outcomes and factors influencing remission in childhood chronic ITP. The hospital records of children aged 0-15 years diagnosed with chronic ITP were retrospectively reviewed. Kaplan-Meier curves were fit to estimate the median time to complete remission with 95% confidence intervals (CIs). Multivariate Cox proportional hazards regression models were used to identify independent factors for remission. A total of 113 patients were included in the analysis. The number of children achieving complete remission was 49 (46%) and the median time to remission was 7.1 years (95% CI: 4.8-11.0). The remission rates at 3, 5, 10, and 20 years were 25, 43, 60, and 75%, respectively. Factors influencing remission were platelets >60 × 10 9 /L at the onset of chronic ITP (hazard ratio [HR]: 7.24, 95% CI: 3.0-17.5) and treatment with intravenous immunoglobulin (HR: 0.37, 95% CI: 0.16-0.84). Age, gender, and clinical factors at the time of newly diagnosed ITP including bleeding manifestations, onset of symptoms, and history of preceding infection and vaccination were not predictive of remission. The spontaneous complete remission rates of chronic ITP were 43 and 60% at 5 and 10 years, respectively, and reached 75% at 20 years. A higher platelet level at diagnosis of chronic ITP and form of treatment were statistically significant indicators for achieving complete remission. © 2017 Wiley Periodicals, Inc.

  17. Immune reconstitution after allogeneic hematopoietic stem cell transplantation in children: a single institution study of 59 patients

    Directory of Open Access Journals (Sweden)

    Hyun O Kim

    2013-01-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; Lymphocyte subset recovery is an important factor that determines the success of hematopoietic stem cell transplantation (HSCT. Temporal differences in the recovery of lymphocyte subsets and the factors influencing this recovery are important variables that affect a patient's posttransplant immune reconstitution, and therefore require investigation. &lt;b&gt;Methods:&lt;/b&gt; The time taken to achieve lymphocyte subset recovery and the factors influencing this recovery were investigated in 59 children who had undergone HSCT at the Department of Pediatrics, The Catholic University of Korea Seoul St. Mary's Hospital, and who had an uneventful follow-up period of at least 1 year. Analyses were carried out at 3 and 12 months post-transplant. An additional study was performed 1 month post-transplant to evaluate natural killer (NK cell recovery. The impact of preand post-transplant variables, including diagnosis of Epstein-Barr virus (EBV DNAemia posttransplant,on lymphocyte recovery was evaluated. &lt;b&gt;Results:&lt;/b&gt; The lymphocyte subsets recovered in the following order: NK cells, cytotoxic T cells, B cells,and helper T cells. At 1 month post-transplant, acute graft-versus-host disease was found to contribute significantly to the delay of CD16+/56+ cell recovery. Younger patients showed delayed recovery of both CD3+/CD8+ and CD19+ cells. EBV DNAemia had a deleterious impact on the recovery of both CD3+ and CD3+/CD4+ lymphocytes at 1 year post-transplant. &lt;b&gt;Conclusion:&lt;/b&gt; In our pediatric allogeneic HSCT cohort, helper T cells were the last subset to recover. Younger age and EBV DNAemia had a negative impact on the post-transplant recovery of T cells and B cells.

  18. Intranasal location and immunohistochemical characterization of the equine olfactory epithelium

    Directory of Open Access Journals (Sweden)

    Alexandra Kupke

    2016-10-01

    Full Text Available The olfactory epithelium (OE is the only body site where neurons contact directly the environment and are therefore exposed to a broad variation of substances and insults. It can serve as portal of entry for neurotropic viruses which spread via the olfactory pathway to the central nervous system (CNS. For horses, it has been proposed and concluded mainly from rodent studies that different viruses, e.g. Borna disease virus (BoDV, equine herpesvirus 1 (EHV-1, hendra virus, influenza virus, rabies virus, vesicular stomatitis virus (VSV can use this route. However, little is yet known about cytoarchitecture, protein expression and the intranasal location of the equine OE. Revealing differences in cytoarchitecture or protein expression pattern in comparison to rodents, canines or humans might help to explain varying susceptibility to certain intranasal virus infections. On the other hand, disclosing similarities especially between rodents and other species, e.g. horses would help to underscore transferability of rodent models. Analysis of the complete noses of 5 adult horses revealed that in the equine OE two epithelial subtypes with distinct marker expression exist, designated as types a and b which resemble those previously described in dogs. Detailed statistical analysis was carried out to confirm the results obtained on the descriptive level. The equine OE was predominantly located in caudodorsal areas of the nasal turbinates with a significant decline in rostroventral direction, especially for type a. Immunohistochemically, olfactory marker protein (OMP and doublecortin (DCX expression was found in more cells of OE type a, whereas expression of proliferating cell nuclear antigen (PCNA and tropomyosin receptor kinase A (TrkA was present in more cells of type b. Accordingly, type a resembles the mature epithelium, in contrast to the more juvenile type b. Protein expression profile was comparable to canine and rodent OE but equine type a and b were

  19. Use of Intranasal Naloxone by Basic Life Support Providers.

    Science.gov (United States)

    Weiner, Scott G; Mitchell, Patricia M; Temin, Elizabeth S; Langlois, Breanne K; Dyer, K Sophia

    2017-01-01

    Intranasal delivery of naloxone to reverse the effects of opioid overdose by Advanced Life Support (ALS) providers has been studied in several prehospital settings. In 2006, in response to the increase in opioid-related overdoses, a special waiver from the state allowed administration of intranasal naloxone by Basic Life Support (BLS) providers in our city. This study aimed to determine: 1) if patients who received a 2-mg dose of nasal naloxone administered by BLS required repeat dosing while in the emergency department (ED), and 2) the disposition of these patients. This was a retrospective review of patients transported by an inner-city municipal ambulance service to one of three academic medical centers. We included patients aged 18 and older that were transported by ambulance between 1/1/2006 and 12/12/2012 and who received intranasal naloxone by BLS providers as per a state approved protocol. Site investigators matched EMS run data to patients from each hospital's EMR and performed a chart review to confirm that the patient was correctly identified and to record the outcomes of interest. Descriptive statistics were then generated. A total of 793 patients received nasal naloxone by BLS and were transported to three hospitals. ALS intervened and transported 116 (14.6%) patients, and 11 (1.4%) were intubated in the field. There were 724 (91.3%) patients successfully matched to an ED chart. Hospital A received 336 (46.4%) patients, Hospital B received 210 (29.0%) patients, and Hospital C received 178 (24.6%) patients. Mean age was 36.2 (SD 10.5) years and 522 (72.1%) were male; 702 (97.1%) were reported to have abused heroin while 21 (2.9%) used other opioids. Nasal naloxone had an effect per the prehospital record in 689 (95.2%) patients. An additional naloxone dose was given in the ED to 64 (8.8%) patients. ED dispositions were: 507 (70.0%) discharged, 105 (14.5%) admitted, and 112 (15.5%) other (e.g., left against medical advice, left without being seen, or

  20. Intranasal Tooth - An Ectopic Eruption of Mesiodens in Nasal Cavity: A Case Report and Review

    Directory of Open Access Journals (Sweden)

    R Guru Prasad

    2011-01-01

    Full Text Available An intranasal tooth (INT is an ectopic tooth erupting into the nasal cavity. It is a rare clinical entity. Ectopic and supernumerary teeth may be present in many regions of maxillofacial skeleton. Ectopic teeth maybe supernumerary, deciduous or permanent. The clinical manifestations of intranasal tooth are quite variable and they may cause a variety of symptoms and complications. Their clinical and radiographic presentations are classical, posing little challenge to the diagnostician. The identification of such teeth can be important since they have potential to cause considerable morbidity. Here, we describe a case of intranasal tooth along with possible etiopathogenesis, clinical and radiographic features, differential diagnosis, potential complications and treatment modalities.

  1. Nasal saline or intranasal corticosteroids to treat allergic rhinitis in children

    Science.gov (United States)

    Madison, Stefani; Brown, Elizabeth Aubrey; Franklin, Rachel; Wickersham, Elizabeth A.; McCarthy, Laine H.

    2016-01-01

    Clinical Question In pediatric populations, is nasal saline irrigation as effective as intranasal corticosteroids at relieving allergic rhinitis symptoms? Answer No. Intranasal steroids are more effective than nasal saline alone to reduce symptoms of allergic rhinitis (AR) in children. Combination therapy further improves symptom reduction. Level of Evidence for the Answer B Search Terms Allergic Rhinitis, Nasal Saline, Nasal corticosteroids, children younger than age 18. Date Search Was Conducted August and September 2014, October 2015. Inclusion Criteria Meta-analyses, randomized controlled trials, systematic reviews, cohort studies, nasal spray, hypertonic saline solution, nasal lavage, rhinitis, intranasal administration, nasal saline, human, English language. Exclusion Criteria Antihistamines, Adults, Articles older than 2008 PMID:27328556

  2. Clinical Question: Nasal saline or intranasal corticosteroids to treat allergic rhinitis in children.

    Science.gov (United States)

    Madison, Stefani; Brown, Elizabeth Aubrey; Franklin, Rachel; Wickersham, Elizabeth A; McCarthy, Laine H

    2016-01-01

    In pediatric populations, is nasal saline irrigation as effective as intranasal corticosteroids at relieving allergic rhinitis symptoms? No. Intranasal steroids are more effective than nasal saline alone to reduce symptoms of allergic rhinitis (AR) in children. Combination therapy further improves symptom reduction. LEVEL OF EVIDENCE FOR THE ANSWER: B SEARCH TERMS: Allergic Rhinitis, Nasal Saline, Nasal corticosteroids, children younger than age 18. DATE SEARCH WAS CONDUCTED: August and September 2014, October 2015. Meta-analyses, randomized controlled trials, systematic reviews, cohort studies, nasal spray, hypertonic saline solution, nasal lavage, rhinitis, intranasal administration, nasal saline, human, English language. Antihistamines, Adults, Articles older than 2008.

  3. A Novel Delivery Method of Cyclovirobuxine D for Brain-Targeting: Chitosan Coated Nanoparticles Loading Cyclovirobuxine D by Intranasal Administration.

    Science.gov (United States)

    Wei, Hanmei; Lai, Sisi; Wei, Jiabao; Yang, Lei; Jiang, Ning; Wang, Qing; Yu, Yang

    2018-08-01

    The blood-brain barrier (BBB) restricts the delivery of most drugs to the brain. In our previous study, the feasibility of cyclovirobuxine D delivery to the brain by a non-invasive nasal route was evaluated. In this study, a suitable drug delivery system by way of intranasal administration was developed, which could improve brain targeting. First, a formulation of cyclovirobuxine D (CVB-D) based on chitosan nanoparticles (CS-CVB-D-NPs) was prepared by the modified ionotropic gelation method through single-factor screening experiment. The CS-CVB-D-NPs with a entrapment efficiency (EE) of (62.82±2.59)% were found to be of a narrow polydispersity index (PI) (0.19±0.01) and (235.37± 12.71) nm in size, with a zeta potential of (33.9 ± 1.7) mV. The NPs possessed a sustained release characterization with in vitro release of 88.03 ± 2.30% at 24 h. In vivo, the higher AUC0-t(brain) of CS-CVB-D-NPs by intranasal administration revealed the development of a novel brain-targeting delivery method of CVB-D.

  4. Evaluation of Antibody and Cytokines Responses in Intranasally and Intramuscularly Administrated BALB/C Mice With Influenza Virus-Like Particle

    Directory of Open Access Journals (Sweden)

    Haideh Nadmdari

    2017-12-01

    Full Text Available We previously developed an influenza virus like particle with HA, M, and NA proteins using Bac-to-Bac expression system and SF9 cell line. To evaluate the immunogenicity of our construct, we assessed the humoral, cytokine induced by H1N1-VLP in BALB/c mice immunized intranasally and intramuscularly. Enzyme-linked immunosorbent assay and Relative quantitative real-time PCR were used to evaluate the antibody (IgG and IgA and mRNA levels of IL-6, IL-4, IL-10 and IFN-g in PBMCs. Our results showed that VLP was capable of intranasal (I.N. and intramuscular (I.M. induction of serum IgG and IgA responses. Interestingly, I.N. route induced higher IgG and IgA titer than I.M. route, which was statistically significant. Moreover, mRNA levels of IL-6 (4.2-4.5 folds, IFN-g (5.5-5.7 folds, and the anti-inflammatory cytokine IL-10 (2.5-3 folds and IL-4 (2.4-2.8 folds were significantly elevated in mice immunized I.N. and I.M. with H1N1-VLP compared to the control group. Our findings indicated that a non-infectious genome-less VLP approach mimics parenteral virus with multiple viral antigens and epitopes that stimulate a diverse set of immune responses such as innate immunity, specific serum IgG antibody, cell-mediated immunity, and local antibodies.

  5. Formulation and kinetic modeling of curcumin loaded intranasal mucoadhesive microemulsion

    Directory of Open Access Journals (Sweden)

    B Mikesh Patel

    2012-01-01

    Full Text Available It is a challenge to develop the optimum dosage form of poorly water-soluble drugs and to target them due to limited bioavailability, intra and inter subject variability. In this investigation, mucoadhesive microemulsion of curcumin was developed by water titration method taking biocompatible components for intranasal delivery and was characterized. Nasal ciliotoxicity studies were carried out using excised sheep nasal mucosa. in vitro release studies of formulations and PDS were performed. Labrafil M 1944 CS based microemulsion was transparent, stable and nasal non-ciliotoxic having particle size 12.32±0.81nm (PdI=0.223 and from kinetic modeling, the release was found to be Fickian diffusion for mucoadhesive microemulsion.

  6. Intranasal oxytocin blocks alcohol withdrawal in human subjects.

    Science.gov (United States)

    Pedersen, Cort A; Smedley, Kelly L; Leserman, Jane; Jarskog, Lars Fredrik; Rau, Shane W; Kampov-Polevoi, Alexei; Casey, Robin L; Fender, Trace; Garbutt, James C

    2013-03-01

    The neuropeptide, oxytocin (OT), has been reported to block tolerance formation to alcohol and decrease withdrawal symptoms in alcohol-dependent rodents. Numerous recent studies in human subjects indicate that OT administered by the intranasal route penetrates into and exerts effects within the brain. In a randomized, double-blind clinical trial, intranasal OT (24 IU/dose, N = 7) or placebo (N = 4) was given twice daily for 3 days in alcohol-dependent subjects admitted to a research unit for medical detoxification using Clinical Institute Withdrawal Assessment for Alcohol (CIWA) score-driven PRN administration of lorazepam. Subjects rated themselves on the Alcohol Withdrawal Symptom Checklist (AWSC) each time CIWA scores were obtained. Subjects also completed the Penn Alcohol Craving Scale, an Alcohol Craving Visual Analog Scale (ACVAS) and the Profile of Mood States (POMS) on inpatient days 2 and 3. All subjects had drunk heavily each day for at least 2 weeks prior to study and had previously experienced withdrawal upon stopping/decreasing alcohol consumption. OT was superior to placebo in reducing alcohol withdrawal as evidenced by: less total lorazepam required to complete detoxification (3.4 mg [4.7, SD] vs. 16.5 [4.4], p = 0.0015), lower mean CIWA scores on admission day 1 (4.3 [2.3] vs. 11.8 [0.4], p block alcohol withdrawal in human subjects. Our results are consistent with previous findings in rodents that OT inhibits neuroadaptation to and withdrawal from alcohol. OT could have advantages over benzodiazepines in managing alcohol withdrawal because it may reverse rather than maintain sedative-hypnotic tolerance. It will be important to test whether OT treatment is effective in reducing drinking in alcohol-dependent outpatients. Copyright © 2012 by the Research Society on Alcoholism.

  7. Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

    2013-11-01

    We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

  8. Vaccination against H9N2 avian influenza virus reduces bronchus-associated lymphoid tissue formation in cynomolgus macaques after intranasal virus challenge infection.

    Science.gov (United States)

    Nakayama, Misako; Ozaki, Hiroichi; Itoh, Yasushi; Soda, Kosuke; Ishigaki, Hirohito; Okamatsu, Masatoshi; Sakoda, Yoshihiro; Park, Chun-Ho; Tsuchiya, Hideaki; Kida, Hiroshi; Ogasawara, Kazumasa

    2016-12-01

    H9N2 avian influenza virus causes sporadic human infection. Since humans do not possess acquired immunity specific to this virus, we examined the pathogenicity of an H9N2 virus isolated from a human and then analyzed protective effects of a vaccine in cynomolgus macaques. After intranasal challenge with A/Hong Kong/1073/1999 (H9N2) (HK1073) isolated from a human patient, viruses were isolated from nasal and tracheal swabs in unvaccinated macaques with mild fever and body weight loss. A formalin-inactivated H9N2 whole particle vaccine derived from our virus library was subcutaneously inoculated to macaques. Vaccination induced viral antigen-specific IgG and neutralization activity in sera. After intranasal challenge with H9N2, the virus was detected only the day after inoculation in the vaccinated macaques. Without vaccination, many bronchus-associated lymphoid tissues (BALTs) were formed in the lungs after infection, whereas the numbers of BALTs were smaller and the cytokine responses were weaker in the vaccinated macaques than those in the unvaccinated macaques. These findings indicate that the H9N2 avian influenza virus HK1073 is pathogenic in primates but seems to cause milder symptoms than does H7N9 influenza virus as found in our previous studies and that a formalin-inactivated H9N2 whole particle vaccine induces protective immunity against H9N2 virus. © 2016 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  9. Peripheral expression of LACK-mRNA induced by intranasal vaccination with PCI-NEO-LACK defines the protection duration against murine visceral leishmaniasis.

    Science.gov (United States)

    De Oliveira Gomes, Daniel Cláudio; Schwedersky, Rodrigo Porto; Barbosa De-Melo, Luiz Dione; Da Silva Costa Souza, Beatriz Lilian; De Matos Guedes, Herbert Leonel; Lopes, Ulisses Gazos; Rossi-Bergmann, Bartira

    2012-10-01

    LACK (Leishmania analogue of the receptor kinase C) is a conserved protein in the protozoan of the genus Leishmania, which is associated with the immunopathogenesis and susceptibility of BALB/c mice to Leishmania major infection. We previously demonstrated that intranasal immunization with a plasmid DNA encoding the p36/LACK leishmanial antigen (pCI-neo-LACK) followed by challenge 7 days after a booster dose effectively protects BALB/c mice against both cutaneous and visceral leishmaniasis. In the present study, the correlation between systemic mRNA expression after nasal DNA uptake, and the duration of protective immunity was addressed. LACK mRNA transcripts were detected in the spleen, brain, cervical lymph nodes and popliteal lymph nodes as early as 7 days, lasting 3 months after vaccination with pCI-neo-LACK. The kinetics of transcript expression correlated with enhanced cutaneous hypersensitivity against parasite antigens. Leishmania chagasi infection at 7 days or 3 months, but not 6 months after vaccination resulted in significantly lower parasite loads as compared with non-vaccinated controls. Protection also correlated with enhanced spleen cell responsiveness to parasite antigens leading to increased IFN- γ and IL-4 and decreased IL-10 production. Together, these data demonstrate that the protection conferred by the intranasal DNA vaccine lasts at least 3 months and is associated with expression of vaccine mRNA in peripheral organs.

  10. Single or combined effects of Lactobacillus sakei and inulin on growth, non-specific immunity and IgM expression in leopard grouper (Mycteroperca rosacea).

    Science.gov (United States)

    Reyes-Becerril, Martha; Ascencio, Felipe; Gracia-Lopez, Vicente; Macias, Ma Esther; Roa, Marcos Cadena; Esteban, María Ángeles

    2014-08-01

    The aim of this study was to evaluate the single or combined effects of Lactobacillus sakei with inulin suitable for immunological in vivo studies in farmed fish. By in vitro assays, L. sakei strain 5-4 showed antibacterial activities against all assayed fish pathogens (except the Vibrio harveyi strain CAIM-1793). L. sakei was able to survive at high fish bile concentrations. Fermentation of the agave inulin resulted in a large increase in number of lactobacilli. For the in vivo study, fish were fed for 8 weeks four practical diets: control diet (control), L. sakei 5-4 (10(7) CFU/g), inulin (1% or 10 g/kg) and L. sakei + inulin (10(7) CFU/g + 10 g/kg). The weight gain showed clearly the synergistic effect of L. sakei 5-4 and inulin at 6 and 8 weeks of treatments. Leopard grouper fed with L. sakei alone or combined with inulin have significantly increased the assayed physiological and humoral immune parameters. By real-time PCR assays, the mRNA transcripts of immunoglobulin M (IgM) were found to be higher expressed in intestine, head kidney, mucus, gill, spleen and skin. Moreover, mRNA expression levels of IgM in head kidney and anterior intestine were measured by real-time PCR. L. sakei 5-4 and L. sakei + inulin supplemented diet up-regulated the expression of IgM at week 4 and 8 in intestine and head kidney, respectively. These results support the idea that the L. sakei 5-4 alone or combined with agave inulin improved growth performance and stimulates the immune system of leopard grouper.

  11. Screening for single-chain variable fragment antibodies against multiple Cry1 toxins from an immunized mouse phage display antibody library.

    Science.gov (United States)

    Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin

    2018-04-01

    Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7  CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.

  12. Selection of single domain antibodies from immune libraries displayed on the surface of E. coli cells with two β-domains of opposite topologies.

    Directory of Open Access Journals (Sweden)

    Valencio Salema

    Full Text Available Screening of antibody (Ab libraries by direct display on the surface of E. coli cells is hampered by the presence of the outer membrane (OM. In this work we demonstrate that the native β-domains of EhaA autotransporter and intimin, two proteins from enterohemorrhagic E. coli O157:H7 (EHEC with opposite topologies in the OM, are effective systems for the display of immune libraries of single domain Abs (sdAbs from camelids (nanobodies or VHH on the surface of E. coli K-12 cells and for the selection of high affinity sdAbs using magnetic cell sorting (MACS. We analyzed the capacity of EhaA and intimin β-domains to display individual sdAbs and sdAb libraries obtained after immunization with the extracellular domain of the translocated intimin receptor from EHEC (TirM(EHEC. We demonstrated that both systems displayed functional sdAbs on the surface of E. coli cells with little proteolysis and cellular toxicity, although E. coli cells displaying sdAbs with the β-domain of intimin showed higher antigen-binding capacity. Both E. coli display libraries were screened for TirM(EHEC binding clones by MACS. High affinity binders were selected by both display systems, although more efficiently with the intimin β-domain. The specificity of the selected clones against TirM(EHEC was demonstrated by flow cytometry of E. coli cells, along with ELISA and surface plasmon resonance with purified sdAbs. Finally, we employed the E. coli cell display systems to provide an estimation of the affinity of the selected sdAb by flow cytometry analysis under equilibrium conditions.

  13. Intranasal epidermoid cyst causing upper airway obstruction in three brachycephalic dogs.

    Science.gov (United States)

    Murgia, D; Pivetta, M; Bowlt, K; Volmer, C; Holloway, A; Dennis, R

    2014-08-01

    This case report describes three brachycephalic dogs with intranasal epidermoid cysts that were causing additional upper airway obstruction. Although epidermoid cysts have been described in several locations in dogs, to the authors' knowledge intranasal epidermoid cysts have not been previously reported. All dogs had mucopurulent to haemorrhagic nasal discharge. Magnetic resonance imaging of the head revealed the presence of unilateral or bilateral intranasal cystic lesions obstructing the nasal cavities partially or completely, with atrophy of the ipsilateral nasal turbinates. The cystic lesions were surgically excised in all dogs using a modified lateral alveolar mucosal approach to the affected nasal cavity. Aerobic, anaerobic and fungal culture of the cystic contents were negative and histology of the excised tissue was consistent with a benign intranasal epidermoid cyst in each dog. Upper airway obstruction was clinically improved in two dogs. © 2014 British Small Animal Veterinary Association.

  14. Influence of intranasal and carotid cooling on cerebral temperature balance and oxygenation

    DEFF Research Database (Denmark)

    Nybo, Lars; Wanscher, Michael; Secher, Niels H.

    2014-01-01

    The present study evaluated the influence of intranasal cooling with balloon catheters, increased nasal ventilation, or percutaneous cooling of the carotid arteries on cerebral temperature balance and oxygenation in six healthy male subjects. Aortic arch and internal jugular venous blood temperat......The present study evaluated the influence of intranasal cooling with balloon catheters, increased nasal ventilation, or percutaneous cooling of the carotid arteries on cerebral temperature balance and oxygenation in six healthy male subjects. Aortic arch and internal jugular venous blood...... temperatures were measured to assess the cerebral heat balance and corresponding paired blood samples were obtained to evaluate cerebral metabolism and oxygenation at rest, following 60 min of intranasal cooling, 5 min of nasal ventilation, and 15 min with carotid cooling. Intranasal cooling induced a parallel...

  15. Intranasal phototherapy versus azelastine in the treatment of seasonal allergic rhinitis.

    Science.gov (United States)

    Albu, Silviu; Baschir, Sorin

    2013-10-01

    It has been suggested that intranasal phototherapy represents an alternative choice in the treatment of seasonal allergic rhinitis (SAR). Our aim was to compare the efficacy of intranasal phototherapy with that of azelastine in patients with SAR. Seventy seven patients were randomly assigned to the two treatment groups: Group A (phototherapy) and Group B (azelastine). Subjective and objective outcomes were represented by changes in Total Nasal Symptom Score (TNSS), Quality of life scores (Rhinoconjunctivitis Quality of Life Questionnaire - RQLQ), and nasal resistance. The study demonstrated that both azelastine and intranasal phototherapy are able to significantly improve TNSS, including individual nasal symptoms. Nevertheless, phototherapy reduced nasal obstruction better than azelastine (p=0.038). Both treatments were highly effective in improving RQLQ scores overall and in seven separate domains. Whether intranasal phototheraphy will be a standard treatment of SAR or not should be appraised in future studies and clinical trials. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. Effect of an intranasal conrticosteroid on exercide induced bronchocostriction in asthmatic children

    NARCIS (Netherlands)

    Kersten, E.T.; Leeuwen, J.C. van; Brand, P.L.; Duiverman, E.J.; de Jongh, Franciscus H.C.; Thio, B.J.; Driessen, J.M.

    2012-01-01

    Rationale: Allergic rhinitis and exercise induced bronchoconstriction (EIB) are common in asthmatic children. The aim of this study was to investigate whether treatment of allergic rhinitis with an intranasal corticosteroid protects against EIB in asthmatic children. Methods: This was a

  17. Cushing's syndrome, growth impairment, and occult adrenal suppression associated with intranasal steroids.

    Science.gov (United States)

    Perry, R J; Findlay, C A; Donaldson, M D C

    2002-07-01

    We have previously described iatrogenic Cushing's syndrome secondary to intranasal steroids. This report further highlights the potential deleterious effects of intranasal steroids. Nine cases (including the original two cases) are reviewed to show the varied clinical manifestations of adrenal suppression caused by intranasal steroids. Four presented with Cushing's syndrome, three with growth failure, while two asymptomatic patients were discovered in the course of pituitary function testing. Four children had dysmorphic syndromes--Down's, Treacher-Collins, CHARGE association, and campomelic dysplasia--reflecting the vulnerability of such children to ENT problems, together with the difficulty of interpreting steroid induced growth failure in this context. Adrenal suppression was seen not only with betamethasone but also with budesonide, beclomethasone and flunisolide nasal preparations. A careful enquiry as to the use of intranasal steroids should be routine in children presenting with unexplained growth failure or Cushing's syndrome. Particular vigilance/awareness is required in children with dysmorphic syndromes.

  18. A single immunization with soluble recombinant trimeric hemagglutinin protects chickens against highly pathogenic avian influenza virus H5N1.

    Directory of Open Access Journals (Sweden)

    Lisette A H M Cornelissen

    Full Text Available BACKGROUND: The highly pathogenic avian influenza (HPAI virus H5N1 causes multi-organ disease and death in poultry, resulting in significant economic losses in the poultry industry. In addition, it poses a major public health threat as it can be transmitted directly from infected poultry to humans with very high (60% mortality rate. Effective vaccination against HPAI H5N1 would protect commercial poultry and would thus provide an important control measure by reducing the likelihood of bird-to-bird and bird-to-human transmission. METHODOLOGY/PRINCIPAL FINDINGS: In the present study we evaluated the vaccine potential of recombinant soluble trimeric subtype 5 hemagglutinin (sH5(3 produced in mammalian cells. The secreted, purified sH5(3 was biologically active as demonstrated by its binding to ligands in a sialic acid-dependent manner. It was shown to protect chickens, in a dose-dependent manner, against a lethal challenge with H5N1 after a single vaccination. Protected animals did not shed challenge virus as determined by a quantitative RT-PCR on RNA isolated from trachea and cloaca swabs. Also in mice, vaccination with sH5(3 provided complete protection against challenge with HPAI H5N1. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that sH5(3 constitutes an attractive vaccine antigen for protection of chickens and mammals against HPAI H5N1. As these recombinant soluble hemagglutinin preparations can be produced with high yields and with relatively short lead time, they enable a rapid response to circulating and potentially pandemic influenza viruses.

  19. Microneedle Vaccination Elicits Superior Protection and Antibody Response over Intranasal Vaccination against Swine-Origin Influenza A (H1N1 in Mice.

    Directory of Open Access Journals (Sweden)

    Ju-Hyung Shin

    Full Text Available Influenza is one of the critical infectious diseases globally and vaccination has been considered as the best way to prevent. In this study, immunogenicity and protection efficacy between intranasal (IN and microneedle (MN vaccination was compared using inactivated swine-origin influenza A/H1N1 virus vaccine. Mice were vaccinated by MN or IN administration with 1 μg of inactivated H1N1 virus vaccine. Antigen-specific antibody responses and hemagglutination-inhibition (HI titers were measured in all immunized sera after immunization. Five weeks after an immunization, a lethal challenge was performed to evaluate the protective efficacy. Furthermore, mice were vaccinated by IN administration with higher dosages (> 1 μg, analyzed in the same manner, and compared with 1 μg-vaccine-coated MN. Significantly higher antigen-specific antibody responses and HI titer were measured in sera in MN group than those in IN group. While 100% protection, slight weight loss, and reduced viral replication were observed in MN group, 0% survival rate were observed in IN group. As vaccine dose for IN vaccination increased, MN-immunized sera showed much higher antigen-specific antibody responses and HI titer than other IN groups. In addition, protective immunity of 1 μg-MN group was similar to those of 20- and 40 μg-IN groups. We conclude that MN vaccination showed more potential immune response and protection than IN vaccination at the same vaccine dosage.

  20. Responses of primary human nasal epithelial cells to EDIII-DENV stimulation: the first step to intranasal dengue vaccination.

    Science.gov (United States)

    Nantachit, Nattika; Sunintaboon, Panya; Ubol, Sukathida

    2016-08-18

    About half of the world's population are living in the endemic area of dengue viruses implying that a rapid-mass vaccination may be required. In addition, a major target of dengue vaccine are children, thus, a needle-free administration is more attractive. These problems may be overcome by the alternative route of vaccination such as topical, oral and intranasal vaccination. Here, we investigated the possibility to deliver a dengue immunogen intranasally, a painless route of vaccination. The tested immunogen was the domain III of dengue serotype-3 E protein (EDIII-D3) loaded into trimethyl chitosan nanoparticles (EDIII-D3 TMC NPs). The primary human nasal epithelial cells, HNEpCs, were used as an in vitro model for nasal responses. At tested concentrations, EDIII-D3 TMC NPs not only exerted no detectable toxicity toward HNEpC cultures but also efficiently delivered EDIII-D3 immunogens into HNEpCs. Moreover, HNEpCs quickly and strongly produced proinflammatory cytokines (IL-1β, IL-6, TNF-α), type-I IFN, the growth factors (GM-CSF, IL-7), the chemokines (MCP-1, MIP-1β, IL-8), Th1-related cytokines (IL-2, IL-12p70, IL-17, IFN-γ) and Th2-related cytokine (IL-4) in response to EDIII-D3 TMC NPs treatment. A potential mucosal delivery system for dengue immunogens was revealed and found to stimulate a strong local innate antiviral response which possibly leading to a systemic adaptive immunity.

  1. Statistical and Methodological Considerations for the Interpretation of Intranasal Oxytocin Studies.

    Science.gov (United States)

    Walum, Hasse; Waldman, Irwin D; Young, Larry J

    2016-02-01

    Over the last decade, oxytocin (OT) has received focus in numerous studies associating intranasal administration of this peptide with various aspects of human social behavior. These studies in humans are inspired by animal research, especially in rodents, showing that central manipulations of the OT system affect behavioral phenotypes related to social cognition, including parental behavior, social bonding, and individual recognition. Taken together, these studies in humans appear to provide compelling, but sometimes bewildering, evidence for the role of OT in influencing a vast array of complex social cognitive processes in humans. In this article, we investigate to what extent the human intranasal OT literature lends support to the hypothesis that intranasal OT consistently influences a wide spectrum of social behavior in humans. We do this by considering statistical features of studies within this field, including factors like statistical power, prestudy odds, and bias. Our conclusion is that intranasal OT studies are generally underpowered and that there is a high probability that most of the published intranasal OT findings do not represent true effects. Thus, the remarkable reports that intranasal OT influences a large number of human social behaviors should be viewed with healthy skepticism, and we make recommendations to improve the reliability of human OT studies in the future. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  2. Intranasal Administration of Whole Inactivated Influenza Virus Vaccine as a Promising Influenza Vaccine Candidate.

    Science.gov (United States)

    Ainai, Akira; Suzuki, Tadaki; Tamura, Shin-Ichi; Hasegawa, Hideki

    The effect of the current influenza vaccine, an inactivated virus vaccine administered by subcutaneous/intramuscular injection, is limited to reducing the morbidity and mortality associated with seasonal influenza outbreaks. Intranasal vaccination, by contrast, mimics natural infection and induces not only systemic IgG antibodies but also local secretory IgA (S-IgA) antibodies found on the surface of the mucosal epithelium in the upper respiratory tract. S-IgA antibodies are highly effective at preventing virus infection. Although the live attenuated influenza vaccine (LAIV) administered intranasally can induce local antibodies, this vaccine is restricted to healthy populations aged 2-49 years because of safety concerns associated with using live viruses in a vaccine. Instead of LAIV, an intranasal vaccine made with inactivated virus could be applied to high-risk populations, including infants and elderly adults. Normally, a mucosal adjuvant would be required to enhance the effect of intranasal vaccination with an inactivated influenza vaccine. However, we found that intranasal administration of a concentrated, whole inactivated influenza virus vaccine without any mucosal adjuvant was enough to induce local neutralizing S-IgA antibodies in the nasal epithelium of healthy individuals with some immunological memory for seasonal influenza viruses. This intranasal vaccine is a novel candidate that could improve on the current injectable vaccine or the LAIV for the prevention of seasonal influenza epidemics.

  3. The rostral migratory stream plays a key role in intranasal delivery of drugs into the CNS.

    Directory of Open Access Journals (Sweden)

    Robert A Scranton

    2011-04-01

    Full Text Available The blood brain barrier (BBB is impermeable to most drugs, impeding the establishment of novel neuroprotective therapies and strategies for many neurological diseases. Intranasal administration offers an alternative path for efficient drug delivery into the CNS. So far, the anatomical structures discussed to be involved in the transport of intranasally administered drugs into the CNS include the trigeminal nerve, olfactory nerve and the rostral migratory stream (RMS, but the relative contributions are debated.In the present study we demonstrate that surgical transection, and the resulting structural disruption of the RMS, in mice effectively obstructs the uptake of intranasally administered radioligands into the CNS. Furthermore, using a fluorescent cell tracer, we demonstrate that intranasal administration in mice allows agents to be distributed throughout the entire brain, including olfactory bulb, hippocampus, cortex and cerebellum.This study provides evidence of the vital role the RMS has in the CNS delivery of intranasally administered agents. The identification of the RMS as the major access path for intranasally administered drugs into the CNS may contribute to the development of treatments that are tailored for efficient transport within this structure. Research into the RMS needs to continue to elucidate its limitations, capabilities, mechanisms of transport and potential hazards before we are able to advance this technique into human research.

  4. One single dose of 200 mu g of antenatal RhIG halves the risk of anti-D immunization and hemolytic disease of the fetus and newborn in the next pregnancy

    NARCIS (Netherlands)

    Koelewijn, Joke M.; de Haas, Masja; Vrijkotte, Tanja G. M.; Bonsel, Gouke J.; van der Schoot, C. Ellen

    2008-01-01

    BACKGROUND: The objective was the evaluation of the effect of the Dutch national routine antenatal RhIG (anti-D) immunization prevention (RAADP) program comprising one single dose of 200 mu g (1000 IU) of RhIG in the 30th week of pregnancy, restricted to women without a living child. STUDY DESIGN

  5. Clinicopathological Characteristics and Outcomes of Chinese Patients with Scanty Immune Deposits Lupus Nephritis: A Large Cohort Study from a Single Center

    Directory of Open Access Journals (Sweden)

    Qiuyu Li

    2014-01-01

    Full Text Available Objective. To assess clinicopathological characteristics of lupus nephritis patients with scanty immune deposits. Methods. The data of patients with scanty immune deposits lupus nephritis were retrospectively analyzed. Plasma ANCA and complement components were detected. Results. Among 316 cases with renal biopsy-proven lupus nephritis, 40 cases were diagnosed as scanty immune deposits. There were significantly higher value of serum creatinine (P=0.002 and lower hemoglobin level (P=0.009 and higher score of cellular crescents (P=0.015 in scanty immune deposits group compared with immune complex deposits group. The frequency of positive plasma ANCA was significantly higher in scanty immune deposits group than that in immune complex deposits group (52.5% versus 10.1%, P<0.001. As for comparisons of plasma complement components, there were significantly higher levels of C1q (P=0.005 and Bb (P=0.02 and lower level of factor H (P=0.003 in scanty immune deposits group. The ratio of treatment failure was significantly higher in scanty immune deposits group than that in immune deposits group (42.5% versus 19.20%, P=0.001. The renal outcomes were similar between the two groups. Conclusions. Patients with scanty immune deposits lupus nephritis had more severe kidney damage. ANCA and activation of complement alternative pathway might be involved in the pathogenesis of the disease.

  6. Effects of intranasal oxytocin prior to encoding and retrieval on recognition memory.

    Science.gov (United States)

    Weigand, Anne; Feeser, Melanie; Gärtner, Matti; Brandt, Emily; Fan, Yan; Fuge, Philipp; Böker, Heinz; Bajbouj, Malek; Grimm, Simone

    2013-05-01

    The neuropeptide oxytocin (OXT) has been shown to modulate a variety of human social behaviors. However, little is known about its impact on emotional memory processing. Previous research demonstrated both memory-enhancing and memory-impairing oxytocinergic effects. We investigated the influence of a single (prior to encoding) and a repeated (prior to encoding and retrieval) intranasal administration of OXT on recognition memory for stimuli taken from the International Affective Picture System. In addition, we assessed the interaction of emotion regulation during encoding and OXT-induced memory effects. In a double-blind, placebo-controlled design, 80 healthy young males performed an emotion regulation task followed by a surprising recognition memory task after 60 min. Results show that repeated OXT administration significantly improved memory certainty for negative social stimuli. Regarding the influence of emotion regulation, the promnestic effect of OXT was more pronounced when participants had been instructed to increase their negative emotions during encoding. Our findings indicate that OXT facilitates the processing of negative social stimuli during memory encoding and retrieval, possibly by enhancing the perception of aversive aspects in social situations.

  7. Evaluation of the dose-response relationship for intra-nasal oxymetazoline hydrochloride in normal adults.

    Science.gov (United States)

    Taverner, D; Bickford, L; Shakib, S; Tonkin, A

    1999-09-01

    To evaluate the dose-response relationship of increasing doses of oxymetazoline compared with placebo in normal subjects, and to determine the sensitivities of rhinomanometry, acoustic rhinometry and symptoms in discriminating between differing doses of oxymetazoline in normal subjects. The study had a randomized, double-blind, placebo-controlled, parallel group, dose-response design. One hundred and twenty-five healthy volunteers with no nasal obstruction were randomized to administration of a single intra-nasal dose of oxymetazoline (6.25 microg, 12.5 microg, 25 microg or 50 microg) or placebo to each nasal cavity. Nasal airway resistance (NAR) was measured by active posterior rhinomanometry. Total minimum cross-sectional area (tMCA) and volume (tVOL) were measured by acoustic rhinometry. Symptoms of congestion (CON) were assessed on a visual analogue scale. The two highest doses of oxymetazoline produced a significant decrease in NAR compared with placebo (P = 0.015) but not between placebo and 12.5 microg or 6.25 microg. There was a dose-response relationship for tVOL, which increased significantly after all doses compared with placebo (P oxymetazoline administered. tVOL provides a sensitive and discriminatory measure of small nasal changes after low doses of oxymetazoline. NAR is able to discriminate between doses, but is less sensitive than tVOL and tMCA, requiring a higher threshold dose before significant changes are seen in nasal patency.

  8. Transient facial nerve paralysis (Bell's palsy following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.

    Directory of Open Access Journals (Sweden)

    David J M Lewis

    2009-09-01

    Full Text Available An association was previously established between facial nerve paralysis (Bell's palsy and intranasal administration of an inactivated influenza virosome vaccine containing an enzymatically active Escherichia coli Heat Labile Toxin (LT adjuvant. The individual component(s responsible for paralysis were not identified, and the vaccine was withdrawn.Subjects participating in two contemporaneous non-randomized Phase 1 clinical trials of nasal subunit vaccines against Human Immunodeficiency Virus and tuberculosis, both of which employed an enzymatically inactive non-toxic mutant LT adjuvant (LTK63, underwent active follow-up for adverse events using diary-cards and clinical examination. Two healthy subjects experienced transient peripheral facial nerve palsies 44 and 60 days after passive nasal instillation of LTK63, possibly a result of retrograde axonal transport after neuronal ganglioside binding or an inflammatory immune response, but without exaggerated immune responses to LTK63.While the unique anatomical predisposition of the facial nerve to compression suggests nasal delivery of neuronal-binding LT-derived adjuvants is inadvisable, their continued investigation as topical or mucosal adjuvants and antigens appears warranted on the basis of longstanding safety via oral, percutaneous, and other mucosal routes.

  9. Transient Facial Nerve Paralysis (Bell's Palsy) following Intranasal Delivery of a Genetically Detoxified Mutant of Escherichia coli Heat Labile Toxin

    Science.gov (United States)

    Lewis, David J. M.; Huo, Zhiming; Barnett, Susan; Kromann, Ingrid; Giemza, Rafaela; Galiza, Eva; Woodrow, Maria; Thierry-Carstensen, Birgit; Andersen, Peter; Novicki, Deborah; Del Giudice, Giuseppe; Rappuoli, Rino

    2009-01-01

    Background An association was previously established between facial nerve paralysis (Bell's palsy) and intranasal administration of an inactivated influenza virosome vaccine containing an enzymatically active Escherichia coli Heat Labile Toxin (LT) adjuvant. The individual component(s) responsible for paralysis were not identified, and the vaccine was withdrawn. Methodology/Principal Findings Subjects participating in two contemporaneous non-randomized Phase 1 clinical trials of nasal subunit vaccines against Human Immunodeficiency Virus and tuberculosis, both of which employed an enzymatically inactive non-toxic mutant LT adjuvant (LTK63), underwent active follow-up for adverse events using diary-cards and clinical examination. Two healthy subjects experienced transient peripheral facial nerve palsies 44 and 60 days after passive nasal instillation of LTK63, possibly a result of retrograde axonal transport after neuronal ganglioside binding or an inflammatory immune response, but without exaggerated immune responses to LTK63. Conclusions/Significance While the unique anatomical predisposition of the facial nerve to compression suggests nasal delivery of neuronal-binding LT–derived adjuvants is inadvisable, their continued investigation as topical or mucosal adjuvants and antigens appears warranted on the basis of longstanding safety via oral, percutaneous, and other mucosal routes. PMID:19756141

  10. MVA-based H5N1 vaccine affords cross-clade protection in mice against influenza A/H5N1 viruses at low doses and after single immunization.

    Directory of Open Access Journals (Sweden)

    Joost H C M Kreijtz

    Full Text Available Human infections with highly pathogenic avian influenza viruses of the H5N1 subtype, frequently reported since 2003, result in high morbidity and mortality. It is feared that these viruses become pandemic, therefore the development of safe and effective vaccines is desirable. MVA-based H5N1 vaccines already proved to be effective when two immunizations with high doses were used. Dose-sparing strategies would increase the number of people that can be vaccinated when the amount of vaccine preparations that can be produced is limited. Furthermore, protective immunity is induced ideally after a single immunization. Therefore the minimal requirements for induction of protective immunity with a MVA-based H5N1 vaccine were assessed in mice. To this end, mice were vaccinated once or twice with descending doses of a recombinant MVA expressing the HA gene of influenza virus A/Vietnam/1194/04. The protective efficacy was determined after challenge infection with the homologous clade 1 virus and a heterologous virus derived from clade 2.1, A/Indonesia/5/05 by assessing weight loss, virus replication and histopathological changes. It was concluded that MVA-based vaccines allowed significant dose-sparing and afford cross-clade protection, also after a single immunization, which are favorable properties for an H5N1 vaccine candidate.

  11. One single dose of 200 microg of antenatal RhIG halves the risk of anti-D immunization and hemolytic disease of the fetus and newborn in the next pregnancy.

    Science.gov (United States)

    Koelewijn, Joke M; de Haas, Masja; Vrijkotte, Tanja G M; Bonsel, Gouke J; van der Schoot, C Ellen

    2008-08-01

    The objective was the evaluation of the effect of the Dutch national routine antenatal RhIG (anti-D) immunization prevention (RAADP) program comprising one single dose of 200 microg (1000 IU) of RhIG in the 30th week of pregnancy, restricted to women without a living child. A nationwide historic control study was performed. All newly detected anti-D-immunized para-1 in 1999, 2002, and 2004 were included and classified on the basis of received prophylaxis during the first pregnancy: antenatal and postnatal versus only postnatal RhIG. The numbers of D- parae-1 who delivered a D+ first child before the introduction (control group) or after the introduction (intervention group) of the RAADP were calculated from Vital Birth Statistics (8,700 and 12,000, respectively). Fifty-eight newly detected anti-D immunizations in the first trimester were observed in the control group and 39 in the intervention group, which resulted in a significant reduction of the prevalence of new anti-D immunizations from 0.67 percent (95% confidence interval [CI], 0.50%-0.84%) to 0.31 percent (95% CI, 0.21%-0.41%). No reduction was observed in anti-D immunizations newly detected at the 30th-week screening (0.25%). A nonsignificant risk reduction of the risk of severe hemolytic disease of the fetus and newborn (HDFN) was found (0.23% vs. 0.10%). The numbers needed to treat to prevent one anti-D-immunized pregnancy and one case of subsequent severe HDFN were 357 and 1255, respectively. RAADP of one single dose of 200 microg of RhIG in addition to postnatal RhIG (200 microg) halves the risk of anti-D immunization and subsequent severe HDFN.

  12. Should Pharmacy Technicians Administer Immunizations?

    Directory of Open Access Journals (Sweden)

    Dylan Atkinson

    2017-09-01

    Full Text Available Purpose. To describe the potential role for pharmacy technicians in administering immunizations – limited for this discussion to specifically inserting the needle into the patient’s arm and pressing down on the plunger – at the discretion of a supervising pharmacist as a way to enhance patient care and workflow efficiency. Summary. Pharmacy technicians currently play an important role in facilitating pharmacy-based immunization programs. Technicians routinely perform non-clinical tasks related to pharmacy-based immunizations, though nearly all states prohibit technicians from administering vaccines. Several studies demonstrate that untrained laypersons can safely administer intranasal or intradermal vaccines, and laypersons routinely administer medications through intramuscular or subcutaneous routes (e.g., patients with diabetes or rheumatic conditions. It stands to reason that a trained pharmacy technician could perform comparably on these techniques that laypersons have mastered. One state has adopted rules to allow pharmacy technicians to administer immunizations if the technician has completed specific training on administration techniques and on basic life support. This task is performed at the discretion of the supervising pharmacist, and the pharmacist would still be responsible for clinical aspects of immunizing such as prescribing the right vaccine to the right patient. Additional considerations factoring into the decision as to whether or not to involve pharmacy technicians in immunization administration are also summarized. Conclusion. If safety can be reasonably assured through training and supervision, it may be appropriate to delegate vaccine administration to appropriately trained pharmacy technicians. Such delegation may enhance workflow efficiency, which may confer added value for patient care and potentially improve access to community pharmacy-based immunizations.   Type: Commentary

  13. A randomized, double-blind, controlled trial evaluating the effect of intranasal insulin on neurocognitive function in euthymic patients with bipolar disorder.

    Science.gov (United States)

    McIntyre, Roger S; Soczynska, Joanna K; Woldeyohannes, Hanna O; Miranda, Andrew; Vaccarino, Anthony; Macqueen, Glenda; Lewis, Gary F; Kennedy, Sidney H

    2012-11-01

    improved performance from baseline to endpoint with no between-group differences. Intranasal insulin was well tolerated; no subject exhibited hypoglycemia or other safety concerns. Adjunctive intranasal insulin administration significantly improved a single measure of executive function in bipolar disorder. We were unable to detect between-group differences on other neurocognitive measures, with improvement noted in both groups. Subject phenotyping on the basis of pre-existing neurocognitive deficits and/or genotype [e.g., apolipoprotein E (ApoE)] may possibly identify a more responsive subgroup. © 2012 John Wiley and Sons A/S.

  14. Development of risperidone liposomes for brain targeting through intranasal route.

    Science.gov (United States)

    Narayan, Reema; Singh, Mohan; Ranjan, OmPrakash; Nayak, Yogendra; Garg, Sanjay; Shavi, Gopal V; Nayak, Usha Y

    2016-10-15

    The present paper is aimed at development of functionalized risperidone liposomes for brain targeting through nasal route for effective therapeutic management of schizophrenia. The risperidone liposomes were prepared by thin film hydration method. Various parameters such as lipid ratio and lipid to drug ratio were optimized by using Design-Expert(®) Software to obtain high entrapment with minimum vesicle size. The surface of the optimized liposomes was modified by coating stearylamine and MPEG-DSPE for enhanced penetration to the brain. The formulations were evaluated for vesicle size, zeta potential, and entrapment efficiency. The morphology was studied by Transmission Electron Microscopy (TEM). In vivo efficacy was assessed by performing pharmacokinetic study in Wistar albino rats following intranasal administration of the formulations in comparison to intravenous bolus administration of pure drug. The mean vesicle size of optimized liposomes ranged from 90 to 100nm with low polydispersity index (risperidone into the brain than plasma. High brain targeting efficiency index for LP-16 indicating preferential transport of the drug to brain. The study demonstrated successful formulation of surface modified risperidone liposomes for nasal delivery with brain targeting potential. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  16. Pharmacokinetic Modeling of Intranasal Scopolamine in Plasma Saliva and Urine

    Science.gov (United States)

    Wu, L.; Tam, V. H.; Chow, D. S. L.; Putcha, L.

    2015-01-01

    An intranasal gel dosage formulation of scopolamine (INSCOP) was developed for the treatment of Space Motion Sickness (SMS). The bioavailability and pharmacokinetics (PK) were evaluated under IND (Investigational New Drug) guidelines. The aim of the project was to develop a PK model that can predict the relationships among plasma, saliva and urinary scopolamine concentrations using data collected from the IND clinical trial protocol with INSCOP. Twelve healthy human subjects were administered at three dose levels (0.1, 0.2 and 0.4 mg) of INSCOP. Serial blood, saliva and urine samples were collected between 5 min to 24 h after dosing and scopolamine concentrations were measured by using a validated LC-MS-MS assay. PK compartmental models, using actual dosing and sampling time, were established using Phoenix (version 1.2). Model selection was based on a likelihood ratio test on the difference of criteria (-2LL (i.e. log-likelihood ratio test)) and comparison of the quality of fit plots. The results: Predictable correlations among scopolamine concentrations in compartments of plasma, saliva and urine were established, and for the first time the model satisfactorily predicted the population and individual PK of INSCOP in plasma, saliva and urine. The model can be utilized to predict the INSCOP plasma concentration by saliva and urine data, and it will be useful for monitoring the PK of scopolamine in space and other remote environments using non-invasive sampling of saliva and/or urine.

  17. Intranasal administration of oxytocin: behavioral and clinical effects, a review.

    Science.gov (United States)

    Veening, Jan G; Olivier, Berend

    2013-09-01

    The intranasal (IN-) administration of substances is attracting attention from scientists as well as pharmaceutical companies. The effects are surprisingly fast and specific. The present review explores our current knowledge about the routes of access to the cranial cavity. 'Direct-access-pathways' from the nasal cavity have been described but many additional experiments are needed to answer a variety of open questions regarding anatomy and physiology. Among the IN-applied substances oxytocin (OT) has an extensive history. Originally applied in women for its physiological effects related to lactation and parturition, over the last decade most studies focused on their behavioral 'prosocial' effects: from social relations and 'trust' to treatment of 'autism'. Only very recently in a microdialysis study in rats and mice, the 'direct-nose-brain-pathways' of IN-OT have been investigated directly, implying that we are strongly dependent on results obtained from other IN-applied substances. Especially the possibility that IN-OT activates the 'intrinsic' OT-system in the hypothalamus as well needs further clarification. We conclude that IN-OT administration may be a promising approach to influence human communication but that the existing lack of information about the neural and physiological mechanisms involved is a serious problem for the proper understanding and interpretation of the observed effects. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Impact of Gender on Pharmocokinetics of Intranasal Scopolamine

    Science.gov (United States)

    Putcha, L.; Lei, Wu.; S-L Chow, Diana

    2013-01-01

    Introduction: An intranasal gel dosage formulation of scopolamine (INSCOP) was developed for the treatment of Space Motion Sickness (SMS), which is commonly experienced by astronauts during space missions. The bioavailability and pharmacokinetics (PK) were evaluated under IND guidelines. Since information is lacking on the effect of gender on the PK of Scopolamine, we examined gender differences in PK parameters of INSCOP at three dose levels of 0.1, 0.2 and 0.4 mg. Methods: Plasma scopolamine concentrations as a function of time data were collected from twelve normal healthy human subjects (6 male/6 female) who participated in a fully randomized double blind crossover study. The PK parameters were derived using WinNonlin. Covariate analysis of PK profiles was performed using NONMEN and statistically compared using a likelihood ratio test on the difference of objective function value (OFV). Statistical significance for covariate analysis was set at Pgender-dependent pharmacokinetics of scopolamine at the high dose level of 0.4 mg. Clearance of the parent compound was significantly faster and the volume of distribution was significantly higher in males than in females, As a result, including gender as a covariate to the pharmacokinetic model of scopolamine offers the best fit for PK modeling of the drug at dose of 0.4 mg or higher.

  19. Intranasal melanoma treated with radiation therapy in three dogs.

    Science.gov (United States)

    Davies, Owen; Spencer, Sarah; Necova, Slavomira; Holmes, Emma; Taylor, Angela; Blackwood, Laura; Lara-Garcia, Ana

    2017-12-01

    Three dogs were investigated for chronic unilateral nasal discharge. In all cases CT imaging showed an intranasal mass causing turbinate lysis and no evidence of metastasis. Cytology in cases 1 (a 14-year-old neutered male crossbreed dog) and 2 (a five-year-old neutered male German Shepherd dog) demonstrated a pleomorphic cell population with variable intracellular pigment suspicious of melanocytic neoplasia. Histopathology with immunohistochemistry (Melan-A and vimentin, plus PNL-2 in one case) confirmed the diagnosis of melanoma in all dogs. All dogs were treated with megavoltage radiotherapy using linear accelerators. Cases 1 and 3 (a nine-year-old neutered female beagle dog) received a hypofractionated (4 × 8 Gy) protocol and case 2 received a definitive (12 × 4 Gy) protocol. Complete remission was demonstrated on repeat CT scan five months after diagnosis in case 1 and seven months in case 2. Stable disease was documented on CT at four months for case 3; however, clinical signs in this dog remained controlled for 10 months in total. Case 1 died of unrelated causes five months after diagnosis, case 2 was euthanased due to the development of seizures 13 months after diagnosis, and case 3 was lost to follow-up 12 months after diagnosis. Melanoma should be considered as a rare differential diagnosis for primary nasal neoplasia in the dog and radiation therapy can be used as effective local therapy.

  20. A single HIV-1 cluster and a skewed immune homeostasis drive the early spread of HIV among resting CD4+ cell subsets within one month post-infection.

    Directory of Open Access Journals (Sweden)

    Charline Bacchus

    Full Text Available Optimizing therapeutic strategies for an HIV cure requires better understanding the characteristics of early HIV-1 spread among resting CD4+ cells within the first month of primary HIV-1 infection (PHI. We studied the immune distribution, diversity, and inducibility of total HIV-DNA among the following cell subsets: monocytes, peripheral blood activated and resting CD4 T cells, long-lived (naive [TN] and central-memory [TCM] and short-lived (transitional-memory [TTM] and effector-memory cells [TEM] resting CD4+T cells from 12 acutely-infected individuals recruited at a median 36 days from infection. Cells were sorted for total HIV-DNA quantification, phylogenetic analysis and inducibility, all studied in relation to activation status and cell signaling. One month post-infection, a single CCR5-restricted viral cluster was massively distributed in all resting CD4+ subsets from 88% subjects, while one subject showed a slight diversity. High levels of total HIV-DNA were measured among TN (median 3.4 log copies/million cells, although 10-fold less (p = 0.0005 than in equally infected TCM (4.5, TTM (4.7 and TEM (4.6 cells. CD3-CD4+ monocytes harbored a low viral burden (median 2.3 log copies/million cells, unlike equally infected resting and activated CD4+ T cells (4.5 log copies/million cells. The skewed repartition of resting CD4 subsets influenced their contribution to the pool of resting infected CD4+T cells, two thirds of which consisted of short-lived TTM and TEM subsets, whereas long-lived TN and TCM subsets contributed the balance. Each resting CD4 subset produced HIV in vitro after stimulation with anti-CD3/anti-CD28+IL-2 with kinetics and magnitude varying according to subset differentiation, while IL-7 preferentially induced virus production from long-lived resting TN cells. In conclusion, within a month of infection, a clonal HIV-1 cluster is massively distributed among resting CD4 T-cell subsets with a flexible inducibility

  1. Rheumatic disorders associated with immune checkpoint inhibitors in patients with cancer-clinical aspects and relationship with tumour response: a single-centre prospective cohort study.

    Science.gov (United States)

    Kostine, Marie; Rouxel, Léa; Barnetche, Thomas; Veillon, Rémi; Martin, Florent; Dutriaux, Caroline; Dousset, Léa; Pham-Ledard, Anne; Prey, Sorilla; Beylot-Barry, Marie; Daste, Amaury; Gross-Goupil, Marine; Lallier, Julie; Ravaud, Alain; Forcade, Edouard; Bannwarth, Bernard; Truchetet, Marie-Elise; Richez, Christophe; Mehsen, Nadia; Schaeverbeke, Thierry

    2018-03-01

    To evaluate the prevalence and type of rheumatic immune-related adverse events (irAEs) in patients receiving immune checkpoint inhibitors (ICIs), as well as the correlation with tumour response. This was a single-centre prospective observational study including all cancer patients receiving ICIs. The occurrence of irAEs and tumour response was assessed on a regular basis. Patients who experienced musculoskeletal symptoms were referred to the department of rheumatology for clinical evaluation and management. From September 2015 to May 2017, 524 patients received ICIs and 35 were referred to the department of rheumatology (6.6%). All but one of the rheumatic irAEs occurred with anti-programmed cell death protein 1(PD-1)/PD-1 ligand 1(PD-L1) antibodies, with a median exposure time of 70 days. There were two distinct clinical presentations: (1) inflammatory arthritis (3.8%) mimicking either rheumatoid arthritis (n=7), polymyalgia rheumatica (n=11) or psoriatic arthritis (n=2) and (2) non-inflammatory musculoskeletal conditions (2.8%; n=15). One patient with rheumatoid arthritis was anti-cyclic citrullinated peptide (anti-CCP) positive. Nineteen patients required glucocorticoids, and methotrexate was started in two patients. Non-inflammatory disorders were managed with non-steroidal anti-inflammatory drugs, analgesics and/or physiotherapy. ICI treatment was pursued in all but one patient. Patients with rheumatic irAEs had a higher tumour response rate compared with patients without irAEs (85.7% vs 35.3%; P<0.0001). Since ICIs are used with increasing frequency, knowledge of rheumatic irAEs and their management is of major interest. All patients were responsive either to low-to-moderate doses of prednisone or symptomatic therapies and did not require ICI discontinuation. Furthermore, tumour response was significantly higher in patients who experienced rheumatic irAEs. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All

  2. A Single HIV-1 Cluster and a Skewed Immune Homeostasis Drive the Early Spread of HIV among Resting CD4+ Cell Subsets within One Month Post-Infection

    Science.gov (United States)

    Avettand-Fenoël, Véronique; Nembot, Georges; Mélard, Adeline; Blanc, Catherine; Lascoux-Combe, Caroline; Slama, Laurence; Allegre, Thierry; Allavena, Clotilde; Yazdanpanah, Yazdan; Duvivier, Claudine; Katlama, Christine; Goujard, Cécile; Seksik, Bao Chau Phung; Leplatois, Anne; Molina, Jean-Michel; Meyer, Laurence; Autran, Brigitte; Rouzioux, Christine

    2013-01-01

    Optimizing therapeutic strategies for an HIV cure requires better understanding the characteristics of early HIV-1 spread among resting CD4+ cells within the first month of primary HIV-1 infection (PHI). We studied the immune distribution, diversity, and inducibility of total HIV-DNA among the following cell subsets: monocytes, peripheral blood activated and resting CD4 T cells, long-lived (naive [TN] and central-memory [TCM]) and short-lived (transitional-memory [TTM] and effector-memory cells [TEM]) resting CD4+T cells from 12 acutely-infected individuals recruited at a median 36 days from infection. Cells were sorted for total HIV-DNA quantification, phylogenetic analysis and inducibility, all studied in relation to activation status and cell signaling. One month post-infection, a single CCR5-restricted viral cluster was massively distributed in all resting CD4+ subsets from 88% subjects, while one subject showed a slight diversity. High levels of total HIV-DNA were measured among TN (median 3.4 log copies/million cells), although 10-fold less (p = 0.0005) than in equally infected TCM (4.5), TTM (4.7) and TEM (4.6) cells. CD3−CD4+ monocytes harbored a low viral burden (median 2.3 log copies/million cells), unlike equally infected resting and activated CD4+ T cells (4.5 log copies/million cells). The skewed repartition of resting CD4 subsets influenced their contribution to the pool of resting infected CD4+T cells, two thirds of which consisted of short-lived TTM and TEM subsets, whereas long-lived TN and TCM subsets contributed the balance. Each resting CD4 subset produced HIV in vitro after stimulation with anti-CD3/anti-CD28+IL-2 with kinetics and magnitude varying according to subset differentiation, while IL-7 preferentially induced virus production from long-lived resting TN cells. In conclusion, within a month of infection, a clonal HIV-1 cluster is massively distributed among resting CD4 T-cell subsets with a flexible inducibility, suggesting that

  3. Protocol for a double blind, randomised placebo-controlled trial using ondansetron to reduce vomiting in children receiving intranasal fentanyl and inhaled nitrous oxide for procedural sedation in the emergency department (the FON trial).

    Science.gov (United States)

    Fauteux-Lamarre, Emmanuelle; Babl, Franz E; Davidson, Andrew J; Legge, Donna; Lee, Katherine J; Palmer, Greta M; Hopper, Sandy M

    2018-01-01

    Intranasal fentanyl and nitrous oxide (N 2 O) can be combined to create a non-parenteral procedural sedation regimen for children in the paediatric emergency department. This combination of intranasal fentanyl and N 2 O provides effective pain relief for more painful procedures, but is associated with a higher incidence of vomiting than N 2 O alone. Our aim is to assess whether ondansetron used preventatively reduces the incidence of vomiting associated with intranasal fentanyl and N 2 O for procedural sedation compared with placebo. This study is a double blind, randomised placebo-controlled superiority trial. This is a single-centre trial of 442 children aged 3-18 years presenting to a tertiary care Paediatric Emergency Department at the Royal Children's Hospital (RCH), Melbourne, Australia, requiring procedural sedation with intranasal fentanyl and N 2 O. After written consent, eligible participants are randomised to receive ondansetron or placebo along with intranasal fentanyl, 30-60 min prior to N 2 O administration. The primary outcome is vomiting during or up to 1 hour after procedural sedation. Secondary outcomes include: number of vomits and retching during procedural sedation, vomiting 1-24 hours after procedural sedation, procedural sedation duration and associated adverse events, procedure abandonment, parental satisfaction and the value parents place on the prevention of vomiting. This trial will allow refinement of a non-parenteral sedation regimen for children requiring painful procedures. This study has ethics approval at the RCH, Melbourne, protocol number 36174. The results from this trial will be submitted to conferences and published in a peer-reviewed journal. Australian New Zealand Clinical Trials Registry (ACTRN12616001213437).

  4. Postprandial administration of intranasal insulin intensifies satiety and reduces intake of palatable snacks in women.

    Science.gov (United States)

    Hallschmid, Manfred; Higgs, Suzanne; Thienel, Matthias; Ott, Volker; Lehnert, Hendrik

    2012-04-01

    The role of brain insulin signaling in the control of food intake in humans has not been thoroughly defined. We hypothesized that the hormone contributes to the postprandial regulation of appetite for palatable food, and assessed the effects on appetite and snack intake of postprandial versus fasted intranasal insulin administration to the brain in healthy women. Two groups of subjects were intranasally administered 160 IU insulin or vehicle after lunch. Two hours later, consumption of cookies of varying palatability was measured under the pretext of a taste test. In a control study, the effects of intranasal insulin administered to fasted female subjects were assessed. Compared with placebo, insulin administration in the postprandial but not in the fasted state decreased appetite as well as intake and rated palatability of chocolate chip cookies (the most palatable snack offered). In both experiments, intranasal insulin induced a slight decrease in plasma glucose but did not affect serum insulin concentrations. Data indicate that brain insulin acts as a relevant satiety signal during the postprandial period, in particular reducing the intake of highly palatable food, and impacts peripheral glucose homeostasis. Postprandial intranasal insulin administration might be useful in curtailing overconsumption of snacks with accentuated rewarding value.

  5. Comparison of Intranasal and Intravenous Diazepam on Status Epilepticus in Stroke Patients

    Science.gov (United States)

    Inokuchi, Ryota; Ohashi-Fukuda, Naoko; Nakamura, Kensuke; Wada, Tomoki; Gunshin, Masataka; Kitsuta, Yoichi; Nakajima, Susumu; Yahagi, Naoki

    2015-01-01

    Abstract Administering diazepam intravenously or rectally in an adult with status epilepticus can be difficult and time consuming. The aim of this study was to examine whether intranasal diazepam is an effective alternative to intravenous diazepam when treating status epilepticus. We undertook a retrospective cohort study based on the medical records of 19 stroke patients presenting with status epilepticus to our institution. We measured the time between arrival at the hospital, the intravenous or intranasal administration of diazepam, and the seizure termination. Intranasal diazepam was administered about 9 times faster than intravenous diazepam (1 vs 9.5 minutes, P = 0.001), resulting in about 3-fold reduction in the time to termination of seizure activity after arrival at the hospital (3 minutes compared with 9.5 minutes in the intravenous group, P = 0.030). No adverse effects of intranasal diazepam were evident from the medical records. Intranasal diazepam administration is safer, easier, and quicker than intravenous administration. PMID:25700327

  6. Brain delivery of insulin boosted by intranasal coadministration with cell-penetrating peptides.

    Science.gov (United States)

    Kamei, Noriyasu; Takeda-Morishita, Mariko

    2015-01-10

    Intranasal administration is considered as an alternative route to enable effective drug delivery to the central nervous system (CNS) by bypassing the blood-brain barrier. Several reports have proved that macromolecules can be transferred directly from the nasal cavity to the brain. However, strategies to enhance the delivery of macromolecules from the nasal cavity to CNS are needed because of their low delivery efficiencies via this route in general. We hypothesized that the delivery of biopharmaceuticals to the brain parenchyma can be facilitated by increasing the uptake of drugs by the nasal epithelium including supporting and neuronal cells to maximize the potentiality of the intranasal pathway. To test this hypothesis, the CNS-related model peptide insulin was intranasally coadministered with the cell-penetrating peptide (CPP) penetratin to mice. As a result, insulin coadministered with l- or d-penetratin reached the distal regions of the brain from the nasal cavity, including the cerebral cortex, cerebellum, and brain stem. In particular, d-penetratin could intranasally deliver insulin to the brain with a reduced risk of systemic insulin exposure. Thus, the results obtained in this study suggested that CPPs are potential tools for the brain delivery of peptide- and protein-based pharmaceuticals via intranasal administration. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Intranasal insulin treatment of an experimental model of moderate traumatic brain injury.

    Science.gov (United States)

    Brabazon, Fiona; Wilson, Colin M; Jaiswal, Shalini; Reed, John; Frey, William H; Byrnes, Kimberly R

    2017-09-01

    Traumatic brain injury (TBI) results in learning and memory dysfunction. Cognitive deficits result from cellular and metabolic dysfunction after injury, including decreased cerebral glucose uptake and inflammation. This study assessed the ability of intranasal insulin to increase cerebral glucose uptake after injury, reduce lesion volume, improve memory and learning function and reduce inflammation. Adult male rats received a controlled cortical impact (CCI) injury followed by intranasal insulin or saline treatment daily for 14 days. PET imaging of [18F]-FDG uptake was performed at baseline and at 48 h and 10 days post-injury and MRI on days three and nine post injury. Motor function was tested with the beam walking test. Memory function was assessed with Morris water maze. Intranasal insulin after CCI significantly improved several outcomes compared to saline. Insulin-treated animals performed better on beam walk and demonstrated significantly improved memory. A significant increase in [18F]-FDG uptake was observed in the hippocampus. Intranasal insulin also resulted in a significant decrease in hippocampus lesion volume and significantly less microglial immunolabeling in the hippocampus. These data show that intranasal insulin improves memory, increases cerebral glucose uptake and decreases neuroinflammation and hippocampal lesion volume, and may therefore be a viable therapy for TBI.

  8. Cardiovascular risk assessment with oxidised LDL measurement in postmenopausal women receiving intranasal estrogen replacement therapy.

    Science.gov (United States)

    Kurdoglu, Mertihan; Yildirim, Mulazim; Kurdoglu, Zehra; Erdem, Ahmet; Erdem, Mehmet; Bilgihan, Ayse; Goktas, Bulent

    2011-08-01

    To investigate the effect of intranasal estrogen replacement therapy administered to postmenopausal women alone or in combination with progesterone on markers of cardiovascular risk. The study was conducted with 44 voluntary postmenopausal women. In group I (n = 15), the patients were treated with only intranasal estradiol (300 μg/day estradiol hemihydrate). In group II (n = 11), the patients received cyclic progesterone (200 mg/day micronized progesterone) for 12 days in each cycle in addition to continuous intranasal estradiol. Group III (n = 18) was the controls. Serum lipid profiles, oxidised low-density lipoprotein (LDL) and other markers of cardiovascular risk were assessed at baseline and at the 3rd month of the treatment. Lipid profile, LDL apolipoprotein B, lipoprotein a, homocysteine, oxidised LDL values and oxidised LDL/LDL cholesterol ratio were not observed to change after 3 months compared to baseline values within each group (p > 0.016). In comparison to changes between the groups after the treatment, only oxidised LDL levels and oxidised LDL/LDL cholesterol ratios of group II were increased compared to control group (p < 0.05). Intranasal estradiol alone did not appear to have an effect on markers of cardiovascular risk in healthy postmenopausal women. However, the addition of cyclic oral micronized progesterone to intranasal estradiol influenced the markers of cardiovascular risk negatively in comparison to non-users in healthy postmenopausal women.

  9. ROLE OF INTRANASAL STEROIDAL SPRAY IN SEASONAL ALLERGIC RHINITIS WITH OCULAR SYMPTOMS

    Directory of Open Access Journals (Sweden)

    Vineel Muppidi

    2017-06-01

    Full Text Available BACKGROUND The eye is especially susceptible to the symptoms of allergic rhinitis, itching (pruritus, tearing (epiphora and redness (erythema because it lacks a mechanical barrier that could prevent the deposition of allergens, such as pollen on the conjunctival surface. These ocular symptoms have been described as examples of the type 1 immediate hypersensitivity reaction. A number of recently published clinical studies apparently support the positive effect of intranasal steroidal sprays on ocular allergy symptoms. The aim of the study is to evaluate the role of intranasal steroids in relieving ocular symptoms in allergic rhinitis. MATERIALS AND METHODS 60 subjects who had seasonal allergic rhinitis with ocular symptoms came to Outpatient Department of Chalmeda Anand Rao Hospital in the year 2015-2016. Randomly, each intranasal steroid is given to 12 patients to a total of 60 patients for 4 weeks 2 puffs in each nostril twice daily and the clinical response is observed. RESULTS A subjective improvement in ocular symptoms was observed in 11 of the 12 patients treated with fluticasone furoate, 8 of 12 patients with fluticasone propionate, 7 of the 12 patients with mometasone furoate, 6 of the 12 patients with beclomethasone and 6 of the 12 patients with budesonide. CONCLUSION Intranasal corticosteroids, which are used for seasonal allergic rhinitis with ocular symptoms are effective in controlling of ocular symptoms. Among these, intranasal corticosteroids, which are used for allergic rhinitis, fluticasone furoate is more effective in relieving ocular symptoms in our study.

  10. [Pre-anesthetic medication with intranasal dexmedetomidine and oral midazolam as an anxiolytic. A clinical trial].

    Science.gov (United States)

    Linares Segovia, B; García Cuevas, M A; Ramírez Casillas, I L; Guerrero Romero, J F; Botello Buenrostro, I; Monroy Torres, R; Ramírez Gómez, X S

    2014-10-01

    Dexmedetomidine is a pharmacological option for sedation in children. In this study, the efficacy of intranasal dexmedetomidine to reduce preoperative anxiety in pediatric patients is compared with that of oral midazolam. A prospective, randomized, double-blind, controlled trial was conducted on children 2-12 years of age, randomly assigned to one of the following two groups: group A received premedication with oral midazolam and intranasal placebo, group B received intranasal dexmedetomidine and oral placebo. Anxiety was assessed with the modified Yale scale, and a risk analysis and number needed to treat was performed. A total of 108 patients were included, 52 (48.1%) treated with dexmedetomidine, and 56 (51.9%) with midazolam. Anxiety was less frequent in the dexmedetomidine group at 60minutes (P=.001), induction (p=.04), and recovery (P=.0001). Risk analysis showed that dexmedetomidine reduced the risk of anxiety by 28% (RAR=0.28, 95% CI; 0.12 to 0.43) and to prevent one case of anxiety, four patients need to be treated with intranasal dexmedetomidine (NNT=4, 95% CI: 3-9).Changes in heart rate, mean arterial pressure, and oxygen saturation, were statistically significant in the dexmedetomidine group, with no clinical consequences. There were no cases of bradycardia, hypotension or oxygen desaturation. Intranasal dexmedetomidine premedication is more effective than oral midazolam to reduce preoperative anxiety in pediatric patients. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  11. Iatrogenic Cushing's Syndrome Due to Intranasal Usage of Ophthalmic Dexamethasone: A Case Report.

    Science.gov (United States)

    Orton, Sarah; Censani, Marisa

    2016-05-01

    Iatrogenic Cushing's syndrome (ICS) is caused by exogenous corticosteroid administration with suppression of the hypothalamic-pituitary-adrenal axis. It has been commonly described with oral and topical steroid use, but scarce reports have documented intranasal steroid usage as the etiology in infancy. In this article, we describe a case of a 4-month-old infant who developed ICS after 6 weeks of intranasal dexamethasone ophthalmic solution administration for nasal obstruction. To our knowledge, this is the youngest patient reported with ICS due to intranasal use of a prescribed dose of an ophthalmic steroid. His hypothalamic-pituitary-adrenal axis recovered fully 4.5 months after steroid discontinuation. Because of the small body surface area and supine position during administration, infants are particularly susceptible to ICS. Given that intranasal steroids are commonly prescribed to infants and children for a variety of diagnoses, this case highlights the risks inherent in the use of intranasal steroid drops, particularly in young infants, for both adrenal suppression and linear growth deceleration, even with short-term use. Close monitoring of these patients' height and weight should occur while on steroid treatment, with every effort made to decrease or discontinue steroid use when possible. Copyright © 2016 by the American Academy of Pediatrics.

  12. Preventive Activity against Influenza (H1N1 Virus by Intranasally Delivered RNA-Hydrolyzing Antibody in Respiratory Epithelial Cells of Mice

    Directory of Open Access Journals (Sweden)

    Seungchan Cho

    2015-09-01

    Full Text Available The antiviral effect of a catalytic RNA-hydrolyzing antibody, 3D8 scFv, for intranasal administration against avian influenza virus (H1N1 was described. The recombinant 3D8 scFv protein prevented BALB/c mice against H1N1 influenza virus infection by degradation of the viral RNA genome through its intrinsic RNA-hydrolyzing activity. Intranasal administration of 3D8 scFv (50 μg/day for five days prior to infection demonstrated an antiviral activity (70% survival against H1N1 infection. The antiviral ability of 3D8 scFv to penetrate into epithelial cells from bronchial cavity via the respiratory mucosal layer was confirmed by immunohistochemistry, qRT-PCR, and histopathological examination. The antiviral activity of 3D8 scFv against H1N1 virus infection was not due to host immune cytokines or chemokines, but rather to direct antiviral RNA-hydrolyzing activity of 3D8 scFv against the viral RNA genome. Taken together, our results suggest that the RNase activity of 3D8 scFv, coupled with its ability to penetrate epithelial cells through the respiratory mucosal layer, directly prevents H1N1 virus infection in a mouse model system.

  13. Single-Dose Universal Hepatitis A Immunization in Argentina: Low Viral Circulation and High Persistence of Protective Antibodies Up to 4 Years.

    Science.gov (United States)

    Vizzotti, C; González, J; Rearte, A; Urueña, A; Pérez Carrega, M; Calli, R; Gentile, A; Uboldi, A; Ramonet, M; Cañero-Velasco, M; Diosque, M

    2015-12-01

    Single-dose hepatitis A virus (HAV) vaccination was implemented in all Argentinean children aged 12 months in 2005. Between 2005 and 2011, a dramatic decline was observed in HAV infection rates, fulminant hepatitis, and liver transplantation. This study assessed current viral circulation and estimated protective antibody persistence 4 years after vaccination. Prevalence of prevaccination anti-HAV antibodies in 12-month-old children was evaluated as an indirect estimation of viral circulation (Group A). Seroprevalence was also measured in 5-year-old children who received 1 dose of HAV vaccine at 1 year of age (Group B). Blood samples were tested for immunoglobulin (Ig)G anti-HAV antibodies (seroprotection = ≥10 mIU/mL). All Group A-positive samples were tested for IgM anti-HAV antibodies to identify recent infections. Logistic regression analysis was done to evaluate associations between demographic and socioeconomic variables and seroprotection. Of 433 children from Group A, 29.5% (95% confidence interval [CI], 25.2-33.8) were positive for IgG anti-HAV antibodies with a geometric mean concentration (GMC) of 6.17 mIU/mL (95% CI, 5.33-7.15 mIU/mL); all IgM anti-HAV were negative. From 1139 in Group B, 93% (95% CI, 91.7-94.6) maintained seroprotection with a GMC of 97.96 mIU/mL (95% CI, 89.21-107.57 mIU/mL). Kindergarten attendance was associated with seroprotection in Group B (odds ratio [OR], 2.0; 95% CI, 1.26-3.3). In contrast, high maternal educational level was associated with a lack of seroprotection in this group (OR, .26; 95% CI, .09-.8). Single-dose, universal hepatitis A immunization in infants resulted in low HAV circulation and persistent immunologic protection up to 4 years in Argentina. Variables associated with presence or absence of seroprotection in vaccinated children could be related to differences in hygiene habits in settings with residual viral circulation. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric

  14. Intranasal oxytocin enhances socially-reinforced learning in rhesus monkeys

    Directory of Open Access Journals (Sweden)

    Lisa A Parr

    2014-09-01

    Full Text Available There are currently no drugs approved for the treatment of social deficits associated with autism spectrum disorders (ASD. One hypothesis for these deficits is that individuals with ASD lack the motivation to attend to social cues because those cues are not implicitly rewarding. Therefore, any drug that could enhance the rewarding quality of social stimuli could have a profound impact on the treatment of ASD, and other social disorders. Oxytocin (OT is a neuropeptide that has been effective in enhancing social cognition and social reward in humans. The present study examined the ability of OT to selectively enhance learning after social compared to nonsocial reward in rhesus monkeys, an important species for modeling the neurobiology of social behavior in humans. Monkeys were required to learn an implicit visual matching task after receiving either intranasal (IN OT or Placebo (saline. Correct trials were rewarded with the presentation of positive and negative social (play faces/threat faces or nonsocial (banana/cage locks stimuli, plus food. Incorrect trials were not rewarded. Results demonstrated a strong effect of socially-reinforced learning, monkeys’ performed significantly better when reinforced with social versus nonsocial stimuli. Additionally, socially-reinforced learning was significantly better and occurred faster after IN-OT compared to placebo treatment. Performance in the IN-OT, but not Placebo, condition was also significantly better when the reinforcement stimuli were emotionally positive compared to negative facial expressions. These data support the hypothesis that OT may function to enhance prosocial behavior in primates by increasing the rewarding quality of emotionally positive, social compared to emotionally negative or nonsocial images. These data also support the use of the rhesus monkey as a model for exploring the neurobiological basis of social behavior and its impairment.

  15. Oxytocin intranasal administration as a new hope for hypogonadotropic hypogonadism patients.

    Science.gov (United States)

    Salehi, Mohammad Saied; Pandamooz, Sareh; Khazali, Homayoun

    2017-11-01

    Hypogonadotropic hypogonadism (HH) is a form of hypogonadism which also known as secondary or central hypogonadism. Congenital HH can occur due to defect in gonadotropin releasing hormone (GnRH) neurons, upstream regulators of GnRH neurons or pituitary gonadotropic cells. Testosterone or gonadotropins therapy are widely used to treat HH patients, however both have undesirable effects and GnRH treatment for HH patients is time and cost consuming. Direct delivery of therapeutics to the brain via the nasal route is located in the center of attention during the last decade and trial application of intranasal oxytocin as a method of enhancing social interactions are reported. It has been delineated that oxytocin stimulates GnRH release from the rat hypothalamic explants and intranasal applied oxytocin up-regulates GnRH expression in the male rat hypothalamus. Therefore application of intranasal oxytocin might be a new strategy to cure HH patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Buccal, intranasal or intravenous lorazepam for the treatment of acute convulsions in children in Malawi: An open randomized trial

    Directory of Open Access Journals (Sweden)

    Samantha Lissauer

    2015-09-01

    Conclusions: Intravenous lorazepam effectively treats most childhood seizures in this setting. Intranasal and buccal routes are less effective but may be useful in pre-hospital care or when intravenous access cannot be obtained. Further studies comparing intranasal lorazepam to other benzodiazepines, or alternative doses by a non-intravenous route are warranted.

  17. Intranasal administration of allergen increases specific IgE whereas intranasal omalizumab does not increase serum IgE levels-A pilot study.

    Science.gov (United States)

    Eckl-Dorna, J; Fröschl, R; Lupinek, C; Kiss, R; Gattinger, P; Marth, K; Campana, R; Mittermann, I; Blatt, K; Valent, P; Selb, R; Mayer, A; Gangl, K; Steiner, I; Gamper, J; Perkmann, T; Zieglmayer, P; Gevaert, P; Valenta, R; Niederberger, V

    2017-10-30

    Administration of the therapeutic anti-IgE antibody omalizumab to patients induces strong increases in IgE antibody levels. To investigate the effect of intranasal administration of major birch pollen allergen Bet v 1, omalizumab or placebo on the levels of total and allergen-specific IgE in patients with birch pollen allergy. Based on the fact that intranasal allergen application induces rises of systemic allergen-specific IgE, we performed a double-blind placebo-controlled pilot trial in which birch pollen allergic subjects were challenged intranasally with omalizumab, placebo or birch pollen allergen Bet v 1. Total and allergen-specific IgE, IgG and basophil sensitivity were measured before and 8 weeks after challenge. For control purposes, total, allergen-specific IgE levels and omalizumab-IgE complexes as well as specific IgG levels were studied in subjects treated subcutaneously with either omalizumab or placebo. Effects of omalizumab on IgE production by IL-4/anti-CD40-treated PBMCs from allergic patients were studied in vitro. Intranasal challenge with Bet v 1 induced increases in Bet v 1-specific IgE levels by a median of 59.2%, and this change differed significantly from the other treatment groups (P = .016). No relevant change in allergen-specific and total IgE levels was observed in subjects challenged with omalizumab. Addition of omalizumab did not enhance IL-4/anti-CD40-induced IgE production in vitro. Significant rises in total IgE (mean IgE before: 131.83 kU/L to mean IgE after: 505.23 kU/L) and the presence of IgE-omalizumab complexes were observed after subcutaneous administration of omalizumab. Intranasal administration of allergen induced rises of allergen-specific IgE levels, whereas intranasal administration of omalizumab did not enhance systemic total or allergen-specific IgE levels. © 2017 The Authors. Allergy Published by John Wiley & Sons Ltd.

  18. IS ATOMIZED INTRANASAL MIDAZOLAM A NOVEL SEDATIVE PREMEDICATION IN PAEDIATRIC PATIENTS?

    Directory of Open Access Journals (Sweden)

    Savitri D. Kabade

    2017-06-01

    Full Text Available BACKGROUND The successful conduct of anaesthesia in children depends on adequate premedication, which not only comforts the anxious child but also comforts the parents or guardians. Atomized Intranasal Midazolam is quickly absorbed through the nasal mucosa, resulting in a rapid and reliable onset of action. Clonidine has several applications in paediatric anaesthesia as a premedication and as an adjuvant in general as well as regional anaesthesia. Thus, in search of a novel premedication technique, we conducted a study to compare the effectiveness of atomized intranasal midazolam with intranasal clonidine for preoperative sedation in paediatric patients undergoing elective surgery. MATERIALS AND METHODS After obtaining Institutional Ethical Committee clearance and parent’s consent, a prospective, randomised, double-blinded clinical study was conducted in 78 children of ASA I and II, belonging to 2 - 10 years age, posted for various elective surgery. Group M (n= 39 received atomized intranasal midazolam (0.3 mg/kg and Group C (n= 39 received clonidine (4 mcg/kg instilled into both the nostrils. Sedation score (Ramsay, separation score, mask acceptance, recovery and vital parameters were recorded. Statistical analysis of data was done using IBM-SPSS version 21.0. RESULTS Mean sedation scores (± SD were higher in Group M than in Group C (at 5th minute 1.58 ± 0.55 in Group M and 1.15 ± 0.36 in Group C with P= 0.002, at 10th minute 2.34 ± 0.97 in Group M and 1.75 ± 0.71 in Group C with P= 0.008. Separation scores and mask acceptance were better with Group M than Group C. Haemodynamic parameters were similar in both the groups and no major adverse effects were noted. CONCLUSION Atomized intranasal midazolam produces superior sedation levels, child-parent separation and mask acceptance compared to intranasal clonidine in children.

  19. Prevention or early cure of type 1 diabetes by intranasal administration of gliadin in NOD mice

    DEFF Research Database (Denmark)

    Funda, David; Fundova, Petra; Hansen, Axel Kornerup

    2014-01-01

    gluten-free diets prevent T1D in animal models. Herewith we investigated whether intranasal (i.n.) administration of gliadin or gluten may arrest the diabetogenic process. I.n. administration of gliadin to 4-week-old NOD mice significantly reduced the diabetes incidence. Similarly, the insulitis...... was lowered. Intranasal gliadin also rescued a fraction of prediabetic 13-week-old NOD mice from progressing to clinical onset of diabetes compared to OVA-treated controls. Vaccination with i.n. gliadin led to an induction of CD4+Foxp3+ T cells and even more significant induction of γδ T cells in mucosal...

  20. Elevated Salivary Levels of Oxytocin Persist More than 7 h after Intranasal Administration

    OpenAIRE

    van IJzendoorn, Marinus H.; Bhandari, Ritu; van der Veen, Rixt; Grewen, Karen M.; Bakermans-Kranenburg, Marian J.

    2012-01-01

    We addressed the question how long salivary oxytocin levels remain elevated after intranasal administration, and whether it makes a difference when 16 or 24 IU of oxytocin administration is used. Oxytocin levels were measured in saliva samples collected from 46 female participants right before intranasal administration (at 9:30 a.m.) of 16 IU (n = 18) or 24 IU (n = 10) of oxytocin, or a placebo (n = 18), and each hour after administration, for 7 h in total. Oxytocin levels did not differ amon...

  1. Elevated salivary levels of oxytocin persist more than seven hours after intranasal administration

    OpenAIRE

    Marinus H. Van IJzendoorn; Ritu eBhandari; Rixt evan der Veen; Karen eGrewen; Marian J. Bakermans-Kranenburg

    2012-01-01

    We addressed the question how long salivary oxytocin levels remain elevated after intranasal administration, and whether it makes a difference when 16 IU or 24 IU of oxytocin administration is used. Oxytocin levels were measured in saliva samples collected from 46 female participants right before intranasal administration (at 9:30 AM) of 16 IU (n = 18) or 24 IU (n = 10) of oxytocin, or a placebo (n = 18), and each hour after administration, for 7h in total.Oxytocin levels did not differ among...

  2. Comparison of intranasal methamphetamine and d-amphetamine self-administration by humans

    Science.gov (United States)

    Kirkpatrick, Matthew G.; Gunderson, Erik W.; Johanson, Chris-Ellyn; Levin, Frances R.; Foltin, Richard W.; Hart, Carl L.

    2012-01-01

    Aims Anecdotally, methamphetamine is considered to have a greater abuse potential compared to d-amphetamine, but there are no studies directly comparing self-administration of these drugs. This study characterized and compared self-administration as well as the mood, performance, and physiological effects of intranasal methamphetamine- and d-amphetamine. Design A randomized, double-blind, placebo-controlled, cross-over study. Setting An outpatient research unit at the New York State Psychiatric Institute. Participants Male recreational methamphetamine users (n = 13). Measurements Five 2-day blocks of sessions were conducted. On the first day of each block, participants “sampled” a single methamphetamine or d-amphetamine dose (0, 12, 50 mg/70 kg) and a monetary reinforcer ($5 or $20). Amphetamines plasma levels, cardiovascular, mood, and psychomotor performance effects were assessed before drug administration and repeatedly thereafter. On the second day of each block, participants chose between the sampled reinforcers (drug or money). Findings There were no significant differences between the drugs on the majority of measures. Under the $5 condition, both amphetamines dose-dependently increased self-administration, whereas under the $20 condition, few drug options were selected. Overall, participants selected more drug choices under the $5 condition compared with the $20 condition (41% versus 17%). Both drugs increased cardiovascular activity and “positive” mood, although methamphetamine produced more prominent effects on some measures (e.g., heart rate and ratings of ‘high’). Conclusions These data are consistent with previous findings suggesting that the two amphetamines produce a similar dose-related profile of acute effects in humans, with methamphetamine producing greater effects on some mood and cardiovascular measures. The amphetamines were self-administered equally indicating their equivalence for abuse potential. PMID:22050030

  3. Dose-Dependent and Lasting Influences of Intranasal Vasopressin on Face Processing in Men

    Directory of Open Access Journals (Sweden)

    Daniel Price

    2017-09-01

    Full Text Available Arginine vasopressin (AVP and related peptides have diverse effects on social behaviors in vertebrates, sometimes promoting affiliative interactions and sometimes aggressive or antisocial responses. The type of influence, in at least some species, depends on social contexts, including the sex of the individuals in the interaction and/or on the levels of peptide within brain circuits that control the behaviors. To determine if AVP promotes different responses to same- and other-sex faces in men, and if those effects are dose dependent, we measured the effects of two doses of AVP on subjective ratings of male and female faces. We also tested if any influences persist beyond the time of drug delivery. When AVP was administered intranasally on an initial test day, 20 IU was associated with decreased social assessments relative to placebo and 40 IU, and some of the effects persisted beyond the initial drug delivery and appeared to generalize to novel faces on subsequent test days. In single men, those influences were most pronounced, but not exclusive, for male faces, whereas in coupled men they were primarily associated with responses to female faces. Similar influences were not observed if AVP was delivered after placebo on a second test day. In a preliminary analysis, the differences in social assessments observed between men who received 20 and 40 IU, which we suggest primarily reflect lowered social assessments induced by the lower dose, appeared most pronounced in subjects who carry what has been identified as a risk allele for the V1a receptor gene. Together, these results suggest that AVP’s effects on face processing, and possibly other social responses, differ according to dose, depend on relationship status, and may be more prolonged than previously recognized.

  4. Latent Adeno-Associated Virus Infection Elicits Humoral but Not Cell-Mediated Immune Responses in a Nonhuman Primate Model

    Science.gov (United States)

    Hernandez, Yosbani J.; Wang, Jianming; Kearns, William G.; Loiler, Scott; Poirier, Amy; Flotte, Terence R.

    1999-01-01

    Latent infection with wild-type (wt) adeno-associated virus (AAV) was studied in rhesus macaques, a species that is a natural host for AAV and that has some homology to humans with respect to the preferred locus for wt AAV integration. Each of eight animals was infected with an inoculum of 1010 IU of wt AAV, administered by either the intranasal, intramuscular, or intravenous route. Two additional animals were infected intranasally with wt AAV and a helper adenovirus (Ad), while one additional animal was inoculated with saline intranasally as a control. There were no detectable clinical or histopathologic responses to wt AAV administration. Molecular analyses, including Southern blot, PCR, and fluorescence in situ hybridization, were performed 21 days after infection. These studies indicated that AAV DNA sequences persisted at the sites of administration, albeit at low copy number, and in peripheral blood mononuclear cells. Site-specific integration into the AAVS1-like locus was observed in a subset of animals. All animals, except those infected by the intranasal route with wt AAV alone, developed a humoral immune response to wt AAV capsid proteins, as evidenced by a ≥fourfold rise in anti-AAV neutralizing titers. However, only animals infected with both wt AAV and Ad developed cell-mediated immune responses to AAV capsid proteins. These findings provide some insights into the nature of anti-AAV immune responses that may be useful in interpreting results of future AAV-based gene transfer studies. PMID:10482608

  5. A single, low dose oral antigen exposure in newborn piglets primes mucosal immunity if administered with CpG oligodeoxynucleotides and polyphosphazene adjuvants.

    Science.gov (United States)

    Pasternak, J Alex; Ng, Siew Hon; Wilson, Heather L

    2014-10-15

    By definition, soluble antigens ingested orally trigger mucosal tolerance such that any subsequent re-exposure by a systemic route results in suppression of immunity. We propose that antigens introduced in extreme early life can readily traverse the gut wall and therefore circumvent induction of mucosal tolerance and instead induce immunity. Piglets were drenched with low-doses of ovalbumin (OVA; 5mg or 0.05 mg) alone, OVA plus adjuvants (CpG oligodeoxynucleotides and PCEP polyphosphazene) or saline within 6h of birth. At 28 days of age, they were administered 10mg OVA plus 1:1 Montanide adjuvant (or saline) via the intraperitoneal (i.p.) route or via the oral route. Serum was obtained on day 28 and day 49 to measure OVA-specific antibodies titres. All piglets boosted orally with OVA plus Montanide, regardless of prior OVA exposure, failed to induce immunity. As expected, piglets drenched with saline but boosted via the i.p. route with OVA plus Montanide showed significant induction of anti-OVA IgA, IgG, IgG1 and IgG2 relative to saline control piglets. Newborn animals drenched with 5mg or 0.05 mg OVA failed to induce oral immunity. A second intramuscular injection in adulthood triggered immunity in the piglets that were drenched with 0.05 mg OVA and boosted initially by the i.p. route suggesting that some systemic lymphocytes were primed despite initial lack of induction of humoral immunity. In contrast, piglets orally immunized with 5mg or 0.05 mg OVA plus adjuvants resulted in significant induction of anti-OVA IgA (5mg only), IgM, IgG, IgG1 and IgG2 in serum relative to saline control piglets as well as significant induction of anti-OVA IgA, IgM (5mg only) IgG, IgG1 (5mg only) or IgG2 relative to piglets drenched with OVA alone. These data clearly show that the response was sensitive to the oral vaccine components and was not simply a response to the i.p. immunization at day 28. This work demonstrates that newborn piglets respond to oral antigens with immunity

  6. Fc Receptor-Targeting of Immunogen as a Strategy for Enhanced Antigen Loading, Vaccination, and Protection Using Intranasally-Administered Antigen-Pulsed Dendritic Cells

    Science.gov (United States)

    Pham, Giang H.; Iglesias, Bibiana V.; Gosselin, Edmund J.

    2014-01-01

    Dendritic cells (DCs) play a critical role in the generation of adaptive immunity via the efficient capture, processing, and presentation of antigen (Ag) to naïve T cells. Administration of Ag-pulsed DCs is also an effective strategy for enhancing immunity to tumors and infectious disease organisms. Studies have also demonstrated that targeting Ags to Fcγ receptors (FcγR) on Ag presenting cells can enhance humoral and cellular immunity in vitro and in vivo. Specifically, our studies using an F. tularensis (Ft) infectious disease vaccine model have demonstrated that targeting immunogens to FcγR via intranasal (i.n.) administration of monoclonal antibody (mAb)-inactivated Ft (iFt) immune complexes (ICs) enhances protection against Ft challenge. Ft is the causative agent of tularemia, a debilitating disease of humans and other mammals and a category A biothreat agent for which there is no approved vaccine. Therefore, using iFt Ag as a model immunogen, we sought to determine if ex vivo targeting of iFt to FcγR on DCs would enhance the potency of i.n. administered iFt-pulsed DCs. In this study, bone marrow-derived DCs (BMDCs) were pulsed ex vivo with iFt or mAb-iFt ICs. Intranasal administration of mAb-iFt-pulsed BMDCs enhanced humoral and cellular immune responses, as well as protection against Ft live vaccine strain (LVS) challenge. Increased protection correlated with increased iFt loading on the BMDC surface as a consequence of FcγR targeting. However, the inhibitory FcγRIIB had no impact on this enhancement. In conclusion, targeting Ag ex vivo to FcγR on DCs provides a method for enhanced Ag loading of DCs ex vivo, thereby reducing the amount of Ag required, while also avoiding the inhibitory impact of FcγRIIB. Thus, this represents a simple and less invasive strategy for increasing the potency of ex vivo-pulsed DC vaccines against chronic infectious diseases and cancer. PMID:25068496

  7. Mucosal immunization with integrase-defective lentiviral vectors protects against influenza virus challenge in mice.

    Directory of Open Access Journals (Sweden)

    Judith M Fontana

    Full Text Available Recent reports highlight the potential for integrase-defective lentiviral vectors (IDLV to be developed as vaccines due to their ability to elicit cell-mediated and humoral immune responses after intramuscular administration. Differently from their integrase-competent counterpart, whose utility for vaccine development is limited by the potential for insertional mutagenesis, IDLV possess a mutation in their integrase gene that prevents genomic integration. Instead, they are maintained as episomal DNA circles that retain the ability to stably express functional proteins. Despite their favorable profile, it is unknown whether IDLV elicit immune responses after intranasal administration, a route that could be advantageous in the case of infection with a respiratory agent. Using influenza as a model, we constructed IDLV expressing the influenza virus nucleoprotein (IDLV-NP, and tested their ability to generate NP-specific immune responses and protect from challenge in vivo. We found that administration of IDLV-NP elicited NP-specific T cell and antibody responses in BALB/c mice. Importantly, IDLV-NP was protective against homologous and heterosubtypic influenza virus challenge only when given by the intranasal route. This is the first report demonstrating that IDLV can induce protective immunity after intranasal administration, and suggests that IDLV may represent a promising vaccine platform against infectious agents.

  8. Cloned defective interfering influenza virus protects ferrets from pandemic 2009 influenza A virus and allows protective immunity to be established.

    Directory of Open Access Journals (Sweden)

    Nigel J Dimmock

    Full Text Available Influenza A viruses are a major cause of morbidity and mortality in the human population, causing epidemics in the winter, and occasional worldwide pandemics. In addition there are periodic outbreaks in domestic poultry, horses, pigs, dogs, and cats. Infections of domestic birds can be fatal for the birds and their human contacts. Control in man operates through vaccines and antivirals, but both have their limitations. In the search for an alternative treatment we have focussed on defective interfering (DI influenza A virus. Such a DI virus is superficially indistinguishable from a normal virus but has a large deletion in one of the eight RNAs that make up the viral genome. Antiviral activity resides in the deleted RNA. We have cloned one such highly active DI RNA derived from segment 1 (244 DI virus and shown earlier that intranasal administration protects mice from lethal disease caused by a number of different influenza A viruses. A more cogent model of human influenza is the ferret. Here we found that intranasal treatment with a single dose of 2 or 0.2 µg 244 RNA delivered as A/PR/8/34 virus particles protected ferrets from disease caused by pandemic virus A/California/04/09 (A/Cal; H1N1. Specifically, 244 DI virus significantly reduced fever, weight loss, respiratory symptoms, and infectious load. 244 DI RNA, the active principle, was amplified in nasal washes following infection with A/Cal, consistent with its amelioration of clinical disease. Animals that were treated with 244 DI RNA cleared infectious and DI viruses without delay. Despite the attenuation of infection and disease by DI virus, ferrets formed high levels of A/Cal-specific serum haemagglutination-inhibiting antibodies and were solidly immune to rechallenge with A/Cal. Together with earlier data from mouse studies, we conclude that 244 DI virus is a highly effective antiviral with activity potentially against all influenza A subtypes.

  9. Attenuated Human Parainfluenza Virus Type 1 Expressing Ebola Virus Glycoprotein GP Administered Intranasally Is Immunogenic in African Green Monkeys.

    Science.gov (United States)

    Lingemann, Matthias; Liu, Xueqiao; Surman, Sonja; Liang, Bo; Herbert, Richard; Hackenberg, Ashley D; Buchholz, Ursula J; Collins, Peter L; Munir, Shirin

    2017-05-15

    against mucosal as well as systemic inoculation are needed. We evaluated a version of human parainfluenza virus type 1 (HPIV1) bearing a stabilized attenuating mutation in the P/C gene (C Δ170 ) as an intranasal vaccine vector to express the EBOV glycoprotein GP. We evaluated expression from two different genome positions (pre-N and N-P) and investigated the use of vector packaging signals. African green monkeys immunized with two doses of the vector expressing GP from the pre-N position developed high titers of GP neutralizing serum antibodies. The attenuated vaccine candidate is expected to be safe and immunogenic and is available for clinical development. Copyright © 2017 American Society for Microbiology.

  10. Safety of Intranasal Fentanyl in the Out-of-Hospital Setting

    DEFF Research Database (Denmark)

    Karlsen, Anders P H; Pedersen, Danny M B; Trautner, Sven

    2014-01-01

    : In this prospective observational study, we administered intranasal fentanyl in the out-of-hospital setting to adults and children older than 8 years with severe pain resulting from orthopedic conditions, abdominal pain, or acute coronary syndrome refractory to nitroglycerin spray. Patients received 1 to 3 doses...

  11. Intranasal Insulin Therapy for Cognitive Impairment and Neurodegeneration: Current State of the Art

    Science.gov (United States)

    de la Monte, Suzanne M.

    2015-01-01

    Introduction Growing evidence supports the concept that insulin resistance plays an important role in the pathogenesis of cognitive impairment and neurodegeneration, including in Alzheimer's disease (AD). The metabolic hypothesis has led to the development and utilization of insulin- and insulin agonist-based treatments. Therapeutic challenges faced include the ability to provide effective treatments that do not require repeated injections and also minimize potentially hazardous off-target effects. Areas covered This review covers the role of intra-nasal insulin therapy for cognitive impairment and neurodegeneration, particularly Alzheimer's disease. The literature reviewed focuses on data published within the past 5 years as this field is evolving rapidly. The author provides evidence that brain insulin resistance is an important and early abnormality in Alzheimer's disease, and that increasing brain supply and utilization of insulin improves cognition and memory. Emphasis was placed on discussing outcomes of clinical trials and interpreting discordant results to clarify the benefits and limitations of intranasal insulin therapy. Expert Opinion Intranasal insulin therapy can efficiently and directly target the brain to support energy metabolism, myelin maintenance, cell survival, and neuronal plasticity, which begin to fail in the early stages of neurodegeneration. Efforts must continue toward increasing the safety, efficacy, and specificity of intranasal insulin therapy. PMID:24215447

  12. Effect of intranasally administered insulin on cerebral blood flow and perfusion

    DEFF Research Database (Denmark)

    Akintola, Abimbola A.; van Opstal, Anna M.; Westendorp, Rudi G.

    2017-01-01

    Insulin, a vasoactive modulator regulating peripheral and cerebral blood flow, has been consistently linked to aging and longevity. In this proof of principle study, using a randomized, double-blinded, placebo-controlled crossover design, we explored the effects of intranasally administered insul.......28±6.75 mL/100g/min versus 63.31±6.84 mL/100g/min, P=0.003). Thus, intranasal insulin improved tissue perfusion of the occipital cortical brain region and the thalamus in older adults.......Insulin, a vasoactive modulator regulating peripheral and cerebral blood flow, has been consistently linked to aging and longevity. In this proof of principle study, using a randomized, double-blinded, placebo-controlled crossover design, we explored the effects of intranasally administered insulin...... labelling. Total flow through the major cerebropetal arteries was unchanged in both young and old. In the older participants, intranasal insulin compared to placebo increased perfusion through the occipital gray matter (65.2±11.0 mL/100g/min vs 61.2±10.1 mL/100g/min, P=0.001), and in the thalamus (68...

  13. Simultaneous intramammary and intranasal inoculation of lactating cows with bovine herpesvirus 4 induce subclinical mastitis

    NARCIS (Netherlands)

    Wellenberg, G.J.; Bruschke, C.J.M.; Wisselink, H.J.; Barkema, H.W.; Oirschot, van J.T.

    2002-01-01

    In this study, we examined whether an experimental bovine herpesvirus 4 (BHV4) infection can induce bovine mastitis, or can enhance bovine mastitis induced by Streptococcus uberis (S. uberis). Four lactating cows were inoculated intramammarily and intranasally with BHV4, and four lactating control

  14. Efficacy of Intranasal Scopolamine Gel for Motion Sickness Treatment in Aviation Candidates

    Science.gov (United States)

    2009-04-13

    H. I. (1953). Absorption from the nasal mucous membrane. Annals of Otology , Rhinology, and Laryngology, 62, 957-968. Jones, D. R., Levy, R. A...intranasal administration. The Annals of Otology , Rhinology, and Laryngology, 62, 630-641. Wood, C. D., Graybiel, A., McDonough, R. G. & Kennedy, R. S. (1965

  15. Effect of an intranasal corticosteroid on exercise induced bronchoconstriction in asthmatic children

    NARCIS (Netherlands)

    Kersten, Elin T. G.; van Leeuwen, Janneke C.; Brand, Paul L. P.; Duiverman, Eric J.; de Jongh, Frans H. C.; Thio, Bernard J.; Driessen, Jean M. M.

    Rationale Allergic rhinitis and exercise induced bronchoconstriction (EIB) are common in asthmatic children. The aim of this study was to investigate whether treatment of allergic rhinitis with an intranasal corticosteroid protects against EIB in asthmatic children. Methods: This was a double-blind,

  16. Restricted sedation and absence of cognitive impairments after administration of intranasal scopolamine.

    Science.gov (United States)

    Weerts, Aurélie P; Pattyn, Nathalie; Putcha, Lakshmi; Hoag, Stephen W; Van Ombergen, Angelique; Hallgren, Emma; Van de Heyning, Paul H; Wuyts, Floris L

    2015-12-01

    Space motion sickness in astronauts during spaceflight causes significant discomfort, which might impede their functionality. Pharmacological treatment has been mainly restricted to promethazine. Transdermal and oral scopolamine have also been used in space; however, their use was reduced due to unpredictable effectiveness and side effects. Recently, intranasal scopolamine administration has gained much interest, since this route ensures fast and reliable absorption with a decreased incidence of undesirable side effects. The aim of this study was to evaluate the effect of intranasal scopolamine on cognitive performance and to determine its side effects. This double-blind, placebo controlled, repeated measures study evaluated vigilant attention, short-term memory, implicit memory and working memory. Side effects were reported on a 22-item questionnaire and sleepiness was assessed by the Karolinska, Stanford and Epworth Sleepiness Scales. Scopolamine had no effect on cognitive function. Only the Karolinska score was significantly increased for scopolamine compared to placebo. Participants reported a dry mouth and dizziness after receiving scopolamine. Results show that intranasal scopolamine did not impair cognitive performance. Intranasal scopolamine might be a good alternative to promethazine for the alleviation of space motion sickness, since the agent has minimal sedative effects and does not hamper cognitive performance. © The Author(s) 2015.

  17. CSF and blood oxytocin concentration changes following intranasal delivery in macaque.

    Directory of Open Access Journals (Sweden)

    Olga Dal Monte

    Full Text Available Oxytocin (OT in the central nervous system (CNS influences social cognition and behavior, making it a candidate for treating clinical disorders such as schizophrenia and autism. Intranasal administration has been proposed as a possible route of delivery to the CNS for molecules like OT. While intranasal administration of OT influences social cognition and behavior, it is not well established whether this is an effective means for delivering OT to CNS targets. We administered OT or its vehicle (saline to 15 primates (Macaca mulatta, using either intranasal spray or a nebulizer, and measured OT concentration changes in the cerebral spinal fluid (CSF and in blood. All subjects received both delivery methods and both drug conditions. Baseline samples of blood and CSF were taken immediately before drug administration. Blood was collected every 10 minutes after administration for 40 minutes and CSF was collected once post-delivery, at the 40 minutes time point. We found that intranasal administration of exogenous OT increased concentrations in both CSF and plasma compared to saline. Both delivery methods resulted in similar elevations of OT concentration in CSF, while the changes in plasma OT concentration were greater after nasal spray compared to nebulizer. In conclusion our study provides evidence that both nebulizer and nasal spray OT administration can elevate CSF OT levels.

  18. Immunization Coverage

    Science.gov (United States)

    ... sheets Fact files Questions & answers Features Multimedia Contacts Immunization coverage Fact sheet Reviewed January 2018 Key facts ... at least 90% coverage of DTP3 vaccine. Global immunization coverage 2016 A summary of global vaccination coverage ...

  19. Immunizations - diabetes

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  20. Immune response

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000821.htm Immune response To use the sharing features on this page, please enable JavaScript. The immune response is how your body recognizes and defends itself ...

  1. Intranasal delivery of bone marrow stromal cells to spinal cord lesions.

    Science.gov (United States)

    Ninomiya, Koshi; Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Ohkawa, Toshika; Yoshimine, Toshiki

    2015-07-01

    The intranasal delivery of bone marrow stromal cells (BMSCs) or mesenchymal stem cells to the injured brains of rodents has been previously reported. In this study, the authors investigated whether BMSCs migrate to spinal cord lesions through an intranasal route and whether the administration affected functional recovery. Forty Sprague-Dawley rats that were subjected to spinal cord injuries at the T7-8 level were divided into 5 groups (injured + intranasal BMSC-treated group, injured + intrathecal BMSC-treated group, injured-only group, injured + intranasal vehicle-treated group, and injured + intrathecal vehicle-treated group). The Basso-Beattie-Bresnahan (BBB) scale was used to assess hind limb motor functional recovery for 2 or 4 weeks. Intralesionally migrated BMSCs were examined histologically and counted at 2 and 4 weeks. To evaluate the neuroprotective and trophic effects of BMSCs, the relative volume of the lesion cavity was measured at 4 weeks. In addition, nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) levels in the CSF were evaluated at 2 weeks. Intranasally administered BMSCs were confirmed within spinal cord sections at both 2 and 4 weeks. The highest number, which was detected in the intrathecal BMSC-treated group at 2 weeks, was significantly higher than that in all the other groups. The BBB score of the intranasal BMSC-treated group showed statistically significant improvements by 1 week compared with the control group. However, in the final BBB scores, there was a statistically significant difference only between the intrathecal BMSC-treated group and the control group. The cavity ratios in the BMSC-treated groups were smaller than those of the control groups, but the authors did not find any significant differences in the NGF and BDNF levels in the CSF among the treatment and control groups. BMSCs reached the injured spinal cord through the intranasal route and contributed to the recovery of hind limb motor function and

  2. Induction of long-term protective immune responses by influenza H5N1 virus-like particles.

    Directory of Open Access Journals (Sweden)

    Sang-Moo Kang

    Full Text Available Recurrent outbreaks of highly pathogenic H5N1 avian influenza virus pose a threat of eventually causing a pandemic. Early vaccination of the population would be the single most effective measure for the control of an emerging influenza pandemic.Influenza virus-like particles (VLPs produced in insect cell-culture substrates do not depend on the availability of fertile eggs for vaccine manufacturing. We produced VLPs containing influenza A/Viet Nam1203/04 (H5N1 hemagglutinin, neuraminidase, and matrix proteins, and investigated their preclinical immunogenicity and protective efficacy. Mice immunized intranasally with H5N1 VLPs developed high levels of H5N1 specific antibodies and were 100% protected against a high dose of homologous H5N1 virus infection at 30 weeks after immunization. Protection is likely to be correlated with humoral and cellular immunologic memory at systemic and mucosal sites as evidenced by rapid anamnestic responses to re-stimulation with viral antigen in vivo and in vitro.These results provide support for clinical evaluation of H5N1 VLP vaccination as a public health intervention to mitigate a possible pandemic of H5N1 influenza.

  3. Immunization Schedule

    Science.gov (United States)

    ... may be given as part of a combination vaccine so that a child gets fewer shots. Talk with your doctor about ... Kids Teens Frequently Asked Questions About Immunizations Your Child's Immunizations Is the Flu Vaccine a Good Idea for Your Family? Word! Immunizations ...

  4. Rapid single-step methods for detection of two immune defence gene polymorphisms: the myeloperoxidase (MPO) G-129A and the Fc gamma receptor 2A (FCGR2A) H/R131

    DEFF Research Database (Denmark)

    Mølle, Ingolf; Melsvik, Dorte; Østergaard, Mette

    2007-01-01

    . formalin-fixed paraffin-embedded tissue specimens. Here we describe two new single-step methods for rapid and sensitive analysis of: 1. The G-129A myeloperoxidase (MPO) promoter polymorphism, which affects the amount of myeloperoxidase in neutrophils. 2. The Fc gamma receptor 2A (FCGR2A)-H/R131......Polymorphisms of immune defence genes may act as disease modifiers and are studied by many researchers. A conclusive analysis of the impact of genetic variations typically requires a large number of sample specimens, and in retrospective studies this may include samples of reduced quality, e.g...... polymorphism, which is critical to the binding of IgG2 immune complexes to phagocytes. Udgivelsesdato: 2007-Jul-31...

  5. The Effects of Oral d-Amphetamine on Impulsivity in Smoked and Intranasal Cocaine Users

    Science.gov (United States)

    Reed, Stephanie Collins; Evans, Suzette M.

    2016-01-01

    BACKGROUND Effective treatments for cocaine use disorders remain elusive. Two factors that may be related to treatment failures are route of cocaine used and impulsivity. Smoked cocaine users are more likely to have poorer treatment outcomes compared to intranasal cocaine users. Further, cocaine users are impulsive and impulsivity is associated with poor treatment outcomes. While stimulants are used to treat Attention Deficit Hyperactivity Disorder (ADHD) and attenuate certain cocaine-related behaviors, few studies have comprehensively examined whether stimulants can reduce behavioral impulsivity in cocaine users, and none examined route of cocaine use as a factor. METHODS The effects of immediate release oral d-amphetamine (AMPH) were examined in 34 cocaine users (13 intranasal, 21 smoked). Participants had three separate sessions where they were administered AMPH (0, 10, or 20 mg) and completed behavioral measures of impulsivity and risk-taking and subjective measures of abuse liability. RESULTS Smoked cocaine users were more impulsive on the Delayed Memory Task, the GoStop task and the Delay Discounting Task than intranasal cocaine users. Smoked cocaine users also reported more cocaine craving and negative mood than intranasal cocaine users. AMPH produced minimal increases on measures of abuse liability (e.g., Drug Liking). CONCLUSIONS Smoked cocaine users were more impulsive than intranasal cocaine users on measures of impulsivity that had a delay component. Additionally, although AMPH failed to attenuate impulsive responding, there was minimal evidence of abuse liability in cocaine users. These preliminary findings need to be confirmed in larger samples that control for route and duration of cocaine use. PMID:27114203

  6. Hemostatic markers in healthy postmenopausal women during intranasal and oral hormone therapy: a randomized trial.

    Science.gov (United States)

    Hemelaar, Majoie; Kenemans, Peter; Hack, C Erik; Klipping, Christine; van der Mooren, Marius J

    2008-01-01

    To study changes in the hemostatic balance during intranasal compared with oral administration of 17beta-estradiol (E2) and norethisterone (NET) or NET acetate in postmenopausal women. A wide range of markers of coagulation and fibrinolysis associated with coronary artery disease was tested. In a two-center, randomized, double-blind, comparative trial, 90 healthy postmenopausal women (aged 56.6 +/- 4.7 y) received daily continuous combined hormone therapy, either E2/NET 175 microg/275 mug intranasally as a spray (n = 47) or E2/NET acetate 1 mg/0.5 mg orally as a capsule (n = 43) for 1 year. Hemostatic markers were measured in blood samples taken at baseline and after 12, 24, and 52 weeks of treatment. After 52 weeks of treatment, changes in the intranasal group in markers of coagulation-fibrinogen (-1.3%), factor VII activity (-14.0%), and prothrombin fragment 1 + 2 (+5.8%)-were significantly less (P < 0.05) than the changes in the oral group for these parameters (-6.5%, -20.3%, and +19.0%, respectively). Changes in activated factor VII did not differ between the groups. Neither group showed significant changes in thrombin-antithrombin complex. In the intranasal group, decreases in markers of fibrinolysis-tissue-type plasminogen activator (-10.4%) and plasminogen activator inhibitor-1 antigen (-13.8%)-were significantly less (P < 0.05) than the decreases in the oral group (-17.8% and -38.0%, respectively). A decrease in plasminogen activator inhibitor-1 activity and increases in D-dimer and plasmin-alpha2-antiplasmin complex did not differ between the groups. No differences were found between the groups in homocysteine, which overall was unaltered in both groups. During intranasal E2/NET therapy, changes in the coagulatory and fibrinolytic markers were to some extent less than those observed during oral therapy.

  7. Conditioned social preference, but not place preference, produced by intranasal oxytocin in female mice.

    Science.gov (United States)

    Kosaki, Yutaka; Watanabe, Shigeru

    2016-04-01

    Oxytocin (OT) has been implicated in a variety of mammalian reproductive and social behaviors, and the use of intranasal OT for clinical purposes is on the rise. However, basic actions of OT, including the rewarding or reinforcing properties of the drug, are currently not fully understood. In this study, the authors investigated whether intranasally administered OT has different reinforcing properties for social and nonsocial stimuli and whether such effects are variable between male and female subjects. Conditioned social preference (CSP) and conditioned place preference (CPP) paradigms were used to examine social and nonsocial reinforcing properties of OT. In CSP, the presence of a same-sex unfamiliar conspecific was repeatedly paired with intranasal OT, while a different conspecific was associated with saline. The reinforcing effect of OT was assessed in a postconditioning choice test under a drug-free condition. In CPP, the 2 conspecifics were replaced with nonsocial black and white compartments. The authors found that intranasal OT (12 μg) in females supported the formation of CSP (Experiment 1) but not CPP (Experiment 3). Neither CSP (Experiment 2) nor CPP (Experiment 4) was formed in males. Extended conditioning with higher dose OT (36 μg), however, abolished the initial CSP in females and produced an aversion to the OT-paired stimulus mouse. Experiment 5 indicated that it was the repeated administrations rather than the higher dose that produced the abolition of the original preference. Overall, the current results demonstrate for the first time a sex- and stimulus-dependent reinforcing property of intranasal OT in mice. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  8. Long-term exposure to intranasal oxytocin in a mouse autism model.

    Science.gov (United States)

    Bales, K L; Solomon, M; Jacob, S; Crawley, J N; Silverman, J L; Larke, R H; Sahagun, E; Puhger, K R; Pride, M C; Mendoza, S P

    2014-11-11

    Oxytocin (OT) is a neuropeptide involved in mammalian social behavior. It is currently in clinical trials for the treatment of autism spectrum disorder (ASD). Previous studies in healthy rodents (prairie voles and C57BL/6J mice) have shown that there may be detrimental effects of long-term intranasal administration, raising the questions about safety and efficacy. To investigate the effects of OT on the aspects of ASD phenotype, we conducted the first study of chronic intranasal OT in a well-validated mouse model of autism, the BTBR T+ Itpr3tf/J inbred strain (BTBR), which displays low sociability and high repetitive behaviors. BTBR and C57BL/6J (B6) mice (N=94) were administered 0.8  IU/kg of OT intranasally, daily for 30 days, starting on day 21. We ran a well-characterized set of behavioral tasks relevant to diagnostic and associated symptoms of autism, including juvenile reciprocal social interactions, three-chambered social approach, open-field exploratory activity, repetitive self-grooming and fear-conditioned learning and memory, some during and some post treatment. Intranasal OT did not improve autism-relevant behaviors in BTBR, except for female sniffing in the three-chambered social interaction test. Male saline-treated BTBR mice showed increased interest in a novel mouse, both in chamber time and sniffing time, whereas OT-treated male BTBR mice showed a preference for the novel mouse in sniffing time only. No deleterious effects of OT were detected in either B6 or BTBR mice, except possibly for the lack of a preference for the novel mouse's chamber in OT-treated male BTBR mice. These results highlight the complexity inherent in understanding the effects of OT on behavior. Future investigations of chronic intranasal OT should include a wider dose range and early developmental time points in both healthy rodents and ASD models to affirm the efficacy and safety of OT.

  9. CD27 instructs CD4+ T cells to provide help for the memory CD8+ T cell response after protein immunization

    NARCIS (Netherlands)

    Xiao, Yanling; Peperzak, Victor; Keller, Anna M.; Borst, Jannie

    2008-01-01

    For optimal quality, memory CD8(+) T cells require CD4(+) T cell help. We have examined whether CD4(+) T cells require CD27 to deliver this help, in a model of intranasal OVA protein immunization. CD27 deficiency reduced the capacity of CD4(+) T cells to support Ag-specific CD8(+) T cell

  10. Echinoderm immunity.

    Science.gov (United States)

    Smith, L Courtney; Ghosh, Julie; Buckley, Katherine M; Clow, Lori A; Dheilly, Nolwenn M; Haug, Tor; Henson, John H; Li, Chun; Lun, Cheng Man; Majeske, Audrey J; Matranga, Valeria; Nair, Sham V; Rast, Jonathan P; Raftos, David A; Roth, Mattias; Sacchi, Sandro; Schrankel, Catherine S; Stensvåg, Klara

    2010-01-01

    A survey for immune genes in the genome for the purple sea urchin has shown that the immune system is complex and sophisticated. By inference, immune responses of all echinoderms maybe similar. The immune system is mediated by several types of coelomocytes that are also useful as sensors of environmental stresses. There are a number of large gene families in the purple sea urchin genome that function in immunity and of which at least one appears to employ novel approaches for sequence diversification. Echinoderms have a simpler complement system, a large set of lectin genes and a number of antimicrobial peptides. Profiling the immune genes expressed by coelomocytes and the proteins in the coelomic fluid provide detailed information about immune functions in the sea urchin. The importance of echinoderms in maintaining marine ecosystem stability and the disastrous effects of their removal due to disease will require future collaborations between ecologists and immunologists working towards understanding and preserving marine habitats.

  11. Immunizing Children

    Directory of Open Access Journals (Sweden)

    Geraldine Jody Macdonald

    2014-11-01

    Full Text Available This article addresses the complex contexts within which Canadian health professionals engage in immunizing children and focuses on the Canadian practice guidelines and current scientific evidence that direct Canadian health professional competencies. The article begins by presenting two current global vaccine initiatives and links these to immunization in Canada. A selected literature review identifies current best immunization practices. With the purpose of promoting quality improvement, three key Canadian immunization competencies for health professional are highlighted: communication with parents, including those who are experiencing vaccine hesitancy; administration of immunizing agents; and documentation of immunizations. Health professionals are encouraged to reflect on immunization competencies and ensure evidence-based practices underpin vaccine delivery in their primary care settings.

  12. Effects of immunization with the rNfa1 protein on experimental Naegleria fowleri-PAM mice.

    Science.gov (United States)

    Lee, Y J; Kim, J H; Sohn, H J; Lee, J; Jung, S Y; Chwae, Y J; Kim, K; Park, S; Shin, H J

    2011-07-01

    Free-living Naegleria fowleri causes primary amoebic meningoencephalitis (PAM) in humans and animals. To examine the effect of immunization with Nfa1 protein on experimental murine PAM because of N. fowleri, BALB/c mice were intra-peritoneally or intra-nasally immunized with a recombinant Nfa1 protein. We analysed Nfa1-specific antibody and cytokine induction, and the mean survival time of infected mice. Mice immunized intra-peritoneally or intra-nasally with rNfa1 protein developed specific IgG, IgA and IgE antibodies; the IgG response was dominated by IgG1, followed by IgG2b, IgG2a and IgG3. High levels of the Th1 cytokine, IFN-γ, and the regulatory cytokine, IL-10, were also induced. The mean survival time of mice immunized intra-peritoneally with rNfa1 protein was prolonged compared with controls, (25.0 and 15.5 days, respectively). Similarly, the mean survival time of mice immunized intra-nasally with rNfa1 protein was 24.7 days, compared with 15.0 days for controls. © 2011 Blackwell Publishing Ltd.

  13. Poly I:C adjuvanted inactivated swine influenza vaccine induces heterologous protective immunity in pigs.

    Science.gov (United States)

    Thomas, Milton; Wang, Zhao; Sreenivasan, Chithra C; Hause, Ben M; Gourapura J Renukaradhya; Li, Feng; Francis, David H; Kaushik, Radhey S; Khatri, Mahesh

    2015-01-15

    Swine influenza is widely prevalent in swine herds in North America and Europe causing enormous economic losses and a public health threat. Pigs can be infected by both avian and mammalian influenza viruses and are sources of generation of reassortant influenza viruses capable of causing pandemics in humans. Current commercial vaccines provide satisfactory immunity against homologous viruses; however, protection against heterologous viruses is not adequate. In this study, we evaluated the protective efficacy of an intranasal Poly I:C adjuvanted UV inactivated bivalent swine influenza vaccine consisting of Swine/OH/24366/07 H1N1 and Swine/CO/99 H3N2, referred as PAV, in maternal antibody positive pigs against an antigenic variant and a heterologous swine influenza virus challenge. Groups of three-week-old commercial-grade pigs were immunized intranasally with PAV or a commercial vaccine (CV) twice at 2 weeks intervals. Three weeks after the second immunization, pigs were challenged with the antigenic variant Swine/MN/08 H1N1 (MN08) and the heterologous Swine/NC/10 H1N2 (NC10) influenza virus. Antibodies in serum and respiratory tract, lung lesions, virus shedding in nasal secretions and virus load in lungs were assessed. Intranasal administration of PAV induced challenge viruses specific-hemagglutination inhibition- and IgG antibodies in the serum and IgA and IgG antibodies in the respiratory tract. Importantly, intranasal administration of PAV provided protection against the antigenic variant MN08 and the heterologous NC10 swine influenza viruses as evidenced by significant reductions in lung virus load, gross lung lesions and significantly reduced shedding of challenge viruses in nasal secretions. These results indicate that Poly I:C or its homologues may be effective as vaccine adjuvants capable of generating cross-protective immunity against antigenic variants/heterologous swine influenza viruses in pigs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Intranasal Oxytocin Normalizes Amygdala Functional Connectivity in Posttraumatic Stress Disorder

    NARCIS (Netherlands)

    Koch, Saskia B. J.; van Zuiden, Mirjam; Nawijn, Laura; Frijling, Jessie L.; Veltman, Dick J.; Olff, Miranda

    2016-01-01

    The neuropeptide oxytocin (OT) has been suggested as a promising pharmacological agent for medication-enhanced psychotherapy in posttraumatic stress disorder (PTSD) because of its anxiolytic and prosocial properties. We therefore investigated the behavioral and neurobiological effects of a single

  15. Safety and Immunogenicity Testing of an Intranasal Group B Meningococcal Native Outer Membrane Vesicle Vaccine in Healthy Volunteers

    National Research Council Canada - National Science Library

    Drabick, Joseph

    1998-01-01

    An intranasal vaccine composed of native outer membrane vesicles (NOMV) not exposed to detergent or denaturing agents was prepared from the group B meningococcal strain and tested in 32 healthy adult volunteers...

  16. Too little or too much corticosteroid? Coexisting adrenal insufficiency and Cushing's syndrome from chronic, intermittent use of intranasal betamethasone.

    Science.gov (United States)

    Dow, Adrienne; Yu, Run; Carmichael, John

    2013-01-01

    To report the puzzling, rare occurrence of coexisting adrenal insufficiency and Cushing's syndrome from chronic, intermittent use of intranasal betamethasone spray. A 62-year-old male was referred to our endocrinology clinic for management of adrenal insufficiency. This previously healthy individual began to experience chronic sinus symptoms in 2007, was treated with multiple ensuing sinus surgeries, and received oral glucocorticoid for 6 months. In the following 5 years, he suffered severe fatigue and was diagnosed with secondary adrenal insufficiency. He could not be weaned from corticosteroid and developed clear cushingoid features. In our clinic, careful inquiry on medications revealed chronic, intermittent use of high-dose intranasal betamethasone since 2008, which was not apparent to his other treating physicians. His cushingoid features significantly improved after holding intranasal betamethasone. Chronic, intermittent intranasal betamethasone can cause secondary adrenal insufficiency and iatrogenic Cushing's syndrome when used in excess.Topical corticosteroid use should be considered in the differential diagnosis of adrenal insufficiency or Cushing's syndrome.

  17. Intranasal vaccination with a secreted chlamydial protein enhances resolution of genital Chlamydia muridarum infection, protects against oviduct pathology, and is highly dependent upon endogenous gamma interferon production.

    Science.gov (United States)

    Murthy, Ashlesh K; Chambers, James P; Meier, Patricia A; Zhong, Guangming; Arulanandam, Bernard P

    2007-02-01

    There is currently no licensed vaccine against Chlamydia trachomatis, the leading cause of sexually transmitted bacterial disease worldwide. Conventional vaccination attempts using surface-exposed chlamydial antigens have achieved only partial success. We have employed a novel vaccination strategy using a secreted protein, chlamydial protease-like activity factor (CPAF), which has been shown to degrade host major histocompatibility complex transcription factors and keratin-8 and therefore may allow immune evasion and establishment of a productive infection. Intranasal immunization using recombinant CPAF (rCPAF) plus interleukin-12 (IL-12) (rCPAF+IL-12 immunization) was used to assess the protective immunity against genital Chlamydia muridarum infection in BALB/c mice. rCPAF+IL-12 immunization induced robust gamma interferon (IFN-gamma) production and minimal IL-4 production by splenocytes upon in vitro recall with rCPAF. The total and immunoglobulin G2a (IgG2a) anti-rCPAF antibody levels in serum were significantly elevated after rCPAF+IL-12 vaccination, as were the total antibody, IgG2a, and IgA levels in bronchoalveolar lavage and vaginal fluids when the animals were compared to animals that received rCPAF alone. rCPAF+IL-12-vaccinated mice displayed significantly reduced bacterial shedding upon chlamydial challenge and accelerated resolution of infection compared to mock-immunized (phosphate-buffered saline) animals. Moreover, rCPAF+IL-12-immunized animals exhibited protection against pathological consequences of chlamydial infection, including the development of hydrosalpinx and oviduct dilatation. This vaccination regimen also reduced the development of fibrosis and the influx of neutrophils into the upper genital tract when the animals were compared to mock-immunized (phosphate-buffered saline) animals after bacterial challenge. rCPAF+IL-12-mediated resolution of the bacterial infection and protection against Chlamydia-induced inflammatory disease were highly

  18. Intranasal corticosteroids compared with oral antihistamines in allergic rhinitis: A systematic review and meta-analysis.

    Science.gov (United States)

    Juel-Berg, Nanna; Darling, Peter; Bolvig, Julie; Foss-Skiftesvik, Majken H; Halken, Susanne; Winther, Lone; Hansen, Kirsten Skamstrup; Askjaer, Nikolaj; Heegaard, Steffen; Madsen, Anders R; Opstrup, Morten S

    2017-01-09

    Intranasal corticosteroids (INS) (corticosteroid nasal sprays) and oral antihistamines (OA) are two of the most common treatments for patients with allergic rhinitis (AR). To our knowledge, there are no systematic reviews on this topic including trials published after 2007. To compare INS with nonsedating OAs as treatments for AR. The systematic review and meta-analysis were based on the Grades of Recommendation, Assessment, Development, and Evaluation principles and the Patient, Intervention, Comparison, and Outcome approach. Primary literature was searched up to January 22, 2015. Criteria for eligibility were randomized controlled trials that compared the efficacy and/or adverse effects of INS and OA in patients with AR. Continuous outcome data were analyzed by using standardized mean differences (SMD) for multiple outcome measures, and mean differences in the case of a single study or outcome. Pooled estimates of effects, 95% confidence interval (CI), were calculated by using random-effects models. The meta-analysis included five randomized controlled trials with a total of 990 patients. INS were superior to OAs in improving total nasal symptoms score (SMD -0.70 [95% CI, -0.93 to -0.47]) and in relieving the following: nasal obstruction (SMD -0.56 [95% CI, -0.82 to -0.29]), rhinorrhea (SMD -0.47 [95% CI, -1.00 to 0.05]), nasal itching (SMD -0.42 [95% CI, -0.65 to -0.18]), sneezing (SMD -0.52 [95% CI, -0.73 to -0.32]), and quality of life mean difference -0.90 [95% CI, -1.18 to -0.62]). There was no difference in relief of ocular symptoms (SMD -0.08 [95% CI, -0.23 to 0.08]). In addition, four randomized controlled trials were included in a narrative analysis. The results in the narrative analysis were comparable with those found in the meta-analysis. INS were superior to OAs in improving nasal symptoms and quality of life in patients with AR.

  19. Comparison of the Intramuscular, Intranasal or Sublingual Routes of Midazolam Administration for the Control of Soman-Induced Seizures

    Science.gov (United States)

    2008-01-01

    bioavailability of intranasal hydromorphone hydrochloride in patients with allergic rhinitis . Pharmacotherapy 2004a; 24 :26–32. 29 Davis GA, Rudy AC...cycle (lights on at 06:00) and received food and water ad libitum except during the experimental period. Surgery. Approximately 1 week...increased nasal secretions from rhinitis have been shown to not significantly affect the bioavailability of other compounds delivered by the intranasal

  20. Visualization of murine intranasal dosing efficiency using luminescent Francisella tularensis: effect of instillation volume and form of anesthesia.

    Directory of Open Access Journals (Sweden)

    Mark A Miller

    Full Text Available Intranasal instillation is a widely used procedure for pneumonic delivery of drugs, vaccine candidates, or infectious agents into the respiratory tract of research mice. However, there is a paucity of published literature describing the efficiency of this delivery technique. In this report we have used the murine model of tularemia, with Francisella tularensis live vaccine strain (FTLVS infection, to evaluate the efficiency of pneumonic delivery via intranasal dosing performed either with differing instillation volumes or different types of anesthesia. FTLVS was rendered luminescent via transformation with a reporter plasmid that constitutively expressed the Photorhabdus luminescens lux operon from a Francisella promoter. We then used an IVIS Spectrum whole animal imaging system to visualize FT dissemination at various time points following intranasal instillation. We found that instillation of FT in a dose volume of 10 µl routinely resulted in infection of the upper airways but failed to initiate infection of the pulmonary compartment. Efficient delivery of FT into the lungs via intranasal instillation required a dose volume of 50 µl or more. These studies also demonstrated that intranasal instillation was significantly more efficient for pneumonic delivery of FTLVS in mice that had been anesthetized with inhaled (isoflurane vs. parenteral (ketamine/xylazine anesthesia. The collective results underscore the need for researchers to consider both the dose volume and the anesthesia type when either performing pneumonic delivery via intranasal instillation, or when comparing studies that employed this technique.

  1. Radiation Mitigating Properties of Intranasally Administered KL4Surfactant in a Murine Model of Radiation-Induced Lung Damage.

    Science.gov (United States)

    Christofidou-Solomidou, Melpo; Pietrofesa, Ralph A; Arguiri, Evguenia; Koumenis, Constantinos; Segal, Robert

    2017-11-01

    The threat of exposure to ionizing radiation from a nuclear reactor accident or deliberate terrorist actions is a significant public health concern. The lung is particularly susceptible to radiation-induced injury from external sources or inhalation of radioactive particles from radioactive fallout. Radiation-induced lung disease can manifest with an acute radiation pneumonitis and/or delayed effects leading to pulmonary fibrosis. As prior warning of radiation exposure is unlikely, medical countermeasures (MCMs) to mitigate radiation-induced lung disease that can be given in mass-casualty situations many hours or days postirradiation are needed to prevent both early and late lung damage. In this study, KL 4 surfactant (lucinactant) was evaluated as a radiation mitigator in a well-characterized mouse model of targeted thoracic radiation exposure, for its effect on both early (several weeks) and late (18 weeks) lung damage. Here, 120 mg/kg total phospholipid of KL 4 surfactant was administered twice daily intranasally, (enabling intrapulmonary inhalation of drug) to C57BL/6 mice 24 h after a single 13.5 Gy dose of thoracic irradiation (LD 50 dose). Both early and chronic phase (2 and 4 weeks and 18 weeks postirradiation, respectively) assessments were performed. Mice were evaluated for evidence of reduced arterial blood oxygenation and early and chronic lung and systemic inflammation, lung fibrosis and oxidative stress. Analysis was done by performing lung function/respiration dynamics and measuring cellular protein content of bronchoalveolar lavage fluid (BALF), and levels of cytokines, 8-iso-prostaglandin F2α, hydroxyproline in lung and plasma, along with evaluating lung histology. The results of this study showed that intranasal delivery of KL 4 surfactant was able to preserve lung function as evidenced by adequate arterial oxygen saturation and reduced lung inflammation and oxidative stress; total white count and absolute neutrophil count was decreased in BALF

  2. Study of embryotoxic effects of intranasally administred desloratadine on laboratory animals

    Directory of Open Access Journals (Sweden)

    Alekhina Т.А.

    2017-04-01

    Full Text Available The study was conducted to detect possible changes in embryogenesis and negative effects of third generation antihistamine – desloratadine – after intranasal administration of 1.3 mg/m3 and 13.0 mg/m3 of the substance to laboratory animals during their prenatal period. In these circumstances, desloratadine does not cause any significant changes of embryogenesis parameters. Macroscopic examination of the fetus and placenta in animals of experimental groups did not reveal any pathology or physiological deviations from the norm. 13.0 mg/m3 concentration of the drug caused a decrease in the weight of embryos in comparison with control group of animals and physiological data, despite a well developed, without visible pathology, placenta. This neces­sitates an in-depth study of possible teratogenic effects of intranasally administred desloratadine to laboratory animals.

  3. Intranasal treatment with bacteriophage rescues mice from Acinetobacter baumannii-mediated pneumonia.

    Science.gov (United States)

    Wang, Yong; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Li, Puyuan; Liu, Yannan; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Tong, Yigang; Bai, Changqing

    2016-05-01

    With the emergence of drug-resistant bacteria, finding alternative agents to treat antibiotic-resistant bacterial infections is imperative. A mouse pneumonia model was developed by combining cyclophosphamide pretreatment and Acinetobacter baumannii challenge, and a lytic bacteriophage was evaluated for its therapeutic efficacy in this model by examining the survival rate, bacterial load in the lung and lung pathology. Intranasal instillation with bacteriophage rescued 100% of mice following lethal challenge with A. baumannii. Phage treatment reduced bacterial load in the lung. Microcomputed tomography indicated a reduction in lung inflammation in mice given phage. This research demonstrates that intranasal application of bacteriophage is viable, and could provide complete protection from pneumonia caused by A. baumannii.

  4. Intranasal administration of insulin to the brain impacts cognitive function and peripheral metabolism.

    Science.gov (United States)

    Ott, V; Benedict, C; Schultes, B; Born, J; Hallschmid, M

    2012-03-01

    In recent years, the central nervous system (CNS) has emerged as a principal site of insulin action. This notion is supported by studies in animals relying on intracerebroventricular insulin infusion and by experiments in humans that make use of the intranasal pathway of insulin administration to the brain. Employing neurobehavioural and metabolic measurements as well as functional imaging techniques, these studies have provided insight into a broad range of central and peripheral effects of brain insulin. The present review focuses on CNS effects of insulin administered via the intranasal route on cognition, in particular memory function, and whole-body energy homeostasis including glucose metabolism. Furthermore, evidence is reviewed that suggests a pathophysiological role of impaired brain insulin signaling in obesity and type 2 diabetes, which are hallmarked by peripheral and possibly central nervous insulin resistance, as well as in conditions such as Alzheimer's disease where CNS insulin resistance might contribute to cognitive dysfunction. © 2011 Blackwell Publishing Ltd.

  5. The role of co-spray-drying procedure in the preformulation of intranasal propranolol hydrochloride.

    Science.gov (United States)

    Ambrus, Rita; Gergely, Matild; Zvonar, Alenka; Szabó-Révész, Piroska; Sipos, Emese

    2014-01-01

    The use of dry powder formulations presents an alternative through which to achieve better deposition and residence time in the nasal cavity, increased stability and possible absorption enhancement. The most important factors involved in the preformulation are particle size and physical stability. Propranolol hydrochloride a model drug was subjected to spray-drying technology to form an intranasal dry powder. Particle size reduction of the drug was carried out by integration (spray-drying) methods, using different excipients. The micrometric properties were characterized by size and morphology. The structure was determined through the use of differential scanning calorimetry, X-ray powder diffraction and Fourier transform infrared spectroscopy investigations. It was concluded that the intranasal dry powder formulation of propranolol hydrochloride can be achieved with a suitable particle size without polymorph modification or chemical decomposition.

  6. Intranasal Insulin Restores Metabolic Parameters and Insulin Sensitivity in Rats with Metabolic Syndrome.

    Science.gov (United States)

    Derkach, K V; Ivantsov, A O; Chistyakova, O V; Sukhov, I B; Buzanakov, D M; Kulikova, A A; Shpakov, A O

    2017-06-01

    We studied the effect of 10-week treatment with intranasal insulin (0.5 IU/day) on glucose tolerance, glucose utilization, lipid metabolism, functions of pancreatic β cells, and insulin system in the liver of rats with cafeteria diet-induced metabolic syndrome. The therapy reduced body weight and blood levels of insulin, triglycerides, and atherogenic cholesterol that are typically increased in metabolic syndrome, normalized glucose tolerance and its utilization, and increased activity of insulin signaling system in the liver, thus reducing insulin resistance. The therapy did not affect the number of pancreatic islets and β cells. The study demonstrates prospects of using intranasal insulin for correction of metabolic parameters and reduction of insulin resistance in metabolic syndrome.

  7. rEnolase maternal immunization confers caries protection on offspring.

    Science.gov (United States)

    Dinis, M; Trigo, G; Chaves, N; Fonseca, A J M M; Ribeiro, A; Tavares, D; Cabrita, A M S; Ferreira, P

    2011-03-01

    Therapeutic vaccination with Streptococcus sobrinus recombinant enolase (rEnolase) protects rats from dental caries. Here, we investigated the effect that maternal rEnolase vaccination before pregnancy had on the offspring's immune response to S. sobrinus oral infection and dental caries progression. Female Wistar rats were immunized by intranasal and subcutaneous routes with rEnolase adsorbed onto aluminum hydroxide as adjuvant or similarly treated with the adjuvant alone (sham-immunized). Ten days after the last administration, the immunized females were paired with a male rat. The oral immune responses to S. sobrinus infection and dental caries in the offspring were evaluated. The results showed that pups born from rEnolase-immunized mothers had higher levels of rEnolase-specific salivary IgA and IgG antibodies (indicating a placental antibody transfer) and lower sulcal and proximal enamel caries scores than rats born from sham-immunized mothers. In conclusion, rEnolase maternal immunization before pregnancy provides offspring with protection against S. sobrinus-induced dental caries.

  8. Mucosal Immunization with Newcastle Disease Virus Vector Coexpressing HIV-1 Env and Gag Proteins Elicits Potent Serum, Mucosal, and Cellular Immune Responses That Protect against Vaccinia Virus Env and Gag Challenges.

    Science.gov (United States)

    Khattar, Sunil K; Manoharan, Vinoth; Bhattarai, Bikash; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

    2015-07-21

    Newcastle disease virus (NDV) avirulent strain LaSota was used to coexpress gp160 Env and p55 Gag from a single vector to enhance both Env-specific and Gag-specific immune responses. The optimal transcription position for both Env and Gag genes in the NDV genome was determined by generating recombinant NDV (rNDV)-Env-Gag (gp160 located between the P and M genes and Gag between the HN and L genes), rNDV-Gag-Env (Gag located between the P and M genes and gp160 between the HN and L genes), rNDV-Env/Gag (gp160 followed by Gag located between the P and M genes), and rNDV-Gag/Env (Gag followed by gp160 located between the P and M genes). All the recombinant viruses replicated at levels similar to those seen with parental NDV in embryonated chicken eggs and in chicken fibroblast cells. Both gp160 and Gag proteins were expressed at high levels in cell culture, with gp160 found to be incorporated into the envelope of NDV. The Gag and Env proteins expressed by all the recombinants except rNDV-Env-Gag self-assembled into human immunodeficiency virus type 1 (HIV-1) virus-like particles (VLPs). Immunization of guinea pigs by the intranasal route with these rNDVs produced long-lasting Env- and Gag-specific humoral immune responses. The Env-specific humoral and mucosal immune responses and Gag-specific humoral immune responses were higher in rNDV-Gag/Env and rNDV-Env/Gag than in the other recombinants. rNDV-Gag/Env and rNDV-Env/Gag were also more efficient in inducing cellular as well as protective immune responses to challenge with vaccinia viruses expressing HIV-1 Env and Gag in mice. These results suggest that vaccination with a single rNDV coexpressing Env and Gag represents a promising strategy to enhance immunogenicity and protective efficacy against HIV. A safe and effective vaccine that can induce both systemic and mucosal immune responses is needed to control HIV-1. In this study, we showed that coexpression of Env and Gag proteins of HIV-1 performed using a single

  9. Intranasal corticosteroids compared with oral antihistamines in allergic rhinitis

    DEFF Research Database (Denmark)

    Juel-Berg, Nanna; Darling, Peter; Bolvig, Julie

    2017-01-01

    in the case of a single study or outcome. Pooled estimates of effects, 95% confidence interval (CI), were calculated by using random-effects models. Results: The meta-analysis included five randomized controlled trials with a total of 990 patients. INS were superior to OAs in improving total nasal symptoms...

  10. Intranasal tissue necrosis associated with opioid abuse: Case report and systematic review.

    Science.gov (United States)

    Morrison, Danielle A; Wise, Sarah K; DelGaudio, John M; Chowdhury, Naweed I; Levy, Joshua M

    2017-12-27

    Opioid abuse is a common disorder affecting over 2 million Americans. Intranasal tissue necrosis is a previously described sequela of nasal opioid inhalation, with a similar presentation to invasive fungal rhinosinusitis (IFRS). The goal of this case report and systematic review is to evaluate the evidence supporting this uncommon disease, with qualitative analysis of the presentation, management and treatment outcomes. MEDLINE, EMBASE, Google Scholar, Scopus, and Web of Science. Preferred Reporting Items for Systematic Reviews and Meta-analyses guidelines were utilized to identify English-language studies reporting intranasal mucosal injury associated with prescription opioid abuse. Primary outcomes included clinical presentation, treatment strategies, and outcomes. Systematic review identified 61 patients for qualitative analysis. Common clinical features include facial pain without a history of chronic sinusitis or known immunodeficiency. Diagnostic nasal endoscopy revealed superficial debris with underlying tissue necrosis, consistent with a preliminary diagnosis of IFRS. Characteristic pathologic findings include mucosal ulceration with an overlying acellular substrate, often with polarizable material. Fungal colonization is often reported, with several accounts of angiocentric invasion in immunocompetent patients. Complete symptom resolution is expected following surgical debridement with cessation of intranasal opioid inhalation, with 89% of identified patients experiencing a complete resolution of disease. Intranasal opioid abuse is a prevalent condition associated with chronic pain and tissue necrosis that is clinically concerning for invasive fungal disease. Whereas IFRS must be excluded, even in patients without known immunodeficiency, complete resolution of symptoms can be expected following surgical debridement with cessation of opioid abuse. Laryngoscope, 2017. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  11. Reduced experimental autoimmune encephalomyelitis after intranasal and oral administration of recombinant lactobacilli expressing myelin antigens.

    Science.gov (United States)

    Maassen, Catharina B M; Laman, Jon D; van Holten-Neelen, Conny; Hoogteijling, Linsy; Groenewegen, Lizet; Visser, Lizette; Schellekens, Marc M; Boersma, Wim J A; Claassen, Eric

    2003-12-01

    Oral administration of autoantigens is a safe and convenient way to induce peripheral T-cell tolerance in autoimmune diseases like multiple sclerosis (MS). To increase the efficacy of oral tolerance induction and obviate the need for large-scale purification of human myelin proteins, we use genetically modified lactobacilli expressing myelin antigens. A panel of recombinant lactobacilli was constructed producing myelin proteins and peptides, including human and guinea pig myelin basic protein (MBP) and proteolipid protein peptide 139-151 (PLP(139-151)). In this study we examined whether these Lactobacillus recombinants are able to induce oral and intranasal tolerance in an animal model for multiple sclerosis, experimental autoimmune encephalomyelitis (EAE). Lewis rats received soluble cell extracts of Lactobacillus transformants intranasally three times prior to induction of EAE. For the induction of oral tolerance, rats were fed live transformed lactobacilli for 20 days. Ten days after the first oral administration EAE was induced. Intranasal administration of extracts containing guinea pig MBP (gpMBP) or MBP(72-85) significantly inhibited EAE in Lewis rats. Extracts of control transformants did not reduce EAE. Live lactobacilli expressing guinea pig MBP(72-85) fused to the marker enzyme beta-glucuronidase (beta-gluc) were also able to significantly reduce disease when administered orally. In conclusion, these experiments provide proof of principle that lactobacilli expressing myelin antigens reduce EAE after mucosal (intranasal and oral) administration. This novel method of mucosal tolerance induction by mucosal administration of recombinant lactobacilli expressing relevant autoantigens could find applications in autoimmune disease in general, such as multiple sclerosis, rheumatoid arthritis and uveitis.

  12. Intranasal Insulin Suppresses Food Intake via Enhancement of Brain Energy Levels in Humans

    OpenAIRE

    Jauch-Chara, Kamila; Friedrich, Alexia; Rezmer, Magdalena; Melchert, Uwe H.; G. Scholand-Engler, Harald; Hallschmid, Manfred; Oltmanns, Kerstin M.

    2012-01-01

    Cerebral insulin exerts anorexic effects in humans and animals. The underlying mechanisms, however, are not clear. Because insulin physiologically facilitates glucose uptake by most tissues of the body and thereby fosters intracellular energy supply, we hypothesized that intranasal insulin reduces food consumption via enhancement of the neuroenergetic level. In a double-blind, placebo?controlled, within-subject comparison, 15 healthy men (BMI 22.2 ? 0.37 kg/m2) aged 22?28 years were intranasa...

  13. Sex-Specific Effects of Stress on Oxytocin Neurons Correspond With Responses to Intranasal Oxytocin.

    Science.gov (United States)

    Steinman, Michael Q; Duque-Wilckens, Natalia; Greenberg, Gian D; Hao, Rebecca; Campi, Katharine L; Laredo, Sarah A; Laman-Maharg, Abigail; Manning, Claire E; Doig, Ian E; Lopez, Eduardo M; Walch, Keenan; Bales, Karen L; Trainor, Brian C

    2016-09-01

    Oxytocin (OT) is considered to be a stress-buffering hormone, dampening the physiologic effects of stress. However, OT can also be anxiogenic. We examined acute and long-lasting effects of social defeat on OT neurons in male and female California mice. We used immunohistochemistry for OT and c-fos cells to examine OT neuron activity immediately after defeat (n = 6-9) and 2 weeks (n = 6-9) and 10 weeks (n = 4-5) later. We quantified Oxt messenger RNA with quantitative polymerase chain reaction (n = 5-9). Intranasal OT was administered to naïve and stressed mice tested in social interaction and resident-intruder tests (n = 8-14). Acute exposure to a third episode of defeat increased OT/c-fos colocalizations in the paraventricular nucleus of both sexes. In the medioventral bed nucleus of the stria terminalis, defeat increased Oxt messenger RNA, total OT neurons, and OT/c-fos colocalizations in female mice but not male mice. Intranasal OT failed to reverse stress-induced social withdrawal in female mice and reduced social interaction behavior in female mice naïve to defeat. In contrast, intranasal OT increased social interaction in stressed male mice and reduced freezing in the resident-intruder test. Social defeat induces long-lasting increases in OT production and OT/c-fos cells in the medioventral bed nucleus of the stria terminalis of female mice but not male mice. Intranasal OT largely reversed the effects of stress on behavior in male mice, but effects were mixed in female mice. These results suggest that changes in OT-sensitive networks contribute to sex differences in behavioral responses to stress. Copyright © 2015 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  14. First clinical experience with intranasal cooling for hyperthermia in brain-injured patients

    DEFF Research Database (Denmark)

    Springborg, Jacob Bertram; Springborg, Karoline Kanstrup; Romner, Bertil

    2013-01-01

    Hyperthermia is common in brain-injured patients and associated with a worse outcome. As brain rather than body temperature reduction, theoretically, is the most important in cerebral protection, there is logic in targeting cooling at the brain. Selective brain cooling can, in theory, be obtained...... by cooling the skull or by heat loss from the upper airways. In this preliminary safety and efficacy study, we report clinical data from brain-injured patients who because of hyperthermia were treated with intranasal cooling....

  15. Combined local and systemic immunization is essential for durable T-cell mediated heterosubtypic immunity against influenza A virus

    DEFF Research Database (Denmark)

    Uddbäck, Ida Elin Maria; Pedersen, Line M I; Pedersen, Sara R

    2016-01-01

    nucleoprotein have previously been found to induce short-term protection in mice. In this study we confirm that systemic (subcutaneous (s.c.) immunization rapidly induced heterosubtypic protection predominantly mediated by CD8 T cells, but within three months clinical protection completely disappeared. Local...... (intranasal (i.n.)) immunization elicited delayed, but more lasting protection despite relatively inefficient immunization. However, by far, the most robust protection was induced by simultaneous, combined (i.n. + s.c.) vaccination, and, notably, in this case clinical protection lasted at least 8 months...... positioned in the lungs prior to challenge, but at the same time underscores an important back-up role for circulating antigen-specific cells with the capacity to expand and infiltrate the infected lungs....

  16. Acute Immune-Inflammatory Responses to a Single Bout of Aerobic Exercise in Smokers; The Effect of Smoking History and Status

    Science.gov (United States)

    Kastelein, Tegan Emma; Duffield, Rob; Marino, Frank E.

    2015-01-01

    This study examined the acute immune and inflammatory responses to exercise in smokers compared to non-smokers, and further, the effect of smoking history on these immune-inflammatory responses. Fifty-four recreationally active males who were either smokers (SM; n = 27) or non-smokers (NS; n = 27) were allocated into either young (YSM, YNS) or middle-aged groups (MSM, MNS) based on smoking status. Participants were matched for fitness and smoking habits and following familiarization and baseline testing, undertook an exercise protocol that involved 40 min of cycle ergometry at 50% of VO2peak. Venous blood was obtained pre- and post- (0 min, 1, and 4 h) exercise to measure circulating leukocytes and inflammatory markers interleukin (IL)-6, IL-1β, IL-1ra, and monocyte chemoattractant protein-1 (MCP-1). Compared to MNS, MSM showed elevated basal concentrations of MCP-1, which were increased with a longer smoking history (P exercise, YSM demonstrated an amplified IL-6 response from immediately- to 1 h-post compared to YNS. Furthermore, IL-1ra in YSM was elevated above that of YNS across all time points (P exercise leukocyte response was greater in MSM compared to YSM and non-smokers (P exercise-induced inflammatory responses noted in YSM may be indicative tobacco smoke exposure priming circulating leukocytes to amplify inflammatory responses. PMID:26779179

  17. Conserved Patterns of Microbial Immune Escape: Pathogenic Microbes of Diverse Origin Target the Human Terminal Complement Inhibitor Vitronectin via a Single Common Motif.

    Directory of Open Access Journals (Sweden)

    Teresia Hallström

    Full Text Available Pathogenicity of many microbes relies on their capacity to resist innate immunity, and to survive and persist in an immunocompetent human host microbes have developed highly efficient and sophisticated complement evasion strategies. Here we show that different human pathogens including Gram-negative and Gram-positive bacteria, as well as the fungal pathogen Candida albicans, acquire the human terminal complement regulator vitronectin to their surface. By using truncated vitronectin fragments we found that all analyzed microbial pathogens (n = 13 bound human vitronectin via the same C-terminal heparin-binding domain (amino acids 352-374. This specific interaction leaves the terminal complement complex (TCC regulatory region of vitronectin accessible, allowing inhibition of C5b-7 membrane insertion and C9 polymerization. Vitronectin complexed with the various microbes and corresponding proteins was thus functionally active and inhibited complement-mediated C5b-9 deposition. Taken together, diverse microbial pathogens expressing different structurally unrelated vitronectin-binding molecules interact with host vitronectin via the same conserved region to allow versatile control of the host innate immune response.

  18. Sero-Surveillance to assess immunity to rubella and assessment of immunogenicity and safety of a single dose of rubella vaccine in school girls

    Directory of Open Access Journals (Sweden)

    Sharma Hitt

    2010-01-01

    Full Text Available Background: Rubella vaccination is not yet included in National Immunization Schedule in India. Serosurvey is frequently used to assess epidemiologic pattern of Rubella in a community. Serosurveys in different parts of India have found that 6-47% of women are susceptible for Rubella infection. The present serosurveillance was conducted in Jammu, India, in two public schools. Objective: To determine serological status of Rubella antibodies of school girls and assessment of immunogenicity and reactogenicity of Rubella immunization in seronegative girls. Materials and Methods: The current study was conducted to determine Rubella serostatus in peripubertal schoolgirls aged 11-18 years and also to assess immunogenicity and safety of Rubella vaccine (R-Vac of Serum Institute of India Ltd., Pune, in seronegative girls. For screening, pre-vaccination serum Rubella IgG antibodies were determined and to assess immunogenicity of the vaccine, post-vaccination IgG antibodies were compared with pre-vaccination levels. Safety assessment was done for a period of 8 weeks, post-vaccination. Results: A total of 90 (32.7% seronegative girls were vaccinated. All girls (100% became seropositive, post-vaccination. Clinically relevant and statistically significant increase in anti-Rubella IgG titres was observed. The adverse events were mild and self-limiting. Conclusions: R-Vac vaccine used in the study demonstrated an excellent safety and immunogenicity profile.

  19. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  20. Innate immunity

    African Journals Online (AJOL)

    various types of pathogen recognition receptors on epithelial cells and resident cells of the innate immune system, especially macrophages, initiate a localised inflammatory response characterised by an early influx of blood neutrophils.1,2. A comparison of the major characteristics of innate and adaptive immune responses ...

  1. [Targeting the brain through the nose. Effects of intranasally administered insulin].

    Science.gov (United States)

    Brünner, Y F; Benedict, C; Freiherr, J

    2013-08-01

    The assumption that the human brain is an insulin-independent organ was disproved with the discovery of insulin receptors in the central nervous system in the year 1978. Evidence has been provided for a high density of insulin receptors in brain regions responsible for cognitive memory processes (hippocampus) and for the regulation of appetite (hypothalamus). Accordingly, in animal studies an increased insulin level in the central nervous system leads to an improvement of hippocampal memory function and a decrease of food intake. Similar results were obtained in humans using the method of intranasal administration of insulin. Intranasal insulin reaches the brain and the cerebrospinal fluid via the olfactory epithelium and olfactory nerve fiber bundles leading through the lamina cribrosa to the olfactory bulb. Thus, this method renders the investigation of specific insulin effects in humans possible. The therapeutic potential of an intranasal insulin administration for the treatment of diseases for which an imbalance of the central nervous insulin metabolism is discussed (e.g. Alzheimer's disease, diabetes mellitus and obesity) can only be estimated with the help of further clinical studies.

  2. Overcoming barriers to intranasal corticosteroid use in patients with uncontrolled allergic rhinitis

    Science.gov (United States)

    Bridgeman, Mary Barna

    2017-01-01

    Patients suffering from allergic rhinitis often attempt to self-manage their symptoms and may seek advice from pharmacists about nonprescription product choices. Several drug classes, both prescription and over-the-counter (OTC), are available, including intranasal corticosteroids (INCSs); oral, intranasal, and ocular antihistamines; leukotriene antagonists; and topical and systemic decongestants, as well as immunotherapies. Selection of the optimal treatment approach depends on the temporal pattern, frequency, and severity of symptoms as well as the patient’s age. Nasal congestion is typically the most bothersome symptom, although rhinorrhea, postnasal drip, and ocular symptoms are also problematic. Together, these symptoms may adversely impact the quality of life, work productivity, sleep quality, and the ability to perform daily activities, particularly when uncontrolled. Practice guidelines recognize that INCSs are the most effective medications for controlling allergic rhinitis symptoms, including nasal congestion. Available INCS products have comparable safety and efficacy profiles, but they differ in formulation characteristics and sensory attributes. Several barriers can impede the use of INCSs, including concerns about safety, misperceptions regarding the loss of response from frequent use, and undesirable sensations associated with intranasal administration. Given the increasing number of INCSs available OTC, pharmacists can help allay these concerns by discussing treatment expectations, recommending INCS products with favorable formulation characteristics, and reviewing proper use and technique for the administration of the selected product. These steps can help to foster a collaborative relationship between the patient and the pharmacist in the treatment of allergic rhinitis. PMID:29354557

  3. Mexico City air pollution adversely affects olfactory function and intranasal trigeminal sensitivity.

    Science.gov (United States)

    Guarneros, Marco; Hummel, Thomas; Martínez-Gómez, Margaríta; Hudson, Robyn

    2009-11-01

    Surprisingly little is known about the effects of big-city air pollution on olfactory function and even less about its effects on the intranasal trigeminal system, which elicits sensations like burning, stinging, pungent, or fresh and contributes to the overall chemosensory experience. Using the Sniffin' Sticks olfactory test battery and an established test for intranasal trigeminal perception, we compared the olfactory performance and trigeminal sensitivity of residents of Mexico City, a region with high air pollution, with the performance of a control population from the Mexican state of Tlaxcala, a geographically comparable but less polluted region. We compared the ability of 30 young adults from each location to detect a rose-like odor (2-phenyl ethanol), to discriminate between different odorants, and to identify several other common odorants. The control subjects from Tlaxcala detected 2-phenyl ethanol at significantly lower concentrations than the Mexico City subjects, they could discriminate between odorants significantly better, and they performed significantly better in the test of trigeminal sensitivity. We conclude that Mexico City air pollution impairs olfactory function and intranasal trigeminal sensitivity, even in otherwise healthy young adults.

  4. Effects of Intranasal Oxytocin Administration on Sexual Functions in Healthy Women: A Laboratory Paradigm.

    Science.gov (United States)

    Kruger, Tillmann H C; Deiter, Frank; Zhang, Yuanyuan; Jung, Stefanie; Schippert, Cordula; Kahl, Kai G; Heinrichs, Markus; Schedlowski, Manfred; Hartmann, Uwe

    2018-03-28

    The neuropeptide oxytocin (OXT) has a variety of physiological functions in maternal behavior and attachment including sexual behavior. Based on animal research and our previous human studies, we set out to investigate intranasal administration of OXT and hypothesized that OXT should be able to modulate sexual function in women. In a double-blind, placebo-controlled, crossover laboratory setting, the acute effects of intranasal administered OXT (24 international units) on sexual drive, arousal, orgasm, and refractory aspects of sexual behavior were analyzed in 27 healthy females (mean age ± SD, 27.52 ± 8.04) together with physiological parameters using vaginal photoplethysmography. Oxytocin administration showed no effect on subjective sexual parameters (eg, postorgasmic tension; P = 0.051). Physiological parameters (vaginal photoplethysmography amplitude and vaginal blood volume) showed a response pattern towards sexual arousal but were not affected by OXT. Using a well-established laboratory paradigm, we did not find that intranasal OXT influences female sexual parameters. Also, sexual drive and other functions were not affected by OXT. These findings indicate that OXT is not able to significantly increase subjective and objective parameters of sexual function in a setting with high internal validity; however, this might be different in a more naturalistic setting.

  5. The cardiovascular effects and pharmacokinetics of intranasal tetracaine plus oxymetazoline: preliminary findings.

    Science.gov (United States)

    Giannakopoulos, Helen; Levin, Lawrence M; Chou, Joli C; Cacek, Anthony T; Hutcheson, Matthew; Secreto, Stacey A; Moore, Paul A; Hersh, Elliot V

    2012-08-01

    The authors evaluated the cardiovascular effects and pharmacokinetics of an intranasal 3 percent tetracaine/0.05 percent oxymetazoline spray developed to provide needle-free anesthesia of maxillary teeth. The authors administered to 12 participants a proposed maximum recommended dose (MRD) (18 milligrams tetracaine/0.3 mg oxymetazoline) as three bilateral pairs of 0.1-milliliter nasal sprays. They administered two times this dose (36 mg tetracaine/0.6 mg oxymetazoline) as six bilateral pairs one to three weeks later. The authors recorded the patients' heart rate, blood pressure and oxygen saturation. They drew blood samples at baseline and 15 times during the two hours after drug administration. Physiological measures remained fairly stable throughout the two-hour period, with small but significant decreases (P Oxymetazoline concentrations from the two-times-MRD administration were approximately 50 percent greater than those from the MRD administration, with a half-life of 1.72 to 2.32 hours. Intranasal tetracaine/oxymetazoline mist generally was well tolerated in study participants. The safety profile and pharmacokinetics of this intranasal formulation indicate that it appears to be generally well tolerated in patients for achieving anesthesia of the maxilla. Additional safety and efficacy data are required, particularly in patients with cardiovascular disease and other comorbidities.

  6. Buccal sulcus versus intranasal approach for postoperative periorbital oedema and ecchymosis in lateral nasal osteotomy.

    Science.gov (United States)

    Ghazipour, Ali; Alani, Nadereh; Ghavami Lahiji, Shervin; Akbari Dilmaghani, Nader

    2014-10-01

    Lateral osteotomies are used in rhinoplasty to narrow the nasal bones, close the open roof deformity after hump removal, and achieve symmetry of an asymmetrical framework. But this procedure causes periorbital oedema & ecchymosis. Different techniques have been described for lateral osteotomy. To compare the postoperative ecchymosis and oedema after buccal sulcus lateral osteotomy versus intranasal lateral osteotomy. In a prospective experimental study, buccal sulcus approach was performed on the right side and an intranasal approach performed on the left side of patients randomly. Then blind analysis of postoperative photographs was performed to determine the incidence of oedema and ecchymosis on each side. Fifty patients were enrolled in the study after exclusion of unfit patients. On the right side (buccal approach osteotomies), a significantly lower incidence of upper and lower eyelid oedema and upper eyelid ecchymosis was seen on both the 2nd day and after 7th day (P ecchymosis was 2.66 (OR = 2.66, 95% CI: 1.09-5.52, p = 0.048) in intranasal group compare to buccal sulcus group. No significant complication observed. The buccal sulcus approach is a safe method for lateral osteotomy with a lower rate of postoperative oedema and ecchymosis and no significant complications. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  7. Intranasal oxytocin increases neural responses to social reward in post-traumatic stress disorder.

    Science.gov (United States)

    Nawijn, Laura; van Zuiden, Mirjam; Koch, Saskia B J; Frijling, Jessie L; Veltman, Dick J; Olff, Miranda

    2017-02-01

    Therapeutic alliance and perceived social support are important predictors of treatment response for post-traumatic stress disorder (PTSD). Intranasal oxytocin administration may enhance treatment response by increasing sensitivity for social reward and thereby therapeutic alliance and perceived social support. As a first step to investigate this therapeutical potential, we investigated whether intranasal oxytocin enhances neural sensitivity to social reward in PTSD patients. Male and female police officers with (n = 35) and without PTSD (n = 37) were included in a double-blind, randomized, placebo-controlled cross-over fMRI study. After intranasal oxytocin (40 IU) and placebo administration, a social incentive delay task was conducted to investigate neural responses during social reward and punishment anticipation and feedback. Under placebo, PTSD patients showed reduced left anterior insula (AI) responses to social rewards (i.e. happy faces) compared with controls. Oxytocin administration increased left AI responses during social reward in PTSD patients, such that PTSD patients no longer differed from controls under placebo. Furthermore, in PTSD patients, oxytocin increased responses to social reward in the right putamen. By normalizing abberant insula responses and increasing putamen responses to social reward, oxytocin administration may enhance sensitivity for social support and therapeutic alliance in PTSD patients. Future studies are needed to investigate clinical effects of oxytocin. © The Author (2016). Published by Oxford University Press.

  8. Mucosal immunization confers long-term protection against intragastrically established Neospora caninum infection.

    Science.gov (United States)

    Ferreirinha, Pedro; Correia, Alexandra; Teixeira-Coelho, Maria; Osório, Hugo; Teixeira, Luzia; Rocha, António; Vilanova, Manuel

    2016-12-07

    Neospora caninum is an obligate intracellular protozoan parasite responsible for heavy economic losses in dairy and beef cattle farms worldwide. Although vaccination is widely regarded as the preferable strategy to prevent neosporosis no commercial vaccine is currently available. We have previously shown that intranasal immunization with an N. caninum antigen extract enriched in hydrophobic proteins plus CpG adjuvant protected mice against intragastrically established neosporosis. Nevertheless, the antigen specificity as well as the long-term protective effect of this immunization strategy were not determined. Here, we show that the protective effect of this intranasal immunization procedure lasted for at least 20weeks. Protection was accompanied by long-lasting elevated levels of parasite-specific serum IgG and intestinal IgA. Moreover, spleen and mesenteric lymph node cells obtained from non-infected long-term immunized mice responded by producing interferon-γ following in vitro parasite-antigen recall. Analysis of serum IgG and intestinal IgA antibody reactivity in immunized mice identified dense granule antigen 7 (NcGRA7) and microneme associated protein 1 (NcMIC1) as immunodominant antigens respectively recognized by those antibody fractions. In summary, this work shows that a previously reported mucosal immunization strategy against N. caninum infection established through the gastrointestinal tract is effective in the long term. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A single cidofovir treatment rescues animals at progressive stages of lethal orthopoxvirus disease

    Directory of Open Access Journals (Sweden)

    Israely Tomer

    2012-06-01

    Full Text Available Abstract Background In an event of a smallpox outbreak in humans, the window for efficacious treatment by vaccination with vaccinia viruses (VACV is believed to be limited to the first few days post-exposure (p.e.. We recently demonstrated in a mouse model for human smallpox, that active immunization 2–3 days p.e. with either VACV-Lister or modified VACV Ankara (MVA vaccines, can rescue animals from lethal challenge of ectromelia virus (ECTV, the causative agent of mousepox. The present study was carried out in order to determine whether a single dose of the anti-viral cidofovir (CDV, administered at different times and doses p.e. either alone or in conjunction with active vaccination, can rescue ECTV infected mice. Methods Animals were infected intranasally with ECTV, treated on different days with various single CDV doses and monitored for morbidity, mortality and humoral response. In addition, in order to determine the influence of CDV on the immune response following vaccination, both the "clinical take”, IFN-gamma and IgG Ab levels in the serum were evaluated as well as the ability of the mice to withstand a lethal challenge of ECTV. Finally the efficacy of a combined treatment regime of CDV and vaccination p.e. was determined. Results A single p.e. CDV treatment is sufficient for protection depending on the initiation time and dose (2.5 – 100 mg/kg of treatment. Solid protection was achieved by a low dose (5 mg/kg CDV treatment even if given at day 6 p.e., approximately 4 days before death of the control infected untreated mice (mean time to death (MTTD 10.2. At the same time point complete protection was achieved by single treatment with higher doses of CDV (25 or 100 mg/kg. Irrespective of treatment dose, all surviving animals developed a protective immune response even when the CDV treatment was initiated one day p.e.. After seven days post treatment with the highest dose (100 mg/kg, virus was still detected in some

  10. Endocine™, N3OA and N3OASq; three mucosal adjuvants that enhance the immune response to nasal influenza vaccination.

    Directory of Open Access Journals (Sweden)

    Tina Falkeborn

    Full Text Available Annual outbreaks of seasonal influenza are controlled or prevented through vaccination in many countries. The seasonal vaccines used are either inactivated, currently administered parenterally, or live-attenuated given intranasally. In this study three mucosal adjuvants were examined for the influence on the humoral (mucosal and systemic and cellular influenza A-specific immune responses induced by a nasally administered vaccine. We investigated in detail how the anionic Endocine™ and the cationic adjuvants N3OA and N3OASq mixed with a split inactivated influenza vaccine induced influenza A-specific immune responses as compared to the vaccine alone after intranasal immunization. The study showed that nasal administration of a split virus vaccine together with Endocine™ or N3OA induced significantly higher humoral and cell-mediated immune responses than the non-adjuvanted vaccine. N3OASq only significantly increased the cell-mediated immune response. Furthermore, nasal administration of the influenza vaccine in combination with any of the adjuvants; Endocine™, N3OA or N3OASq, significantly enhanced the mucosal immunity against influenza HA protein. Thus the addition of these mucosal adjuvants leads to enhanced immunity in the most relevant tissues, the upper respiratory tract and the systemic circulation. Nasal influenza vaccination with an inactivated split vaccine can therefore provide an important mucosal immune response, which is often low or absent after traditional parenteral vaccination.

  11. Immunity booster

    International Nuclear Information System (INIS)

    Stefanescu, Ioan; Titescu, Gheorghe; Tamaian, Radu; Haulica, Ion; Bild, Walther

    2002-01-01

    The immunity booster is, according to its patent description, microbiologically pure water with an D/(D+H) isotopic concentration of 100 ppm, with physical-chemical characteristics similar to those of distilled water. It is obtained by sterilization of a mixture of deuterium depleted water, with a 25 ppm isotopic concentration, with distilled water in a volume ratio of 4:6. Unlike natural immunity boosters (bacterial agents as Bacillus Chalmette-Guerin, Corynebacterium parvum; lipopolysaccharides; human immunoglobulin) or synthetical products (levamysol; isoprinosyne with immunostimulating action), which cause hypersensitivity and shocks, thrill, fever, sickness and the immunity complex disease, the water of 100 ppm D/(D + H) isotopic concentration is a toxicity free product. The testing for immune reaction of the immunity booster led to the following results: - an increase of cell action capacity in the first immunity shielding stage (macrophages), as evidenced by stimulation of a number of essential characterizing parameters, as well as of the phagocytosis capacity, bactericide capacity, and opsonic capacity of serum; - an increase of the number of leucocyte particularly of the granulocyte in peripheral blood, produced especially when medullar toxic agents like caryolysine are used; - it hinders the effect of lowering the number of erythrocytes in peripheral blood produced by experimentally induced chronic inflammation; - an increase of nonspecific immunity defence capacity against specific bacterial aggression of both Gram-positive bacteria (Streptococcus pneumoniae 558 ) and of the Gram-negative ones (Klebsiella pneumoniae 507 ); - an increase of immunity - stimulating activity (proinflamatory), like that of levamisole as evidenced by the test of stimulation of experimentally induced inflammation by means of carrageenan. The following advantages of the immunity booster are stressed: - it is toxicity free and side effect free; - can be orally administrated as

  12. A Single 17D Yellow Fever Vaccination Provides Lifelong Immunity; Characterization of Yellow-Fever-Specific Neutralizing Antibody and T-Cell Responses after Vaccination

    NARCIS (Netherlands)

    Wieten, Rosanne W.; Jonker, Emile F. F.; van Leeuwen, Ester M. M.; Remmerswaal, Ester B. M.; ten Berge, Ineke J. M.; de Visser, Adriëtte W.; van Genderen, Perry J. J.; Goorhuis, Abraham; Visser, Leo G.; Grobusch, Martin P.; de Bree, Godelieve J.

    2016-01-01

    Prompted by recent amendments of Yellow Fever (YF) vaccination guidelines from boost to single vaccination strategy and the paucity of clinical data to support this adjustment, we used the profile of the YF-specific CD8+ T-cell subset profiles after primary vaccination and neutralizing antibodies as

  13. Naegleria fowleri immunization modifies lymphocytes and APC of nasal mucosa.

    Science.gov (United States)

    Carrasco-Yepez, M M; Campos-Rodríguez, R; Reséndiz-Albor, A A; Peña-Juárez, C; Contis-Montes de Oca, A; Arciniega-Martínez, I M; Bonilla-Lemus, P; Rojas-Hernandez, S

    2018-03-01

    We investigated whether intranasal immunization with amoebic lysates plus cholera toxin modified the populations of T and B lymphocytes, macrophages and dendritic cells by flow cytometry from nose-associated lymphoid tissue (NALT), cervical lymph nodes (CN), nasal passages (NP) and spleen (SP). In all immunized groups, the percentage of CD4 was higher than CD8 cells. CD45 was increased in B cells from mice immunized. We observed IgA antibody-forming cell (IgA-AFC) response, mainly in NALT and NP. Macrophages from NP and CN expressed the highest levels of CD80 and CD86 in N. fowleri lysates with either CT or CT alone immunized mice, whereas dendritic cells expressed high levels of CD80 and CD86 in all compartment from immunized mice. These were lower than those expressed by macrophages. Only in SP from CT-immunized mice, these costimulatory molecules were increased. These results suggest that N. fowleri and CT antigens are taking by APCs, and therefore, protective immunity depends on interactions between APCs and T cells from NP and CN. Consequently, CD4 cells stimulate the differentiation from B lymphocytes to AFC IgA-positive; antibody that we previously found interacting with trophozoites in the nasal lumen avoiding the N. fowleri attachment to nasal epithelium. © 2017 John Wiley & Sons Ltd.

  14. Sublingual immunization with a live attenuated influenza a virus lacking the nonstructural protein 1 induces broad protective immunity in mice.

    Directory of Open Access Journals (Sweden)

    Hae-Jung Park

    Full Text Available The nonstructural protein 1 (NS1 of influenza A virus (IAV enables the virus to disarm the host cell type 1 IFN defense system. Mutation or deletion of the NS1 gene leads to attenuation of the virus and enhances host antiviral response making such live-attenuated influenza viruses attractive vaccine candidates. Sublingual (SL immunization with live influenza virus has been found to be safe and effective for inducing protective immune responses in mucosal and systemic compartments. Here we demonstrate that SL immunization with NS1 deleted IAV (DeltaNS1 H1N1 or DeltaNS1 H5N1 induced protection against challenge with homologous as well as heterosubtypic influenza viruses. Protection was comparable with that induced by intranasal (IN immunization and was associated with high levels of virus-specific antibodies (Abs. SL immunization with DeltaNS1 virus induced broad Ab responses in mucosal and systemic compartments and stimulated immune cells in mucosa-associated and systemic lymphoid organs. Thus, SL immunization with DeltaNS1 offers a novel potential vaccination strategy for the control of influenza outbreaks including pandemics.

  15. Sublingual immunization with a live attenuated influenza a virus lacking the nonstructural protein 1 induces broad protective immunity in mice.

    Science.gov (United States)

    Park, Hae-Jung; Ferko, Boris; Byun, Young-Ho; Song, Joo-Hye; Han, Gye-Yeong; Roethl, Elisabeth; Egorov, Andrej; Muster, Thomas; Seong, Baiklin; Kweon, Mi-Na; Song, Manki; Czerkinsky, Cecil; Nguyen, Huan H

    2012-01-01

    The nonstructural protein 1 (NS1) of influenza A virus (IAV) enables the virus to disarm the host cell type 1 IFN defense system. Mutation or deletion of the NS1 gene leads to attenuation of the virus and enhances host antiviral response making such live-attenuated influenza viruses attractive vaccine candidates. Sublingual (SL) immunization with live influenza virus has been found to be safe and effective for inducing protective immune responses in mucosal and systemic compartments. Here we demonstrate that SL immunization with NS1 deleted IAV (DeltaNS1 H1N1 or DeltaNS1 H5N1) induced protection against challenge with homologous as well as heterosubtypic influenza viruses. Protection was comparable with that induced by intranasal (IN) immunization and was associated with high levels of virus-specific antibodies (Abs). SL immunization with DeltaNS1 virus induced broad Ab responses in mucosal and systemic compartments and stimulated immune cells in mucosa-associated and systemic lymphoid organs. Thus, SL immunization with DeltaNS1 offers a novel potential vaccination strategy for the control of influenza outbreaks including pandemics.

  16. Time course of immune system status in rats during adaptation to single and fractionated external low-level gamma-radiation

    International Nuclear Information System (INIS)

    Sambur, M.B.; Mel'nikov, O.F.; Timchenko, S.V.; Timchenko, M.D.

    1994-01-01

    The content of serum corticosterone so as immunological and nonspecific reactivity in rats exposed to single or fractionated gamma-radiation (0.35 Gy) were studied during 1 month. It has been revealed that corticosteron level, dynamics of absolute amount of leucocytes, lymphocytes, Rc-receptor-bearing cells in blood, relative content of FcR + -cells in bone marrow, spleen and peripheral lymph nodes of irradiated animals depend on the scheme of irradiation. Single irradiation didn't significantly influence natural and antibody-dependent killer cells activity and basal chemiluminescence level of polymorphonuclear cells, while the fractionated irradiation in equal dose induced considerable fluctuations of these parameters. The direction and intensity of the disturbance depend on the time after irradiation

  17. Single dose of glycoengineered anti-CD19 antibody (MEDI551) disrupts experimental autoimmune encephalomyelitis by inhibiting pathogenic adaptive immune responses in the bone marrow and spinal cord while preserving peripheral regulatory mechanisms.

    Science.gov (United States)

    Chen, Ding; Blazek, Monica; Ireland, Sara; Ortega, Sterling; Kong, Xiangmei; Meeuwissen, Anouk; Stowe, Ann; Carter, Laura; Wang, Yue; Herbst, Ronald; Monson, Nancy L

    2014-11-15

    Plasma cells and the autoreactive Abs they produce are suspected to contribute to the pathogenesis of multiple sclerosis, but recent attempts to target these components of humoral immunity have failed. MEDI551, an anti-CD19 Ab that depletes mature B cells including plasma cells may offer a compelling alternative that reduces pathogenic adaptive immune responses while sparing regulatory mechanisms. Indeed, our data demonstrate that a single dose of MEDI551, given before or during ongoing experimental autoimmune encephalomyelitis, disrupts development of the disease. Leukocyte infiltration into the spinal cord is significantly reduced, as well as short-lived and long-lived autoreactive CD138(+) plasma cells in the spleen and bone marrow, respectively. In addition, potentially protective CD1d(hi)CD5(+) regulatory B cells show resistance to depletion, and myelin-specific Foxp3(+) regulatory T cells are expanded. Taken together, these results demonstrate that MEDI551 disrupts experimental autoimmune encephalomyelitis by inhibiting multiple proinflammatory components whereas preserving regulatory populations. Copyright © 2014 by The American Association of Immunologists, Inc.

  18. Microbiota is an essential element for mice to initiate a protective immunity against Vaccinia virus.

    Science.gov (United States)

    Lima, Maurício T; Andrade, Ana C S P; Oliveira, Graziele P; Calixto, Rafael S; Oliveira, Danilo B; Souza, Éricka L S; Trindade, Giliane S; Nicoli, Jacques R; Kroon, Erna G; Martins, Flaviano S; Abrahão, Jônatas S

    2016-02-01

    The gastrointestinal tract of vertebrates harbors one of the most complex ecosystems known in microbial ecology and this indigenous microbiota almost always has a profound influence on host-parasite relationships, which can enhance or reduce the pathology of the infection. In this context, the impact of the microbiota during the infection of several viral groups remains poorly studied, including the family Poxviridae. Vaccinia virus (VACV) is a member of this family and is the causative agent of bovine vaccinia, responsible for outbreaks that affect bovines and humans. To determine the influence of the microbiota in the development of the disease caused by VACV, a comparative study using a murine model was performed. Germ-free and conventional, 6- to 7-week-old Swiss NIH mice were infected by tail scarification and intranasally with VACV. Moreover, immunosuppression and microbiota reposition were performed, to establish the interactions among the host's immune system, microbiota and VACV. The data demonstrate that the microbiota is essential for the effective immune response of mice against VACV in intranasal inoculation and to control the virus at the primary site of infection. Furthermore, this study is the first to show that Swiss conventional mice are refractory to the intranasal infection of VACV. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Long-Term Single-Dose Efficacy of a Vesicular Stomatitis Virus-Based Andes Virus Vaccine in Syrian Hamsters

    Directory of Open Access Journals (Sweden)

    Joseph Prescott

    2014-01-01

    Full Text Available Andes virus (ANDV is highly pathogenic in humans and is the primary etiologic agent of hantavirus cardiopulmonary syndrome (HCPS in South America. Case-fatality rates are as high as 50% and there are no approved vaccines or specific therapies for infection. Our laboratory has recently developed a replication-competent recombinant vesicular stomatitis virus (VSV-based vaccine that expressed the glycoproteins of Andes virus in place of the native VSV glycoprotein (G. This vaccine is highly efficacious in the Syrian hamster model of HCPS when given 28 days before challenge with ANDV, or when given around the time of challenge (peri-exposure, and even protects when administered post-exposure. Herein, we sought to test the durability of the immune response to a single dose of this vaccine in Syrian hamsters. This vaccine was efficacious in hamsters challenged intranasally with ANDV 6 months after vaccination (p = 0.025, but animals were not significantly protected following 1 year of vaccination (p = 0.090. The decrease in protection correlated with a reduction of measurable neutralizing antibody responses, and suggests that a more robust vaccination schedule might be required to provide long-term immunity.

  20. A 0.18 micrometer CMOS Thermopile Readout ASIC Immune to 50 MRAD Total Ionizing Dose (SI) and Single Event Latchup to 174MeV-cm(exp 2)/mg

    Science.gov (United States)

    Quilligan, Gerard T.; Aslam, Shahid; Lakew, Brook; DuMonthier, Jeffery J.; Katz, Richard B.; Kleyner, Igor

    2014-01-01

    Radiation hardened by design (RHBD) techniques allow commercial CMOS circuits to operate in high total ionizing dose and particle fluence environments. Our radiation hard multi-channel digitizer (MCD) ASIC (Figure 1) is a versatile analog system on a chip (SoC) fabricated in 180nm CMOS. It provides 18 chopper stabilized amplifier channels, a 16- bit sigma-delta analog-digital converter (SDADC) and an on-chip controller. The MCD was evaluated at Goddard Space Flight Center and Texas A&M University's radiation effects facilities and found to be immune to single event latchup (SEL) and total ionizing dose (TID) at 174 MeV-cm(exp 2)/mg and 50 Mrad (Si) respectively.

  1. Intranasal inoculation of white-tailed deer (Odocoileus virginianus with lyophilized chronic wasting disease prion particulate complexed to montmorillonite clay.

    Directory of Open Access Journals (Sweden)

    Tracy A Nichols

    Full Text Available Chronic wasting disease (CWD, the only known prion disease endemic in wildlife, is a persistent problem in both wild and captive North American cervid populations. This disease continues to spread and cases are found in new areas each year. Indirect transmission can occur via the environment and is thought to occur by the oral and/or intranasal route. Oral transmission has been experimentally demonstrated and although intranasal transmission has been postulated, it has not been tested in a natural host until recently. Prions have been shown to adsorb strongly to clay particles and upon oral inoculation the prion/clay combination exhibits increased infectivity in rodent models. Deer and elk undoubtedly and chronically inhale dust particles routinely while living in the landscape while foraging and rutting. We therefore hypothesized that dust represents a viable vehicle for intranasal CWD prion exposure. To test this hypothesis, CWD-positive brain homogenate was mixed with montmorillonite clay (Mte, lyophilized, pulverized and inoculated intranasally into white-tailed deer once a week for 6 weeks. Deer were euthanized at 95, 105, 120 and 175 days post final inoculation and tissues examined for CWD-associated prion proteins by immunohistochemistry. Our results demonstrate that CWD can be efficiently transmitted utilizing Mte particles as a prion carrier and intranasal exposure.

  2. Sedation and physiologic response to manual restraint after intranasal administration of midazolam in Hispaniolan Amazon parrots (Amazona ventralis).

    Science.gov (United States)

    Mans, Christoph; Guzman, David Sanchez-Migallon; Lahner, Lesanna L; Paul-Murphy, Joanne; Sladky, Kurt K

    2012-09-01

    Administration of intranasal midazolam (2 mg/kg) was evaluated for sedation and effects on cloacal temperature, respiratory rate, and heart rate in manually restrained Hispaniolan Amazon parrots (Amazona ventralis). Adult parrots (n=9) were administered either midazolam (2 mg/kg) or an equal volume of saline solution intranasally before a 15-minute manual restraint in a complete crossover study. Respiratory rate and sedation scores were recorded before and during capture and during and after 15 minutes of manual restraint. Heart rate and cloacal temperature were recorded during manual restraint. After restraint, the parrots received intranasal flumazenil (0.05 mg/kg) or an equal volume of saline solution, and the recovery time was recorded. In those birds that received midazolam, sedation was observed within 3 minutes of administration, and vocalization, flight, and defense responses were significantly reduced during capture. During manual restraint, the mean rate of cloacal temperature increase was significantly slower and remained significantly lower in birds that received midazolam compared with controls. Mean respiratory rates were significantly lower for up to 12 minutes in parrots that received midazolam compared with those receiving saline solution. Flumazenil antagonized the effects of midazolam within 10 minutes. No overt clinical adverse effects to intranasal midazolam and flumazenil administration were observed. Further studies on the safety of intranasal midazolam and flumazenil in this species are warranted.

  3. Immunization with Bivalent Flagellin Protects Mice against Fatal Pseudomonas aeruginosa Pneumonia

    Directory of Open Access Journals (Sweden)

    Bahador Behrouz

    2017-01-01

    Full Text Available Pseudomonas aeruginosa lung infections present a major challenge to healthcare systems worldwide because they are commonly associated with high morbidity and mortality. Here, we demonstrate the protective efficacy of type a and b flagellins (bivalent flagellin against acute fatal pneumonia in mice. Mice immunized intranasally with a bivalent flagellin vaccine were challenged by different flagellated strains of P. aeruginosa in an acute pneumonia model. Besides the protective effect of the vaccine, we further measured the host innate and cellular immunity responses. The immunized mice in our study were protected against both strains. Remarkably, active immunization with type a or b flagellin significantly improved survival of mice against heterologous strain compared to flagellin a or b antisera. We also showed that after an intranasal challenge by P. aeruginosa strain, neutrophils are recruited to the airways of vaccinated mice, and that the bivalent flagellin vaccine was proved to be protective by the generated CD4+IL-17+ Th17 cells. In conclusion, bivalent flagellin vaccine can confer protection against different strains of P. aeruginosa in an acute pneumonia mouse model by eliciting effective cellular and humoral immune responses, including increased IL-17 production and improved opsonophagocytic killing.

  4. Immunity to Fish Rhabdoviruses

    Directory of Open Access Journals (Sweden)

    Maureen K. Purcell

    2012-01-01

    Full Text Available Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M protein to mediate host-cell shutoff and the non‑virion (NV protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  5. Immunity to Fish Rhabdoviruses

    Science.gov (United States)

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals. PMID:22355456

  6. Immunity to fish rhabdoviruses.

    Science.gov (United States)

    Purcell, Maureen K; Laing, Kerry J; Winton, James R

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  7. Safety and Immunogenicity of Seven Dosing Regimens of the Candidate RTS,S/AS01E Malaria Vaccine Integrated Within an Expanded Program on Immunization Regimen: A Phase II, Single-Center, Open, Controlled Trial in Infants in Malawi.

    Science.gov (United States)

    Witte, Desiree; Cunliffe, Nigel A; Turner, Ann M; Ngulube, Edward; Ofori-Anyinam, Opokua; Vekemans, Johan; Chimpeni, Philips; Lievens, Marc; Wilson, Trevor P; Njiram'madzi, Jenala; Mendoza, Yolanda Guerra; Leach, Amanda

    2018-05-01

    In a phase III trial, the RTS,S/AS01 malaria vaccine produced lower anti-circumsporozoite (CS) antibody titers when co-administered with Expanded Programme on Immunization vaccines (0-, 1- and 2-month schedule) at 6 to 12 weeks compared with 5 to 17 months at first vaccination. Alternative infant immunization schedules within the Expanded Programme on Immunization were investigated. This phase II, open, single-site (Blantyre, Malawi) trial was conducted in infants 1 to 7 days of age. Subjects were equally randomized across 7 groups to receive 3 doses of RTS,S/AS01E at time points that included ≤7 days, 6, 10, 14 and 26 weeks, and 9 months. All RTS,S/AS01E groups plus a control group (without RTS,S/AS01E) received Bacillus Calmette-Guérin + oral poliovirus vaccine at ≤7 days, diphtheria, tetanus, whole-cell pertussis, hepatitis B and Haemophilus influenzae type b vaccine + oral poliovirus vaccine at 6, 10, and 14 weeks and measles vaccine at 9 months; one RTS,S/AS01E group and the control additionally received hepatitis B vaccination at ≤7 days. Serum anti-CS antibody geometric mean concentration (GMC; enzyme-linked immunosorbent assay) and safety were assessed up to age 18 months. Of the 480 infants enrolled, 391 completed the study. No causally related serious adverse event was reported. A higher frequency of fever within 7 days of RTS,S/AS01E vaccination compared with control was observed. Compared with the standard 6-, 10-, 14-week schedule, anti-CS antibody GMC ratios post-dose 3 were significantly higher in the 10-, 14- and 26-week group only (ratio 1.80; 95% confidence interval, 1.24-2.60); RTS,S/AS01E vaccination at ≤7 days and 10 and 14 weeks produced significantly lower anti-CS GMCs (ratio 0.59; 95% confidence interval, 0.38-0.92). Initiation of RTS,S/AS01E vaccination above 6 weeks of age tended to improve anti-CS antibody responses. Neonatal vaccination was well tolerated but produced a comparatively lower immune response.

  8. A Single Meal Containing Raw, Crushed Garlic Influences Expression of Immunity- and Cancer-Related Genes in Whole Blood of Humans.

    Science.gov (United States)

    Charron, Craig S; Dawson, Harry D; Albaugh, George P; Solverson, Patrick M; Vinyard, Bryan T; Solano-Aguilar, Gloria I; Molokin, Aleksey; Novotny, Janet A

    2015-11-01

    Preclinical and epidemiologic studies suggest that garlic intake is inversely associated with the progression of cancer and cardiovascular disease. We designed a study to probe the mechanisms of garlic action in humans. We conducted a randomized crossover feeding trial in which 17 volunteers consumed a garlic-containing meal (100 g white bread, 15 g butter, and 5 g raw, crushed garlic) or a garlic-free control meal (100 g white bread and 15 g butter) after 10 d of consuming a controlled, garlic-free diet. Blood was collected before and 3 h after test meal consumption for gene expression analysis in whole blood. Illumina BeadArray was used to screen for genes of interest, followed by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) on selected genes. To augment human study findings, Mono Mac 6 cells were treated with a purified garlic extract (0.5 μL/mL), and mRNA was measured by qRT-PCR at 0, 3, 6, and 24 h. The following 7 genes were found to be upregulated by garlic intake: aryl hydrocarbon receptor (AHR), aryl hydrocarbon receptor nuclear translocator (ARNT), hypoxia-inducible factor 1α (HIF1A), proto-oncogene c-Jun (JUN), nuclear factor of activated T cells (NFAT) activating protein with immunoreceptor tyrosine-based activation motif 1 (NFAM1), oncostatin M (OSM), and V-rel avian reticuloendotheliosis viral oncogene homolog (REL). Fold-increases in mRNA transcripts ranged from 1.6 (HIF1A) to 3.0 (NFAM1) (P garlic, respectively). OSM is a pleiotropic cytokine that inhibits several tumor cell lines in culture. These data indicate that the bioactivity of garlic is multifaceted and includes activation of genes related to immunity, apoptosis, and xenobiotic metabolism in humans and Mono Mac 6 cells. This trial is registered at clinicaltrials.gov as NCT01293591. © 2015 American Society for Nutrition.

  9. A Single Meal Containing Raw, Crushed Garlic Influences Expression of Immunity- and Cancer-Related Genes in Whole Blood of Humans1234

    Science.gov (United States)

    Charron, Craig S; Dawson, Harry D; Albaugh, George P; Solverson, Patrick M; Vinyard, Bryan T; Solano-Aguilar, Gloria I; Molokin, Aleksey; Novotny, Janet A

    2015-01-01

    Background: Preclinical and epidemiologic studies suggest that garlic intake is inversely associated with the progression of cancer and cardiovascular disease. Objective: We designed a study to probe the mechanisms of garlic action in humans. Methods: We conducted a randomized crossover feeding trial in which 17 volunteers consumed a garlic-containing meal (100 g white bread, 15 g butter, and 5 g raw, crushed garlic) or a garlic-free control meal (100 g white bread and 15 g butter) after 10 d of consuming a controlled, garlic-free diet. Blood was collected before and 3 h after test meal consumption for gene expression analysis in whole blood. Illumina BeadArray was used to screen for genes of interest, followed by real-time quantitative reverse transcriptase–polymerase chain reaction (qRT-PCR) on selected genes. To augment human study findings, Mono Mac 6 cells were treated with a purified garlic extract (0.5 μL/mL), and mRNA was measured by qRT-PCR at 0, 3, 6, and 24 h. Results: The following 7 genes were found to be upregulated by garlic intake: aryl hydrocarbon receptor (AHR), aryl hydrocarbon receptor nuclear translocator (ARNT), hypoxia-inducible factor 1α (HIF1A), proto-oncogene c-Jun (JUN), nuclear factor of activated T cells (NFAT) activating protein with immunoreceptor tyrosine-based activation motif 1 (NFAM1), oncostatin M (OSM), and V-rel avian reticuloendotheliosis viral oncogene homolog (REL). Fold-increases in mRNA transcripts ranged from 1.6 (HIF1A) to 3.0 (NFAM1) (P garlic, respectively). OSM is a pleiotropic cytokine that inhibits several tumor cell lines in culture. Conclusion: These data indicate that the bioactivity of garlic is multifaceted and includes activation of genes related to immunity, apoptosis, and xenobiotic metabolism in humans and Mono Mac 6 cells. This trial is registered at clinicaltrials.gov as NCT01293591. PMID:26423732

  10. Nasal mucosal blood flow after intranasal allergen challenge

    International Nuclear Information System (INIS)

    Holmberg, K.; Bake, B.; Pipkorn, U.

    1988-01-01

    The nasal mucosal blood flow in patients with allergic rhinitis was determined at nasal allergen challenges with the 133 Xenon washout method. Determinations were made in 12 subjects before and 15 minutes after challenge with diluent and increasing doses of allergen. The time course was followed in eight subjects by means of repeated measurements during 1 hour after a single allergen dose. Finally, the blood flow was measured after unilateral allergen challenge in the contralateral nasal cavity. A dose-dependent decrease in blood flow was found after nasal challenge with increasing doses of allergens, whereas challenge with diluent alone did not induce any changes. The highest allergen dose, which also induced pronounced nasal symptoms, resulted in a decrease in blood flow of 25% (p less than 0.001). The time-course study demonstrated a maximum decrease in blood flow 10 to 20 minutes after challenge and then a gradual return to baseline. Unilateral allergen challenge resulted in a decrease in blood flow in the contralateral, unchallenged nasal cavity, suggesting that part of the allergen-induced changes in blood flow were reflex mediated

  11. Radiographic findings in cats with intranasal neoplasia or chronic rhinitis: 29 cases (1982-1988)

    International Nuclear Information System (INIS)

    O'Brien, R.T.; Evans, S.M.; Wortman, J.A.; Hendrick, M.J.

    1996-01-01

    Objective: To compare radiographic findings and determine useful criteria to differentiate between intranasal neoplasia and chronic rhinitis in cats. Design: Retrospective study. Animals: Cats with chronic nasal disease caused by neoplasia (n = 18) or by chronic rhinitis (n = 11). Procedure: Radiographs were reviewed by 3 radiologists, followed by group review. Diagnosis was determined by intranasal biopsy or necropsy, and specimens were reviewed by a pathologist to confirm cause and histologic diagnosis. Results: Lymphosarcoma was the most common (n = 5) of the 6 histopathologic types in the neoplasia group. Cats in the neoplasia and chronic rhinitis groups had a high prevalence of aggressive radiographic lesions. Prevalence of a facial mass in cats with neoplasia (8/18) versus in those with chronic rhinitis (4/11) and of deviation (9/18 vs 6/11, respectively) or lysis (12/18 vs 7/11) of the nasal septum was similar. However, significantly (P = 0.02) more cats with neoplasia than with chronic rhinitis (13/16 vs 3/7, respectively) had unilateral turbinate destruction/lysis. Additionally, unilateral lateral bone erosion and loss of teeth associated with adjacent intranasal disease were more prevalent in cats with neoplasia (7/8 and 5/18, respectively) than in cats with chronic rhinitis (1/3 and 0/11, respectively). Clinical Implications: Features that may assist in radiographic diagnosis of neoplasia include the appearance of unilateral aggressive lesions, such as lysis of lateral bones, nasal turbinate destruction, and loss of teeth. Bilaterally symmetric lesions are more suggestive of chronic rhinitis than of neoplasia

  12. Effect of intranasal manganese administration on neurotransmission and spatial learning in rats

    Energy Technology Data Exchange (ETDEWEB)

    Blecharz-Klin, Kamilla; Piechal, Agnieszka; Joniec-Maciejak, Ilona; Pyrzanowska, Justyna; Widy-Tyszkiewicz, Ewa, E-mail: etyszkiewicz@wum.edu.pl

    2012-11-15

    The effect of intranasal manganese chloride (MnCl{sub 2}·4H{sub 2}O) exposure on spatial learning, memory and motor activity was estimated in Morris water maze task in adult rats. Three-month-old male Wistar rats received for 2 weeks MnCl{sub 2}·4H{sub 2}O at two doses the following: 0.2 mg/kg b.w. (Mn0.2) or 0.8 mg/kg b.w. (Mn0.8) per day. Control (Con) and manganese-exposed groups were observed for behavioral performance and learning in water maze. ANOVA for repeated measurements did not show any significant differences in acquisition in the water maze between the groups. However, the results of the probe trial on day 5, exhibited spatial memory deficits following manganese treatment. After completion of the behavioral experiment, the regional brain concentrations of neurotransmitters and their metabolites were determined via HPLC in selected brain regions, i.e. prefrontal cortex, hippocampus and striatum. ANOVA demonstrated significant differences in the content of monoamines and metabolites between the treatment groups compared to the controls. Negative correlations between platform crossings on the previous platform position in Southeast (SE) quadrant during the probe trial and neurotransmitter turnover suggest that impairment of spatial memory and cognitive performance after manganese (Mn) treatment is associated with modulation of the serotonergic, noradrenergic and dopaminergic neurotransmission in the brain. These findings show that intranasally applied Mn can impair spatial memory with significant changes in the tissue level and metabolism of monoamines in several brain regions. -- Highlights: ► Intranasal exposure to manganese in rats impairs spatial memory in the water maze. ► Regional changes in levels of neurotransmitters in the brain have been identified. ► Cognitive disorder correlates with modulation of 5-HT, NA and DA neurotransmission.

  13. The acute effects of intranasal oxytocin administration on endocrine and sexual function in males.

    Science.gov (United States)

    Burri, Andrea; Heinrichs, Markus; Schedlowski, Manfred; Kruger, Tillmann H C

    2008-06-01

    The role of the neuropeptide oxytocin (OT) ranges from the modulation of neuroendocrine physiological effects to the establishment of complex social and bonding behaviours. Experimental studies in animals, as well as case reports in humans, suggest that OT affects different aspects of sexual behaviour and has predominantly facilitating properties for sexual appetence and performance. Using a previously established experimental paradigm of sexual arousal and masturbation-induced orgasm, this study investigated the acute effects of intranasal OT application (24I.U.) on endocrine parameters and measures of sexual appetence and function in healthy men (n=10). In a double-blind, placebo-controlled, balanced cross-over design, sexual arousal, and orgasm were induced by an erotic film and masturbation. In addition to the continuous recording of endocrine (OT, cortisol, prolactin, epinephrine, norepinephrine) and cardiovascular data (heart rate), parameters of appetitive, consummatory, and refractory sexual behaviour were assessed using the acute sexual experience scale (ASES). OT plasma levels were significantly elevated after intranasal OT throughout the whole experiment (>60 min). In addition, OT treatment induced significantly higher increases in epinephrine plasma levels during sexual activity without affecting cortisol levels, prolactin levels or heart rate. OT treatment did not alter appetitive, consummatory, and refractory sexual behaviour according to the ASES. However, when subjects were asked about their subjective perception of whether OT or placebo had been applied, eight out of 10 subjects in the OT group answered correctly, thus pointing to an altered perception of arousal. In conclusion, intranasally administered OT leads to a marked increase in OT plasma levels together with increased secretion of catecholamines when subjects are engaged in sexual activity in a laboratory setting. As the effects of OT on sexual behaviour were equivocal, future studies

  14. Intranasal administration of IL-35 inhibits allergic responses and symptoms in mice with allergic rhinitis.

    Science.gov (United States)

    Suzuki, Motohiko; Yokota, Makoto; Nakamura, Yoshihisa; Ozaki, Shinya; Murakami, Shingo

    2017-04-01

    IL-35 was recently identified as an anti-inflammatory cytokine. We previously reported that recombinant fusion protein of murine IL-35 and human IgG1 Fc fragment (rIL-35) reduced Th2 cytokines (IL-4 and IL-5) in vitro. However, it is unclear whether IL-35 can attenuate nasal allergic responses and symptoms of allergic rhinitis in vivo. To investigate the in vivo effect of IL-35 on allergic rhinitis in mice, mice were sensitized with ovalbumin (OVA). Intranasal administration of rIL-35 and intranasal challenge of OVA were then performed. Nasal symptoms were estimated after the last nasal challenge. Nasal tissue and cervical lymph nodes (CLN) were collected. OVA-specific IgE in sera, OVA-specific T cell response, and the production of cytokines (IL-4, IL-5, and IL-10) stimulated by the OVA antigen were measured. The transcription level of Foxp3 and the frequency of CD4 + CD25 + regulatory T cells were also measured. rIL-35 significantly inhibited the number of sneezes and nasal rubbing movements. It also reduced the number of eosinophils in the nasal mucosa and significantly decreased the level of OVA-specific IgE, the OVA-specific T cell proliferation, and the production of IL-4 and IL-5. Furthermore, rIL-35 significantly increased the production of IL-10, the transcription level of Foxp3, and the frequency of CD4 + CD25 + regulatory T cells. This study showed for the first time that rIL-35 inhibits nasal allergic responses and symptoms in mice, and that rIL-35 increases IL-10, Foxp3, and CD4 + CD25 + regulatory T cells in CLN. This study also suggests that intranasal administration of IL-35 can attenuate allergic rhinitis. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  15. Differential effects of intranasal oxytocin on sexual experiences and partner interactions in couples.

    Science.gov (United States)

    Behnia, Behnoush; Heinrichs, Markus; Bergmann, Wiebke; Jung, Stefanie; Germann, Janine; Schedlowski, Manfred; Hartmann, Uwe; Kruger, Tillmann H C

    2014-03-01

    Knowledge about the effects of the neuropeptide oxytocin (OXT) on human sexual behaviors and partner interactions remains limited. Based on our previous studies, we hypothesize that OXT should be able to positively influence parameters of sexual function and couple interactions. Employing a naturalistic setting involving 29 healthy heterosexual couples (n=58 participants), we analyzed the acute effects of intranasally administered OXT (24IU) on sexual drive, arousal, orgasm and refractory aspects of sexual behavior together with partner interactions. Data were assessed by psychometric instruments (Acute Sexual Experiences Scale, Arizona Sexual Experience Scale) as well as biomarkers, such as cortisol, α-amylase and heart rate. Intranasal OXT administration did not alter "classical" parameters of sexual function, such as sexual drive, arousal or penile erection and lubrication. However, analysis of variance and a hierarchical linear model (HLM) revealed specific effects related to the orgasmic/post-orgasmic interval as well as parameters of partner interactions. According to HLM analysis, OXT increased the intensity of orgasm, contentment after sexual intercourse and the effect of study participation. According to ANOVA analysis, these effects were more pronounced in men. Men additionally indicated higher levels of sexual satiety after sexual intercourse with OXT administration. Women felt more relaxed and subgroups indicated better abilities to share sexual desires or to empathize with their partners. The effect sizes were small to moderate. Biomarkers indicated moderate psychophysiological activation but were not affected by OXT, gender or method of contraception. Using a naturalistic setting, intranasal OXT administration in couples exerted differential effects on parameters of sexual function and partner interactions. These results warrant further investigations, including subjects with sexual and relationship problems. Copyright © 2014 Elsevier Inc. All

  16. Effect of intranasal manganese administration on neurotransmission and spatial learning in rats

    International Nuclear Information System (INIS)

    Blecharz-Klin, Kamilla; Piechal, Agnieszka; Joniec-Maciejak, Ilona; Pyrzanowska, Justyna; Widy-Tyszkiewicz, Ewa

    2012-01-01

    The effect of intranasal manganese chloride (MnCl 2 ·4H 2 O) exposure on spatial learning, memory and motor activity was estimated in Morris water maze task in adult rats. Three-month-old male Wistar rats received for 2 weeks MnCl 2 ·4H 2 O at two doses the following: 0.2 mg/kg b.w. (Mn0.2) or 0.8 mg/kg b.w. (Mn0.8) per day. Control (Con) and manganese-exposed groups were observed for behavioral performance and learning in water maze. ANOVA for repeated measurements did not show any significant differences in acquisition in the water maze between the groups. However, the results of the probe trial on day 5, exhibited spatial memory deficits following manganese treatment. After completion of the behavioral experiment, the regional brain concentrations of neurotransmitters and their metabolites were determined via HPLC in selected brain regions, i.e. prefrontal cortex, hippocampus and striatum. ANOVA demonstrated significant differences in the content of monoamines and metabolites between the treatment groups compared to the controls. Negative correlations between platform crossings on the previous platform position in Southeast (SE) quadrant during the probe trial and neurotransmitter turnover suggest that impairment of spatial memory and cognitive performance after manganese (Mn) treatment is associated with modulation of the serotonergic, noradrenergic and dopaminergic neurotransmission in the brain. These findings show that intranasally applied Mn can impair spatial memory with significant changes in the tissue level and metabolism of monoamines in several brain regions. -- Highlights: ► Intranasal exposure to manganese in rats impairs spatial memory in the water maze. ► Regional changes in levels of neurotransmitters in the brain have been identified. ► Cognitive disorder correlates with modulation of 5-HT, NA and DA neurotransmission.

  17. DOES INTRANASAL STEROIDS REDUCE THE NEED OF ADENOIDECTOMY IN ADENOID HYPERTROPHY

    Directory of Open Access Journals (Sweden)

    Sudeep Madisetti

    2017-06-01

    Full Text Available BACKGROUND Adenoidal hypertrophy is one of the common pathological condition in the paediatric population. Adenoid hypertrophy manifests as bilateral nasal obstruction, rhinorrhea, cough, snoring, hyponasal speech and sleep apnoea. At present, complications and sequelae of adenoidectomy (i.e., alteration of the immunological system, postoperative bleeding and recurrence of adenoids are object of criticism. For this reason, research was conducted to test the efficacy of topical nasal steroids in decreasing the severity of nasal symptoms and adenoidal mass. MATERIALS AND METHODS This prospective, controlled study includes 60 children between the ages of 3-12 yrs. who presented with symptoms of adenoid hypertrophy. The study group (33 subjects underwent course of antibiotic therapy (amoxicillin and potassium clavulanate/cefpodoxime proxetil/cefuroxime axetil along with mometasone furoate nasal spray 50 mcg in each nostril (100 mcg/day once daily for 6 weeks, whereas the control group (27 subjects treated symptomatically with course of antibiotic therapy and saline nasal drops. We assessed the effectiveness of intranasal corticosteroids for improving nasal airway obstruction, thus reducing the need for adenoidectomy. RESULTS We tested the efficacy of Mometasone Furoate (MF monohydrate to improve the symptom scores of patients with adenoid hypertrophy. 60 children (3-12 years old were enrolled in a prospective, controlled, clinical study. At the end of the trial, symptom scores improved significantly in the steroid group, while no significant improvements were observed in control patients. CONCLUSION Usage of nasal steroid spray is safe and well tolerated in children. Intranasal steroid therapy can be considered as a treatment option in children with adenoid hypertrophy and in patients who are not willing to undergo or are contraindicated for surgery. In case of failure of intranasal steroidal therapy, adenoidectomy remains the procedure of choice.

  18. Intranasal oxytocin reduces social perception in women: Neural activation and individual variation.

    Science.gov (United States)

    Hecht, Erin E; Robins, Diana L; Gautam, Pritam; King, Tricia Z

    2017-02-15

    Most intranasal oxytocin research to date has been carried out in men, but recent studies indicate that females' responses can differ substantially from males'. This randomized, double-blind, placebo-controlled study involved an all-female sample of 28 women not using hormonal contraception. Participants viewed animations of geometric shapes depicting either random movement or social interactions such as playing, chasing, or fighting. Probe questions asked whether any shapes were "friends" or "not friends." Social videos were preceded by cues to attend to either social relationships or physical size changes. All subjects received intranasal placebo spray at scan 1. While the experimenter was not blinded to nasal spray contents at Scan 1, the participants were. Scan 2 followed a randomized, double-blind design. At scan 2, half received a second placebo dose while the other half received 24 IU of intranasal oxytocin. We measured neural responses to these animations at baseline, as well as the change in neural activity induced by oxytocin. Oxytocin reduced activation in early visual cortex and dorsal-stream motion processing regions for the social > size contrast, indicating reduced activity related to social attention. Oxytocin also reduced endorsements that shapes were "friends" or "not friends," and this significantly correlated with reduction in neural activation. Furthermore, participants who perceived fewer social relationships at baseline were more likely to show oxytocin-induced increases in a broad network of regions involved in social perception and social cognition, suggesting that lower social processing at baseline may predict more positive neural responses to oxytocin. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Effects of intranasal kinetic oscillation stimulation on heart rate variability.

    Science.gov (United States)

    Jerling, Markus; Cygankiewicz, Iwona; Al-Tawil, Nabil; Darpo, Borje; Ljungström, Anders; Zareba, Wojciech

    2018-01-01

    Kinetic oscillation stimulation in the nasal cavity (KOS) has been shown to have positive symptomatic effects in subjects with non-allergic rhinitis and in patients with migraine. To evaluate the effect of KOS on autonomic function, we assessed heart rate variability (HRV) in this small exploratory study in 12 healthy subjects. KOS treatment was performed using a minimally invasive system with a single-use catheter inserted into the nasal cavity. During treatment, the tip was inflated and oscillated with a mean pressure of 95 millibar and amplitude of the oscillations of 100 millibar at a frequency of 68 Hz. Treatment was given for 15 minutes sequentially on each side. Heart rate variability was assessed during five 30-minutes periods before, during and immediately after KOS treatment and 3.5 hours thereafter. KOS resulted in a substantial reduction of HRV. As compared to baseline recorded during 30 minutes preceding treatment, VLF was reduced by 65%, LF by 55%, the ratio LF/HF by 44%, with somewhat smaller observed effects in the time domain; SDNN and RMSDD were reduced by of 36% and 18%, respectively. Heart rate remained stable during treatment with minimal mean changes from 68 ± 7 bpm before to 68 ± 9 and 69 ± 9 bpm during and after treatment. Reduction of HRV parameters was consistently seen in all subjects, with rapid onset and return towards baseline values during post-treatment observation periods. KOS has an effect on the autonomic balance with pronounced heart-rate independent reduction on HRV. © 2017 The Authors Annals of Noninvasive Electrocardiology Published by Wiley Periodicals, Inc.

  20. Validation of a Best-Fit Pharmacokinetic Model for Scopolamine Disposition after Intranasal Administration

    Science.gov (United States)

    Wu, L.; Chow, D. S-L.; Tam, V.; Putcha, L.

    2015-01-01

    An intranasal gel formulation of scopolamine (INSCOP) was developed for the treatment of Motion Sickness. Bioavailability and pharmacokinetics (PK) were determined per Investigative New Drug (IND) evaluation guidance by the Food and Drug Administration. Earlier, we reported the development of a PK model that can predict the relationship between plasma, saliva and urinary scopolamine (SCOP) concentrations using data collected from an IND clinical trial with INSCOP. This data analysis project is designed to validate the reported best fit PK model for SCOP by comparing observed and model predicted SCOP concentration-time profiles after administration of INSCOP.

  1. Intranasal tetracaine and oxymetazoline: a newly approved drug formulation that provides maxillary dental anesthesia without needles.

    Science.gov (United States)

    Hersh, Elliot V; Saraghi, Mana; Moore, Paul A

    2016-10-03

    An intranasal formulation of 3% tetracaine and 0.05% oxymetazoline (Kovanaze) received FDA approval on 29 June 2016. This formulation appears to provide sufficient local anesthesia to perform routine dental restorative (filling) procedures in maxillary teeth from second premolar forward. The aim of this paper is to provide an overview of the efficacy, pharmacokinetics and tolerability of 3% tetracaine plus 0.05% oxymetazoline when administered intranasally. The literature was reviewed employing the search terms intranasal delivery, tetracaine, oxymetazoline and dental local anesthesia employing the search engines PubMed Plus, Scopus and the Web of Science. The search was limited to double-blind, randomized, placebo or sham-controlled trials except for phase 1 and phase 2 pharmacokinetic and safety data. A total of five relevant publications appeared in the peer reviewed literature. Three per cent tetracaine plus 0.05% oxymetazoline produced a success rate of between 83% and 90% in providing sufficient local anesthesia to perform dental restorative procedures in maxillary premolars, canines, and incisors. The vasoconstrictive action of the oxymetazoline component was determined to be necessary for anesthetic success. The tetracaine component has a very short half-life and is undetectable in many subjects. Oxymetazoline has a half-life of approximately 2 hours. The most common side effects of this formulation are nasal runniness, stuffiness, and stinging. Cardiovascular parameters remained relatively stable although there was a pressor response in two individuals out of 186 subjects exposed to the drug; one with a history of Hashimoto's thyrotoxicosis (a relative contraindication to the use of oxymetazoline) and one in a normal volunteer. These hypertensive events are most likely due to the oxymetazoline component, the active ingredient in over-the-counter nasal decongestants. Intranasal 3% tetracaine plus 0.05% oxymetazoline provides sufficient dental anesthesia

  2. Chronic orbital inflammatory disease and optic neuropathy associated with long-term intranasal cocaine abuse: 2 cases and literature review.

    Science.gov (United States)

    Siemerink, Martin J; Freling, Nicole J M; Saeed, Peerooz

    2017-10-01

    Orbital inflammatory disease and secondary optic neuropathy is a rare but devastating complication of long-term intranasal cocaine abuse. We describe 2 patients with a history of intranasal cocaine consumption who presented with subacute onset of unilateral vision loss from optic neuropathy and limitation of abduction in the affected eye. Magnetic resonance imaging findings included an orbital mass in combination with absent nasal septum and partial destruction of the paranasal sinuses. Biopsies and histopathologic examination of the nasal cavity and the orbital mass revealed chronic inflammation. Both patients were treated with oral corticosteroids, ocular movements completely normalized but no improvement of visual acuity was noted. Intranasal cocaine abuse can cause orbital complications from chronic sinonasal inflammatory disease and these patients are at risk to develop optic neuropathy. Optic neuropathy may be caused by compression, infiltration, or ischaemia.

  3. A comparison of the clinical efficacy and safety of intranasal fluticasone propionate and antihistamines in the treatment of rhinitis.

    Science.gov (United States)

    Foresi, A

    2000-01-01

    Adequate management of allergic rhinitis is needed to avoid its considerable adverse social, clinical, and economic impact. Both topical intranasal steroids and oral or topical antihistamines are recognised as effective treatments for this condition. In comparative studies, however, intranasal steroids and, in particular, fluticasone propionate aqueous nasal spray (FPANS), have afforded consistently better symptomatic relief, and have a greater beneficial effect on quality of life. Furthermore, the addition of an antihistamine to FPANS therapy has generally produced little further benefit. Intranasal administration is associated with a low systemic absorption of fluticasone propionate and, following regular use of FPANS, placebo, or an oral antihistamine, no significant differences were seen between treatment groups in plasma or urinary cortisol. Overall, therefore, the data indicate that FPANS is superior to second-generation antihistamines in the management of allergic rhinitis.

  4. Pharmepéna-Psychonautics: Human intranasal, sublingual and oral pharmacology of 5-methoxy-N,N-dimethyl-tryptamine.

    Science.gov (United States)

    Ott, J

    2001-01-01

    Summarized are psychonautic bioassays (human self-experiments) of pharmepéna--crystalline 5-methoxy-N,N-dimethyltryptamine (5-MeO-DMT; O-Me-bufotenine), at times combined with crystalline beta-carbolines (harmaline or harmine). These substances were administered via intranasal, sublingual and oral routes, by way of pharmacological modeling of diverse South American shamanic inebriants (principally the snuffs epéna/nyakwana, prepared from barks of diverse species of Virola.) Intranasal, sublingual and oral psychoactivity of 5-MeO-DMT, and the 1967 Holmstedt-Lindgren hypothesis of the paricá-effect--intranasal potentiation of tryptamines by concomitant administration of monoamine-oxidase-inhibiting (MAOI) beta-carbolines from stems of Banisteriopsis caapi admixed with the snuffs--have been confirmed by some 17 psychonautic bioassays. Salient phytochemical and psychonautic literature is reviewed.

  5. Oral steroids alone or followed by intranasal steroids versus watchful waiting in the management of otitis media with effusion.

    Science.gov (United States)

    Hussein, A; Fathy, H; Amin, S M; Elsisy, N

    2017-10-01

    To evaluate the effects of oral steroids alone or followed by intranasal steroids versus watchful waiting on the resolution of otitis media with effusion in children aged 2-11 years. A total of 290 children with bilateral otitis media with effusion were assigned to 3 groups: group A was treated with oral steroids followed by intranasal steroids, group B was treated with oral steroids alone and group C was managed with watchful waiting. Patients were evaluated with audiometry and tympanometry. The complete resolution rates of otitis media with effusion were higher in groups A and B than in group C at six weeks. There were no significant differences in otitis media with effusion resolution rates between the groups at three, six and nine months. Oral steroids lead only to a quick resolution of otitis media with effusion, with no long-term benefits. There was no benefit of using intranasal steroids in the management of otitis media with effusion.

  6. Brief Report: Oxytocin Enhances Paternal Sensitivity to a Child with Autism--A Double-Blind Within-Subject Experiment with Intranasally Administered Oxytocin

    Science.gov (United States)

    Naber, Fabienne B. A.; Poslawsky, Irina E.; van Ijzendoorn, Marinus H.; van Engeland, Herman; Bakermans-Kranenburg, Marian J.

    2013-01-01

    Oxytocin seems associated with parenting style, and experimental work showed positive effects of intranasally administered oxytocin on parenting style of fathers. Here, the first double-blind, placebo-controlled, within-subject experiment with intranasal oxytocin administration to fathers of children with autism spectrum disorder (ASD) is…

  7. Early clinical and immune response to NNRTI-based antiretroviral therapy among women with prior exposure to single-dose nevirapine.

    Science.gov (United States)

    Chi, Benjamin H; Sinkala, Moses; Stringer, Elizabeth M; Cantrell, Ronald A; Mtonga, Velepi; Bulterys, Marc; Zulu, Isaac; Kankasa, Chipepo; Wilfert, Catherine; Weidle, Paul J; Vermund, Sten H; Stringer, Jeffrey S A

    2007-05-11

    To determine whether prior exposure to single-dose nevirapine (NVP) for prevention of mother-to-child HIV transmission (PMTCT) is associated with attenuated CD4 cell response, death, or clinical treatment failure in women starting antiretroviral therapy (ART) containing non-nucleoside reverse transcriptase inhibitors (NNRTI). Open cohort evaluation of outcomes for women in program sites across Zambia. HIV treatment was provided according to Zambian/World Health Organization guidelines. Peripartum NVP exposure status was known for 6740 women initiating NNRTI-containing ART, of whom 751 (11%) reported prior use of NVP for PMTCT. There was no significant difference in mean CD4 cell change between those exposed or unexposed to NVP at 6 (+202 versus +182 cells/microl; P = 0.20) or 12 (+201 versus +211 cells/microl; P = 0.60) months. Multivariable analyses showed no significant differences in mortality [adjusted hazard ratio (HR), 1.2; 95% confidence interval (CI), 0.8-1.8] or clinical treatment failure (adjusted HR, 1.1; 95% CI, 0.8-1.5). Comparison of recent NVP exposure with remote exposure suggested a less favorable CD4 cell response at 6 (+150 versus +219 cells/microl; P = 0.06) and 12 (+149 versus +215 cells/microl; P = 0.39) months. Women with recent NVP exposure also had a trend towards elevated risk for clinical treatment failure (adjusted HR, 1.6; 95% CI, 0.9-2.7). Exposure to maternal single-dose NVP was not associated with substantially different short-term treatment outcomes. However, evidence was suggestive that exposure within 6 months of ART initiation may be a risk factor for poor treatment outcomes, highlighting the importance of ART screening and initiation early in pregnancy.

  8. Intranasal buprenorphine alone and in combination with naloxone: Abuse liability and reinforcing efficacy in physically dependent opioid abusers.

    Science.gov (United States)

    Walsh, Sharon L; Nuzzo, Paul A; Babalonis, Shanna; Casselton, Victoria; Lofwall, Michelle R

    2016-05-01

    Buprenorphine can be abused by the intranasal route. This study sought to examine the relative abuse liability and reinforcing efficacy of intranasal buprenorphine compared to intranasal buprenorphine/naloxone in opioid-dependent individuals. Eleven healthy male and female volunteers physically dependent on short-acting opioids resided as inpatients during participation in this double blind, within subject, placebo-controlled study. Participants were maintained on oxycodone (30 mg/q.i.d., p.o.) throughout the 6-week study. Eight pairs of experimental sessions were conducted at ≥48 h intervals to examine the pharmacodynamic profile (Sample) and reinforcing efficacy (Self-administration the following day) of intranasal placebo, oxycodone (60 mg), buprenorphine (2, 8 & 16 mg) and buprenorphine/naloxone (2/0.5, 8/2 & 16/4 mg). Subjective, observer-rated and physiological measures were collected to assess the magnitude of opioid agonist and antagonist effects. A progressive ratio self-administration procedure assessed choices for drug versus money. All active doses produced opioid agonist-like effects (e.g., increased ratings of "liking," and miosis) compared to placebo. The effects of buprenorphine and buprenorphine/naloxone were not reliably dose-dependent. Intranasal buprenorphine/naloxone elicited modest and transient opioid withdrawal-like effects in the first hour post-drug administration, while simultaneously blunting or blocking the early onset of agonist effects seen with buprenorphine alone. All active doses of buprenorphine were self-administered more than placebo, but buprenorphine/naloxone doses were not. These data confirm that intranasal buprenorphine/naloxone has deterrent properties related to transient withdrawal effects that likely decrease its desirability for misuse compared to buprenorphine in opioid-dependent individuals maintained on short-acting opioids. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. The effect of intranasal oxytocin on perceiving and understanding emotion on the Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT).

    Science.gov (United States)

    Cardoso, Christopher; Ellenbogen, Mark A; Linnen, Anne-Marie

    2014-02-01

    Evidence suggests that intranasal oxytocin enhances the perception of emotion in facial expressions during standard emotion identification tasks. However, it is not clear whether this effect is desirable in people who do not show deficits in emotion perception. That is, a heightened perception of emotion in faces could lead to "oversensitivity" to the emotions of others in nonclinical participants. The goal of this study was to assess the effects of intranasal oxytocin on emotion perception using ecologically valid social and nonsocial visual tasks. Eighty-two participants (42 women) self-administered a 24 IU dose of intranasal oxytocin or a placebo in a double-blind, randomized experiment and then completed the perceiving and understanding emotion components of the Mayer-Salovey-Caruso Emotional Intelligence Test. In this test, emotion identification accuracy is based on agreement with a normative sample. As expected, participants administered intranasal oxytocin rated emotion in facial stimuli as expressing greater emotional intensity than those given a placebo. Consequently, accurate identification of emotion in faces, based on agreement with a normative sample, was impaired in the oxytocin group relative to placebo. No such effect was observed for tests using nonsocial stimuli. The results are consistent with the hypothesis that intranasal oxytocin enhances the salience of social stimuli in the environment, but not nonsocial stimuli. The present findings support a growing literature showing that the effects of intranasal oxytocin on social cognition can be negative under certain circumstances, in this case promoting "oversensitivity" to emotion in faces in healthy people. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  10. Comparative evaluation of oral and intranasal priming with replication-competent adenovirus 5 host range mutant (Ad5hr)-simian immunodeficiency virus (SIV) recombinant vaccines on immunogenicity and protective efficacy against SIV(mac251).

    Science.gov (United States)

    Zhou, Qifeng; Hidajat, Rachmat; Peng, Bo; Venzon, David; Aldrich, M Kristine; Richardson, Ersell; Lee, Eun Mi; Kalyanaraman, V S; Grimes, George; Gómez-Román, V Raúl; Summers, L Ebonita; Malkevich, Nina; Robert-Guroff, Marjorie

    2007-11-19

    Oral, replication-competent Ad-HIV vaccines are advancing to human trials. Previous evaluation of protective efficacy in non-human primates has primarily followed upper respiratory tract administrations. Here we compared sequential oral (O/O) versus intranasal/oral (I/O) priming of rhesus macaques with Ad5 host range mutant-SIV recombinants expressing SIV env/rev, gag, and nef genes followed by boosting with SIV gp120 protein. Cellular immune responses in PBMC were stronger and more frequent after I/O administration. Both groups developed mucosal immunity, including memory cells in bronchial alveolar lavage, and gut-homing receptors on PBMC. Following intrarectal SIV(mac251) challenge, both groups exhibited equivalent, significant protection and robust post-challenge cellular immunity. Our results illustrate the promise of oral replication-competent Ad-recombinant vaccines. Pre-challenge PBMC ELISPOT and proliferative responses did not predict protection in the O/O group, highlighting the need for simple, non-invasive methods to reliably assess mucosal immunity.

  11. Limited evidence for intranasal fentanyl in the emergency department and the prehospital setting--a systematic review

    DEFF Research Database (Denmark)

    Hansen, Morten Sejer; Dahl, Jørgen Berg

    2013-01-01

    The intranasal (IN) mode of application may be a valuable asset in non-invasive pain management. Fentanyl demonstrates pharmacokinetic and pharmacodynamic properties that are desirable in the management of acute pain, and IN fentanyl may be of value in the prehospital setting. The aim of this sys......The intranasal (IN) mode of application may be a valuable asset in non-invasive pain management. Fentanyl demonstrates pharmacokinetic and pharmacodynamic properties that are desirable in the management of acute pain, and IN fentanyl may be of value in the prehospital setting. The aim...

  12. Effects of sublingual immunotherapy in a murine asthma model sensitized by intranasal administration of house dust mite extracts

    OpenAIRE

    Kenjiro Shima; Toshiyuki Koya; Keisuke Tsukioka; Takuro Sakagami; Takashi Hasegawa; Chiharu Fukano; Katsuyo Ohashi-Doi; Satoshi Watanabe; Eiichi Suzuki; Toshiaki Kikuchi

    2017-01-01

    Background: Sublingual immunotherapy (SLIT) has received attention as a method for allergen immunotherapy. However, the mechanism of SLIT has not yet been fully investigated. Therefore, we evaluated the effects of SLIT in a murine asthma model, sensitized by intranasal administration of house dust mite (HDM) extracts. Methods: Female BALB/c mice were intranasally exposed to HDM for either 3 or 5 weeks (5 consecutive days per week). Mice were administered either low-dose (0.5 mg/day) or hig...

  13. Clinical experience using intranasal ketamine in the longitudinal treatment of juvenile bipolar disorder with fear of harm phenotype.

    Science.gov (United States)

    Papolos, Demitri; Frei, Mark; Rossignol, Daniel; Mattis, Steven; Hernandez-Garcia, Laura C; Teicher, Martin H

    2018-01-01

    Fear of Harm (FOH) is a pediatric onset phenotype of bipolar disorder (BD) characterized by BD plus treatment resistance, separation anxiety, aggressive obsessions, parasomnias, and thermal dysregulation. Intranasal ketamine (InK) in 12 youths with BD-FOH produced marked improvement during a two-week trial. Here we report on the open effectiveness and safety of InK in maintenance treatment of BD-FOH from the private practice of one author. As part of a chart review, patients 18 years or older and parents of younger children responded to a clinical effectiveness and safety survey. Effectiveness was assessed from analysis of responses to 49 questions on symptomatology plus qualitative content analyses of written reports and chart review. Adverse events (AEs) were analyzed by frequency, duration and severity. Peak InK doses ranged from 20 to 360mg per administration. Surveys were completed on 45 patients treated with InK for 3 months to 6.5 years. Almost all patients were "much" to "very much" improved clinically and in ratings of social function and academic performance. Significant reductions were reported in all symptom categories. There were 13 reports of persistent AEs, none of which resulted in discontinuation. Acute emergence reactions were sporadically observed in up to 75%, but were mild and of brief duration. Retrospective review from a single practice without placebo control with potential for response and recall bias. InK every 3-4 days at sub-anesthetic doses appeared to be a beneficial and well-tolerated treatment. Use of InK may be considered as a tertiary alternative in treatment refractory cases. Randomized control trials are warranted. Copyright © 2017. Published by Elsevier B.V.

  14. Cellular and humoral immune responses to chimeric EGFP-pseudocapsids derived from the mouse polyomavirus after their intranasal administration

    Czech Academy of Sciences Publication Activity Database

    Frič, Jan; Marek, M.; Hrušková, V.; Holáň, Vladimír; Forstová, J.

    2008-01-01

    Roč. 26, č. 26 (2008), s. 3242-3251 ISSN 0264-410X R&D Projects: GA MŠk 1M0506; GA MŠk LC545 Grant - others:GA Mšk(CZ) 1M0508 Program:1M Institutional research plan: CEZ:AV0Z50520514 Keywords : mouse polyomavirus pseudocapsids * chimeric VLPs * antigen carrier and adjuvant Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.298, year: 2008

  15. Intranasal administration of antibody-bound respiratory syncytial virus particles efficiently primes virus-specific immune responses in mice

    NARCIS (Netherlands)

    Kruijsen, Debby; Einarsdottir, Helga K.; Schijf, Marcel A.; Coenjaerts, Frank E.; van der Schoot, Ellen C.; Vidarsson, Gestur; van Bleek, Grada M.

    2013-01-01

    Infants are protected from a severe respiratory syncytial virus (RSV) infection in the first months of life by maternal antibodies or by prophylactically administered neutralizing antibodies. Efforts are under way to produce RSV-specific antibodies with increased neutralizing capacity compared to

  16. Evaluation of polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer nanomicelle for trigeminal ganglion neurons delivering with intranasal administration.

    Science.gov (United States)

    Li, Mengshuang; Xin, Meng; Song, Kaichao; Sun, Fengyuan; Hou, Yuzhen; Li, Jun; Wu, Xianggen

    2018-03-01

    Purpose How to deliver enough medical agents to the trigeminal ganglion (TG) neurons conveniently still remains a challenge in pharmaceutics and clinics. The purpose of this study was to reveal that intranasal administration of polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer (PVCL-PVA-PEG) nanomicelle formulation could efficiently deliver agent to TG neurons in mice. Methods Ocular topical or intranasal administration of nanomicelle coumarin-6 was performed in mice, and tissue distribution after administration (0.25, 1, 2, 4, 6, 8, and 10 h) was analyzed. Fluoro-Gold was used as a retrograde tracer to identify corneal and nasal neurons in the TG. Pharmacokinetic profiles after ocular topical or intranasal administration were explored in detail. Results Coumarin-6 levels in the TG neurons were significantly higher in intranasal administration groups than in topical administration groups, and the difference was statistically significant (P < 0.05) at all time points except for 10 h. Interestingly, in cornea, coumarin-6 was detected after intranasal administration. For intranasal administration groups, it was also interestingly found that coumarin-6 levels in the TG neurons were much higher than that in the brain, suggesting that the TG neurons was a target tissue after the intranasal administration of nanomicelle coumarin-6. These levels also indicated the safety of brain tissue after intranasal administration. Using Fluoro-Gold tract tracing techniques, coumarin-6 was detected in TG neurons after either ocular topical or intranasal administration of nanomicelle coumarin-6, indicating the high colocalization of corneal and nasal neurons in the TG. Conclusions Intranasal administration of PVCL-PVA-PEG nanomicelle formulation could efficiently deliver to TG neurons, and it might be a promising therapy for pathological TG neurons.

  17. A new single-dose bivalent vaccine of porcine circovirus type 2 and Mycoplasma hyopneumoniae elicits protective immunity and improves growth performance under field conditions.

    Science.gov (United States)

    Jeong, Jiwoon; Park, Changhoon; Choi, Kyuhyung; Chae, Chanhee

    2016-01-15

    The efficacy of the new single-dose bivalent vaccine of porcine circovirus type 2 (PCV2) and Mycoplasma hyopneumoniae was evaluated under field conditions for registration as recommended by the Republic of Korea's Animal, Plant & Fisheries Quarantine & Inspection Agency. Three farms were selected based on their history of co-infection with PCV2 and M. hyopneumoniae. On each farm, a total of 80 3-week-old pigs were randomly allocated to one of two treatment groups: (i) vaccinated (n=40) and (ii) unvaccinated (n=40) animals at 3 weeks of age. Protection by the bivalent vaccine helped increase the market weight by 6.2 kg/pig (106.2 kg in vaccinated group vs. 100 kg in unvaccinated group; Phyopneumoniae-specific IFN-γ-SC. Vaccinated animals displayed a reduced PCV2 load in the blood and M. hyopneumoniae load in nasal swabs compared to unvaccinated animals. Vaccination of pigs against PCV2 and M. hyopneumoniae effectively reduced the lung and lymphoid lesion scores compared to unvaccinated animals in all 3 farms. The new bivalent vaccine is very efficacious in controlling PCV2 and M. hyopneumoniae infection based on clinical, immunological, virological, and pathological evaluations under field conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Effect of once-daily, modified-release hydrocortisone versus standard glucocorticoid therapy on metabolism and innate immunity in patients with adrenal insufficiency (DREAM): a single-blind, randomised controlled trial.

    Science.gov (United States)

    Isidori, Andrea M; Venneri, Mary Anna; Graziadio, Chiara; Simeoli, Chiara; Fiore, Daniela; Hasenmajer, Valeria; Sbardella, Emilia; Gianfrilli, Daniele; Pozza, Carlotta; Pasqualetti, Patrizio; Morrone, Stefania; Santoni, Angela; Naro, Fabio; Colao, Annamaria; Pivonello, Rosario; Lenzi, Andrea

    2018-03-01

    Conventional treatment of patients with adrenal insufficiency involves administration of glucocorticoids multiple times a day and has been associated with weight gain and metabolic impairment. The optimal glucocorticoid replacement therapy for these patients is highly debated because of the scarcity of evidence from randomised trials. We aimed to establish whether the timing and pharmacokinetics of glucocorticoid replacement therapy affect the metabolism and immune system of patients with adrenal insufficiency. We did a single-blind randomised controlled trial at two reference university hospitals in Italy. Eligible patients (aged 18-80 years) with adrenal insufficiency were on conventional glucocorticoid therapy and had been stable for at least 3 months before enrolment. Patients were randomly assigned (1:1) with a computer-generated random sequence stratified by type of adrenal insufficiency and BMI to continue conventional glucocorticoid therapy (standard treatment group) or to switch to an equivalent dose of once-daily, modified-release oral hydrocortisone (switch treatment group). Outcome assessors were masked to treatment allocation. The primary outcome was bodyweight change from baseline to 24 weeks. Secondary outcomes included immune cell profiles, susceptibility to infections, and quality of life. Efficacy analyses included all patients who received at least one dose of the study drug. This trial is registered with ClinicalTrials.gov, NCT02277587. Between March 1, 2014, and June 30, 2016, 89 patients with adrenal insufficiency were randomly assigned to continue standard glucocorticoid therapy (n=43) or to switch to once-daily, modified-release hydrocortisone (n=46). At 24 weeks, bodyweight reduction was superior in patients in the once-daily hydrocortisone group compared with those in the standard treatment group (-2·1 kg [95% CI -4·0 to -0·3] vs 1·9 kg [-0·1 to 3·9]; treatment difference -4·0 kg, 95% CI -6·9 to -1·1; p=0·008). Additionally

  19. Optimization of curcumin nanoemulsion for intranasal delivery using design of experiment and its toxicity assessment.

    Science.gov (United States)

    Sood, Sumeet; Jain, Kunal; Gowthamarajan, K

    2014-01-01

    The objective of the study was to optimize curcumin nanoemulsion for intranasal delivery using design of experiment. Box-Behnken design was constructed using oil, surfactant and co-surfactant concentration as independent variables and their affect on response y1 (globule size) and y2 (zeta potential) were studied. The ANOVA test identified the significant factors that affected the responses. For globule size, percentage of oil, surfactant and co-surfactant were identified as significant model terms whereas for zeta potential, oil and co-surfactant were found to be significant. Critical factors affecting the responses were identified using perturbation and contour plots. The derived polynomial equation and contour graph aid in predicting the values of selected independent variables for preparation of optimum nanoemulsion with desired properties. Further, 2(4) factorial design was used to study influence of chitosan on particle size and zeta potential. The formulations were subjected to in vitro cytotoxicity using SK-N-SH cell line and nasal ciliotoxicity studies. The developed formulations did not show any toxicity and were safe for intranasal delivery for brain targeting. In vitro diffusion studies revealed that nanoemulsions had a significantly higher release compared to drug solution. Ex vivo diffusion studies were carried out using sheep nasal mucosa fixed onto Franz diffusion cells. Mucoadhesive nanoemulsion showed higher flux and permeation across sheep nasal mucosa. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Neuroprotective and regenerative roles of intranasal Wnt-3a administration after focal ischemic stroke in mice.

    Science.gov (United States)

    Wei, Zheng Zachory; Zhang, James Ya; Taylor, Tammi M; Gu, Xiaohuan; Zhao, Yingying; Wei, Ling

    2018-03-01

    Wnt signaling is a conserved pathway involved in expansion of neural progenitors and lineage specification during development. However, the role of Wnt signaling in the post-stroke brain has not been well-elucidated. We hypothesized that Wnt-3a would play an important role for neurogenesis and brain repair. Adult male mice were subjected to a focal ischemic stroke targeting the sensorimotor cortex. Mice that received Wnt-3a (2 µg/kg/day, 1 h after stroke and once a day for the next 2 days, intranasal delivery) had reduced infarct volume compared to stroke controls. Wnt-3a intranasal treatment of seven days upregulated the expression of brain-derived growth factor (BDNF), increased the proliferation and migration of neuroblasts from the subventricular zone (SVZ), resulting in increased numbers of newly formed neurons and endothelial cells in the peri-infarct zone. Both the molecular and cellular effects of Wnt-3a were blocked by the Wnt specific inhibitors XAV-939 or Dkk-1. In functional assays, Wnt-3a treatment enhanced the local cerebral blood flow (LCBF) in the peri-infarct, as well as improved sensorimotor functions in a battery of behavioral tests. Together, our data demonstrates that the Wnt-3a signaling can act as a dual neuroprotective and regenerative factor for the treatment of ischemic stroke.

  1. Antidepressant effect of recombinant NT4-NAP/AAV on social isolated mice through intranasal route.

    Science.gov (United States)

    Liu, Fei; Liu, You-Ping; Lei, Gang; Liu, Peng; Chu, Zheng; Gao, Cheng-Ge; Dang, Yong-Hui

    2017-02-07

    The purpose of the present study was to observe the depression-like behavior induced by social isolation; detect the antidepressant effect of a recombinant adeno-associated virus (AAV) expressing NAP on social isolation mice by intranasal delivery. After construction of NT4-NAP/AAV, expression of NAP was confirmed in vitro. 3-week-old C57/BL mice were bred individually in cages as social isolation-rearing. Six weeks later, the first subset of mice underwent behavioral tests and western blot; the second was for enzyme-linked immunosorbent assay. NT4-NAP/AAV was delivered quaque die by nasal administration for consecutive 10 days before behavioral test. Several depression-like behaviors were observed in social isolation mice, including decreased relative sucrose preference, longer immobility time in forced swimming test, lower plasma corticosterone and decreased brain-derived neurotrophic factor in hippocampus. Thus, social isolation procedure appears to be an animal model of depression with good face and construct validity. What's more, the antidepressant effect in social isolation-rearing mice was observed after intranasal administration of NT4-NAP/AAV, suggesting that this might be a promising therapeutic strategy for depressive disorder.

  2. Intranasal Delivery of Recombinant NT4-NAP/AAV Exerts Potential Antidepressant Effect.

    Science.gov (United States)

    Ma, Xian-Cang; Chu, Zheng; Zhang, Xiao-Ling; Jiang, Wen-Hui; Jia, Min; Dang, Yong-Hui; Gao, Cheng-Ge

    2016-06-01

    The present study was designed to construct a recombinant adeno-associated virus (rAAV) which can express NAP in the brain and examine whether this virus can produce antidepressant effects on C57 BL/6 mice that had been subjected to open field test and forced swimming test, via nose-to-brain pathway. When the recombinant plasmid pGEM-T Easy/NT4-NAP was digested by EcoRI, 297 bp fragments can be obtained and NT4-NAP sequence was consistent with the designed sequence confirmed by DNA sequencing. When the recombinant plasmid pSSCMV/NT4-NAP was digested by EcoRI, 297 bp fragments is visible. Immunohistochemical staining of fibroblasts revealed that expression of NAP was detected in NT4-NAP/AAV group. Intranasal delivery of NT4-NAP/AAV significantly reduced immobility time when the FST was performed after 1 day from the last administration. The effects observed in the FST could not be attributed to non-specific increases in activity since intranasal delivery of NT4-NAP/AAV did not alter the behavior of the mice during the open field test. The results indicated that a recombinant AAV vector which could express NAP in cells was successfully constructed and NAP may be a potential target for therapeutic action of antidepressant treatment.

  3. Effects of intranasal insulin application on the hypothalamic BOLD response to glucose ingestion

    DEFF Research Database (Denmark)

    van Opstal, Anna M.; Akintola, Abimbola A.; Elst, Marjan van der

    2017-01-01

    The hypothalamus is a crucial structure in the brain that responds to metabolic cues and regulates energy homeostasis. Patients with type 2 diabetes demonstrate a lack of hypothalamic neuronal response after glucose ingestion, which is suggested to be an underlying cause of the disease. In this s......The hypothalamus is a crucial structure in the brain that responds to metabolic cues and regulates energy homeostasis. Patients with type 2 diabetes demonstrate a lack of hypothalamic neuronal response after glucose ingestion, which is suggested to be an underlying cause of the disease....... In this study, we assessed whether intranasal insulin can be used to enhance neuronal hypothalamic responses to glucose ingestion. In a randomized, double-blinded, placebo-controlled 4-double cross-over experiment, hypothalamic activation was measured in young non- diabetic subjects by determining blood......-oxygen-level dependent MRI signals over 30 minutes before and after ingestion of 75 g glucose dissolved in 300 ml water, under intranasal insulin or placebo condition. Glucose ingestion under placebo condition lead to an average 1.4% hypothalamic BOLD decrease, under insulin condition the average response to glucose...

  4. Intranasal insulin modulates intrinsic reward and prefrontal circuitry of the human brain in lean women.

    Science.gov (United States)

    Kullmann, Stephanie; Frank, Sabine; Heni, Martin; Ketterer, Caroline; Veit, Ralf; Häring, Hans-Ulrich; Fritsche, Andreas; Preissl, Hubert

    2013-01-01

    There is accumulating evidence that food consumption is controlled by a wide range of brain circuits outside of the homeostatic system. Activation in these brain circuits may override the homeostatic system and also contribute to the enormous increase of obesity. However, little is known about the influence of hormonal signals on the brain's non-homeostatic system. Thus, selective insulin action in the brain was investigated by using intranasal application. We performed 'resting-state' functional magnetic resonance imaging in 17 healthy lean female subjects to assess intrinsic brain activity by fractional amplitude of low-frequency fluctuations (fALFF) before, 30 and 90 min after application of intranasal insulin. Here, we showed that insulin modulates intrinsic brain activity in the hypothalamus and orbitofrontal cortex. Furthermore, we could show that the prefrontal and anterior cingulate cortex response to insulin is associated with body mass index. This demonstrates that hormonal signals as insulin may reduce food intake by modifying the reward and prefrontal circuitry of the human brain, thereby potentially decreasing the rewarding properties of food. Due to the alarming increase in obesity worldwide, it is of great importance to identify neural mechanisms of interaction between the homeostatic and non-homeostatic system to generate new targets for obesity therapy. Copyright © 2012 S. Karger AG, Basel.

  5. Formulation and optimization of mucoadhesive microemulsion containing mirtazapine for intranasal delivery

    Directory of Open Access Journals (Sweden)

    Hetal P Thakkar

    2014-01-01

    Full Text Available Background: Mirtazapine, an antidepressant drug, has absolute bioavailability of only 50% due to high first pass metabolism. Aim: The purpose of this study was to develop and optimize mucoadhesive microemulsion containing mirtazapine for intranasal delivery. Materials and Methods: Based on solubility study, Capmul Medium chain Monoglyceride, Tween 80 and polyethylene glycol (PEG 400 were selected as oil, surfactant and co surfactant respectively. Microemulsions were prepared using water titration method. 3:1% w/w ratio (Tween 80: PEG 400 was selected for formulation development. The prepared microemulsions were optimized for globule size, zeta potential, % transmittance and polydispersity index. The optimized batch was further characterized for % drug content, conductivity and transmission electron microscopy. Results and Conclusion: All the parameters showed the suitability of microemulsion of mirtazapine for intranasal delivery. Chitosan (0.5% w/w was used as a polymer for the preparation of mucoadhesive microemulsion to enhance the retention time in the nasal mucosa. Results of nasal toxicity study using excised sheep nasal mucosa showed comparatively no damage to epithelium and so formulation was considered safe for nasal administration. mirtazapine mucoadhesive microemulsion showed the highest percentage of diffusion (57.11 ± 0.710% after 210 min during in-vitro drug diffusion study through sheep nasal mucosa, followed by mirtazapine microemulsion (46.08 ± 0.674% and finally by mirtazapine solution (17.63 ± 0.612%.

  6. Development and implementation of intranasal naloxone opioid overdose response protocol at a homeless health clinic.

    Science.gov (United States)

    Dahlem, Chin Hwa Y; Horstman, Molly J; Williams, Brent C

    2016-01-01

    To describe the development, implementation, and preliminary evaluation of Opioid Overdose Response Protocol using intranasal (IN) naloxone in a homeless shelter. Opioid Overdose Response Protocol and training curriculum were developed using the Massachusetts Department of Public Health Opioid Overdose Education and Naloxone Distribution (OEND) flow chart, the American Heart Association (AHA) simplified adult basic life support algorithm, and resources through Harms Reduction Coalition. Intranasal naloxone offers a safe and effective method for opioid reversal. To combat the rising incidence of opioid overdose, IN naloxone should be made available at homeless shelters and other facilities with high frequency of opioid overdose, including the training of appropriate staff. This project has demonstrated the effective training and implementation of an Opioid Overdose Response Protocol, based on feedback received from cardiopulmonary resuscitation (CPR) trained nonhealthcare staff. Nurse practitioners (NPs), with our focus on patient care, prevention, and education, are well suited to the deployment of this life-saving protocol. NPs are in critical positions to integrate opioid overdose prevention education and provide naloxone rescue kits in clinical practices. ©2015 American Association of Nurse Practitioners.

  7. Low-dose intranasal versus oral midazolam for routine body MRI of claustrophobic patients

    International Nuclear Information System (INIS)

    Tschirch, Frank T.C.; Goepfert, Kerstin; Brunner, Genevieve; Weishaupt, Dominik; Froehlich, Johannes M.

    2007-01-01

    The purpose of this study was to assess prospectively the potential of low-dose intranasal midazolam compared to oral midazolam in claustrophobic patients undergoing routine body magnetic resonance imaging (MRI). Seventy-two adult claustrophobic patients referred for body MRI were randomly assigned to one of two treatment groups (TG1 and TG2). The 36 patients of TG1 received 7.5 mg midazolam orally 15 min before MRI, whereas the 36 patients of TG2 received one (or, if necessary, two) pumps of a midazolam nasal spray into each nostril immediately prior to MRI (in total, 1 or 2 mg). Patients' tolerance, anxiety and sedation were assessed using a questionnaire and a visual analogue scale immediately before and after MRI. Image quality was evaluated using a five-point-scale. In TG1, 18/36 MRI examinations (50%) had to be cancelled, the reduction of anxiety was insufficient in 12/18 remaining patients (67%). In TG2, 35/36 MRI examinations (97%) were completed successfully, without relevant adverse effects. MRI image quality was rated higher among patients of TG2 compared to TG1 (p<0.001). Low-dose intranasal midazolam is an effective and patient-friendly solution to overcome anxiety in claustrophobic patients in a broad spectrum of body MRI. Its anxiolytic effect is superior to that of the orally administrated form. (orig.)

  8. Low-dose intranasal versus oral midazolam for routine body MRI of claustrophobic patients

    Energy Technology Data Exchange (ETDEWEB)

    Tschirch, Frank T.C.; Goepfert, Kerstin; Brunner, Genevieve; Weishaupt, Dominik [University Hospital Zuerich, Institute of Diagnostic Radiology, Zuerich (Switzerland); Froehlich, Johannes M. [Klus-Apotheke, Zuerich (Switzerland)

    2007-06-15

    The purpose of this study was to assess prospectively the potential of low-dose intranasal midazolam compared to oral midazolam in claustrophobic patients undergoing routine body magnetic resonance imaging (MRI). Seventy-two adult claustrophobic patients referred for body MRI were randomly assigned to one of two treatment groups (TG1 and TG2). The 36 patients of TG1 received 7.5 mg midazolam orally 15 min before MRI, whereas the 36 patients of TG2 received one (or, if necessary, two) pumps of a midazolam nasal spray into each nostril immediately prior to MRI (in total, 1 or 2 mg). Patients' tolerance, anxiety and sedation were assessed using a questionnaire and a visual analogue scale immediately before and after MRI. Image quality was evaluated using a five-point-scale. In TG1, 18/36 MRI examinations (50%) had to be cancelled, the reduction of anxiety was insufficient in 12/18 remaining patients (67%). In TG2, 35/36 MRI examinations (97%) were completed successfully, without relevant adverse effects. MRI image quality was rated higher among patients of TG2 compared to TG1 (p<0.001). Low-dose intranasal midazolam is an effective and patient-friendly solution to overcome anxiety in claustrophobic patients in a broad spectrum of body MRI. Its anxiolytic effect is superior to that of the orally administrated form. (orig.)

  9. Intranasal Insulin Prevents Anesthesia-Induced Cognitive Impairment and Chronic Neurobehavioral Changes

    Directory of Open Access Journals (Sweden)

    Yanxing Chen

    2017-05-01

    Full Text Available General anesthesia increases the risk for cognitive impairment post operation, especially in the elderly and vulnerable individuals. Recent animal studies on the impact of anesthesia on postoperative cognitive impairment have provided some valuable insights, but much remains to be understood. Here, by using mice of various ages and conditions, we found that anesthesia with propofol and sevoflurane caused significant deficits in spatial learning and memory, as tested using Morris Water Maze (MWM 2–6 days after anesthesia exposure, in aged (17–18 months old wild-type (WT mice and in adult (7–8 months old 3xTg-AD mice (a triple transgenic mouse model of Alzheimer’s disease (AD, but not in adult WT mice. Anesthesia resulted in long-term neurobehavioral changes in the fear conditioning task carried out 65 days after exposure to anesthesia in 3xTg-AD mice. Importantly, daily intranasal administration of insulin (1.75 U/mouse/day for only 3 days prior to anesthesia completely prevented the anesthesia-induced deficits in spatial learning and memory and the long-term neurobehavioral changes tested 65 days after exposure to anesthesia in 3xTg-AD mice. These results indicate that aging and AD-like brain pathology increase the vulnerability to cognitive impairment after anesthesia and that intranasal treatment with insulin can prevent anesthesia-induced cognitive impairment.

  10. Revisiting the role of sucrose in PLGA-PEG nanocarrier for potential intranasal delivery.

    Science.gov (United States)

    Bonaccorso, A; Musumeci, T; Carbone, C; Vicari, L; Lauro, M Rosaria; Puglisi, G

    2018-03-01

    The efficient design of nanocarriers is a major challenge and must be correlated with the route of administration. Intranasal route is studied for local, systemic or cerebral treatments. In order to develop nanocarriers with suitable properties for intranasal delivery, to achieve brain and to market the product, it is extremely important the simplification of the formulation in terms of raw materials. Surfactants and cryoprotectants are often added to improve structuration and/or storage of polymeric nanoparticles. PLGA-PEG nanocarriers were prepared by nanoprecipitation method evaluating the critical role of sucrose as surfactant-like and cryoprotectant, with the aim to obtain a simpler formulation compared to those proposed in other papers. Photon correlation spectroscopy and Turbiscan analysis show that sucrose is a useful excipient during the preparation process and it effectively cryoprotects nanoparticles. Among the investigated nanocarriers with different degree of PEG, PEGylated PLGA (5%) confers weak interaction between nanoparticles and mucin as demonstrated by thermal analysis and mucin particle method. Furthermore, in vitro biological studies on HT29, as epithelium cell line, does not show cytotoxicity effect for this nanocarrier at all texted concentrations. The selected nanosystem was also studied to load docetaxel, as model drug, and characterized by a technological point of view.

  11. Cluster headache with ptosis responsive to intranasal lidocaine application: a case report

    Directory of Open Access Journals (Sweden)

    Bakbak Berker

    2012-02-01

    Full Text Available Abstract Introduction The application of lidocaine to the nasal mucosal area corresponding to the sphenopalatine fossa has been shown to be effective at extinguishing pain attacks in patients with a cluster headache. In this report, the effectiveness of local administration of lidocaine on cluster headache attacks as a symptomatic treatment of this disorder is discussed. Cases presentation A 22-year-old Turkish man presented with a five-year history of severe, repeated, unilateral periorbital pain and headache, diagnosed as a typical cluster headache. He suffered from rhinorrhea, lacrimation and ptosis during headaches. He had tried several unsuccessful daily medications. We applied a cotton tip with lidocaine hydrochloride into his left nostril for 10 minutes. The ptosis responded to the treatment and the intensity of his headache decreased. Conclusion Intranasal lidocaine is a useful treatment for the acute management of a cluster headache. Intranasal lidocaine blocks the neural transmission of the sphenopalatine ganglion, which contributes to the trigeminal nerve as well as containing both parasympathetic and sympathetic fibers.

  12. Food consumption and activity levels increase in rats following intranasal Hypocretin-1.

    Science.gov (United States)

    Dhuria, Shyeilla V; Fine, Jared M; Bingham, Deborah; Svitak, Aleta L; Burns, Rachel B; Baillargeon, Amanda M; Panter, Scott S; Kazi, Abdul N; Frey, William H; Hanson, Leah R

    2016-08-03

    Hypocretin-1 (HC, orexin-A) is a neuropeptide involved in regulating physiological functions of sleep, appetite and arousal, and it has been shown that intranasal (IN) administration can target HC to the brain. Recent clinical studies have shown that IN HC has functional effects in human clinical trials. In this study, we use rats to determine whether IN HC has an immediate effect on food consumption and locomotor activity, whether distribution in the brain after IN delivery is dose-dependent, and whether MAPK and PDK1 are affected after IN delivery. Food intake and wheel-running activity were quantified for 24h after IN delivery. Biodistribution was determined 30min after IN delivery of both a high and low dose of 125I-radiolabelled HC throughout the brain and other bodily tissues, while Western blots were used to quantify changes in cell signaling pathways (MAPK and PDK1) in the brain. Intranasal HC significantly increased food intake and wheel activity within 4h after delivery, but balanced out over the course of 24h. The distribution studies showed dose-dependent delivery in the CNS and peripheral tissues, while PDK1 was significantly increased in the brain 30min after IN delivery of HC. This study adds to the growing body of evidence that IN administration of HC is a promising strategy for treatment of HC related behaviors. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Intranasal bevacizumab in the treatment of HHT -related epistaxis: a systematic review.

    Science.gov (United States)

    Stokes, P; Rimmer, J

    2018-03-01

    Hereditary haemorrhagic telangiectasia (HHT) remains a difficult disease for the ENT specialist to manage. Affected patients often report recurrent epistaxis as the most debilitating symptom. The pathogenesis of the disease is due to genetic mutations affecting angiogenesis. For this reason, the anti-angiogenic therapy bevacizumab has gained popularity in the local treatment of epistaxis in patients with HHT. A systematic review of the efficacy of bevacizumab in local treatment of epistaxis in patients with HHT based on epistaxis duration, frequency, severity and impact on quality of life. A systematic search was performed using the PubMed, MEDLINE and EMBASE databases. The Preferred Items for Systematic Reviews and Meta-Analyses guidelines were followed. Studies that measured the efficacy of intranasal bevacizumab treatment of epistaxis in patients with HHT were included for qualitative analysis. Thirteen studies (four randomised controlled trials, three prospective studies, three retrospective studies, one case series and two case reports) with a total of 357 patients were included. Local administration (either by submucosal injection or topically) did not have a significant impact on epistaxis duration, frequency, severity or quality of life compared to placebo or other local treatments. The available evidence suggests that intranasal bevacizumab treatment does not have a significant effect on epistaxis in patients with HHT. There are several limitations that require further investigation to confidently rule out local bevacizumab as an effective therapy in HHT related epistaxis.

  14. Impact of daily supplementation of Spirulina platensis on the immune system of naïve HIV-1 patients in Cameroon: a 12-months single blind, randomized, multicenter trial.

    Science.gov (United States)

    Ngo-Matip, Marthe-Elise; Pieme, Constant Anatole; Azabji-Kenfack, Marcel; Moukette, Bruno Moukette; Korosky, Emmanuel; Stefanini, Philippe; Ngogang, Jeanne Yonkeu; Mbofung, Carl Moses

    2015-07-21

    Micronutrient deficiencies occur early in Human Immunodeficiency Virus (HIV) infections they have reverse effects on the nutritional status. The diet supplementation with a natural nutraceutical rich in proteins and micronutrient like Spirulina platensis, may be effective and efficient in delaying HIV disease progression by frequently reported improvement in immune response. A prospective single-blind, randomized, multicenter study conducted on 320 HIV-1 ARV-naïve participants for 12 months. Participants received either S. platensis supplementation and standard care or standard care and local balanced diet without S. platenis. Selected hematological and biochemical as well as CD4 count cells, viral load copies were assessed at three separate times. Among the 169 ART-naïve participants enrolled in the study, the female was mostly represented (67.1%). The significant increase of CD4 count cells (596.32-614.92 cells count) and significant decrease of viral load levels (74.7 × 10(3)-30.87 × 10(3) copies/mL) of the patients who received a supplementation of S. platensis was found after 6 months of treatment. Haemoglobin level was also significantly higher in the same group while the fasting blood glucose concentration decreased after 12 months compared to control. A daily supplementation with S. platensis to diet combined with a reasonable balanced diet has significantly increased the CD4 cells and reduced the viral load after 6 months. Further studies are recommended among a large specific group of people infected by the HIV in order to investigate the mechanisms involved on the effect of S. platensis on immune system.

  15. A review of the clinical efficacy and safety of MP-AzeFlu, a novel intranasal formulation of azelastine hydrochloride and fluticasone propionate, in clinical studies conducted during different allergy seasons in the US

    Directory of Open Access Journals (Sweden)

    Prenner BM

    2016-07-01

    Full Text Available Bruce M Prenner Allergy Associates Medical Group, Inc., San Diego, CA, USA Abstract: A novel intranasal formulation of azelastine HCl (AZE, an antihistamine and fluticasone propionate (FP, a corticosteroid in a single spray (MP-AzeFlu [Dymista®] was studied in four randomized, double-blind, placebo-controlled trials of patients with seasonal allergic rhinitis conducted in the US. Study sites were distributed so that all major US geographic regions and the prevalent pollens within these regions were represented. Spring and summer studies included patients aged 12 years and older with allergy to grass and tree pollens. Fall studies enrolled patients with allergy to weeds, in particular ragweed. In addition, a study was conducted during the winter months in patients with allergy to mountain cedar pollen in TX, USA. Regardless of allergy season or prevalent pollen, MP-AzeFlu improved nasal symptoms of allergic rhinitis (AR to a significantly greater degree than AZE or FP, two treatments that currently are recommended as the first-line AR therapy. MP-AzeFlu improved all individual AR symptoms and was significantly better than FP and AZE for nasal congestion relief, which is generally accepted as the most bothersome symptom for AR patients. The onset of action was within 30 minutes. MP-AzeFlu also provided clinically important improvement in the overall Rhinoconjunctivitis Quality of Life Questionnaire score and significantly improved ocular symptoms of rhinitis compared to placebo. Favorable characteristics of the MP-AzeFlu formulation as well as superior clinical efficacy make it an ideal intranasal therapy for AR. Keywords: Dymista, seasonal allergic rhinitis, grass pollen, ragweed, Texas mountain cedar, intranasal therapy

  16. Vaccines (immunizations) - overview

    Science.gov (United States)

    Vaccinations; Immunizations; Immunize; Vaccine shots; Prevention - vaccine ... component) of the vaccine. VACCINE SCHEDULE The recommended vaccination (immunization) schedule is updated every 12 months by ...

  17. Immunization with the Recombinant Cholera Toxin B Fused to Fimbria 2 Protein Protects against Bordetella pertussis Infection

    Directory of Open Access Journals (Sweden)

    Noelia Olivera

    2014-01-01

    Full Text Available This study examined the immunogenic properties of the fusion protein fimbria 2 of Bordetella pertussis (Fim2—cholera toxin B subunit (CTB in the intranasal murine model of infection. To this end B. pertussis Fim2 coding sequence was cloned downstream of the cholera toxin B subunit coding sequence. The expression and assembly of the fusion protein into pentameric structures (CTB-Fim2 were evaluated by SDS-PAGE and monosialotetrahexosylgaglioside (GM1-ganglioside enzyme-linked immunosorbent assay (ELISA. To evaluate the protective capacity of CTB-Fim2, an intraperitoneal or intranasal mouse immunization schedule was performed with 50 μg of CTB-Fim2. Recombinant (rFim2 or purified (BpFim2 Fim2, CTB, and phosphate-buffered saline (PBS were used as controls. The results showed that mice immunized with BpFim2 or CTB-Fim2 intraperitoneally or intranasally presented a significant reduction in bacterial lung counts compared to control groups (P<0.01 or P<0.001, resp.. Moreover, intranasal immunization with CTB-Fim2 induced significant levels of Fim2-specific IgG in serum and bronchoalveolar lavage (BAL and Fim2-specific IgA in BAL. Analysis of IgG isotypes and cytokines mRNA levels showed that CTB-Fim2 results in a mixed Th1/Th2 (T-helper response. The data presented here provide support for CTB-Fim2 as a promising recombinant antigen against Bordetella pertussis infection.

  18. Adult Immunization

    Directory of Open Access Journals (Sweden)

    Omer Coskun

    2008-04-01

    Full Text Available Despite the many advances in modern medicine, each year thousands of people in the world die from diseases that are easily prevented by safe and effective vaccines. Few measures in preventive medicine are of such proven value and as easy to implement as routine immunization against infectious diseases. Prevention of infection by immunization is a lifelong process. There are a number of vaccines that all adults (¡I18 years require. There are also other vaccines that need to be tailored to meet individual variations in risk resulting from occupation, foreign travel, underlying illness, lifestyle and age. In this study, we tried to review this important subject. [TAF Prev Med Bull 2008; 7(2.000: 159-166

  19. Adult Immunization

    Directory of Open Access Journals (Sweden)

    Omer Coskun

    2008-04-01

    Full Text Available Despite the many advances in modern medicine, each year thousands of people in the world die from diseases that are easily prevented by safe and effective vaccines. Few measures in preventive medicine are of such proven value and as easy to implement as routine immunization against infectious diseases. Prevention of infection by immunization is a lifelong process. There are a number of vaccines that all adults (¡I18 years require. There are also other vaccines that need to be tailored to meet individual variations in risk resulting from occupation, foreign travel, underlying illness, lifestyle and age. In this study, we tried to review this important subject. [TAF Prev Med Bull. 2008; 7(2: 159-166

  20. Interferon-lambda contributes to innate immunity of mice against influenza A virus but not against hepatotropic viruses

    DEFF Research Database (Denmark)

    Mordstein, M; Kochs, G; Dumoutier, L

    2008-01-01

    a distinct receptor complex for signaling that is not present on all cell types. Since type I IFN receptor-deficient mice (IFNAR1(0/0)) exhibit greatly increased susceptibility to various viral diseases, it remained unclear to which degree IFN-lambda might contribute to innate immunity. To address this issue...... we performed influenza A virus infections of mice which carry functional alleles of the influenza virus resistance gene Mx1 and which, therefore, develop a more complete innate immune response to influenza viruses than standard laboratory mice. We demonstrate that intranasal administration of IFN...

  1. Intranasal Insulin Prevents Cognitive Decline, Cerebral Atrophy and White Matter Changes in Murine Type I Diabetic Encephalopathy

    Science.gov (United States)

    Francis, George J.; Martinez, Jose A.; Liu, Wei Q.; Xu, Kevin; Ayer, Amit; Fine, Jared; Tuor, Ursula I.; Glazner, Gordon; Hanson, Leah R.; Frey, William H., II; Toth, Cory

    2008-01-01

    Insulin deficiency in type I diabetes may lead to cognitive impairment, cerebral atrophy and white matter abnormalities. We studied the impact of a novel delivery system using intranasal insulin (I-I) in a mouse model of type I diabetes (streptozotocin-induced) for direct targeting of pathological and cognitive deficits while avoiding potential…

  2. Enhanced Brain Delivery of 2-(Phosphonomethyl)pentanedioic Acid Following Intranasal Administration of Its gamma-Substituted Ester Prodrugs

    Czech Academy of Sciences Publication Activity Database

    Nedelcovych, M.; Dash, R. P.; Tenora, Lukáš; Zimmermann, S. C.; Gadiano, A. J.; Garrett, C.; Alt, J.; Hollinger, K. R.; Pommier, E.; Jančařík, Andrej; Rojas, C.; Thomas, A. G.; Wu, Y.; Wozniak, K.; Majer, Pavel; Slusher, B. S.; Rais, R.

    2017-01-01

    Roč. 14, č. 10 (2017), s. 3248-3257 ISSN 1543-8384 Institutional support: RVO:61388963 Keywords : 2-PMPA * glutamate carboxypeptidase II * neurological disease * intranasal * pharmacokinetics * prodrugs Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 4.440, year: 2016

  3. Laksekalcitonin ved osteoporose. Effekten af intranasal applikation på knoglemineralindhold og frakturhyppighed hos postmenopausale kvinder med manifeste osteoporotiske forandringer

    DEFF Research Database (Denmark)

    Ravn, Pernille

    1993-01-01

    The objective was to study the dose-related response of intranasal salmon calcitonin (Salcatonin) on bone mass and bone turnover and the effect of salcatonin on rates of fracture in elderly women with moderate osteoporosis. A total of 208 healthy women aged 68-72 years, who had a bone mineral con...

  4. AMELIORATING TREATMENT-REFRACTORY DEPRESSION WITH INTRANASAL KETAMINE: POTENTIAL NMDA RECEPTOR ACTIONS IN THE PAIN CIRCUITRY REPRESENTING MENTAL ANGUISH

    Science.gov (United States)

    Opler, Lewis A.; Opler, Mark G.; Arnsten, Amy F.T.

    2014-01-01

    This paper reviews the anti-depressant actions of the N-methyl-D-aspartame glutamate receptor (NMDAR) antagonist, ketamine, and offers a potential neural mechanism for intranasal ketamine’s ultra-rapid actions based on the key role of NMDAR in the nonhuman primate prefrontal cortex (PFC). Although intravenous ketamine infusions can lift mood within hours, the current review describes how intranasal ketamine administration can have ultra-rapid antidepressant effects, beginning within minutes (5–40 minutes) and lasting hours, but with repeated treatments needed for sustained antidepressant actions. Research in rodents suggests that increased synaptogenesis in PFC may contribute to the prolonged benefit of ketamine administration, beginning hours after administration. However, these data cannot explain the relief that occurs within minutes of intranasal ketamine delivery. We hypothesize that the ultra-rapid effects of intranasal administration in humans may be due to ketamine blocking the NMDAR circuits that generate the emotional representations of pain (e.g. Brodmann Areas 24 and 25, insular cortex), cortical areas that can be overactive in depression and which sit above the nasal epithelium. In contrast, NMDAR blockade in the dorsolateral PFC following systemic administration of ketamine may contribute to cognitive deficits. This novel view may help to explain how intravenous ketamine can treat the symptoms of depression yet worsen the symptoms of schizophrenia. PMID:25619798

  5. Evaluation of the use of an intranasal metallic dilator in patients with obstructive sleep apnea syndrome using CPAP

    Directory of Open Access Journals (Sweden)

    Mekhitarian Neto, Levon

    2009-06-01

    Full Text Available Introduction: The obstructive sleep apnea-hyponea syndrome (OSAHS is a chronic and progressive disease with a high morbidity. The application of positive pressure mask in the airways, connected to a CPAP (nasal continuous positive airway pressure is an efficient method, but with side effects relating to the mask and to the pressure. Objective: To determine the possible reduction of the CPAP pressure, with the use of a metallic intranasal dilator. Method: We carried out a multicentric prospective study of 15 patients, from November 2003 through June 2006, with patients using CPAP, divided into two groups: 10 with adhesion problems and five without adhesion problems, all examined for inclusion. We performed another polissonography for classification of the pressure with the use of the intranasal dilator in both groups. Results: Out of 10 patients with treatment adhesion problems, all had a reduction on the classification pressure, in the polissonography made with the use of the intranasal dilator. Out of five patients without adhesion problems in two the pressure didn't change, but they mentioned the sensation of comfort improved; in two, the pressure increases; and in one the pressure decreased. Conclusion: The use of the intranasal dilator diminishes the CPAP classification pressure.

  6. Effect of intranasal mometasone furoate administered in children with coexisting allergic rhinitis and asthma towards asthma attacks and lung function

    Directory of Open Access Journals (Sweden)

    Ellen P. Gandaputra

    2009-12-01

    during the study. There was >50% improvement in allergic rhinitis symptoms after 4 weeks of treatment (P50% after 8 weeks of treatment (P50% of asthma symptoms, however it is not followed with significant improvement in lung function. No side effects are reported during 8 weeks use of intranasal mometasone furoate.

  7. The optimum dose of intranasal remifentanil for laryngeal mask airway insertion during sevoflurane induction in children: a randomized controlled trial.

    Science.gov (United States)

    Yao, Yusheng; Ni, Juan; Yang, Yang; Guo, Yanhua; Ye, Huazhen; Chen, Yanqing

    2015-01-01

    The purpose of this study was to determine the optimum dose of intranasal remifentanil required to produce satisfactory laryngeal mask airway (LMA) insertion conditions during inhalation induction of anesthesia using 5% sevoflurane in children. Seven-five American Society of Anesthesiologists physical status (ASA) I subjects, aged 2-5 years, scheduled for minor elective surgery were randomly allocated to receive one of five doses of intranasal remifentanil (nil, 0.25, 0.5, 0.75 and 1.0 μg·kg(-1)) during 5% sevoflurane induction. Laryngeal mask insertion was attempted 120 s after intranasal remifentanil administration and the response of subjects was classified as either 'Failure' or 'Success'. "Success" was defined as a relaxed mandible without coughing, gapping, swallowing, laryngospasm or gross purposeful movement. Secondary outcomes included the duration of apnea, hemodynamic changes and complications. For each groups (nil, 0.25, 0.5, 0.75 or 1.0 μg·kg(-1) remifentanil), the incidence of satisfactory LMA insertion conditions was 0, 33.3%, 60%, 86.7% and 100% respectively. None of subjects suffered from any serious complications such as laryngospasm,or hypotension and bradycardia. The ED50 and ED95 of intranasal remifentanil for successful LMA insertion in children were estimated to be 0.36 and 0.998 μg·kg(-1) during 5% sevoflurane inhalation induction for 3 min.

  8. A common oxytocin receptor gene (OXTR) polymorphism modulates intranasal oxytocin effects on the neural response to social cooperation in humans.

    Science.gov (United States)

    Feng, C; Lori, A; Waldman, I D; Binder, E B; Haroon, E; Rilling, J K

    2015-09-01

    Intranasal oxytocin (OT) can modulate social-emotional functioning and related brain activity in humans. Consequently, OT has been discussed as a potential treatment for psychiatric disorders involving social behavioral deficits. However, OT effects are often heterogeneous across individuals. Here we explore individual differences in OT effects on the neural response to social cooperation as a function of the rs53576 polymorphism of the oxytocin receptor gene (OXTR). Previously, we conducted a double-blind, placebo-controlled study in which healthy men and women were randomized to treatment with intranasal OT or placebo. Afterwards, they were imaged with functional magnetic resonance imaging while playing an iterated Prisoner's Dilemma Game with same-sex partners. Within the left ventral caudate nucleus, intranasal OT treatment increased activation to reciprocated cooperation in men, but tended to decrease activation in women. Here, we show that these sex differences in OT effects are specific to individuals with the rs53576 GG genotype, and are not found for other genotypes (rs53576 AA/AG). Thus, OT may increase the reward or salience of positive social interactions for male GG homozygotes, while decreasing those processes for female GG homozygotes. These results suggest that rs53576 genotype is an important variable to consider in future investigations of the clinical efficacy of intranasal OT treatment. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  9. Brain delivery of valproic acid via intranasal administration of nanostructured lipid carriers: in vivo pharmacodynamic studies using rat electroshock model

    Directory of Open Access Journals (Sweden)

    Sharareh Eskandari

    2011-02-01

    Full Text Available Sharareh Eskandari1, Jaleh Varshosaz1, Mohsen Minaiyan2, Majid Tabbakhian11Department of Pharmaceutics, 2Department of Pharmacology, School of Pharmacy and Isfahan Pharmaceutical Sciences Research Center, Isfahan University of Medical Sciences, Isfahan, IranAbstract: The treatment of brain disorders is one of the greatest challenges in drug delivery because of a variety of main barriers in effective drug transport and maintaining therapeutic concentrations in the brain for a prolonged period. The objective of this study was delivery of valproic acid (VPA to the brain by intranasal route. For this purpose, nanostructured lipid carriers (NLCs were prepared by solvent diffusion method followed by ultrasonication and characterized for size, zeta potential, drug-loading percentage, and release. Six groups of rats each containing six animals received drug-loaded NLCs intraperitoneally (IP or intranasally. Brain responses were then examined by using maximal electroshock (MES. The hind limb tonic extension:flexion inhibition ratio was measured at 15-, 30-, 60-, 90-, and 120-minute intervals. The drug concentration was also measured in plasma and brain at the most protective point using gas chromatography method. The particle size of NLCs was 154 ± 16 nm with drug-loading percentage of 47% ± 0.8% and drug release of 75% ± 1.9% after 21 days. In vivo results showed that there was a significant difference between protective effects of NLCs of VPA and control group 15, 30, 60, and 90 minutes after treatment via intranasal route (P < 0.05. Similar protective effect was observed in rats treated with NLCs of VPA in intranasal route and positive control in IP route (P > 0.05. Results of drug determination in brain and plasma showed that brain:plasma concentration ratio was much higher after intranasal administration of NLCs of VPA than the positive control group (IP route. In conclusion, intranasal administration of NLCs of VPA provided a better protection

  10. Determination of the maximum tolerated dose of intranasal sufentanil and midazolam in Chinese: a pilot study.

    Science.gov (United States)

    Zou, Y; Shao, L; Tian, M; Zhang, Y; Liu, F

    2018-01-29

    The purpose of this study was to determine the maximum tolerated dose (MTD, the dose of causing 10% respiratory depression) of intranasal sufentanil (SUF) and midazolam (MID) for sedation during gastroscopy by continual reassessment method (CRM). Patients (18-65 years old) scheduled for gastroscopy were recruited in this study. Subjects received intranasal SUF and MID for sedation. The dose of MID (5 mg) was fixed, while the dose of SUF was increased progressively (six incremental doses ranging from 0-0.60 μg/kg, n = 3 for each dose). The first cohort received a conservative, predetermined dose of 5 mg MID and 0 μg/kg SUF, subsequent cohorts received doses of SUF that were determined by the responses of all previous patients using Bayesian-based software. The dose allocated to the next cohort is the one with an updated posterior response probability closest to 10%. Thirty Chinese patients scheduled for gastroscopy were included. Probability of respiratory depression at each dose was as follows: 5 mg MID + 0 μg/kg SUF, 0.4%; 5 mg MID + 0.1 μg/kg SUF, 0.8%; 5 mg MID + 0.2 μg/kg SUF, 1.8%; 5 mg MID + 0.3 μg/kg SUF, 3.7%; 5 mg MID + 0.4 μg/kg SUF, 9.9%; 5 mg MID + 0.5 μg/kg SUF, 17.8%; 5 mg MID + 0.6 μg/kg SUF, 36.0%. The MTD of intranasal MID and SUF for sedation during gastroscopy causing 10% respiratory depression is 5 mg MID + 0.4 μg/kg SUF, based on CRM. © 2018 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  11. IgA polymerization contributes to efficient virus neutralization on human upper respiratory mucosa after intranasal inactivated influenza vaccine administration.

    Science.gov (United States)

    Terauchi, Yoshihiko; Sano, Kaori; Ainai, Akira; Saito, Shinji; Taga, Yuki; Ogawa-Goto, Kiyoko; Tamura, Shin-Ichi; Odagiri, Takato; Tashiro, Masato; Fujieda, Mikiya; Suzuki, Tadaki; Hasegawa, Hideki

    2018-02-09

    Unlike the current injectable influenza vaccines, intranasally administered influenza vaccines induce influenza virus-specific IgA antibodies in the local respiratory mucosa as well as IgG antibodies in the systemic circulation. Our previous study showed that after five volunteers underwent intranasal administration with inactivated H3N2 or H5N1 vaccines, their IgA antibodies on the upper respiratory tract were present as monomers, dimers, and multimers (trimers and tetramers). Moreover, the multimers associated with the highest virus neutralizing activity. However, it has remained elusive whether a more practical intranasal vaccination strategy could induce the high-performance IgA multimers in the nasal mucosa. In the present study, volunteers were administered with two doses of the intranasal trivalent whole-virus inactivated influenza vaccine and showed that in nasal wash samples the amount of multimeric IgA correlated positively with virus neutralizing titers, indicating that the multimeric IgA antibodies play an important role in the antiviral activity at the nasal mucosa. Surface plasmon resonance analysis of the binding dynamics of nasal wash derived IgA monomers, dimers, and multimers against recombinant trimeric influenza virus HA showed that sample fractions containing IgA multimers dissociated from HA less well than sample fractions without IgA multimers. Thus, IgA multimers may "stick" to the antigen more tightly than the other structures. In summary, intranasal administration of two doses of multivalent inactivated influenza vaccines induced multimeric IgA. Multimerization of mucosal IgA antibodies conferred higher neutralizing activity against viruses in the nasal mucosa, possibly by increasing their cohesion to virus antigens. (243 words Limit: 250 words).

  12. Comparison of Oral and Intranasal Midazolam/Ketamine Sedation in 3‒6-year-old Uncooperative Dental Patients

    Directory of Open Access Journals (Sweden)

    Masoud Fallahinejad Ghajari

    2015-07-01

    Full Text Available Background and aims. There are several known sedative drugs, with midazolam and ketamine being the most commonly used drugs in children. The aim of this study was to compare the effect of intranasal and oral midazolam plus ketamine in children with high levels of dental anxiety. Materials and methods. A crossover double-blind clinical trial was conducted on 23 uncooperative children aged 3‒6 (negative or definitely negative by Frankel scale, who required at least two similar dental treatment visits. Cases were ran-domly given ketamine (10 mg/kg and midazolam (0.5 mg/kg through oral or intranasal routes in each visit. The sedative efficacy of the agents was assessed by an overall success rate judged by two independent pediatric dentists based on Houpt’s scale for sedation. Data analysis was carried out using Wilcoxon test and paired t-test. Results. Intranasal administration was more effective in reduction of crying and movement during dental procedures com-pared to oral sedation (P<0.05. Overall behavior control was scored higher in nasal compared to oral routes at the time of LA injection and after 15 minutes (P<0.05. The difference was found to be statistically significant at the start and during treatment. However, the difference was no longer significant after 30 minutes, with the vital signs remaining within physio-logical limits. Recovery time was longer in the intranasal group (P<0.001 with a more sleepy face (P=0.004. Conclusion. Intranasal midazolam/ketamine combination was more satisfactory and effective than the oral route when sedating uncooperative children.

  13. Quantitative single serum-dilution liquid phase competitive blocking ELISA for the assessment of herd immunity and expected protection against foot-and-mouth disease virus in vaccinated cattle.

    Science.gov (United States)

    Robiolo, Blanca; La Torre, José; Duffy, Sergio; Leon, Emilio; Seki, Cristina; Torres, Adriana; Mattion, Nora

    2010-06-01

    A single serum-dilution liquid phase ELISA (slpELISA) was standardized to be used for serological evaluation of herd immunity against foot-and-mouth disease. The absorbance value at a dilution 1:64 of each serum sample was interpolated in a standard curve by plotting the antibody titers of six control sera determined by end point dilution liquid phase ELISA (lpELISA), against the absorbance values for the same control sera at 1:64 dilutions. A straight line was obtained by linear regression analysis (r>0.90) in the titer range of 1.40-2.40. The reliability of the antibody titers was confirmed by the simultaneous titration of 60 cattle sera by slpELISA and lpELISA, which showed an acceptable correlation (R(2)>0.87) for viral strains A24/Cruzeiro, A/Argentina/01, O1/Campos and C3/Indaial. Titers obtained by both methods were not significantly different (p>0.05), thus confirming that slpELISA could be used successfully to replace the conventional serial dilution ELISA for the assessment of protection status of cattle in epidemiological studies. In addition, this quantitative slpELISA provides an adequate method for monitoring the effectiveness of vaccination campaigns and is also suitable for the assessment of seroconversion of naive animals during early stages of infection. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Sublingual immunization with a subunit influenza vaccine elicits comparable systemic immune response as intramuscular immunization, but also induces local IgA and TH17 responses.

    Science.gov (United States)

    Gallorini, Simona; Taccone, Marianna; Bonci, Alessandra; Nardelli, Filomena; Casini, Daniele; Bonificio, Amanda; Kommareddy, Sushma; Bertholet, Sylvie; O'Hagan, Derek T; Baudner, Barbara C

    2014-04-25

    Influenza is a vaccine-preventable disease that remains a major health problem world-wide. Needle and syringe are still the primary delivery devices, and injection of liquid vaccine into the muscle is still the primary route of immunization. Vaccines could be more convenient and effective if they were delivered by the mucosal route. Elicitation of systemic and mucosal innate and adaptive immune responses, such as pathogen neutralizing antibodies (including mucosal IgA at the site of pathogen entry) and CD4(+) T-helper cells (especially the Th17 subset), have a critical role in vaccine-mediated protection. In the current study, a sublingual subunit influenza vaccine formulated with or without mucosal adjuvant was evaluated for systemic and mucosal immunogenicity and compared to intranasal and intramuscular vaccination. Sublingual administration of adjuvanted influenza vaccine elicited comparable antibody titers to those elicited by intramuscular immunization with conventional influenza vaccine. Furthermore, influenza-specific Th17 cells or neutralizing mucosal IgA were detected exclusively after mucosal immunization. Copyright © 2014. Published by Elsevier Ltd.

  15. Activation of Innate Immunity by Bacterial Ligands of Toll-like Receptors

    Directory of Open Access Journals (Sweden)

    Nelli K. Akhmatova

    2014-03-01

    Full Text Available Tγδ and B1 lymphocytes are essential components of the mucosal immune system, activating different bacterial and viral ligands without costimulatory signals and preprocessing of other immune effectors. This ability enables the immune system to provide rapid protection against pathogens and contributes to the decoding mechanism of the sensitizing activity of mucosal antigens, because the interaction of these cells produces antibodies for immunoglobulin M (IgM and IgA, but not for IgE. We studied 3 routes of introducing antigens for opportunistic microorganisms to activate Tγδ and B1 lymphocytes: subcutaneous, intranasal, and oral. The subcutaneous and intranasal routes produced a significant increase of these cells in lymph nodes associated with the nasal cavity (NALT and in those associated with bronchial tissue (BALT. The oral route significantly increased levels of these cells in the spleen, in NALT, BALT, and in nodes associated with the gut (GALT. We found that mucosal application of the immunomodulator Immunovac-VP-4 (contains antigens of conditionally pathogenic microorganisms, in conjunction with the activation of Tγδ and B1, induces adaptive immune mechanisms not only in the lymphoid formations associated with the respiratory system and with GALT, but also in the spleen (increased expression of cluster of differentiation 3 [CD3], CD4, CD8, CD19, and CD25. This indicates that there is migration of lymphoid cells from the regional lymph nodes and mucosal lymphoid tissues via the lymph and blood to distant organs, lymphoid development, and both local and systemic immunity. Mucosal application of Immunovac-VP-4 in mice potentiates the cytotoxic activity of NK cells in the NALT, BALT and GALT. The highest cytotoxicity was observed in cells, derived from lymphoid tissue of the intestine after oral immunization. Although we found that cytokine production was increased by all 3 immunization routes, it was most intensive after subcutaneous

  16. Upper-airway obstruction and prolonged recovery from anesthesia following intranasal clotrimazole administration.

    Science.gov (United States)

    Caulkett, N; Lew, L; Fries, C

    1997-01-01

    A 16-month-old Labrador retriever was presented for evaluation and treatment of nasal aspergillosis. Intranasal clotrimazole was administered to treat the condition. The dog was anesthetized on two occasions to facilitate drug administration. Following the first treatment, the dog developed mild pharyngitis but no other complications. Inflammation and edema of the pharynx resulted in upper-airway obstruction following the second treatment. Pentobarbital sedation was used to maintain the endotracheal tube until the obstruction was relieved. Recovery following sedation was extremely prolonged. This case illustrates two adverse drug reactions: severe pharyngitis and edema (probably a result of the vehicles present in the clotrimazole formulation) and prolonged recovery (possibly the result of microsomal enzyme inhibition by the clotrimazole).

  17. Experimentally induced nasal hypersecretion does not reduce the efficacy of intranasal levocabastine

    DEFF Research Database (Denmark)

    Borum, Stefan; Nielsen, K; Bisgaard, H

    1998-01-01

    In allergic rhinitis, a nasal H1-antihistamine spray seems to be well suited for usage on an as-needed basis, because it has a quick onset of action, and many patients prefer to take medicine only when they have symptoms. It is a prerequisite, however, that nasal hypersecretion during a rhinitis...... episode does not significantly reduce the efficacy of intranasal treatment by washing away the drug before it reaches the H1-histamine receptors. In order to investigate this problem, we have induced nasal hypersecretion with a methacholine challenge in one experiment and in four experiments we have......% (p antihistamine spray. We conclude that experimentally induced nasal hypersecretion does not reduce the efficacy...

  18. Intranasal LH-RH treatment of cryptorchidism. A clinical trial and 5 years follow-up

    DEFF Research Database (Denmark)

    Thorup, Jørgen Mogens; Mauritzen, K; Skakkebaek, N E

    1987-01-01

    The effect of intranasal LH-RH on cryptorchidism was investigated in 45 prepubertal boys with 68 undescended testes. A daily dose of 1.2 mg LH-RH was given for 4 weeks. A total of 16 testes (24%) descended. Follow-up examination 5 years later showed that relapse had occurred in two cases. Fifty......-two testes did not descend during the LH-RH treatment. However, seven of these testes descended spontaneously during puberty. So far surgical treatment has been carried out in 39 of the remaining 45 testes. Anatomical anomalies (ectopic position of the testis, open processus vaginalis, abnormal epididymis......) explained the failure of LH-RH to cause descent in the majority of the surgically treated cases....

  19. MILK LET-DOWN-The Use of Intranasal Oxytocin for Nursing Mothers.

    Science.gov (United States)

    Stern, B D

    1961-09-01

    A study was carried out to determine whether intranasal spraying with a solution of oxytocin was an effective way to increase flow of milk in mothers who wished to breast-feed their babies.A hundred such women were given the drug intramuscularly for two days before they were to begin nursing. Then administration by that means was discontinued and 50 of the hundred were given oxytocin nasal spray kits for use at home. In general the patients receiving the spray kits were those who were apprehensive about sufficient lactation, those who had had previous difficulty and those who had flat, inverted or tender nipples. Results were not much different between the 50 women who used the spray and the 50 controls, but since the former group included the "difficult" cases, some benefit may be attributed to the aerosol therapy. Ninety per cent of those who used it said they would be willing to use it again.

  20. Antiglomerular basement membrane antibody-mediated glomerulonephritis after intranasal cocaine use.

    Science.gov (United States)

    Peces, R; Navascués, R A; Baltar, J; Seco, M; Alvarez, J

    1999-01-01

    We report a case of rapidly progressive glomerulonephritis due to antiglomerular basement membrane (anti-GBM) antibodies that progressed to end-stage renal disease in a 35-year-old man who used intranasal cocaine on an occasional basis. In contrast to many prior reports of acute renal failure occurring with cocaine-associated rhabdomyolysis, this patient did not have any evidence of acute muscle damage and myoglobin release. Circulating anti-GBM antibodies and renal biopsy with linear IgG and C3 deposits confirmed the diagnosis of anti-GBM disease. The possibility of anti-GBM must be considered in the differential diagnosis of acute renal failure in cocaine addicts. This unusual combination raises complex questions regarding the pathogenesis of this type of renal injury.

  1. Evaluation of lung immunity in chimpanzees

    International Nuclear Information System (INIS)

    Bice, D.E.; Harris, D.L.; Muggenburg, B.A.; Bowen, J.A.

    1980-01-01

    The effects of inhaled pollutants on the immune defenses in the lung can be studied in several animal species. To assure that the data obtained can be extrapolated to man, it is essential that the development of lung immunity is similar in the experimental animal selected and in humans. Because of the similarity of immune responses in chimpanzees and in humans, the development of immunity in the chimpanzee after lung immunization was evaluated. The results from the chimpanzees were qualitatively the same as those from previous studies in which single lung lobes of dogs were immunized. It was concluded that immunotoxicology data obtained in dogs can be used to estimate the effects of inhaled pollutants on the immune defense mechanism in the human lung

  2. Intranasal oxytocin does not reduce age-related difficulties in social cognition.

    Science.gov (United States)

    Grainger, Sarah A; Henry, Julie D; Steinvik, Henriette R; Vanman, Eric J; Rendell, Peter G; Labuschagne, Izelle

    2018-03-01

    Oxytocin is a neuropeptide that plays a key role in social processing and there are several studies suggesting that intranasally administered oxytocin