WorldWideScience

Sample records for single host species

  1. Ancient host specificity within a single species of brood parasitic bird.

    Science.gov (United States)

    Spottiswoode, Claire N; Stryjewski, Katherine Faust; Quader, Suhel; Colebrook-Robjent, John F R; Sorenson, Michael D

    2011-10-25

    Parasites that exploit multiple hosts often experience diversifying selection for host-specific adaptations. This can result in multiple strains of host specialists coexisting within a single parasitic species. A long-standing conundrum is how such sympatric host races can be maintained within a single parasitic species in the face of interbreeding among conspecifics specializing on different hosts. Striking examples are seen in certain avian brood parasites such as cuckoos, many of which show host-specific differentiation in traits such as host egg mimicry. Exploiting a Zambian egg collection amassed over several decades and supplemented by recent fieldwork, we show that the brood parasitic Greater Honeyguide Indicator indicator exhibits host-specific differentiation in both egg size and egg shape. Genetic analysis of honeyguide eggs and chicks show that two highly divergent mitochondrial DNA lineages are associated with ground- and tree-nesting hosts, respectively, indicating perfect fidelity to two mutually exclusive sets of host species for millions of years. Despite their age and apparent adaptive diversification, however, these ancient lineages are not cryptic species; a complete lack of differentiation in nuclear genes shows that mating between individuals reared by different hosts is sufficiently frequent to prevent speciation. These results indicate that host specificity is maternally inherited, that host-specific adaptation among conspecifics can be maintained without reproductive isolation, and that host specificity can be remarkably ancient in evolutionary terms.

  2. A single natural nucleotide mutation alters bacterial pathogen host tropism.

    Science.gov (United States)

    Viana, David; Comos, María; McAdam, Paul R; Ward, Melissa J; Selva, Laura; Guinane, Caitriona M; González-Muñoz, Beatriz M; Tristan, Anne; Foster, Simon J; Fitzgerald, J Ross; Penadés, José R

    2015-04-01

    The capacity of microbial pathogens to alter their host tropism leading to epidemics in distinct host species populations is a global public and veterinary health concern. To investigate the molecular basis of a bacterial host-switching event in a tractable host species, we traced the evolutionary trajectory of the common rabbit clone of Staphylococcus aureus. We report that it evolved through a likely human-to-rabbit host jump over 40 years ago and that only a single naturally occurring nucleotide mutation was required and sufficient to convert a human-specific S. aureus strain into one that could infect rabbits. Related mutations were identified at the same locus in other rabbit strains of distinct clonal origin, consistent with convergent evolution. This first report of a single mutation that was sufficient to alter the host tropism of a microorganism during its evolution highlights the capacity of some pathogens to readily expand into new host species populations.

  3. Patterns of host adaptation in fly infecting Entomophthora species

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Jensen, Annette Bruun; Eilenberg, Jørgen

    .g. Entomophthora, Strongwellsea and Entomophaga). Species diversification of the obligate IPF within Entomophthoromycota thus seems to be primarily driven by co-evolutionary host adaptation to specific insect families, genera or species-complexes, but the underlying genetic factors of host adaptation......Insect pathogenic fungi (IPF) differ widely in their capability to infect different hosts. Some are generalists and will, given a sufficient number of infectious spores are present, infect almost any species of insect (e.g. Hypocrealean Metarhizium and Beauveria). Members of a different main IPF...... phylum Entomophthoromycota generally have more narrow host-ranges where some species for example only infect aphids or only locusts. Certain species (or strains) are even more host specific and are only known to infect a single or very few taxonomically related insect species under natural conditions (e...

  4. Patterns of host adaptation in fly infecting Entomophthora species

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Jensen, Annette Bruun; Eilenberg, Jørgen

    phylum Entomophthoromycota generally have more narrow host-ranges where some species for example only infect aphids or only locusts. Certain species (or strains) are even more host specific and are only known to infect a single or very few taxonomically related insect species under natural conditions (e...... in this fungal order are largely unknown and leave many unanswered questions. For example are the number of virulence factors increasing, or decreasing when fungal pathogens adapt to a narrow range of potential hosts? And, are host specialization based on many genetic changes with small effect or few with large......Insect pathogenic fungi (IPF) differ widely in their capability to infect different hosts. Some are generalists and will, given a sufficient number of infectious spores are present, infect almost any species of insect (e.g. Hypocrealean Metarhizium and Beauveria). Members of a different main IPF...

  5. Host species exploitation and discrimination by animal parasites.

    Science.gov (United States)

    Forbes, Mark R; Morrill, André; Schellinck, Jennifer

    2017-05-05

    Parasite species often show differential fitness on different host species. We developed an equation-based model to explore conditions favouring host species exploitation and discrimination. In our model, diploid infective stages randomly encountered hosts of two species; the parasite's relative fitness in exploiting each host species, and its ability to discriminate between them, was determined by the parasite's genotype at two independent diallelic loci. Relative host species frequency determined allele frequencies at the exploitation locus, whereas differential fitness and combined host density determined frequency of discrimination alleles. The model predicts instances where populations contain mixes of discriminatory and non-discriminatory infective stages. Also, non-discriminatory parasites should evolve when differential fitness is low to moderate and when combined host densities are low, but not so low as to cause parasite extinction. A corollary is that parasite discrimination (and host-specificity) increases with higher combined host densities. Instances in nature where parasites fail to discriminate when differential fitness is extreme could be explained by one host species evolving resistance, following from earlier selection for parasite non-discrimination. Similar results overall were obtained for haploid extensions of the model. Our model emulates multi-host associations and has implications for understanding broadening of host species ranges by parasites.This article is part of the themed issue 'Opening the black box: re-examining the ecology and evolution of parasite transmission'. © 2017 The Authors.

  6. Cophylogeny of the anther smut fungi and their caryophyllaceous hosts: Prevalence of host shifts and importance of delimiting parasite species for inferring cospeciation

    Directory of Open Access Journals (Sweden)

    Yockteng Roxana

    2008-03-01

    Full Text Available Abstract Background Using phylogenetic approaches, the expectation that parallel cladogenesis should occur between parasites and hosts has been validated in some studies, but most others provided evidence for frequent host shifts. Here we examine the evolutionary history of the association between Microbotryum fungi that cause anther smut disease and their Caryophyllaceous hosts. We investigated the congruence between host and parasite phylogenies, inferred cospeciation events and host shifts, and assessed whether geography or plant ecology could have facilitated the putative host shifts identified. For cophylogeny analyses on microorganisms, parasite strains isolated from different host species are generally considered to represent independent evolutionary lineages, often without checking whether some strains actually belong to the same generalist species. Such an approach may mistake intraspecific nodes for speciation events and thus bias the results of cophylogeny analyses if generalist species are found on closely related hosts. A second aim of this study was therefore to evaluate the impact of species delimitation on the inferences of cospeciation. Results We inferred a multiple gene phylogeny of anther smut strains from 21 host plants from several geographic origins, complementing a previous study on the delimitation of fungal species and their host specificities. We also inferred a multi-gene phylogeny of their host plants, and the two phylogenies were compared. A significant level of cospeciation was found when each host species was considered to harbour a specific parasite strain, i.e. when generalist parasite species were not recognized as such. This approach overestimated the frequency of cocladogenesis because individual parasite species capable of infecting multiple host species (i.e. generalists were found on closely related hosts. When generalist parasite species were appropriately delimited and only a single representative of

  7. Fish, fans and hydroids: host species of pygmy seahorses.

    Science.gov (United States)

    Reijnen, Bastian T; van der Meij, Sancia E T; van Ofwegen, Leen P

    2011-01-01

    An overview of the octocoral and hydrozoan host species of pygmy seahorses is provided based on literature records and recently collected field data for Hippocampus bargibanti, Hippocampus denise and Hippocampus pontohi. Seven new associations are recognized and an overview of the so far documented host species is given. A detailed re-examination of octocoral type material and a review of the taxonomic history of the alcyonacean genera Annella (Subergorgiidae) and Muricella (Acanthogorgiidae) are included as baseline for future revisions. The host specificity and colour morphs of pygmy seahorses are discussed, as well as the reliability of (previous) identifications and conservation issues.

  8. Host insect species of Ophiocordyceps sinensis: a review

    Directory of Open Access Journals (Sweden)

    Xiao-Liang Wang

    2011-09-01

    Full Text Available Ophiocordyceps sinensis (≡ Cordyceps sinensis is one of the most valued medicinal fungi in China, used for its invigorating effects in strengthening the body and restoring energy. The fungus parasitizes larvae of moths and converts them into sclerotia from which the fungus fruiting body grows. Since the late 1950s, considerable effort has been devoted to the study of host insects related to the fungus. In the present paper, the research history of insect species associated with O. sinensis is briefly reviewed and an extensive literature survey is presented. Ninety-one insect names, spanning 13 genera, related to host insects of O. sinensis are investigated. The relationships between the reported insect species and O. sinensis are analyzed. Fifty-seven of these are considered as recognizable potential host species of the fungus distributed throughout the Tibetan Plateau, whilst eight are considered as indeterminate hosts and 26 as non-hosts. Among the names of recognizable potential host insects, three are invalid (nomen nudum and require further study. This work provides basic information for management of the insect resources and for the conservation and sustainable use of O. sinensis.

  9. Attraction of two lacewing species to volatiles produced by host plants and aphid prey

    Science.gov (United States)

    Zhu, J.; Obrycki, J. J.; Ochieng, Samuel A.; Baker, Thomas C.; Pickett, J. A.; Smiley, D.

    2005-06-01

    It is well documented that host-related odors enable many species of parasitoids and predatory insects to locate their prey and prey habitats. This study reports the first characterization of prey and prey host odor reception in two species of lacewings, Chrysoperla carnea (Say) and Chrysopa oculata L. 2-Phenylethanol, one of the volatiles emitted from their prey’s host plants (alfalfa and corn) evoked a significant EAG response from antennae of C. carnea. Traps baited with this compound attracted high numbers of adult C. carnea, which were predominantly females. One of the sex pheromone components (1R,4aS,7S,7aR)-nepetalactol of an aphid species, Acyrthosiphon pisum (Harris) attracted only C. oculata adults. Single sensillum recordings showed that the olfactory neurons of C. carnea responded to both 2-phenylethanol and aphid sex pheromone components, but those of C. oculata only responded to the latter.

  10. Variations in Host Preference among and within Populations of Heterodera trifolii and Related Species.

    Science.gov (United States)

    Wang, S; Riggs, R D

    1999-12-01

    Seven populations of Heterodera trifolii from Arkansas, Kentucky, Pennsylvania, and Australia plus 3 or 4 single-cyst isolates (SCI) from each population were tested for reproduction on seven species of plants to compare the host preferences among and within populations. Common lespedeza, Kummerowia striata cv. Kobe, was a good host for all populations and isolates. Therefore, a plant was considered to be a host if the number of females produced on it was 10% or more of the number on Kobe. All seven populations reproduced on Trifolium repens and T. pratense. None reproduced on Beta vulgaris or Glycine max. One single-cyst isolate from the Australian population produced a few females on T. pratense. The Australian population maintained on carnation, Dianthus caryophyllus, produced females on carnation but not on curly dock, Rumex crispus. However, its subpopulation maintained on T. repens produced females on R. crispus but not on carnation. Four of the other six populations produced females on R. crispus, and four produced females on carnation. Differences in host range were observed among seven of the mother populations and their SCI, and among isolates within each population. Five host range patterns were found in populations and SCI of H. trifolii. Significant quantitative differences occurred among populations in the numbers of females on most hosts, between isolates and their original populations, and among isolates from the same population. SCI selected from white clover produced fewer females on a series of test hosts and had host ranges the same as or narrower than those of the original populations. However, SCI selected from Kobe lespedeza had more females on some hosts and had host ranges the same as or wider than those of the original populations. The host ranges of all populations and SCI of H. trifolii were different from those of populations and SCI of race 3 of H. glycines and H. lespedezae.

  11. COI and ITS2 sequences delimit species, reveal cryptic taxa and host specificity of fig-associated Sycophila (Hymenoptera, Eurytomidae).

    Science.gov (United States)

    Li, Yanwei; Zhou, Xin; Feng, Gui; Hu, Haoyuan; Niu, Liming; Hebert, Paul D N; Huang, Dawei

    2010-01-01

    Although the genus Sycophila has broad host preferences, some species are specifically associated with figs as nonpollinator wasps. Because of their sexual dimorphism, morphological plasticity, cryptic mating behaviour and poorly known biology, species identifications are often uncertain. It is particularly difficult to match conspecific females and males. In this study, we employed two molecular markers, mitochondrial COI and nuclear ITS2, to identify Sycophila from six Chinese fig species. Morphological studies revealed 25 female and male morphs, while sequence results for both genes were consistent in supporting the presence of 15 species, of which 13 were host specialists and two used dual hosts. A single species of Sycophila was respectively found on four fig species, but six species were isolated from Ficus benjamina and a same number was reared from Ficus microcarpa. Sequence results revealed three male morphs in one species and detected two species that were overlooked by morphological analysis. © 2009 Blackwell Publishing Ltd.

  12. New Ravenelia species on leguminous hosts from the Brazilian Cerrado

    OpenAIRE

    REZENDE, DENISE V.; DIANESE, JOSÉ C.

    2001-01-01

    Four new Ravenelia species were described on native leguminous hosts from the Brazilian Cerrado, as follows: Ravenelia cerradensis sp. nov., R. chapadensis sp. nov., R. mineirosensis sp. nov. and R. emaensis sp. nov. on Chamaecrista clausenii var. cyclophylla, Chamaecriista conferta var. virgata, Anadenanthera colubrina var. colubrina, and on Anadenanthera sp., respectively. Quatro espécies novas de Ravenelia foram descritas em leguminosas do Cerrado brasileiro, a saber: Ravenelia cerraden...

  13. Are cryptic host species also cryptic to parasites? Host specificity and geographical distribution of acanthocephalan parasites infecting freshwater Gammarus.

    Science.gov (United States)

    Westram, A M; Baumgartner, C; Keller, I; Jokela, J

    2011-07-01

    Many parasites infect multiple host species. In coevolving host-parasite interactions, theory predicts that parasites should be adapted to locally common hosts, which could lead to regional shifts in host preferences. We studied the interaction between freshwater Gammarus (Crustacea, Amphipoda) and their acanthocephalan parasites using a large-scale field survey and experiments, combined with molecular identification of cryptic host and parasite species. Gammarus pulex is a common host for multiple species of Acanthocephala in Europe but, in Switzerland, is less common than two cryptic members of the Gammarus fossarum species complex (type A and type B). We found that natural populations of these cryptic species were frequently infected by Pomphorhynchus tereticollis and Polymorphus minutus. Four additional parasite species occurred only locally. Parasites were more common in G. fossarum type B than in type A. Infection experiments using several host and parasite sources confirmed consistently lower infection rates in G. pulex than in G. fossarum type A, suggesting a general difference in susceptibility between the two species. In conclusion, we could show that cryptic host species differ in their interactions with parasites, but that these differences were much less dramatic than differences between G. fossarum (type A) and G. pulex. Our data suggest that the acanthocephalans in Switzerland have adapted to the two most common Gammarus species in this region where host species frequencies differ from near-by regions in Europe. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Genetic differentiation associated with host plants and geography among six widespread species of South American Blepharoneura fruit flies (Tephritidae).

    Science.gov (United States)

    Ottens, K; Winkler, I S; Lewis, M L; Scheffer, S J; Gomes-Costa, G A; Condon, M A; Forbes, A A

    2017-04-01

    Tropical herbivorous insects are astonishingly diverse, and many are highly host-specific. Much evidence suggests that herbivorous insect diversity is a function of host plant diversity; yet, the diversity of some lineages exceeds the diversity of plants. Although most species of herbivorous fruit flies in the Neotropical genus Blepharoneura are strongly host-specific (they deposit their eggs in a single host plant species and flower sex), some species are collected from multiple hosts or flowers and these may represent examples of lineages that are diversifying via changes in host use. Here, we investigate patterns of diversification within six geographically widespread Blepharoneura species that have been collected and reared from at least two host plant species or host plant parts. We use microsatellites to (1) test for evidence of local genetic differentiation associated with different sympatric hosts (different plant species or flower sexes) and (2) examine geographic patterns of genetic differentiation across multiple South American collection sites. In four of the six fly species, we find evidence of local genetic differences between flies collected from different hosts. All six species show evidence of geographic structure, with consistent differences between flies collected in the Guiana Shield and flies collected in Amazonia. Continent-wide analyses reveal - in all but one instance - that genetically differentiated flies collected in sympatry from different host species or different sex flowers are not one another's closest relatives, indicating that genetic differences often arise in allopatry before, or at least coincident with, the evolution of novel host use. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

  15. Host range, host ecology, and distribution of more than 11800 fish parasite species

    Science.gov (United States)

    Strona, Giovanni; Palomares, Maria Lourdes D.; Bailly, Nicholas; Galli, Paolo; Lafferty, Kevin D.

    2013-01-01

    Our data set includes 38 008 fish parasite records (for Acanthocephala, Cestoda, Monogenea, Nematoda, Trematoda) compiled from the scientific literature, Internet databases, and museum collections paired to the corresponding host ecological, biogeographical, and phylogenetic traits (maximum length, growth rate, life span, age at maturity, trophic level, habitat preference, geographical range size, taxonomy). The data focus on host features, because specific parasite traits are not consistently available across records. For this reason, the data set is intended as a flexible resource able to extend the principles of ecological niche modeling to the host–parasite system, providing researchers with the data to model parasite niches based on their distribution in host species and the associated host features. In this sense, the database offers a framework for testing general ecological, biogeographical, and phylogenetic hypotheses based on the identification of hosts as parasite habitat. Potential applications of the data set are, for example, the investigation of species–area relationships or the taxonomic distribution of host-specificity. The provided host–parasite list is that currently used by Fish Parasite Ecology Software Tool (FishPEST, http://purl.oclc.org/fishpest), which is a website that allows researchers to model several aspects of the relationships between fish parasites and their hosts. The database is intended for researchers who wish to have more freedom to analyze the database than currently possible with FishPEST. However, for readers who have not seen FishPEST, we recommend using this as a starting point for interacting with the database.

  16. Panamanian frog species host unique skin bacterial communities

    Directory of Open Access Journals (Sweden)

    Lisa K. Belden

    2015-10-01

    Full Text Available Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd, that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26% were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in

  17. Trophic relationships between the parasitic plant species Phelipanche ramosa (L. and different hosts depending on host phenological stage and host growth rate

    Directory of Open Access Journals (Sweden)

    Delphine Moreau

    2016-07-01

    Full Text Available Phelipanche ramosa (L. Pomel (branched broomrape is a holoparasitic plant that reproduces on crops and also on weeds, which contributes to increase the parasite seed bank in fields. This parasite extracts all its nutrients at the host's expense so that host-parasite trophic relationships are crucial to determine host and parasite growth. This study quantified the intensity with which P. ramosa draws assimilates from its host and analyzed whether it varied with host species, host phenological stage and host growth rate. A greenhouse experiment was conducted on three host species: the crop species Brassica napus (L. (oilseed rape and two weed species, Capsella bursa-pastoris (L. Medik. and Geranium dissectum (L.. Plants were grown with or without P. ramosa and under three light levels to modulate host growth rate. The proportion of host biomass loss due to parasitism by P. ramosa differed between host species (at host fructification, biomass loss ranged from 34% to 84%. Brassica napus and C. bursa-pastoris displayed a similar response to P. ramosa, probably because they belong to the same botanical family. The sensitivity to P. ramosa in each host species could be related to the precocity of P. ramosa development on them. Host compartments could be ranked as a function of their sensitivity to parasitism, with the reproductive compartment being the most severely affected, followed by stems and roots. The proportion of biomass allocated to leaves was not reduced by parasitism. The proportion of pathosystem biomass allocated to the parasite depended on host species. It generally increased with host stage progression but was constant across light induced-host growth rate, showing that P. ramosa adapts its growth to host biomass production. The rank order of host species in terms of sink strength differed from that in terms of host sensitivity. Finally, for B. napus, the biomass of individual parasite shoots decreased with increasing their number per

  18. Effects of rearing host species on the host-feeding capacity and parasitism of the whitefly parasitoid Encarsia formosa.

    Science.gov (United States)

    Dai, Peng; Ruan, Changchun; Zang, Liansheng; Wan, Fanghao; Liu, Linzhou

    2014-01-01

    Parasitoids of the Encarsia genus (Hymenoptera: Aphelinidae) are important biological control agents against whiteflies. Some of the species in this genus not only parasitize their hosts, but also kill them through host feeding. The whitefly parasitoid, Encarsia formosa Gahan, was examined to determine whether the rearing host species affects its subsequent host-feeding capacity and parasitism. E. formosa wasps were reared on Trialeurodes vaporariorum (Westwood) (Hemiptera: Aleyrodidae) and Bemisia tabaci (Gennadius) 'Q', and their subsequent host-feeding capacity and parasitism of T. vaporariorum and B. tabaci were examined. E. formosa reared on T. vaporariorum were significantly larger in body size than those reared on B. tabaci, but these wasps killed a similar number of whitefly nymphs by host feeding when they attacked the same host species on which they were reared. Regardless of the species on which it was reared, E. formosa fed significantly more on the B. tabaci nymphs than on the T. vaporariorum nymphs. The number of whitefly nymphs parasitized by E. formosa differed between the wasps reared on T. vaporariorum and those reared on B. tabaci depending on which whitefly species was offered as a host. In addition, the wasps reared on T. vaporariorum parasitized significantly more on T. vaporariorum than those reared on B. tabaci. The wasps reared on B. tabaci, however, parasitized similar numbers of whiteflies of both host species. The results indicated that the host-feeding capacity of E. formosa was affected more by the host species attacked than by the rearing host species, but the parasitism was affected by the host species attacked and the rearing host species. Generally, E. formosa reared on T. vaporariorum killed more T. vaporariorum nymphs by parasitism and host feeding than those reared on B. tabaci. Additionally, a similar number of B. tabaci nymphs were killed by parasitism and host feeding regardless of the rearing host species. Currently

  19. Rotaxane and catenane host structures for sensing charged guest species.

    Science.gov (United States)

    Langton, Matthew J; Beer, Paul D

    2014-07-15

    CONSPECTUS: The promise of mechanically interlocked architectures, such as rotaxanes and catenanes, as prototypical molecular switches and shuttles for nanotechnological applications, has stimulated an ever increasing interest in their synthesis and function. The elaborate host cavities of interlocked structures, however, can also offer a novel approach toward molecular recognition: this Account describes the use of rotaxane and catenane host systems for binding charged guest species, and for providing sensing capability through an integrated optical or electrochemical reporter group. Particular attention is drawn to the exploitation of the unusual dynamic properties of interlocked molecules, such as guest-induced shuttling or conformational switching, as a sophisticated means of achieving a selective and functional sensor response. We initially survey interlocked host systems capable of sensing cationic guests, before focusing on our accomplishments in synthesizing rotaxanes and catenanes designed for the more challenging task of selective anion sensing. In our group, we have developed the use of discrete anionic templation to prepare mechanically interlocked structures for anion recognition applications. Removal of the anion template reveals an interlocked host system, possessing a unique three-dimensional geometrically restrained binding cavity formed between the interlocked components, which exhibits impressive selectivity toward complementary anionic guest species. By incorporating reporter groups within such systems, we have developed both electrochemical and optical anion sensors which can achieve highly selective sensing of anionic guests. Transition metals, lanthanides, and organic fluorophores integrated within the mechanically bonded structural framework of the receptor are perturbed by the binding of the guest, with a concomitant change in the emission profile. We have also exploited the unique dynamics of interlocked hosts by demonstrating that an

  20. Are Ascaris lumbricoides and Ascaris suum a single species?

    Science.gov (United States)

    Leles, Daniela; Gardner, Scott L; Reinhard, Karl; Iñiguez, Alena; Araujo, Adauto

    2012-02-20

    Since the original description and naming of Ascaris lumbricoides from humans by Linnaeus in 1758 and later of Ascaris suum from pigs by Goeze 1782, these species have been considered to be valid. Four hypotheses relative to the conspecificity or lack thereof (and thus origin of these species) are possible: 1) Ascaris lumbricoides (usually infecting humans) and Ascaris suum (recorded mostly from pigs) are both valid species, with the two species originating via a speciation event from a common ancestor sometime before the domestication of pigs by humans, or 2) Ascaris lumbricoides in humans is derived directly from the species A. suum found in pigs with A. suum then existing as a persistent ancestor after formation of A. lumbricoides, or 3) Ascaris suum is derived directly from A. lumbricoides with the persistent ancestor being A. lumbricoides and A. suum being the newly derived species, and finally, 4) Ascaris lumbricoides and A. suum are the same species, this hypothesis being supported by studies showing both low morphological and low genetic divergence at several genes. We present and discuss paleoparasitological and genetic evidence that complement new data to evaluate the origin and evolution of Ascaris spp. in humans and pigs, and the uniqueness of the species in both hosts. Finally, we conclude that Ascaris lumbricoides and A. suum are a single species and that the name A. lumbricoides Linnaeus 1758 has taxonomic priority; therefore A. suum Goeze 1782 should be considered a synonym of A. lumbricoides.

  1. Trophic Relationships between the Parasitic Plant Species Phelipanche ramosa (L.) and Different Hosts Depending on Host Phenological Stage and Host Growth Rate

    Science.gov (United States)

    Moreau, Delphine; Gibot-Leclerc, Stéphanie; Girardin, Annette; Pointurier, Olivia; Reibel, Carole; Strbik, Florence; Fernández-Aparicio, Mónica; Colbach, Nathalie

    2016-01-01

    Phelipanche ramosa (L.) Pomel (branched broomrape) is a holoparasitic plant that reproduces on crops and also on weeds, which contributes to increase the parasite seed bank in fields. This parasite extracts all its nutrients at the host’s expense so that host–parasite trophic relationships are crucial to determine host and parasite growth. This study quantified the intensity with which P. ramosa draws assimilates from its host and analyzed whether it varied with host species, host phenological stage and host growth rate. A greenhouse experiment was conducted on three host species: the crop species Brassica napus (L.) (oilseed rape) and two weed species, Capsella bursa-pastoris (L.) Medik. and Geranium dissectum (L.). Plants were grown with or without P. ramosa and under three light levels to modulate host growth rate. The proportion of host biomass loss due to parasitism by P. ramosa differed between host species (at host fructification, biomass loss ranged from 34 to 84%). B. napus and C. bursa-pastoris displayed a similar response to P. ramosa, probably because they belong to the same botanical family. The sensitivity to P. ramosa in each host species could be related to the precocity of P. ramosa development on them. Host compartments could be ranked as a function of their sensitivity to parasitism, with the reproductive compartment being the most severely affected, followed by stems and roots. The proportion of biomass allocated to leaves was not reduced by parasitism. The proportion of pathosystem biomass allocated to the parasite depended on host species. It generally increased with host stage progression but was constant across light induced-host growth rate, showing that P. ramosa adapts its growth to host biomass production. The rank order of host species in terms of sink strength differed from that in terms of host sensitivity. Finally, for B. napus, the biomass of individual parasite shoots decreased with increasing their number per host plant

  2. Colonization and infection with Trichosporon species in the immunosuppressed host.

    Science.gov (United States)

    Haupt, H M; Merz, W G; Beschorner, W E; Vaughan, W P; Saral, R

    1983-02-01

    Trichosporon beigelii and Trichosporon capitatum have recently been recognized as systemic pathogens in the immunosuppressed host. We studied the incidence of colonization and systemic infection with these organisms in 353 highly immunocompromised patients over a 37-month period. Thirteen patients (3.7%) had positive surveillance cultures for Trichosporon species in stool, skin, or urine. Three of the 13 patients developed systemic infections after having positive surveillance cultures. In two of these three patients, urine cultures were positive near the time of systemic infection. The route of entry appeared to have been enteric in two patients and cutaneous in one patient. Both colonizing and infecting organisms showed in vitro susceptibility to amphotericin B and nystatin. This study suggests that positive surveillance cultures for Trichosporon species may correlate with systemic infection in the severely immunocompromised patient and that repeated positive urine cultures may indicate dissemination.

  3. Do parasitic trematode cercariae demonstrate a preference for susceptible host species?

    Directory of Open Access Journals (Sweden)

    Brittany F Sears

    Full Text Available Many parasites are motile and exhibit behavioural preferences for certain host species. Because hosts can vary in their susceptibility to infections, parasites might benefit from preferentially detecting and infecting the most susceptible host, but this mechanistic hypothesis for host-choice has rarely been tested. We evaluated whether cercariae (larval trematode parasites prefer the most susceptible host species by simultaneously presenting cercariae with four species of tadpole hosts. Cercariae consistently preferred hosts in the following order: Anaxyrus ( = Bufo terrestris (southern toad, Hyla squirella (squirrel tree frog, Lithobates ( = Rana sphenocephala (southern leopard frog, and Osteopilus septentrionalis (Cuban tree frog. These host species varied in susceptibility to cercariae in an order similar to their attractiveness with a correlation that approached significance. Host attractiveness to parasites also varied consistently and significantly among individuals within a host species. If heritable, this individual-level host variation would represent the raw material upon which selection could act, which could promote a Red Queen "arms race" between host cues and parasite detection of those cues. If, in general, motile parasites prefer to infect the most susceptible host species, this phenomenon could explain aggregated distributions of parasites among hosts and contribute to parasite transmission rates and the evolution of virulence. Parasite preferences for hosts belie the common assumption of disease models that parasites seek and infect hosts at random.

  4. Identifying the Achilles heel of multi-host pathogens : the concept of keystone 'host' species illustrated by Mycobacterium ulcerans transmission

    OpenAIRE

    Roche, Benjamin; Benbow, M. E.; Merritt, R.; Kimbirauskas, R.; McIntosh, M.; Small, P. L. C.; Williamson, H.; Guégan, Jean-François

    2013-01-01

    Pathogens that use multiple host species are an increasing public health issue due to their complex transmission, which makes them difficult to mitigate. Here, we explore the possibility of using networks of ecological interactions among potential host species to identify the particular disease-source species to target to break down transmission of such pathogens. We fit a mathematical model on prevalence data of Mycobacterium ulcerans in western Africa and we show that removing the most abun...

  5. Single-species microarrays and comparative transcriptomics.

    Directory of Open Access Journals (Sweden)

    Frédéric J J Chain

    Full Text Available BACKGROUND: Prefabricated expression microarrays are currently available for only a few species but methods have been proposed to extend their application to comparisons between divergent genomes. METHODOLOGY/PRINCIPAL FINDINGS: Here we demonstrate that the hybridization intensity of genomic DNA is a poor basis on which to select unbiased probes on Affymetrix expression arrays for studies of comparative transcriptomics, and that doing so produces spurious results. We used the Affymetrix Xenopus laevis microarray to evaluate expression divergence between X. laevis, X. borealis, and their F1 hybrids. When data are analyzed with probes that interrogate only sequences with confirmed identity in both species, we recover results that differ substantially analyses that use genomic DNA hybridizations to select probes. CONCLUSIONS/SIGNIFICANCE: Our findings have implications for the experimental design of comparative expression studies that use single-species microarrays, and for our understanding of divergent expression in hybrid clawed frogs. These findings also highlight important limitations of single-species microarrays for studies of comparative transcriptomics of polyploid species.

  6. Host phylogeny constrains cross-species emergence and establishment of rabies virus in bats.

    Science.gov (United States)

    Streicker, Daniel G; Turmelle, Amy S; Vonhof, Maarten J; Kuzmin, Ivan V; McCracken, Gary F; Rupprecht, Charles E

    2010-08-06

    For RNA viruses, rapid viral evolution and the biological similarity of closely related host species have been proposed as key determinants of the occurrence and long-term outcome of cross-species transmission. Using a data set of hundreds of rabies viruses sampled from 23 North American bat species, we present a general framework to quantify per capita rates of cross-species transmission and reconstruct historical patterns of viral establishment in new host species using molecular sequence data. These estimates demonstrate diminishing frequencies of both cross-species transmission and host shifts with increasing phylogenetic distance between bat species. Evolutionary constraints on viral host range indicate that host species barriers may trump the intrinsic mutability of RNA viruses in determining the fate of emerging host-virus interactions.

  7. Type IV Effector Secretion and Subversion of Host Functions by Bartonella and Brucella Species.

    Science.gov (United States)

    Dehio, Christoph; Tsolis, Renée M

    2017-01-01

    Bartonella and Brucella species comprise closely related genera of the order Rhizobiales within the class α-proteobacteria. Both groups of bacteria are mammalian pathogens with a facultative intracellular lifestyle and are capable of causing chronic infections, but members of each genus have evolved broadly different infection and transmission strategies. While Brucella spp. transmit in general via the reproductive tract in their natural hosts, the Bartonella spp. have evolved to transmit via arthropod vectors. However, a shared feature of both groups of pathogens is their reliance on type IV secretion systems (T4SSs) to interact with cells in their mammalian hosts. The genomes of Bartonella spp. encode three types of T4SS, Trw, Vbh/TraG, and VirB/VirD4, whereas those of Brucella spp. uniformly contain a single T4SS of the VirB type. The VirB systems of Bartonella and Brucella are associated with distinct groups of effector proteins that collectively mediate interactions with host cells. This chapter discusses recent findings on the role of T4SS in the biology of Bartonella spp. and Brucella spp. with emphasis on effector repertoires, on recent advances in our understanding of their evolution, how individual effectors function at the molecular level, and on the consequences of these interactions for cellular and immune responses in the host.

  8. Codivergence and multiple host species use by fig wasp populations of the Ficus pollination mutualism

    Directory of Open Access Journals (Sweden)

    McLeish Michael J

    2012-01-01

    Full Text Available Abstract Background The interaction between insects and plants takes myriad forms in the generation of spectacular diversity. In this association a species host range is fundamental and often measured using an estimate of phylogenetic concordance between species. Pollinating fig wasps display extreme host species specificity, but the intraspecific variation in empirical accounts of host affiliation has previously been underestimated. In this investigation, lineage delimitation and codiversification tests are used to generate and discuss hypotheses elucidating on pollinating fig wasp associations with Ficus. Results Statistical parsimony and AMOVA revealed deep divergences at the COI locus within several pollinating fig wasp species that persist on the same host Ficus species. Changes in branching patterns estimated using the generalized mixed Yule coalescent test indicated lineage duplication on the same Ficus species. Conversely, Elisabethiella and Alfonsiella fig wasp species are able to reproduce on multiple, but closely related host fig species. Tree reconciliation tests indicate significant codiversification as well as significant incongruence between fig wasp and Ficus phylogenies. Conclusions The findings demonstrate more relaxed pollinating fig wasp host specificity than previously appreciated. Evolutionarily conservative host associations have been tempered by horizontal transfer and lineage duplication among closely related Ficus species. Independent and asynchronistic diversification of pollinating fig wasps is best explained by a combination of both sympatric and allopatric models of speciation. Pollinator host preference constraints permit reproduction on closely related Ficus species, but uncertainty of the frequency and duration of these associations requires better resolution.

  9. Expression differences in Aphidius ervi (Hymenoptera: Braconidae females reared on different aphid host species

    Directory of Open Access Journals (Sweden)

    Gabriel I. Ballesteros

    2017-08-01

    Full Text Available The molecular mechanisms that allow generalist parasitoids to exploit many, often very distinct hosts are practically unknown. The wasp Aphidius ervi, a generalist koinobiont parasitoid of aphids, was introduced from Europe into Chile in the late 1970s to control agriculturally important aphid species. A recent study showed significant differences in host preference and host acceptance (infectivity depending on the host A. ervi were reared on. In contrast, no genetic differentiation between A. ervi populations parasitizing different aphid species and aphids of the same species reared on different host plants was found in Chile. Additionally, the same study did not find any fitness effects in A. ervi if offspring were reared on a different host as their mothers. Here, we determined the effect of aphid host species (Sitobion avenae versus Acyrthosiphon pisum reared on two different host plants alfalfa and pea on the transcriptome of adult A. ervi females. We found a large number of differentially expressed genes (between host species: head: 2,765; body: 1,216; within the same aphid host species reared on different host plants: alfalfa versus pea: head 593; body 222. As expected, the transcriptomes from parasitoids reared on the same host species (pea aphid but originating from different host plants (pea versus alfalfa were more similar to each other than the transcriptomes of parasitoids reared on a different aphid host and host plant (head: 648 and 1,524 transcripts; body: 566 and 428 transcripts. We found several differentially expressed odorant binding proteins and olfactory receptor proteins in particular, when we compared parasitoids from different host species. Additionally, we found differentially expressed genes involved in neuronal growth and development as well as signaling pathways. These results point towards a significant rewiring of the transcriptome of A. ervi depending on aphid-plant complex where parasitoids develop, even if

  10. Species-specific genes under selection characterize the co-evolution of slavemaker and host lifestyles.

    Science.gov (United States)

    Feldmeyer, B; Elsner, D; Alleman, A; Foitzik, S

    2017-12-04

    The transition to a parasitic lifestyle entails comprehensive changes to the selective regime. In parasites, genes encoding for traits that facilitate host detection, exploitation and transmission should be under selection. Slavemaking ants are social parasites that exploit the altruistic behaviour of their hosts by stealing heterospecific host brood during raids, which afterwards serve as slaves in slavemaker nests. Here we search for evidence of selection in the transcriptomes of three slavemaker species and three closely related hosts. We expected selection on genes underlying recognition and raiding or defense behaviour. Analyses of selective forces in species with a slavemaker or host lifestyle allowed investigation into whether or not repeated instances of slavemaker evolution share the same genetic basis. To investigate the genetic basis of host-slavemaker co-evolution, we created orthologous clusters from transcriptome sequences of six Temnothorax ant species - three slavemakers and three hosts - to identify genes with signatures of selection. We further tested for functional enrichment in selected genes from slavemakers and hosts respectively and investigated which pathways the according genes belong to. Our phylogenetic analysis, based on more than 5000 ortholog sequences, revealed sister species status for two slavemakers as well as two hosts, contradicting a previous phylogeny based on mtDNA. We identified 309 genes with signs of positive selection on branches leading to slavemakers and 161 leading to hosts. Among these were genes potentially involved in cuticular hydrocarbon synthesis, thus species recognition, and circadian clock functionality possibly explaining the different activity patterns of slavemakers and hosts. There was little overlap of genes with signatures of positive selection among species, which are involved in numerous different functions and different pathways. We identified different genes, functions and pathways under positive

  11. Finding and recognition of the snail intermediate hosts by 3 species of echinostome cercariae.

    Science.gov (United States)

    Haas, W; Körner, M; Hutterer, E; Wegner, M; Haberl, B

    1995-02-01

    Finding and recognition of snail second intermediate hosts was studied in cercariae of 3 echinostome species. The cercariae of the 3 species accumulated in snail-conditioned water (SCW) with 2 types of orientation mechanisms and responded to different small molecular weight ( snails and to disperse. Attachments occurred specifically to snail hosts in the 3 species and were stimulated by macromolecular mucus compounds, probably mainly by viscoelastic properties of the mucus. The results of this study show, that host-finding mechanisms and the stimulating host cues of snail invading echinostome cercariae differ considerably from those of schistosome miracidia.

  12. Cactoblastis cactorum (Berg) (Lepidoptera: Pyralidae) use of Opuntia host species in Argentina

    Science.gov (United States)

    A central aspect in biology and ecology is to determine the combination of factors that influence the distribution of species. In the case of herbivorous insects, the distribution of herbivorous species is necessarily associated with their host plants, a pattern often referred to as “host use”. Nove...

  13. Plant-associated odor perception and processing in two parasitoid species with different degrees of host specificity: Implications for host location strategies.

    Science.gov (United States)

    Das, Prithwiraj; Morawo, Tolulope; Fadamiro, Henry

    2017-08-01

    Microplitis croceipes and Cotesia marginiventris (Hymenoptera: Braconidae) are parasitoids of lepidopteran larvae with different degrees of host specificity. Both parasitoid species rely on host-related plant volatiles as odor cues to locate their herbivore hosts. To better understand mechanisms of odor processing in parasitoids, we tested responses of olfactory sensory neurons (OSNs) in the antennal sensilla placodea of female parasitoids to select plant volatiles and mixtures. The compounds tested include two green leaf volatiles (i.e., cis-3-hexenol and hexanal) and three herbivore-induced plant volatiles (i.e., cis-3-hexenyl butyrate, cis-3-hexenyl acetate and linalool). Single-sensillum recording showed that the test compounds elicited activity in large and small amplitude neurons housed in the short sensilla placodea of both parasitoid species. In general, C. marginiventris showed greater OSN responses to a low dose while M. croceipes showed greater responses to a high dose of test compounds. Binary mixtures of cis-3-hexenol and linalool inhibited OSN activity in M. croceipes, but not in C. marginiventris. These differences may have implications for odor discrimination in the two parasitoid species. In addition, anterograde neurobiotin stainings were performed to map glomerular projections of OSNs in the antennal lobe of the parasitoids. In M. croceipes, a mixture of cis-3-hexenol and linalool inhibited activity of the glomerulus activated by cis-3-hexenol alone. In C. marginiventris, a mixture of cis-3-hexenol and cis-3-hexenyl acetate showed intense labeling in their respective glomeruli, possibly suggesting a synergistic interaction. These differences in detection and coding of single compounds and mixtures may impact host location strategies in the two parasitoid species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Morphometric variation in Periglischrus torrealbai (Acari: Spinturnicidae) on three species of host bats (Chiroptera: Phyllostomidae) with a new record of host species.

    Science.gov (United States)

    de Almeida, Juliana Cardoso; Gomes, Luiz Antonio Costa; Owen, Robert D

    2018-01-01

    We evaluated morphometric variation of the mite Periglischrus torrealbai (Spinturnicidae) on three species of host bats: Phyllostomus discolor, P. hastatus, and Tonatia bidens (Phyllostomidae). A total of 67 females and 74 males of P. torrealbai were collected from 41 host individuals of these three bat species that were sampled in Brazil, Paraguay, and Peru. Twenty-one measurements from the dorsal side and 28 from the ventral side were recorded from female mites and 21 dorsal and 34 ventral measurements were taken from males. To evaluate morphological variation of P. torrealbai on different species of host bats, principal component analysis and unweighted pair-group method using arithmetic averages cluster analysis with Euclidean distances were used. Both analyses showed three groups of mites clearly separated: group 1 comprised all ectoparasites collected from T. bidens, group 2 included all mites from P. hastatus, and group 3 had all those from P. discolor. This result indicates that P. torrealbai varies morphologically by host bat species and suggests that this nominal species comprises three morphologically distinct species. In the present study, we record for the first time, the association between P. torrealbai and T. bidens. Our data reinforce the high relationship of specificity between Periglischrus mites and phyllostomid bat species.

  15. Host preferences and differential contributions of deciduous tree species shape mycorrhizal species richness in a mixed Central European forest.

    Science.gov (United States)

    Lang, Christa; Seven, Jasmin; Polle, Andrea

    2011-05-01

    Mycorrhizal species richness and host ranges were investigated in mixed deciduous stands composed of Fagus sylvatica, Tilia spp., Carpinus betulus, Acer spp., and Fraxinus excelsior. Acer and Fraxinus were colonized by arbuscular mycorrhizas and contributed 5% to total stand mycorrhizal fungal species richness. Tilia hosted similar and Carpinus half the number of ectomycorrhizal (EM) fungal taxa compared with Fagus (75 putative taxa). The relative abundance of the host tree the EM fungal richness decreased in the order Fagus > Tilia > Carpinus. After correction for similar sampling intensities, EM fungal species richness of Carpinus was still about 30-40% lower than that of Fagus and Tilia. About 10% of the mycorrhizal species were shared among the EM forming trees; 29% were associated with two host tree species and 61% with only one of the hosts. The latter group consisted mainly of rare EM fungal species colonizing about 20% of the root tips and included known specialists but also putative non-host associations such as conifer or shrub mycorrhizas. Our data indicate that EM fungal species richness was associated with tree identity and suggest that Fagus secures EM fungal diversity in an ecosystem since it shared more common EM fungi with Tilia and Carpinus than the latter two among each other.

  16. Fish population studies using parasites from the Southeastern Pacific Ocean: considering host population changes and species body size as sources of variability of parasite communities.

    Science.gov (United States)

    George-Nascimento, Mario; Oliva, Marcelo

    2015-01-01

    Research using parasites in fish population studies in the South Eastern Pacific (SEP) is summarized. There are 27 such studies (snapshots mainly) in single host species sampled at different geographic localities and at somewhat similar times. They have been devoted mainly to economically important species, though others on coastal and intertidal fish or on less- or non-commercial species provide insights on scales of temporal and spatial variation of parasite infracommunities. Later, we assess whether the probability of harbouring parasites depends on the host species body size. Our results indicate that a stronger tool for fish population studies may be developed under regular (long term) scrutiny of parasite communities, especially of small fish host species, due to their larger variability in richness, abundance and total biomass, than in large fish species. Finally, it might also be necessary to consider the effects of fishing on parasite communities as well as the natural oscillations (coupled or not) of host and parasite populations.

  17. Infection of non-host model plant species with the narrow-host-range Cacao swollen shoot virus.

    Science.gov (United States)

    Friscina, Arianna; Chiappetta, Laura; Jacquemond, Mireille; Tepfer, Mark

    2017-02-01

    Cacao swollen shoot virus (CSSV) is a major pathogen of cacao (Theobroma cacao) in Africa, and long-standing efforts to limit its spread by the culling of infected trees have had very limited success. CSSV is a particularly difficult virus to study, as it has a very narrow host range, limited to several tropical tree species. Furthermore, the virus is not mechanically transmissible, and its insect vector can only be used with difficulty. Thus, the only efficient means to infect cacao plants that have been experimentally described so far are by particle bombardment or the agroinoculation of cacao plants with an infectious clone. We have genetically transformed three non-host species with an infectious form of the CSSV genome: two experimental hosts widely used in plant virology (Nicotiana tabacum and N. benthamiana) and the model species Arabidopsis thaliana. In transformed plants of all three species, the CSSV genome was able to replicate, and, in tobacco, CSSV particles could be observed by immunosorbent electron microscopy, demonstrating that the complete virus cycle could be completed in a non-host plant. These results will greatly facilitate the preliminary testing of CSSV control strategies using plants that are easy to raise and to transform genetically. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  18. Higher gregarine parasitism often in sibling species of host damselflies with smaller geographical distributions

    OpenAIRE

    Mlynarek, JJ; Hassall, C; Forbes, MR

    2012-01-01

    1. This study investigated inter-specific variation in parasitism by gregarines (Eugregarinorida: Actinocephalidae), among sibling species of damselflies (Odonata: Zygoptera), in relation to relative size of geographical ranges of host species. 2. Gregarines are considered generalist parasites, particularly for taxonomically related host species collected at the same sites or area. Prevalence and median intensity of gregarine parasitism was obtained for 1338 adult damselflies, representing 14...

  19. Counting Legionella cells within single amoeba host cells

    Science.gov (United States)

    Here we present the first attempt to quantify L. pneumophila cell numbers within individual amoebae hosts that may be released into engineered water systems. The maximum numbers of culturable L. pneumophila cells grown within Acanthamoeba polyphaga and Naegleria fowleri were 134...

  20. Rapid combined characterization of microorganism and host genotypes using a single technology.

    Science.gov (United States)

    Hjalmarsson, Sandra; Alderborn, Anders; Fock, Caroline; Muldin, Ingrid; Kling, Helene; Uhlén, Mathias; Engstrand, Lars

    2004-04-01

    Genetic information is becoming increasingly important in diagnosis and prognosis of infectious diseases. In this study we investigated the possibility of using a single technology, the Pyrosequencing trade mark technology (Biotage AB, Uppsala, Sweden), to gather several kinds of important genetic information from the human pathogen Helicobacter pylori, as well as from the carrier of the H. pylori infection. DNA from 87 clinical isolates of H. pylori, 50 isolates from H. pylori-infected transgenic mice and nine gastric biopsies from H. pylori-infected patients was analyzed for targets in the 16S rRNA, 23S rRNA and cytotoxin associated gene A (cagA) genes to determine species identity, clarithromycin susceptibility and virulence level, respectively. In addition, three single nucleotide polymorphisms in the human interleukin-1B (IL-1B) gene, reported to affect the risk of developing gastric cancer, were analyzed in the gastric biopsy samples. All DNA targets were processed and analyzed in parallel, enabling convenient genetic characterization of both pathogen and host. All genotypes were easily and accurately assigned. In the 16S rRNA analysis, 99.83% of the bases were correctly called. We conclude that genetic analysis using Pyrosequencing trade mark technology was nonlaborious, and gave highly accurate data for different kinds of target. We therefore believe that this technology has the potential to complement or in the future substitute the time-consuming traditional microbial identification and typing methods, as well as enabling rapid typing of relevant host genetic markers.

  1. Characterization of viral RNA splicing using whole-transcriptome datasets from host species.

    Science.gov (United States)

    Zhou, Chengran; Liu, Shanlin; Song, Wenhui; Luo, Shiqi; Meng, Guanliang; Yang, Chentao; Yang, Hua; Ma, Jinmin; Wang, Liang; Gao, Shan; Wang, Jian; Yang, Huanming; Zhao, Yun; Wang, Hui; Zhou, Xin

    2018-02-19

    RNA alternative splicing (AS) is an important post-transcriptional mechanism enabling single genes to produce multiple proteins. It has been well demonstrated that viruses deploy host AS machinery for viral protein productions. However, knowledge on viral AS is limited to a few disease-causing viruses in model species. Here we report a novel approach to characterizing viral AS using whole transcriptome dataset from host species. Two insect transcriptomes (Acheta domesticus and Planococcus citri) generated in the 1,000 Insect Transcriptome Evolution (1KITE) project were used as a proof of concept using the new pipeline. Two closely related densoviruses (Acheta domesticus densovirus, AdDNV, and Planococcus citri densovirus, PcDNV, Ambidensovirus, Densovirinae, Parvoviridae) were detected and analyzed for AS patterns. The results suggested that although the two viruses shared major AS features, dramatic AS divergences were observed. Detailed analysis of the splicing junctions showed clusters of AS events occurred in two regions of the virus genome, demonstrating that transcriptome analysis could gain valuable insights into viral splicing. When applied to large-scale transcriptomics projects with diverse taxonomic sampling, our new method is expected to rapidly expand our knowledge on RNA splicing mechanisms for a wide range of viruses.

  2. Habitat requirements and host selectivity of Thesium species (Santalaceae)

    Czech Academy of Sciences Publication Activity Database

    Dostálek, T.; Münzbergová, Zuzana

    2010-01-01

    Roč. 164, č. 4 (2010), s. 394-408 ISSN 0024-4074 R&D Projects: GA MŠk 2B06178; GA ČR GD206/08/H049 Institutional research plan: CEZ:AV0Z60050516 Keywords : hemiparasites * host range and specifity * Santalales Subject RIV: EF - Botanics Impact factor: 1.931, year: 2010

  3. Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.

    Science.gov (United States)

    Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C

    2017-04-15

    Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and

  4. Host plant use among closely related Anaea butterfly species (Lepidoptera, Nymphalidae, Charaxinae

    Directory of Open Access Journals (Sweden)

    QUEIROZ J. M.

    2002-01-01

    Full Text Available There is a great number of Charaxinae (Lepidoptera: Nymphalidae species in the tropics whose larvae feed on several plant families. However the genus Anaea is almost always associated with Croton species (Euphorbiaceae. This work describes patterns of host plant use by immature and adult abundance on different vertical strata of sympatric Anaea species in a forest of Southeastern Brazil. Quantitative samples of leaves were taken in April/1999 and May/2000 to collect eggs and larvae of four Anaea species on C.alchorneicarpus, C. floribundus and C. salutaris in a semideciduous forest. Sampled leaves were divided into three classes of plant phenological stage: saplings, shrubs and trees. The results showed that the butterfly species are segregating in host plant use on two scales: host plant species and plant phenological stages. C. alchorneicarpus was used by only one Anaea species, whereas C. floribundus was used by three species and C. salutaris by four Anaea species. There was one Anaea species concentrated on sapling, another on sapling/shrub and two others on shrub/tree leaves. Adults of Anaea were more frequent at canopy traps but there were no differences among species caught in traps at different vertical positions. This work supplements early studies on host plant use among Charaxinae species and it describes how a guild of closely related butterfly species may be organized in a complex tropical habitat.

  5. Seasonal changes in infection with trematode species utilizing jellyfish as hosts: evidence of transmission to definitive host fish via medusivory.

    Science.gov (United States)

    Kondo, Yusuke; Ohtsuka, Susumu; Hirabayashi, Takeshi; Okada, Shoma; Ogawa, Nanako O; Ohkouchi, Naohiko; Shimazu, Takeshi; Nishikawa, Jun

    2016-01-01

    In the Seto Inland Sea of western Japan, metacercariae of three species of trematodes, Lepotrema clavatum Ozaki, 1932, Cephalolepidapedon saba Yamaguti, 1970, and Opechona olssoni (Yamaguti, 1934), were found in the mesoglea of the jellyfish Aurelia aurita s.l., Chrysaora pacifica, and Cyanea nozakii. Moreover, these jellyfish frequently harbored juveniles of the fish species Psenopsis anomala, Thamnaconus modestus, and Trachurus japonicus. The former two fish species are well-known medusivores. We investigated seasonal changes in the prevalence and intensity of these metacercariae in their host jellyfish from March 2010 to September 2012 and presumed that infection by the trematodes of the definitive host fish occurs through these associations. The mean intensity of metacercariae in A. aurita s.l. clearly showed seasonality, being consistently high in June of each year. The intensity of metacercariae in C. nozakii was highest among all jellyfish hosts and appeared to be enhanced by medusivory of this second intermediate, and/or paratenic host. Trophic interactions between jellyfish and associated fish were verified using both gut content and stable isotope analyses. The detection of trematodes and nematocysts in the guts of P. anomala and T. modestus juveniles, in addition to stable isotope analysis, suggests that transmission of the parasites occurs via prey-predator relationships. In addition, the stable isotope analysis also suggested that P. anomala is more nutritionally dependent on jellyfish than Th. modestus and Tr. japonicus. © Y. Kondo et al., published by EDP Sciences, 2016.

  6. Seasonal changes in infection with trematode species utilizing jellyfish as hosts: evidence of transmission to definitive host fish via medusivory

    Directory of Open Access Journals (Sweden)

    Kondo Yusuke

    2016-01-01

    Full Text Available In the Seto Inland Sea of western Japan, metacercariae of three species of trematodes, Lepotrema clavatum Ozaki, 1932, Cephalolepidapedon saba Yamaguti, 1970, and Opechona olssoni (Yamaguti, 1934, were found in the mesoglea of the jellyfish Aurelia aurita s.l., Chrysaora pacifica, and Cyanea nozakii. Moreover, these jellyfish frequently harbored juveniles of the fish species Psenopsis anomala, Thamnaconus modestus, and Trachurus japonicus. The former two fish species are well-known medusivores. We investigated seasonal changes in the prevalence and intensity of these metacercariae in their host jellyfish from March 2010 to September 2012 and presumed that infection by the trematodes of the definitive host fish occurs through these associations. The mean intensity of metacercariae in A. aurita s.l. clearly showed seasonality, being consistently high in June of each year. The intensity of metacercariae in C. nozakii was highest among all jellyfish hosts and appeared to be enhanced by medusivory of this second intermediate, and/or paratenic host. Trophic interactions between jellyfish and associated fish were verified using both gut content and stable isotope analyses. The detection of trematodes and nematocysts in the guts of P. anomala and T. modestus juveniles, in addition to stable isotope analysis, suggests that transmission of the parasites occurs via prey-predator relationships. In addition, the stable isotope analysis also suggested that P. anomala is more nutritionally dependent on jellyfish than Th. modestus and Tr. japonicus.

  7. Molecular phylogenetic assessment of host range in five Dermanyssus species

    NARCIS (Netherlands)

    Roy, L.; Dowling, A.P.G.; Chauve, C.M.; Lesna, I.; Sabelis, M.W.; Buronfosse, T.

    2009-01-01

    Given that 14 out of the 25 currently described species of Dermanyssus Dugès, 1834, are morphologically very close to each another, misidentifications may occur and are suspected in at least some records. One of these 14 species is the red fowl mite, D. gallinae (De Geer, 1778), a blood parasite of

  8. CONDITIONS FOR COEXISTENCE OF FRESHWATER MUSSEL SPECIES VIA PARTITIONING OF FISH HOST RESOURCES

    Science.gov (United States)

    Riverine freshwater mussel species can be found in highly diverse communities where many similar species coexist. Mussel species potentially compete for food and space as adults, and for fish host resources during the larval (glochidial) stage. Resource partitioning at the larv...

  9. A Single Residue in Ebola Virus Receptor NPC1 Influences Cellular Host Range in Reptiles.

    Science.gov (United States)

    Ndungo, Esther; Herbert, Andrew S; Raaben, Matthijs; Obernosterer, Gregor; Biswas, Rohan; Miller, Emily Happy; Wirchnianski, Ariel S; Carette, Jan E; Brummelkamp, Thijn R; Whelan, Sean P; Dye, John M; Chandran, Kartik

    2016-01-01

    viper NPC1. This resistance to infection can be mapped to a single amino acid residue in viper NPC1 that renders it unable to bind to EBOV GP. The newly solved structure of EBOV GP bound to NPC1 confirms our findings, revealing that this residue dips into the GP receptor-binding pocket and is therefore critical to the binding interface. Consequently, this otherwise well-conserved residue in vertebrate species influences the ability of reptilian NPC1 proteins to bind to EBOV GP, thereby affecting viral host range in reptilian cells.

  10. Identifying the Achilles' heel of multi-host pathogens: The concept of keystone "host" species illustrated by Mycobacterium ulcerans transmission.

    Science.gov (United States)

    Roche, Benjamin; Benbow, M Eric; Merritt, Richard; Kimbirauskas, Ryan; McIntosh, Mollie; Small, Pamela L C; Williamson, Heather; Guégan, Jean-François

    2013-01-01

    Pathogens that use multiple host species are an increasing public health issue due to their complex transmission, which makes them difficult to mitigate. Here, we explore the possibility of using networks of ecological interactions among potential host species to identify the particular disease-source species to target to break down transmission of such pathogens. We fit a mathematical model on prevalence data of Mycobacterium ulcerans in western Africa and we show that removing the most abundant taxa for this category of pathogen is not an optimal strategy to decrease the transmission of the mycobacterium within aquatic ecosystems. On the contrary, we reveal that the removal of some taxa, especially Oligochaeta worms, can clearly reduce rates of pathogen transmission and should be considered as a keystone organism for its transmission because it leads to a substantial reduction in pathogen prevalence regardless of the network topology. Besides its potential application for the understanding of M. ulcerans ecology, we discuss about how networks of species interactions can modulate transmission of multi-host pathogens.

  11. Mapping host-species abundance of three major exotic forest pests

    Science.gov (United States)

    Randall S. Morin; Andrew M. Liebhold; Eugene R. Luzader; Andrew J. Lister; Kurt W. Gottschalk; Daniel B. Twardus

    2005-01-01

    Periodically over the last century, forests of the Eastern United States devastated by invasive pests. We used existing data to predict the geographical extent of future damage from beech bark disease (BBD), hemlock woolly adelgid (HWA), and gypsy moth. The distributions of host species of these alien pests were mapped in 1-km2 cells by interpolating host basal area/ha...

  12. Diversity, distribution and host-species associations of epiphytic orchids in Nepal

    Czech Academy of Sciences Publication Activity Database

    Timsina, B.; Rokaya, Maan Bahadur; Münzbergová, Zuzana; Kindlmann, P.; Shrestha, B.; Bhattarai, B.; Raskoti, B. B.

    2016-01-01

    Roč. 25, č. 13 (2016), s. 2803-2819 ISSN 0960-3115 Institutional support: RVO:67985939 Keywords : species richness * host * Nepal Himalaya Subject RIV: EF - Botanics Impact factor: 2.265, year: 2016

  13. Cross-Species Virus-Host Protein-Protein Interactions Inhibiting Innate Immunity

    Science.gov (United States)

    2016-07-01

    of zoonotic viruses acquiring new host species , including humans. This news story was prompted by the emergence of the Middle Eastern Respiratory...infectious diseases are viral in nature and involve a host species jump from animals to humans. Many factors may contribute to (re-) emergence of viral...widespread morbidity and mortality, with new strains emerging from animal reservoirs possessing the potential to cause pandemics. The influenza A RNA

  14. KEY TO THE POWDERY MILDEW SPECIES ON THE BASIS OF THE HOST PLANT FAMILIES AND GENERA

    Directory of Open Access Journals (Sweden)

    E. V. Rakhimova

    2015-05-01

    Full Text Available Key on the basis of the host plant taxonomy, symptoms of the infected plants and microscopic features of fungi was composed for identification of powdery mildews of the Kazakhstan. Features, which were used for identification of fungus, were the number of asci in cleistothecium, the number of ascospores in ascus and the type of appendages of cleistothecium. Key was composed for 81 species and 25 variations of Erysiphales fungi, infecting 739 species of host plants, which belong to 305 genera.

  15. Padus serotina (Rosaceae, a new host plant for some species of parasitic microfungi

    Directory of Open Access Journals (Sweden)

    Nałgorzata Ruszkiewicz-Michalska

    2014-08-01

    Full Text Available Four species of parasitic microfungi were collected recenUy on Padus serotina (Ehrh. Borkh. (Rosaceae in Poland. Three species, Phyllactina guttata (Wallr. ex Fr. Lév. (Erysiphales, Monilia linhartiana Sacc. (Hyphomycetes, and Microsphaeropsis olivacea (Bonord. Höhn. (Coelomycetes, have not been reported before on thc plant, and Padus serotina is a new host for them. Monnilia linhartiana Sacc. is a new species for Poland. The fourth species, Podosphaera tridactyla (Wallr. de Baly var. tridactyla (Erysiphales, is known only from three localities in Europe, and has been collected on the host plant in Poland for the first time.

  16. Recurrent evolution of host and vector association in bacteria of the Borrelia burgdorferi sensu lato species complex.

    Science.gov (United States)

    Becker, Noémie S; Margos, Gabriele; Blum, Helmut; Krebs, Stefan; Graf, Alexander; Lane, Robert S; Castillo-Ramírez, Santiago; Sing, Andreas; Fingerle, Volker

    2016-09-15

    The Borrelia burgdorferi sensu lato (s.l.) species complex consists of tick-transmitted bacteria and currently comprises approximately 20 named and proposed genospecies some of which are known to cause Lyme Borreliosis. Species have been defined via genetic distances and ecological niches they occupy. Understanding the evolutionary relationship of species of the complex is fundamental to explaining patterns of speciation. This in turn forms a crucial basis to frame testable hypotheses concerning the underlying processes including host and vector adaptations. Illumina Technology was used to obtain genome-wide sequence data for 93 strains of 14 named genospecies of the B. burgdorferi species complex and genomic data already published for 18 additional strain (including one new species) was added. Phylogenetic reconstruction based on 114 orthologous single copy genes shows that the genospecies represent clearly distinguishable taxa with recent and still ongoing speciation events apparent in Europe and Asia. The position of Borrelia species in the phylogeny is consistent with host associations constituting a major driver for speciation. Interestingly, the data also demonstrate that vector associations are an additional driver for diversification in this tick-borne species complex. This is particularly obvious in B. bavariensis, a rodent adapted species that has diverged from the bird-associated B. garinii most likely in Asia. It now consists of two populations one of which most probably invaded Europe following adaptation to a new vector (Ixodes ricinus) and currently expands its distribution range. The results imply that genotypes/species with novel properties regarding host or vector associations have evolved recurrently during the history of the species complex and may emerge at any time. We suggest that the finding of vector associations as a driver for diversification may be a general pattern for tick-borne pathogens. The core genome analysis presented here

  17. Monogenean parasite species descriptions from Labeo spp. hosts in ...

    African Journals Online (AJOL)

    Specimens of Labeo capensis (n = 13) and Labeo umbratus (n = 26) from the Vaal Dam (South Africa) were collected and examined for gill and skin monogenean parasites. Three new Dactylogyrus and one new Dogielius species are described. Dactylogyrus iwani n.sp. (longer inner root on anchor and predominates on L.

  18. Characterization of Arabidopsis Transcriptional Responses to Different Aphid Species Reveals Genes that Contribute to Host Susceptibility and Non-host Resistance

    Science.gov (United States)

    Jaouannet, Maëlle; Morris, Jenny A.; Hedley, Peter E.; Bos, Jorunn I. B.

    2015-01-01

    Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants. PMID:25993686

  19. Characterization of Arabidopsis Transcriptional Responses to Different Aphid Species Reveals Genes that Contribute to Host Susceptibility and Non-host Resistance.

    Directory of Open Access Journals (Sweden)

    Maëlle Jaouannet

    2015-05-01

    Full Text Available Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants.

  20. No Effect of Host Species on Phenoloxidase Activity in a Mycophagous Beetle.

    Directory of Open Access Journals (Sweden)

    Vincent Formica

    Full Text Available Ecological immunology is an interdisciplinary field that helps elucidate interactions between the environment and immune response. The host species individuals experience have profound effects on immune response in many species of insects. However, this conclusion comes from studies of herbivorous insects even though species of mycophagous insects also inhabit many different host species. The goal of this study was to determine if fungal host species as well as individual, sex, body size, and host patch predict one aspect of immune function, phenoloxidase activity (PO. We sampled a metapopulation of Bolitotherus cornutus, a mycophagous beetle in southwestern Virginia. B. cornutus live on three species of fungus that differ in nutritional quality, social environment, and density. A filter paper phenoloxidase assay was used to quantify phenoloxidase activity. Overall, PO activity was significantly repeatable among individuals (0.57 in adult B. cornutus. While there was significant variance among individuals in PO activity, there were surprisingly no significant differences in PO activity among subpopulations, beetles living on different host species, or between the sexes; there was also no effect of body size. Our results suggest that other factors such as age, genotype, disease prevalence, or natal environment may be generating variance among individuals in PO activity.

  1. Single-Photon Source for Quantum Information Based on Single Dye Molecule Fluorescence in Liquid Crystal Host

    International Nuclear Information System (INIS)

    Lukishova, S.G.; Knox, R.P.; Freivald, P.; McNamara, A.; Boyd, R.W.; Stroud, Jr. C.R.; Schmid, A.W.; Marshall, K.L.

    2006-01-01

    This paper describes a new application for liquid crystals: quantum information technology. A deterministically polarized single-photon source that efficiently produces photons exhibiting antibunching is a pivotal hardware element in absolutely secure quantum communication. Planar-aligned nematic liquid crystal hosts deterministically align the single dye molecules which produce deterministically polarized single (antibunched) photons. In addition, 1-D photonic bandgap cholesteric liquid crystals will increase single-photon source efficiency. The experiments and challenges in the observation of deterministically polarized fluorescence from single dye molecules in planar-aligned glassy nematic-liquid-crystal oligomer as well as photon antibunching in glassy cholesteric oligomer are described for the first time

  2. Gene expression plasticity across hosts of an invasive scale insect species

    DEFF Research Database (Denmark)

    Christodoulides, Nicholas; Van Dam, Alex; Peterson, Daniel A.

    2017-01-01

    For plant-eating insects, we still have only a nascent understanding of the genetic basis of host-use promiscuity. Here, to improve that situation, we investigated host-induced gene expression plasticity in the invasive lobate lac scale insect, Paratachardina pseudolobata (Hemiptera: Keriidae). We...... were particularly interested in the differential expression of detoxification and effector genes, which are thought to be critical for overcoming a plant’s chemical defenses. We collected RNA samples from P. pseudolobata on three different host plant species, assembled transcriptomes de novo...... of several recently published studies of other plant-eating insect species. Thus, across plant-eating insect species, there may be a common set of gene expression changes that enable host-use promiscuity....

  3. Do host species evolve a specific response to slave-making ants?

    Directory of Open Access Journals (Sweden)

    Delattre Olivier

    2012-12-01

    Full Text Available Abstract Background Social parasitism is an important selective pressure for social insect species. It is particularly the case for the hosts of dulotic (so called slave-making ants, which pillage the brood of host colonies to increase the worker force of their own colony. Such raids can have an important impact on the fitness of the host nest. An arms race which can lead to geographic variation in host defenses is thus expected between hosts and parasites. In this study we tested whether the presence of a social parasite (the dulotic ant Myrmoxenus ravouxi within an ant community correlated with a specific behavioral defense strategy of local host or non-host populations of Temnothorax ants. Social recognition often leads to more or less pronounced agonistic interactions between non-nestmates ants. Here, we monitored agonistic behaviors to assess whether ants discriminate social parasites from other ants. It is now well-known that ants essentially rely on cuticular hydrocarbons to discriminate nestmates from aliens. If host species have evolved a specific recognition mechanism for their parasite, we hypothesize that the differences in behavioral responses would not be fully explained simply by quantitative dissimilarity in cuticular hydrocarbon profiles, but should also involve a qualitative response due to the detection of particular compounds. We scaled the behavioral results according to the quantitative chemical distance between host and parasite colonies to test this hypothesis. Results Cuticular hydrocarbon profiles were distinct between species, but host species did not show a clearly higher aggression rate towards the parasite than toward non-parasite intruders, unless the degree of response was scaled by the chemical distance between intruders and recipient colonies. By doing so, we show that workers of the host and of a non-host species in the parasitized site displayed more agonistic behaviors (bites and ejections towards parasite

  4. Do host species evolve a specific response to slave-making ants?

    Science.gov (United States)

    2012-01-01

    Background Social parasitism is an important selective pressure for social insect species. It is particularly the case for the hosts of dulotic (so called slave-making) ants, which pillage the brood of host colonies to increase the worker force of their own colony. Such raids can have an important impact on the fitness of the host nest. An arms race which can lead to geographic variation in host defenses is thus expected between hosts and parasites. In this study we tested whether the presence of a social parasite (the dulotic ant Myrmoxenus ravouxi) within an ant community correlated with a specific behavioral defense strategy of local host or non-host populations of Temnothorax ants. Social recognition often leads to more or less pronounced agonistic interactions between non-nestmates ants. Here, we monitored agonistic behaviors to assess whether ants discriminate social parasites from other ants. It is now well-known that ants essentially rely on cuticular hydrocarbons to discriminate nestmates from aliens. If host species have evolved a specific recognition mechanism for their parasite, we hypothesize that the differences in behavioral responses would not be fully explained simply by quantitative dissimilarity in cuticular hydrocarbon profiles, but should also involve a qualitative response due to the detection of particular compounds. We scaled the behavioral results according to the quantitative chemical distance between host and parasite colonies to test this hypothesis. Results Cuticular hydrocarbon profiles were distinct between species, but host species did not show a clearly higher aggression rate towards the parasite than toward non-parasite intruders, unless the degree of response was scaled by the chemical distance between intruders and recipient colonies. By doing so, we show that workers of the host and of a non-host species in the parasitized site displayed more agonistic behaviors (bites and ejections) towards parasite than toward non

  5. Relative geographic range of sibling species of host damselflies does not reliably predict differential parasitism by water mites.

    Science.gov (United States)

    Mlynarek, Julia J; Knee, Wayne; Forbes, Mark R

    2013-12-18

    One of the main challenges in evolutionary parasitology is to determine the factors that explain variation among host species in parasitism. In this study, we addressed whether host phylogeny or ecology was important in determining host species use by water mites. Parasitism (prevalence and intensity) by Arrenurus water mites was examined in relation to geographic distribution of host damselflies from sibling species pairs. In addition, the likelihood of putative mite species parasitizing both species of a host species pair was explored. A total of 1162 damselflies were examined for water mites across four sites in Southeastern Ontario. These damselflies represent ten species (five closely related host species pairs) in the Coenagrionidae. Only two of the five species pairs showed near significant or significant differences in prevalence of infection by mites. In one of those species comparisons, it was the less widespread host that had higher water mite prevalence and in the other species comparison, the less widespread host species had lower water mite prevalence. Only one of the five pairs showed a significant difference in intensity of infection; intensity was higher in the species with a smaller geographic distribution. Based on the COI barcode, there were nine water mite clades (OTU) infecting these ten host species. Three Arrenurus OTUs may be host monospecific, four OTUs were specific to a given host species pair, and two OTUs infected at least three host species. Host species in each species pairs tend to share at least one of the Arrenurus OTU. No striking differences in mite species diversity were found among species in any species pair. Finally, the Arrenurus examined in this study appear to be ecological specialists, restricted to a particular type of habitat, parasitizing few to many of the host species present in that site or habitat. Although differences in levels of parasitism by water mites exist for some closely related hosts species, no such

  6. Leuconostoc mesenteroides and Leuconostoc pseudomesenteroides bacteriophages: Genomics and cross-species host ranges.

    Science.gov (United States)

    Pujato, Silvina A; Guglielmotti, Daniela M; Martínez-García, Manuel; Quiberoni, Andrea; Mojica, Francisco J M

    2017-09-18

    Unveiling virus-host interactions are relevant for understanding the biology and evolution of microbes globally, but in particular, it has also a paramount impact on the manufacture of fermented dairy products. In this study, we aim at characterizing phages infecting the commonly used heterofermentative Leuconostoc spp. on the basis of host range patterns and genome analysis. Host range of six Leuconostoc phages was investigated using three methods (efficiency of plaquing, spot and turbidity tests) against Ln. mesenteroides and Ln. pseudomesenteroides strains. Complete genome sequencing from four out of the six studied Leuconostoc phages were obtained in this work, while the remaining two have been sequenced previously. According to our results, cross-species host specificity was demonstrated, as all phages tested were capable of infecting both Ln. pseudomesenteroides and Ln. mesenteroides strains, although with different efficiency of plaquing (EOP). Phage adsorption rates and ability of low-EOP host strains to propagate phages by crossing the Leuconostoc species' barrier confirm results. At the genome level, phages CHA, CHB, Ln-7, Ln-8 and Ln-9 revealed high similarity with previously characterized phages infecting mostly Ln. mesenteroides strains, while phage LDG was highly similar to phages infecting Ln. pseudomesenteroides. Additionally, correlation between receptor binding protein (RBP) and host range patterns allowed us to unveil a finer clustering of Leuconostoc phages studied into four groups. This is the first report of overlapped phage host ranges between Leuconostoc species. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Molecular approaches identify known species, reveal cryptic species and verify host specificity of Chinese Philotrypesis (Hymenoptera: Pteromalidae).

    Science.gov (United States)

    Zhou, Mei-Jiao; Xiao, Jin-Hua; Bian, Sheng-Nan; Li, Yan-Wei; Niu, Li-Ming; Hu, Hao-Yuan; Wu, Wen-Shan; Murphy, Robert W; Huang, Da-Wei

    2012-07-01

    Philotrypesis, a major component of the fig wasp community (Hymenoptera: Pteromalidae), is a model taxon for studying male fighting and mating behaviour. Its extreme sexual dimorphism and male polymorphism render species identification uncertain and in-depth research on its ecology, behaviour and other evolutionary topics challenging. The fig wasps' enclosed habitat within the syconia makes their mating behaviour inaccessible, to the extent of matching conspecific females and males. In this study, we combine morphological and molecular analyses to identify species of Philotrypesis sampled from south China and to associate their extraordinarily dimorphic genders and labile male morphologies. Morphological evaluations of females identify 22 species and 28 male morphs. The mitochondrial cytochrome c oxidase I and nuclear internal transcribed spacer 2 data detect 21 species using females, and 15 species among the males. Most of the males match the species as delimited by females. Both markers reveal cryptic species in P. quadrisetosa on Ficus vasculosa. Most species of wasps live on one species of fig but three species co-occur in two hosts (F. microcarpa and F. benjamina), which indicates host switching. © 2012 Blackwell Publishing Ltd.

  8. How do PrPSc Prions Spread between Host Species, and within Hosts?

    Directory of Open Access Journals (Sweden)

    Neil A. Mabbott

    2017-11-01

    Full Text Available Prion diseases are sub-acute neurodegenerative diseases that affect humans and some domestic and free-ranging animals. Infectious prion agents are considered to comprise solely of abnormally folded isoforms of the cellular prion protein known as PrPSc. Pathology during prion disease is restricted to the central nervous system where it causes extensive neurodegeneration and ultimately leads to the death of the host. The first half of this review provides a thorough account of our understanding of the various ways in which PrPSc prions may spread between individuals within a population, both horizontally and vertically. Many natural prion diseases are acquired peripherally, such as by oral exposure, lesions to skin or mucous membranes, and possibly also via the nasal cavity. Following peripheral exposure, some prions accumulate to high levels within the secondary lymphoid organs as they make their journey from the site of infection to the brain, a process termed neuroinvasion. The replication of PrPSc prions within secondary lymphoid organs is important for their efficient spread to the brain. The second half of this review describes the key tissues, cells and molecules which are involved in the propagation of PrPSc prions from peripheral sites of exposure (such as the lumen of the intestine to the brain. This section also considers how additional factors such as inflammation and aging might influence prion disease susceptibility.

  9. How do PrPScPrions Spread between Host Species, and within Hosts?

    Science.gov (United States)

    Mabbott, Neil A

    2017-11-24

    Prion diseases are sub-acute neurodegenerative diseases that affect humans and some domestic and free-ranging animals. Infectious prion agents are considered to comprise solely of abnormally folded isoforms of the cellular prion protein known as PrP Sc . Pathology during prion disease is restricted to the central nervous system where it causes extensive neurodegeneration and ultimately leads to the death of the host. The first half of this review provides a thorough account of our understanding of the various ways in which PrP Sc prions may spread between individuals within a population, both horizontally and vertically. Many natural prion diseases are acquired peripherally, such as by oral exposure, lesions to skin or mucous membranes, and possibly also via the nasal cavity. Following peripheral exposure, some prions accumulate to high levels within the secondary lymphoid organs as they make their journey from the site of infection to the brain, a process termed neuroinvasion. The replication of PrP Sc prions within secondary lymphoid organs is important for their efficient spread to the brain. The second half of this review describes the key tissues, cells and molecules which are involved in the propagation of PrP Sc prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. This section also considers how additional factors such as inflammation and aging might influence prion disease susceptibility.

  10. Experimental Evaluation of Host Adaptation of Lactobacillus reuteri to Different Vertebrate Species.

    Science.gov (United States)

    Duar, Rebbeca M; Frese, Steven A; Lin, Xiaoxi B; Fernando, Samodha C; Burkey, Thomas E; Tasseva, Guergana; Peterson, Daniel A; Blom, Jochen; Wenzel, Cory Q; Szymanski, Christine M; Walter, Jens

    2017-06-15

    The species Lactobacillus reuteri has diversified into host-specific lineages, implying a long-term association with different vertebrates. Strains from rodent lineages show specific adaptations to mice, but the processes underlying the evolution of L. reuteri in other hosts remain unknown. We administered three standardized inocula composed of strains from different host-confined lineages to mice, pigs, chickens, and humans. The ecological performance of each strain in the gastrointestinal tract of each host was determined by typing random colonies recovered from fecal samples collected over five consecutive days postadministration. Results revealed that rodent strains were predominant in mice, confirming previous findings of host adaptation. In chickens, poultry strains of the lineage VI (poultry VI) and human isolates from the same lineage (human VI) were recovered at the highest and second highest rates, respectively. Interestingly, human VI strains were virtually undetected in human feces. These findings, together with ancestral state reconstructions, indicate poultry VI and human VI strains share an evolutionary history with chickens. Genomic analysis revealed that poultry VI strains possess a large and variable accessory genome, whereas human VI strains display low genetic diversity and possess genes encoding antibiotic resistance and capsular polysaccharide synthesis, which might have allowed temporal colonization of humans. Experiments in pigs and humans did not provide evidence of host adaptation of L. reuteri to these hosts. Overall, our findings demonstrate host adaptation of L. reuteri to rodents and chickens, supporting a joint evolution of this bacterial species with several vertebrate hosts, although questions remain about its natural history in humans and pigs. IMPORTANCE Gut microbes are often hypothesized to have coevolved with their vertebrate hosts. However, the evidence is sparse and the evolutionary mechanisms have not been identified. We

  11. Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species: an important role for cell death control

    NARCIS (Netherlands)

    Baarlen, van P.; Woltering, E.J.; Staats, M.; Kan, van J.A.L.

    2007-01-01

    Susceptibility was evaluated of host and non-host plants to three pathogenic Botrytis species: the generalist B. cinerea and the specialists B. elliptica (lily) and B. tulipae (tulip). B. tulipae was, unexpectedly, able to infect plant species other than tulip, and to a similar extent as B. cinerea.

  12. Climate driven range divergence among host species affects range-wide patterns of parasitism

    Directory of Open Access Journals (Sweden)

    Richard E. Feldman

    2017-01-01

    Full Text Available Species interactions like parasitism influence the outcome of climate-driven shifts in species ranges. For some host species, parasitism can only occur in that part of its range that overlaps with a second host species. Thus, predicting future parasitism may depend on how the ranges of the two hosts change in relation to each other. In this study, we tested whether the climate driven species range shift of Odocoileus virginianus (white-tailed deer accounts for predicted changes in parasitism of two other species from the family Cervidae, Alces alces (moose and Rangifer tarandus (caribou, in North America. We used MaxEnt models to predict the recent (2000 and future (2050 ranges (probabilities of occurrence of the cervids and a parasite Parelaphostrongylus tenuis (brainworm taking into account range shifts of the parasite’s intermediate gastropod hosts. Our models predicted that range overlap between A. alces/R. tarandus and P. tenuis will decrease between 2000 and 2050, an outcome that reflects decreased overlap between A. alces/R. tarandus and O. virginianus and not the parasites, themselves. Geographically, our models predicted increasing potential occurrence of P. tenuis where A. alces/R. tarandus are likely to decline, but minimal spatial overlap where A. alces/R. tarandus are likely to increase. Thus, parasitism may exacerbate climate-mediated southern contraction of A. alces and R. tarandus ranges but will have limited influence on northward range expansion. Our results suggest that the spatial dynamics of one host species may be the driving force behind future rates of parasitism for another host species.

  13. Host life history strategy, species diversity, and habitat influence Trypanosoma cruzi vector infection in Changing landscapes.

    Directory of Open Access Journals (Sweden)

    Nicole L Gottdenker

    Full Text Available Anthropogenic land use may influence transmission of multi-host vector-borne pathogens by changing diversity, relative abundance, and community composition of reservoir hosts. These reservoir hosts may have varying competence for vector-borne pathogens depending on species-specific characteristics, such as life history strategy. The objective of this study is to evaluate how anthropogenic land use change influences blood meal species composition and the effects of changing blood meal species composition on the parasite infection rate of the Chagas disease vector Rhodnius pallescens in Panama.R. pallescens vectors (N = 643 were collected in different habitat types across a gradient of anthropogenic disturbance. Blood meal species in DNA extracted from these vectors was identified in 243 (40.3% vectors by amplification and sequencing of a vertebrate-specific fragment of the 12SrRNA gene, and T. cruzi vector infection was determined by pcr. Vector infection rate was significantly greater in deforested habitats as compared to contiguous forests. Forty-two different species of blood meal were identified in R. pallescens, and species composition of blood meals varied across habitat types. Mammals (88.3% dominated R. pallescens blood meals. Xenarthrans (sloths and tamanduas were the most frequently identified species in blood meals across all habitat types. A regression tree analysis indicated that blood meal species diversity, host life history strategy (measured as r(max, the maximum intrinsic rate of population increase, and habitat type (forest fragments and peridomiciliary sites were important determinants of vector infection with T. cruzi. The mean intrinsic rate of increase and the skewness and variability of r(max were positively associated with higher vector infection rate at a site.In this study, anthropogenic landscape disturbance increased vector infection with T. cruzi, potentially by changing host community structure to favor hosts

  14. Effects of Host Plant Factors on the Bacterial Communities Associated with Two Whitefly Sibling Species.

    Directory of Open Access Journals (Sweden)

    Ming-Ming Su

    Full Text Available Although discrepancy in the specific traits and ecological characteristics of Bemisia tabaci between species are partially attributed to the B. tabaci-associated bacteria, the factors that affect the diversity of B. tabaci-associated bacteria are not well-understood. We used the metagenomic approach to characterize the B. tabaci-associated bacterial community because the approach is an effective tool to identify the bacteria.To investigate the effects of the host plant and a virus, tomato yellow leaf curl virus (TYLCV, on the bacterial communities of B. tabaci sibling species B and Q, we analyzed the bacterial communities associated with whitefly B and Q collected from healthy cotton, healthy tomato, and TYLCV-infected tomato. The analysis used miseq-based sequencing of a variable region of the bacterial 16S rDNA gene. For the bacteria associated with B. tabaci, we found that the influence of the host plant species was greater than that of the whitefly cryptic species. With further analysis of host plants infected with the TYLCV, the virus had no significant effects on the B. tabaci-associated bacterial community.The effects of different plant hosts and TYLCV-infection on the diversity of B. tabaci-associated bacterial communities were successfully analyzed in this study. To explain why B. tabaci sibling species with different host ranges differ in performance, the analysis of the bacterial community may be essential to the explanation.

  15. Effects of Host Plant Factors on the Bacterial Communities Associated with Two Whitefly Sibling Species.

    Science.gov (United States)

    Su, Ming-Ming; Guo, Lei; Tao, Yun-Li; Zhang, You-Jun; Wan, Fang-Hao; Chu, Dong

    2016-01-01

    Although discrepancy in the specific traits and ecological characteristics of Bemisia tabaci between species are partially attributed to the B. tabaci-associated bacteria, the factors that affect the diversity of B. tabaci-associated bacteria are not well-understood. We used the metagenomic approach to characterize the B. tabaci-associated bacterial community because the approach is an effective tool to identify the bacteria. To investigate the effects of the host plant and a virus, tomato yellow leaf curl virus (TYLCV), on the bacterial communities of B. tabaci sibling species B and Q, we analyzed the bacterial communities associated with whitefly B and Q collected from healthy cotton, healthy tomato, and TYLCV-infected tomato. The analysis used miseq-based sequencing of a variable region of the bacterial 16S rDNA gene. For the bacteria associated with B. tabaci, we found that the influence of the host plant species was greater than that of the whitefly cryptic species. With further analysis of host plants infected with the TYLCV, the virus had no significant effects on the B. tabaci-associated bacterial community. The effects of different plant hosts and TYLCV-infection on the diversity of B. tabaci-associated bacterial communities were successfully analyzed in this study. To explain why B. tabaci sibling species with different host ranges differ in performance, the analysis of the bacterial community may be essential to the explanation.

  16. Genes, communities & invasive species: understanding the ecological and evolutionary dynamics of host-pathogen interactions.

    Science.gov (United States)

    Burdon, J J; Thrall, P H; Ericson, L

    2013-08-01

    Reciprocal interactions between hosts and pathogens drive ecological, epidemiological and co-evolutionary trajectories, resulting in complex patterns of diversity at population, species and community levels. Recent results confirm the importance of negative frequency-dependent rather than 'arms-race' processes in the evolution of individual host-pathogen associations. At the community level, complex relationships between species abundance and diversity dampen or alter pathogen impacts. Invasive pathogens challenge these controls reflecting the earliest stages of evolutionary associations (akin to arms-race) where disease effects may be so great that they overwhelm the host's and community's ability to respond. Viewing these different stabilization/destabilization phases as a continuum provides a valuable perspective to assessment of the role of genetics and ecology in the dynamics of both natural and invasive host-pathogen associations. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Toxocara cati (Schrank, 1788 (Nematoda, Ascarididae in different wild feline species in Brazil: new host records

    Directory of Open Access Journals (Sweden)

    Moisés Gallas

    2013-09-01

    Full Text Available This is the first detailed description of Toxocara cati parasitizing felines in South America. Seventeen run over wild felines (Leopardus colocolo, Leopardus geoffroyi, Leopardus tigrinus, and Puma yagouaroundi were collected from different towns in the State of Rio Grande do Sul, Brazil. The morphometry of males and females allowed the identification of specimens as being T. cati. The helminths were found in the stomach and intestine of hosts with prevalences of 66.6% in L. colocolo, L. geoffroyi, and L. tigrinus; and 60% in P. yagouaroundi. The ecological parameters were calculated for each host and L. colocolo had the highest infection intensity (22.5 helminths/host. This is the first report of T. cati parasitizing four wild felines species in southern Brazil, besides a new record of this parasite for two host species.

  18. Host species and habitat affect nodulation by specific Frankia genotypes in two species of Alnus in interior Alaska

    Science.gov (United States)

    Michael Damon Anderson; Roger W. Ruess; David D. Myrold; D. Lee. Taylor

    2009-01-01

    This study examined the genetic structure (nifD-K spacer RFLP haplotypes) of Frankia assemblages symbiotic with two species of Alnus (A. tenuifolia and A. viridis) in four successional habitats in interior Alaska. We used one habitat in which both hosts occurred to...

  19. Alternative mechanisms of increased eggshell hardness of avian brood parasites relative to host species.

    Science.gov (United States)

    Igic, Branislav; Braganza, Kim; Hyland, Margaret M; Silyn-Roberts, Heather; Cassey, Phillip; Grim, Tomas; Rutila, Jarkko; Moskát, Csaba; Hauber, Mark E

    2011-11-07

    Obligate brood parasitic birds lay their eggs in nests of other species and parasite eggs typically have evolved greater structural strength relative to host eggs. Increased mechanical strength of the parasite eggshell is an adaptation that can interfere with puncture ejection behaviours of discriminating hosts. We investigated whether hardness of eggshells is related to differences between physical and chemical traits from three different races of the parasitic common cuckoo Cuculus canorus, and their respective hosts. Using tools developed for materials science, we discovered a novel correlate of increased strength of parasite eggs: the common cuckoo's egg exhibits a greater microhardness, especially in the inner region of the shell matrix, relative to its host and sympatric non-host species. We then tested predictions of four potential mechanisms of shell strength: (i) increased relative thickness overall, (ii) greater proportion of the structurally harder shell layers, (iii) higher concentration of inorganic components in the shell matrix, and (iv) elevated deposition of a high density compound, MgCO(3), in the shell matrix. We confirmed support only for hypothesis (i). Eggshell characteristics did not differ between parasite eggs sampled from different host nests in distant geographical sites, suggesting an evolutionarily shared microstructural mechanism of stronger parasite eggshells across diverse host-races of brood parasitic cuckoos.

  20. Stress responses in Streptococcus species and their effects on the host.

    Science.gov (United States)

    Nguyen, Cuong Thach; Park, Sang-Sang; Rhee, Dong-Kwon

    2015-11-01

    Streptococci cause a variety of diseases, such as dental caries, pharyngitis, meningitis, pneumonia, bacteremia, endocarditis, erysipelas, and necrotizing fasciitis. The natural niche of this genus of bacteria ranges from the mouth and nasopharynx to the skin, indicating that the bacteria will inevitably be subjected to environmental changes during invasion into the host, where it is exposed to the host immune system. Thus, the Streptococcus-host interaction determines whether bacteria are cleared by the host's defenses or whether they survive after invasion to cause serious diseases. If this interaction was to be deciphered, it could aid in the development of novel preventive and therapeutic agents. Streptococcus species possess many virulent factors, such as peroxidases and heat-shock proteins (HSPs), which play key roles in protecting the bacteria from hostile host environments. This review will discuss insights into the mechanism(s) by which streptococci adapt to host environments. Additionally, we will address how streptococcal infections trigger host stress responses; however, the mechanism by which bacterial components modulate host stress responses remains largely unknown.

  1. The herbaceous landlord: integrating the effects of symbiont consortia within a single host

    Directory of Open Access Journals (Sweden)

    Roo Vandegrift

    2015-11-01

    Full Text Available Plants are typically infected by a consortium of internal fungal associates, including endophytes in their leaves, as well as arbuscular mycorrhizal fungi (AMF and dark septate endophytes (DSE in their roots. It is logical that these organisms will interact with each other and the abiotic environment in addition to their host, but there has been little work to date examining the interactions of multiple symbionts within single plant hosts, or how the relationships among symbionts and their host change across environmental conditions. We examined the grass Agrostis capillaris in the context of a climate manipulation experiment in prairies in the Pacific Northwest, USA. Each plant was tested for presence of foliar endophytes in the genus Epichloë, and we measured percent root length colonized (PRLC by AMF and DSE. We hypothesized that the symbionts in our system would be in competition for host resources, that the outcome of that competition could be driven by the benefit to the host, and that the host plants would be able to allocate carbon to the symbionts in such a way as to maximize fitness benefit within a particular environmental context. We found a correlation between DSE and AMF PRLC across climatic conditions; we also found a fitness cost to increasing DSE colonization, which was negated by presence of Epichloë endophytes. These results suggest that selective pressure on the host is likely to favor host/symbiont relationships that structure the community of symbionts in the most beneficial way possible for the host, not necessarily favoring the individual symbiont that is most beneficial to the host in isolation. These results highlight the need for a more integrative, systems approach to the study of host/symbiont consortia.

  2. Community Sampling and Integrative Taxonomy Reveal New Species and Host Specificity in the Army Ant-Associated Beetle Genus Tetradonia (Coleoptera, Staphylinidae, Aleocharinae)

    Science.gov (United States)

    von Beeren, Christoph; Maruyama, Munetoshi; Kronauer, Daniel J. C.

    2016-01-01

    Army ant colonies host a diverse community of arthropod symbionts. Among the best-studied symbiont communities are those of Neotropical army ants of the genus Eciton. It is clear, however, that even in these comparatively well studied systems, a large proportion of symbiont biodiversity remains unknown. Even more striking is our lack of knowledge regarding the nature and specificity of these host-symbiont interactions. Here we surveyed the diversity and host specificity of rove beetles of the genus Tetradonia Wasmann, 1894 (Staphylinidae: Aleocharinae). Systematic community sampling of 58 colonies of the six local Eciton species at La Selva Biological Station, Costa Rica, combined with an integrative taxonomic approach, allowed us to uncover species diversity, host specificity, and co-occurrence patterns of symbionts in unprecedented detail. We used an integrative taxonomic approach combining morphological and genetic analyses, to delineate species boundaries. Mitochondrial DNA barcodes were analyzed for 362 Tetradonia specimens, and additional nuclear markers for a subset of 88 specimens. All analyses supported the presence of five Tetradonia species, including two species new to science. Host specificity is highly variable across species, ranging from generalists such as T. laticeps, which parasitizes all six local Eciton species, to specialists such as T. lizonae, which primarily parasitizes a single species, E. hamatum. Here we provide a dichotomous key along with diagnostic molecular characters for identification of Tetradonia species at La Selva Biological Station. By reliably assessing biodiversity and providing tools for species identification, we hope to set the baseline for future studies of the ecological and evolutionary dynamics in these species-rich host-symbiont networks. PMID:27829037

  3. Host-plant species conservatism and ecology of a parasitoid fig wasp genus (Chalcidoidea; Sycoryctinae; Arachonia.

    Directory of Open Access Journals (Sweden)

    Michael J McLeish

    Full Text Available Parasitoid diversity in terrestrial ecosystems is enormous. However, ecological processes underpinning their evolutionary diversification in association with other trophic groups are still unclear. Specialisation and interdependencies among chalcid wasps that reproduce on Ficus presents an opportunity to investigate the ecology of a multi-trophic system that includes parasitoids. Here we estimate the host-plant species specificity of a parasitoid fig wasp genus that attacks the galls of non-pollinating pteromalid and pollinating agaonid fig wasps. We discuss the interactions between parasitoids and the Ficus species present in a forest patch of Uganda in context with populations in Southern Africa. Haplotype networks are inferred to examine intraspecific mitochondrial DNA divergences and phylogenetic approaches used to infer putative species relationships. Taxonomic appraisal and putative species delimitation by molecular and morphological techniques are compared. Results demonstrate that a parasitoid fig wasp population is able to reproduce on at least four Ficus species present in a patch. This suggests that parasitoid fig wasps have relatively broad host-Ficus species ranges compared to fig wasps that oviposit internally. Parasitoid fig wasps did not recruit on all available host plants present in the forest census area and suggests an important ecological consequence in mitigating fitness trade-offs between pollinator and Ficus reproduction. The extent to which parasitoid fig wasps exert influence on the pollination mutualism must consider the fitness consequences imposed by the ability to interact with phenotypes of multiple Ficus and fig wasps species, but not equally across space and time.

  4. Frequent cross-species transmission of parvoviruses among diverse carnivore hosts

    Science.gov (United States)

    Allison, Andrew B.; Kohler, Dennis J.; Fox, Karen A.; Brown, Justin D.; Gerhold, Richard W.; Shearn-Bochsler, Valerie I.; Dubovi, Edward J.; Parrish, Colin R.; Holmes, Edward C.

    2013-01-01

    Although parvoviruses are commonly described in domestic carnivores, little is known about their biodiversity in nondomestic species. A phylogenetic analysis of VP2 gene sequences from puma, coyote, gray wolf, bobcat, raccoon, and striped skunk revealed two major groups related to either feline panleukopenia virus (“FPV-like”) or canine parvovirus (“CPV-like”). Cross-species transmission was commonplace, with multiple introductions into each host species but, with the exception of raccoons, relatively little evidence for onward transmission in nondomestic species.

  5. Discrimination of the Social Parasite Ectatomma parasiticum by Its Host Sibling Species (E. tuberculatum

    Directory of Open Access Journals (Sweden)

    Renée Fénéron

    2013-01-01

    Full Text Available Among social parasites, workerless inquilines entirely depend on their host for survival and reproduction. They are usually close phylogenetic relatives of their host, which raises important questions about their evolutionary history and mechanisms of speciation at play. Here we present new findings on Ectatomma parasiticum, the only inquiline ant described in the Ectatomminae subfamily. Field data confirmed its rarity and local distribution in a facultative polygynous population of E. tuberculatum in Mexico. Genetic analyses demonstrated that the parasite is a sibling species of its host, from which it may have diverged recently. Polygyny is suggested to have favored the evolution of social parasite by sympatric speciation. Nevertheless, host workers from this population were able to discriminate parasites from their conspecifics. They treated the parasitic queens either as individuals of interest or as intruders, depending on their colonial origin, probably because of the peculiar chemical profile of the parasites and/or their reproductive status. We suggest that E. parasiticum could have conserved from its host sibling species the queen-specific substances that produce attracting and settling effect on workers, which, in return, would increase the probability to be detected. This hypothesis could explain the imperfect social integration of the parasite into host colonies.

  6. Comparative recruitment, morphology and reproduction of a generalist trematode, Dicrocoelium dendriticum, in three species of host.

    Science.gov (United States)

    Beck, Melissa A; Goater, Cameron P; Colwell, Douglas D

    2015-09-01

    Epidemiological rate parameters of host generalist parasites are difficult to estimate, especially in cases where variation in parasite performance can be attributed to host species. Such cases are likely common for generalist parasites of sympatric grazing mammals. In this study, we combined data from experimental exposures in cattle and sheep and natural infections in elk to compare the recruitment, morphology and reproduction of adult Dicrocoelium dendriticum, a generalist trematode that has emerged in sympatric grazing hosts in Cypress Hills Provincial Park, Alberta. Overall, there were no significant differences in the recruitment of metacercariae and in the pre-patency period of adults in experimentally exposed cattle and sheep. All flukes reached reproductive maturity and the degree of reproductive inequality between individual flukes within each infrapopulation was moderate and approximately equal among the three host species. Neither fluke size nor per capita fecundity was constrained by density dependence. Thus, fitness parameters associated with growth and reproduction were approximately equivalent among at least three species of definitive host, two of which are sympatric on pastures in this Park. The generalist life-history strategy of this trematode, which is known to extend to other stages of its life cycle, has likely contributed to its invasion history outside its native range in Europe.

  7. Host-parasite interaction between crustaceans of six fish species from the Brazilian Amazon

    Directory of Open Access Journals (Sweden)

    Huann Carllo Gentil Vasconcelos

    2016-07-01

    Full Text Available Host-parasite interactions between crustaceans and six fish species (Psectrogaster falcata, Ageneiosus ucayalensis, Acestrorhynchus falcirostris, Hemiodus unimaculatus, Serrasalmus gibbus and Geophagus proximus from a reservoir in eastern Amazon, northern Brazil, were investigated. Eight hundred and seventy-eight parasites belonging to three crustacean species, Excorallana berbicensis, Argulus chicomendesi and Ergasilus turucuyus, which parasitized the hosts’ mouth, gills and tegument, were collected from 295 fish and examined. High infestation levels were caused by E. berbicensis on the body surface of the hosts. Excorallana berbicensis showed aggregate dispersion, except in S. gibbus, while E. turucuyus showed random dispersion in A. falcirostris. The host’s sex did not influence infestation by E. berbicensis, and high parasitism failed to affect the body conditions of the fish. In the case of some hosts, rainfall rates, temperature, dissolved oxygen levels and water pH affected the prevalence and abundance of E. berbicensis, the dominant parasite species. Results revealed that the environment and life-style of the hosts were determining factors in infestations by parasites. Current assay is the first report on E. berbicensis for the six hosts, as well as on A. chicomendesi for G. proximus and P. falcata.

  8. Impact of Nosema ceranae and Nosema apis on individual worker bees of the two host species (Apis cerana and Apis mellifera) and regulation of host immune response.

    Science.gov (United States)

    Sinpoo, Chainarong; Paxton, Robert J; Disayathanoowat, Terd; Krongdang, Sasiprapa; Chantawannakul, Panuwan

    Nosema apis and Nosema ceranae are obligate intracellular microsporidian parasites infecting midgut epithelial cells of host adult honey bees, originally Apis mellifera and Apis cerana respectively. Each microsporidia cross-infects the other host and both microsporidia nowadays have a worldwide distribution. In this study, cross-infection experiments using both N. apis and N. ceranae in both A. mellifera and A. cerana were carried out to compare pathogen proliferation and impact on hosts, including host immune response. Infection by N. ceranae led to higher spore loads than by N. apis in both host species, and there was greater proliferation of microsporidia in A. mellifera compared to A. cerana. Both N. apis and N. ceranae were pathogenic in both host Apis species. N. ceranae induced subtly, though not significantly, higher mortality than N. apis in both host species, yet survival of A. cerana was no different to that of A. mellifera in response to N. apis or N. ceranae. Infections of both host species with N. apis and N. ceranae caused significant up-regulation of AMP genes and cellular mediated immune genes but did not greatly alter apoptosis-related gene expression. In this study, A. cerana enlisted a higher immune response and displayed lower loads of N. apis and N. ceranae spores than A. mellifera, suggesting it may be better able to defend itself against microsporidia infection. We caution against over-interpretation of our results, though, because differences between host and parasite species in survival were insignificant and because size differences between microsporidia species and between host Apis species may alternatively explain the differential proliferation of N. ceranae in A. mellifera. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Wild Cervids Are Host for Tick Vectors of Babesia Species with Zoonotic Capability in Belgium

    OpenAIRE

    Lempereur, Laetitia; Wirtgen, Marc; Nahayo, Adrien; Caron, Yannick; Shiels, Brian; Saegerman, Claude; Losson, Bertrand; Linden, Annick

    2012-01-01

    Babesiosis is a tick-borne disease caused by different species of intraerythrocytic protozoan parasites within the genus Babesia. Different species of Babesia are described as potentially zoonotic and cause a malaria-like disease mainly in immunocompromised humans. Interest in the zoonotic potential of Babesia is growing and babesiosis has been described by some authors as an emergent zoonotic disease. The role of cervids to maintain tick populations and act as a reservoir host for some Babes...

  10. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  11. (macro- Evolutionary ecology of parasite diversity: From determinants of parasite species richness to host diversification

    Directory of Open Access Journals (Sweden)

    Serge Morand

    2015-04-01

    Full Text Available The present review summarized the factors or determinants that may explain parasite diversity among host species and the consequences of this parasite diversity on the evolution of host-life history traits. As host–parasite interactions are asymmetrical exploited–exploiter relationships, ecological and epidemiological theories produce hypotheses to find the potential determinants of parasite species richness, while life-history theory helps for testing potential consequences on parasite diversity on the evolution of hosts. This review referred only to studies that have specifically controlled or took into account phylogenetic information illustrated with parasites of mammals. Several points needing more investigation were identified with a special emphasis to develop the metabolic theory of epidemiology.

  12. Species of Mycosphaerellaceae and Teratosphaeriaceae on native Myrtaceae in Uruguay: evidence of fungal host jumps.

    Science.gov (United States)

    Pérez, C A; Wingfield, M J; Altier, N; Blanchette, R A

    2013-02-01

    Mycosphaerella species are well-known causal agents of leaf diseases on many economically and ecologically important plant species. In Uruguay, a relatively large number of Mycosphaerellaceae and Teratosphaeriaceae are found on Eucalyptus, but nothing is known of these fungi on native Myrtaceae. The aim of this study was to identify Mycosphaerellaceae and Teratosphaeriaceae species associated with leaf diseases on native Myrtaceae in Uruguay and to consider whether host jumps by the pathogen from introduced Eucalyptus to native Myrtaceae have occurred. Several native forests throughout the country were surveyed with special attention given to those located close to Eucalyptus plantations. Five species belonging to the Mycosphaerellaceae and Teratosphaeriaceae clades were found on native Myrtaceous trees and three of these had previously been reported on Eucalyptus in Uruguay. Those occurring both on Eucalyptus and native Myrtaceae included Pallidocercospora heimii, Pseudocercospora norchiensis, and Teratosphaeria aurantia. In addition, Mycosphaerella yunnanensis, a species known to occur on Eucalyptus but not previously recorded in Uruguay, was found on leaves of two native Myrtaceous hosts. Because most of these species occur on Eucalyptus in countries other than Uruguay, it appears that they were introduced in this country and have adapted to be able to infect native Myrtaceae. These apparent host jumps have the potential to result in serious disease problems and they should be carefully monitored. Copyright © 2012 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  13. Feeding behavior of two exotic aphid species on their original hosts in a new invaded area.

    Science.gov (United States)

    Lazzarotto, C M; Lazzari, S M N; Penteado, S R C

    2011-01-01

    Greenidea ficicola Takahashi and Greenidea psidii van der Goot (Aphididae: Greenideinae) are Asian aphid species newly introduced in Brazil associated with Moraceae and Myrtaceae. The feeding behavior of G. ficicola and G. psidii was investigated on their respective host plants, Ficus benjamina (Moraceae) and Psidium guajava (Myrtaceae), using the Electrical Penetration Graph (EPG). Fifteen females of each aphid species were monitored during 24h using a DC-EPG GIGA-4 monitor. The time spent in phloem phase (waveforms E1 and E2) was 13.6% of the total recording time for G. ficicola and 0.8% for G. psidii. The average time in the pathway phase (waveforms C and pd) represented 50% of the total time for both species. Aphids spent more time in non-penetration and stylet pathway activities than in the phloem phase or actual feeding. The principal component analysis (PCA) showed that the two species formed different groups in relation to EPG parameters, despite some overlapping. The probing patterns with multiple penetrations of short duration in the sieve elements for both species may indicate apparent unsuitability for sustained feeding on their respective host plants. These results suggest that these two exotic species are in the process of adaptation to their host plants in their new environment and/or the plants may present either chemical or physical barriers against these insects.

  14. Diversity, distribution and host-species associations of epiphytic orchids in Nepal

    Czech Academy of Sciences Publication Activity Database

    Timsina, Binu; Rokaya, Maan Bahadur; Munzbergová, Z.; Kindlmann, Pavel; Shrestha, B.; Bhattarai, Bishnu Prasad; Raskoti, B. B.

    2016-01-01

    Roč. 25, č. 13 (2016), s. 2803-2819 ISSN 0960-3115 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : vascular epiphytes * vertical stratification * elevational gradients * kathmandu valley * tree utilization * forest * richness * mexico * conservation * abundance * Species richness * Composition * Host * Traits * Nepal Himalaya Subject RIV: EF - Botanics Impact factor: 2.265, year: 2016

  15. Multi locus sequence typing of Chlamydia reveals an association between Chlamydia psittaci genotypes and host species.

    Science.gov (United States)

    Pannekoek, Yvonne; Dickx, Veerle; Beeckman, Delphine S A; Jolley, Keith A; Keijzers, Wendy C; Vretou, Evangelia; Maiden, Martin C J; Vanrompay, Daisy; van der Ende, Arie

    2010-12-02

    Chlamydia comprises a group of obligate intracellular bacterial parasites responsible for a variety of diseases in humans and animals, including several zoonoses. Chlamydia trachomatis causes diseases such as trachoma, urogenital infection and lymphogranuloma venereum with severe morbidity. Chlamydia pneumoniae is a common cause of community-acquired respiratory tract infections. Chlamydia psittaci, causing zoonotic pneumonia in humans, is usually hosted by birds, while Chlamydia abortus, causing abortion and fetal death in mammals, including humans, is mainly hosted by goats and sheep. We used multi-locus sequence typing to asses the population structure of Chlamydia. In total, 132 Chlamydia isolates were analyzed, including 60 C. trachomatis, 18 C. pneumoniae, 16 C. abortus, 34 C. psittaci and one of each of C. pecorum, C. caviae, C. muridarum and C. felis. Cluster analyses utilizing the Neighbour-Joining algorithm with the maximum composite likelihood model of concatenated sequences of 7 housekeeping fragments showed that C. psittaci 84/2334 isolated from a parrot grouped together with the C. abortus isolates from goats and sheep. Cluster analyses of the individual alleles showed that in all instances C. psittaci 84/2334 formed one group with C. abortus. Moving 84/2334 from the C. psittaci group to the C. abortus group resulted in a significant increase in the number of fixed differences and elimination of the number of shared mutations between C. psittaci and C. abortus. C. psittaci M56 from a muskrat branched separately from the main group of C. psittaci isolates. C. psittaci genotypes appeared to be associated with host species. The phylogenetic tree of C. psittaci did not follow that of its host bird species, suggesting host species jumps. In conclusion, we report for the first time an association between C. psittaci genotypes with host species.

  16. Multi locus sequence typing of Chlamydia reveals an association between Chlamydia psittaci genotypes and host species.

    Directory of Open Access Journals (Sweden)

    Yvonne Pannekoek

    2010-12-01

    Full Text Available Chlamydia comprises a group of obligate intracellular bacterial parasites responsible for a variety of diseases in humans and animals, including several zoonoses. Chlamydia trachomatis causes diseases such as trachoma, urogenital infection and lymphogranuloma venereum with severe morbidity. Chlamydia pneumoniae is a common cause of community-acquired respiratory tract infections. Chlamydia psittaci, causing zoonotic pneumonia in humans, is usually hosted by birds, while Chlamydia abortus, causing abortion and fetal death in mammals, including humans, is mainly hosted by goats and sheep. We used multi-locus sequence typing to asses the population structure of Chlamydia. In total, 132 Chlamydia isolates were analyzed, including 60 C. trachomatis, 18 C. pneumoniae, 16 C. abortus, 34 C. psittaci and one of each of C. pecorum, C. caviae, C. muridarum and C. felis. Cluster analyses utilizing the Neighbour-Joining algorithm with the maximum composite likelihood model of concatenated sequences of 7 housekeeping fragments showed that C. psittaci 84/2334 isolated from a parrot grouped together with the C. abortus isolates from goats and sheep. Cluster analyses of the individual alleles showed that in all instances C. psittaci 84/2334 formed one group with C. abortus. Moving 84/2334 from the C. psittaci group to the C. abortus group resulted in a significant increase in the number of fixed differences and elimination of the number of shared mutations between C. psittaci and C. abortus. C. psittaci M56 from a muskrat branched separately from the main group of C. psittaci isolates. C. psittaci genotypes appeared to be associated with host species. The phylogenetic tree of C. psittaci did not follow that of its host bird species, suggesting host species jumps. In conclusion, we report for the first time an association between C. psittaci genotypes with host species.

  17. Bayesian species delimitation reveals generalist and specialist parasitic wasps on Galerucella beetles (Chrysomelidae): sorting by herbivore or plant host.

    Science.gov (United States)

    Hambäck, Peter A; Weingartner, Elisabet; Ericson, Lars; Fors, Lisa; Cassel-Lundhagen, Anna; Stenberg, Johan A; Bergsten, Johannes

    2013-04-27

    To understand the ecological and evolutionary consequences of species interactions in food webs necessitates that interactions are properly identified. Genetic analyses suggest that many supposedly generalist parasitoid species should rather be defined as multiple species with a more narrow diet, reducing the probability that such species may mediate indirect interactions such as apparent competition among hosts. Recent studies showed that the parasitoid Asecodes lucens mediate apparent competition between two hosts, Galerucella tenella and G. calmariensis, affecting both interaction strengths and evolutionary feedbacks. The same parasitoid was also recorded from other species in the genus Galerucella, suggesting that similar indirect effects may also occur for other species pairs. To explore the possibility of such interactions, we sequenced mitochondrial and nuclear genetic markers to resolve the phylogeny of both host and parasitoid and to test the number of parasitoid species involved. We thus collected 139 Galerucella larvae from 8 host plant species and sequenced 31 adult beetle and 108 parasitoid individuals. The analysis of the Galerucella data, that also included sequences from previous studies, verified the five species previously documented as reciprocally monophyletic, but the Bayesian species delimitation for A. lucens suggested 3-4 cryptic taxa with a more specialised host use than previously suggested. The gene data analyzed under the multispecies coalescent model allowed us to reconstruct the species tree phylogeny for both host and parasitoid and we found a fully congruent coevolutionary pattern suggesting that parasitoid speciation followed upon host speciation. Using multilocus sequence data in a Bayesian species delimitation analysis we propose that hymenopteran parasitoids of the genus Asecodes that infest Galerucella larvae constitute at least three species with narrow diet breath. The evolution of parasitoid Asecodes and host Galerucella show

  18. Suppression of graft-versus-host reactivity by a single host-specific blood transfusion to prospective donors of hemopoietic cells

    NARCIS (Netherlands)

    Knulst, A.C.; Bril-Bazuin, C.; Savelkoul, H.F.J.; Benner, R.

    1991-01-01

    Delayed-type hypersensitivity responses against recipient's histocompatibility antigens can occur early in the course of a graft-versus-host reaction in lethally irradiated allogeneically reconstituted mice. This reactivity could be suppressed by a single host-specific blood transfusion to the

  19. Ultrastructural characteristics of nurse cell-larva complex of four species of Trichinella in several hosts

    Directory of Open Access Journals (Sweden)

    Sacchi L.

    2001-06-01

    Full Text Available The nurse cell-larva complex of nematodes of the genus Trichinella plays an Important role in the survival of the larva in decaying muscles, frequently favouring the transmission of the parasite in extreme environmental conditions. The ultrastructure of the nurse cell-larva complex in muscles from different hosts infected with T. nativa (a walrus and a polar bear, T. spiralis (horses and humans, T. pseudospiralis (a laboratory mouse and T. papuae (a laboratory mouse were examined. Analysis with transmission electron microscope showed that the typical nurse cell structure was present in all examined samples, irrespective of the species of larva, of the presence of a collagen capsule, of the age of infection and of the host species, suggesting that there exists a molecular mechanism that in the first stage of larva invasion is similar for encapsulated and non-encapsulated species.

  20. Global Asymptotic Stability for Discrete Single Species Population Models

    Directory of Open Access Journals (Sweden)

    A. Bilgin

    2017-01-01

    Full Text Available We present some basic discrete models in populations dynamics of single species with several age classes. Starting with the basic Beverton-Holt model that describes the change of single species we discuss its basic properties such as a convergence of all solutions to the equilibrium, oscillation of solutions about the equilibrium solutions, Allee’s effect, and Jillson’s effect. We consider the effect of the constant and periodic immigration and emigration on the global properties of Beverton-Holt model. We also consider the effect of the periodic environment on the global properties of Beverton-Holt model.

  1. Enhanced efficiency in single-host white organic light-emitting diode by triplet exciton conversion

    International Nuclear Information System (INIS)

    Wu, Qingyang; Zhang, Shiming; Yue, Shouzhen; Zhang, Zhensong; Xie, Guohua; Zhao, Yi; Liu, Shiyong

    2013-01-01

    The authors observe that the external quantum efficiency (EQE) of the Iridium (III) bis(4-phenylthieno [3,2-c]pyridinato-N,C 2′ )acetylacetonate (PO-01) based yellow organic light-emitting diode (OLED) is significantly increased by uniformly co-doping Iridium (III)bis[(4,6-difluorophenyl)-pyridinato-N,C 2− ] (FIrpic) and PO-01 into the same wide band-gap host of N,N ′ -dicarbazolyl-3, 5-benzene (mCP). Detailed investigation indicates that the efficiency enhancement is ascribed to effective triplet exciton gathering by FIrpic, followed by energy transfer to PO-01. Compared to the control device, which has maximum EQE of 10.5%, an improved maximum EQE of 13.2% is obtained in the optimization white device based on FIrpic and PO-01 emission according to this principle. This work makes it easier for a single host white OLED to simultaneously harvest high efficiency in both blue and yellow units. Comprehensive experimental results show that this phenomenon can also be found and utilized in other popular hosts to realize more efficient white devices. -- Highlights: • This work makes easier for a single host white OLED to harvest high efficiency in both blue and yellow units. • Efficiency enhancement is ascribed to effective triplet exciton gathering by FIrpic, followed by energy transfer to PO-01. • This phenomenon can also be found and utilized in other popular hosts to realize more efficient white devices

  2. Interaction of bovine peripheral blood polymorphonuclear cells and Leptospira species; innate responses in the natural bovine reservoir host.

    Science.gov (United States)

    Cattle are the reservoir hosts of Leptospira borgpetersenii serovar Hardjo, and also be reservoir hosts of other Leptospira species such as L. kirschneri, and L. interrogans. As a reservoir host, cattle shed Leptospira, infecting other animals, including humans. Previous studies with human and murin...

  3. Variation within and between Frankliniella Thrips Species in Host Plant Utilization

    Science.gov (United States)

    Baez, Ignacio; Reitz, Stuart R.; Funderburk, Joseph E.; Olson, Steve M.

    2011-01-01

    Anthophilous flower thrips in the genus Frankliniella (Thysanoptera: Thripidae) exploit ephemeral plant resources and therefore must be capable of successfully locating appropriate hosts on a repeated basis, yet little is known of interspecific and intraspecific variation in responses to host plant type and nutritional quality. Field trials were conducted over two seasons to determine if the abundance of males and females of three common Frankliniella species, F. occidentalis (Pergande), F. tritici (Fitch) and F. bispinosa (Morgan), their larvae, and a key predator, Orius insidiosus (Say) (Hemiptera: Anthocoridae) were affected by host plant type and plant nutritional quality. Two host plants, pepper, Capsicum annuum L. (Solanales: Solanaceae) and tomato, Solanum lycopersicum L. that vary in suitability for these species were examined, and their nutritional quality was manipulated by applying three levels of nitrogen fertilization (101 kg/ha, 202 kg/ha, 404 kg/ha). F. occidentalis females were more abundant in pepper than in tomato, but males did not show a differential response. Both sexes of F. tritici and F. bispinosa were more abundant in tomato than in pepper. Larval thrips were more abundant in pepper than in tomato. Likewise, O. insidiosus females and nymphs were more abundant in pepper than in tomato. Only F. occidentalis females showed a distinct response to nitrogen fertilization, with abundance increasing with fertilization. These results show that host plant utilization patterns vary among Frankliniella spp. and should not be generalized from results of the intensively studied F. occidentalis. Given the different pest status of these species and their differential abundance in pepper and tomato, it is critical that scouting programs include species identifications for proper management. PMID:21539418

  4. Single species victory in a two-site, two-species model of population dispersion

    Science.gov (United States)

    Waddell, Jack; Sander, Len; Kessler, David

    2008-03-01

    We study the behavior of two species, differentiated only by their dispersal rates in an environment providing heterogeneous growth rates. Previous deterministic studies have shown that the slower-dispersal species always drives the faster species to extinction, while stochastic studies show that the opposite case can occur given small enough population and spatial heterogeneity. Other models of similar systems demonstrate the existence of an optimum dispersal rate, suggesting that distinguishing the species as faster or slower is insufficient. We here study the interface of these models for a small spatial system and determine the conditions of stability for a single species outcome.

  5. Bacterial Communities of Two Parthenogenetic Aphid Species Cocolonizing Two Host Plants across the Hawaiian Islands ▿

    Science.gov (United States)

    Jones, Ryan T.; Bressan, Alberto; Greenwell, April M.; Fierer, Noah

    2011-01-01

    Aphids (Hemiptera: Aphididae) have been the focus of several studies with respect to their interactions with inherited symbionts, but bacterial communities of most aphid species are still poorly characterized. In this research, we used bar-coded pyrosequencing to characterize bacterial communities in aphids. Specifically, we examined the diversity of bacteria in two obligately parthenogenetic aphid species (the melon aphid, Aphis gossypii, and the cardamom aphid, Pentalonia caladii) cocolonizing two plant species (taro, Colocasia esculenta, and ginger, Alpinia purpurata) across four Hawaiian Islands (Hawaii, Kauai, Maui, and Oahu). Results from this study revealed that heritable symbionts dominated the bacterial communities for both aphid species. The bacterial communities differed significantly between the two species, and A. gossypii harbored a more diverse bacterial community than P. caladii. The bacterial communities also differed across aphid populations sampled from the different islands; however, communities did not differ between aphids collected from the two host plants. PMID:21965398

  6. Bacterial communities of two parthenogenetic aphid species cocolonizing two host plants across the Hawaiian Islands.

    Science.gov (United States)

    Jones, Ryan T; Bressan, Alberto; Greenwell, April M; Fierer, Noah

    2011-12-01

    Aphids (Hemiptera: Aphididae) have been the focus of several studies with respect to their interactions with inherited symbionts, but bacterial communities of most aphid species are still poorly characterized. In this research, we used bar-coded pyrosequencing to characterize bacterial communities in aphids. Specifically, we examined the diversity of bacteria in two obligately parthenogenetic aphid species (the melon aphid, Aphis gossypii, and the cardamom aphid, Pentalonia caladii) cocolonizing two plant species (taro, Colocasia esculenta, and ginger, Alpinia purpurata) across four Hawaiian Islands (Hawaii, Kauai, Maui, and Oahu). Results from this study revealed that heritable symbionts dominated the bacterial communities for both aphid species. The bacterial communities differed significantly between the two species, and A. gossypii harbored a more diverse bacterial community than P. caladii. The bacterial communities also differed across aphid populations sampled from the different islands; however, communities did not differ between aphids collected from the two host plants.

  7. Environment and host species shape the skin microbiome of captive neotropical bats

    Directory of Open Access Journals (Sweden)

    Virginie Lemieux-Labonté

    2016-09-01

    Full Text Available Background A wide range of microorganisms inhabit animal skin. This microbial community (microbiome plays an important role in host defense against pathogens and disease. Bats (Chiroptera: Mammalia are an ecologically and evolutionarily diversified group with a relatively unexplored skin microbiome. The bat skin microbiome could play a role in disease resistance, for example, to white nose syndrome (WNS, an infection which has been devastating North American bat populations. However, fundamental knowledge of the bat skin microbiome is needed before understanding its role in health and disease resistance. Captive neotropical frugivorous bats Artibeus jamaicensis and Carollia perspicillataprovide a simple controlled system in which to characterize the factors shaping the bat microbiome. Here, we aimed to determine the relative importance of habitat and host species on the bat skin microbiome. Methods We performed high-throughput 16S rRNA gene sequencing of the skin microbiome of two different bat species living in captivity in two different habitats. In the first habitat, A. jamaicensis and C. perspicillata lived together, while the second habitat contained only A. jamaicensis. Results We found that both habitat and host species shape the composition and diversity of the skin microbiome, with habitat having the strongest influence. Cohabitating A. jamaicensis and C. perspicillata shared more similar skin microbiomes than members of the same species (A. jamaicensis across two habitats. Discussion These results suggest that in captivity, the skin microbial community is homogenised by the shared environments and individual proximities of bats living together in the same habitat, at the expense of the innate host species factors. The predominant influence of habitat suggests that environmental microorganisms or pathogens might colonize bat skin. We also propose that bat populations could differ in pathogen susceptibility depending on their immediate

  8. Environment and host species shape the skin microbiome of captive neotropical bats.

    Science.gov (United States)

    Lemieux-Labonté, Virginie; Tromas, Nicolas; Shapiro, B Jesse; Lapointe, François-Joseph

    2016-01-01

    A wide range of microorganisms inhabit animal skin. This microbial community (microbiome) plays an important role in host defense against pathogens and disease. Bats (Chiroptera: Mammalia) are an ecologically and evolutionarily diversified group with a relatively unexplored skin microbiome. The bat skin microbiome could play a role in disease resistance, for example, to white nose syndrome (WNS), an infection which has been devastating North American bat populations. However, fundamental knowledge of the bat skin microbiome is needed before understanding its role in health and disease resistance. Captive neotropical frugivorous bats Artibeus jamaicensis and Carollia perspicillataprovide a simple controlled system in which to characterize the factors shaping the bat microbiome. Here, we aimed to determine the relative importance of habitat and host species on the bat skin microbiome. We performed high-throughput 16S rRNA gene sequencing of the skin microbiome of two different bat species living in captivity in two different habitats. In the first habitat, A. jamaicensis and C. perspicillata lived together, while the second habitat contained only A. jamaicensis. We found that both habitat and host species shape the composition and diversity of the skin microbiome, with habitat having the strongest influence. Cohabitating A. jamaicensis and C. perspicillata shared more similar skin microbiomes than members of the same species (A. jamaicensis) across two habitats. These results suggest that in captivity, the skin microbial community is homogenised by the shared environments and individual proximities of bats living together in the same habitat, at the expense of the innate host species factors. The predominant influence of habitat suggests that environmental microorganisms or pathogens might colonize bat skin. We also propose that bat populations could differ in pathogen susceptibility depending on their immediate environment and habitat.

  9. epidemiology of single and multiple species of helminth infections ...

    African Journals Online (AJOL)

    hi-tech

    2000-03-01

    Mar 1, 2000 ... East African Medical Journal Vol. 77 No. 3 March 2000. EPIDEMIOLOGY OF SINGLE AND MULTIPLE SPECIES OF HELMINTH INFECTIONS AMONG SCHOOL CHILDREN IN BUSIA DISTRICT, KENYA. S. Brooker, MA, Wellcome Trust Centre for the Epidemiology of Infectious Disease, University of Oxford, ...

  10. Protochlamydia phocaeensis sp. nov., a new Chlamydiales species with host dependent replication cycle.

    Science.gov (United States)

    Bou Khalil, Jacques Y; Benamar, Samia; Di Pinto, Fabrizio; Blanc-Tailleur, Caroline; Raoult, Didier; La Scola, Bernard

    2017-06-01

    Chlamydiae are pathogenic and symbiotic bacteria, which form an important part of amoeba-associated microorganisms. In this paper, we report the isolation, developmental cycle and genome analysis of Protochlamydia phocaeensis sp. nov., an obligate intracellular parasite with a large host spectrum, able to infect Acanthamoeba castellanii, Acanthamoeba polyphaga, and Vermamoeba vermiformis. The genome size is 3,424,182 bp with a GC content of 42%. This bacterium displayed a particular developmental cycle depending on the infected host. The P. phocaeensis showed typical inclusion vacuoles in A. castellanii, while these were absent in V. vermiformis. Since "Chlamydiae-amoebae" interactions are supposed to depend on the chlamydial species, our findings speculate that variations in the developmental cycle of certain Chlamydiae are also host dependent. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Structure of capsule around acanthocephalan Corynosoma strumosum from uncommon paratenic hosts-lizards of two species.

    Science.gov (United States)

    Skorobrechova, Ekaterina M; Nikishin, Vladimir P; Lisitsyna, Olga I

    2012-01-01

    Micromorphology and ultrastructure of capsule forming around acanthocephalan Corynosoma strumosum in uncommon paratenic hosts-lizards Lacerta agilis and Lacerta viridis-have been studied. Experimental infestation of the lizards by acanthocephalans obtained from naturally infested sea fishes showed that only small amount of parasites occurred in the intestine of the host was able to migrate into body cavity and to be encapsulated. Micromorphology of capsules of different ages from different species of lizards and micromorphology and ultrastructure of capsules at the age of 1.5 and 10 days appeared to be similar. In the capsule's structure cells of inflammatory rank were prevailing: mononuclear and multinuclear macrophages, eosinophils, and basophils. Fibroblasts were not numerous and were located only in the outer part of a capsule; exocellular collagen fibers were absent. Inflammatory character of capsule confirms the idea that lizards are unsuitable paratenic hosts for corynosomes.

  12. Ultra-deep sequencing of intra-host rabies virus populations during cross-species transmission.

    Science.gov (United States)

    Borucki, Monica K; Chen-Harris, Haiyin; Lao, Victoria; Vanier, Gilda; Wadford, Debra A; Messenger, Sharon; Allen, Jonathan E

    2013-11-01

    One of the hurdles to understanding the role of viral quasispecies in RNA virus cross-species transmission (CST) events is the need to analyze a densely sampled outbreak using deep sequencing in order to measure the amount of mutation occurring on a small time scale. In 2009, the California Department of Public Health reported a dramatic increase (350) in the number of gray foxes infected with a rabies virus variant for which striped skunks serve as a reservoir host in Humboldt County. To better understand the evolution of rabies, deep-sequencing was applied to 40 unpassaged rabies virus samples from the Humboldt outbreak. For each sample, approximately 11 kb of the 12 kb genome was amplified and sequenced using the Illumina platform. Average coverage was 17,448 and this allowed characterization of the rabies virus population present in each sample at unprecedented depths. Phylogenetic analysis of the consensus sequence data demonstrated that samples clustered according to date (1995 vs. 2009) and geographic location (northern vs. southern). A single amino acid change in the G protein distinguished a subset of northern foxes from a haplotype present in both foxes and skunks, suggesting this mutation may have played a role in the observed increased transmission among foxes in this region. Deep-sequencing data indicated that many genetic changes associated with the CST event occurred prior to 2009 since several nonsynonymous mutations that were present in the consensus sequences of skunk and fox rabies samples obtained from 20032010 were present at the sub-consensus level (as rare variants in the viral population) in skunk and fox samples from 1995. These results suggest that analysis of rare variants within a viral population may yield clues to ancestral genomes and identify rare variants that have the potential to be selected for if environment conditions change.

  13. Ultra-deep sequencing of intra-host rabies virus populations during cross-species transmission.

    Directory of Open Access Journals (Sweden)

    Monica K Borucki

    2013-11-01

    Full Text Available One of the hurdles to understanding the role of viral quasispecies in RNA virus cross-species transmission (CST events is the need to analyze a densely sampled outbreak using deep sequencing in order to measure the amount of mutation occurring on a small time scale. In 2009, the California Department of Public Health reported a dramatic increase (350 in the number of gray foxes infected with a rabies virus variant for which striped skunks serve as a reservoir host in Humboldt County. To better understand the evolution of rabies, deep-sequencing was applied to 40 unpassaged rabies virus samples from the Humboldt outbreak. For each sample, approximately 11 kb of the 12 kb genome was amplified and sequenced using the Illumina platform. Average coverage was 17,448 and this allowed characterization of the rabies virus population present in each sample at unprecedented depths. Phylogenetic analysis of the consensus sequence data demonstrated that samples clustered according to date (1995 vs. 2009 and geographic location (northern vs. southern. A single amino acid change in the G protein distinguished a subset of northern foxes from a haplotype present in both foxes and skunks, suggesting this mutation may have played a role in the observed increased transmission among foxes in this region. Deep-sequencing data indicated that many genetic changes associated with the CST event occurred prior to 2009 since several nonsynonymous mutations that were present in the consensus sequences of skunk and fox rabies samples obtained from 20032010 were present at the sub-consensus level (as rare variants in the viral population in skunk and fox samples from 1995. These results suggest that analysis of rare variants within a viral population may yield clues to ancestral genomes and identify rare variants that have the potential to be selected for if environment conditions change.

  14. Animal African Trypanosomiasis: Time to Increase Focus on Clinically Relevant Parasite and Host Species.

    Science.gov (United States)

    Morrison, Liam J; Vezza, Laura; Rowan, Tim; Hope, Jayne C

    2016-08-01

    Animal African trypanosomiasis (AAT), caused by Trypanosoma congolense and Trypanosoma vivax, remains one of the most important livestock diseases in sub-Saharan Africa, particularly affecting cattle. Despite this, our detailed knowledge largely stems from the human pathogen Trypanosoma brucei and mouse experimental models. In the postgenomic era, the genotypic and phenotypic differences between the AAT-relevant species of parasite or host and their model organism counterparts are increasingly apparent. Here, we outline the timeliness and advantages of increasing the research focus on both the clinically relevant parasite and host species, given that improved tools and resources for both have been developed in recent years. We propose that this shift of emphasis will improve our ability to efficiently develop tools to combat AAT. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Species boundaries and host range of tortoise mites (Uropodoidea) phoretic on bark beetles (Scolytinae), using morphometric and molecular markers.

    Science.gov (United States)

    Knee, Wayne; Beaulieu, Frédéric; Skevington, Jeffrey H; Kelso, Scott; Cognato, Anthony I; Forbes, Mark R

    2012-01-01

    Understanding the ecology and evolutionary history of symbionts and their hosts requires accurate taxonomic knowledge, including clear species boundaries and phylogenies. Tortoise mites (Mesostigmata: Uropodoidea) are among the most diverse arthropod associates of bark beetles (Curculionidae: Scolytinae), but their taxonomy and host associations are largely unstudied. We tested the hypotheses that (1) morphologically defined species are supported by molecular data, and that (2) bark beetle uropodoids with a broad host range comprise cryptic species. To do so, we assessed the species boundaries of uropodoid mites collected from 51 host species, across 11 countries and 103 sites, using morphometric data as well as partial cytochrome oxidase I (COI) and nuclear large subunit ribosomal DNA (28S). Overall, morphologically defined species were confirmed by molecular datasets, with a few exceptions. Twenty-nine of the 36 uropodoid species (Trichouropoda, Nenteria and Uroobovella) collected in this study had narrow host ranges, while seven species had putative broad host ranges. In all but one species, U. orri, our data supported the existence of these host generalists, which contrasts with the typical finding that widespread generalists are actually complexes of cryptic specialists.

  16. Species boundaries and host range of tortoise mites (Uropodoidea phoretic on bark beetles (Scolytinae, using morphometric and molecular markers.

    Directory of Open Access Journals (Sweden)

    Wayne Knee

    Full Text Available Understanding the ecology and evolutionary history of symbionts and their hosts requires accurate taxonomic knowledge, including clear species boundaries and phylogenies. Tortoise mites (Mesostigmata: Uropodoidea are among the most diverse arthropod associates of bark beetles (Curculionidae: Scolytinae, but their taxonomy and host associations are largely unstudied. We tested the hypotheses that (1 morphologically defined species are supported by molecular data, and that (2 bark beetle uropodoids with a broad host range comprise cryptic species. To do so, we assessed the species boundaries of uropodoid mites collected from 51 host species, across 11 countries and 103 sites, using morphometric data as well as partial cytochrome oxidase I (COI and nuclear large subunit ribosomal DNA (28S. Overall, morphologically defined species were confirmed by molecular datasets, with a few exceptions. Twenty-nine of the 36 uropodoid species (Trichouropoda, Nenteria and Uroobovella collected in this study had narrow host ranges, while seven species had putative broad host ranges. In all but one species, U. orri, our data supported the existence of these host generalists, which contrasts with the typical finding that widespread generalists are actually complexes of cryptic specialists.

  17. New African species of Echinobothrium (Cestoda: Diphyllidea) and implications for the identities of their skate hosts.

    Science.gov (United States)

    Caira, J N; Rodriguez, N; Pickering, M

    2013-10-01

    Two new species of diphyllidean cestodes of the genus Echinobothrium, each hosted by a different skate species in the Raja miraletus complex, are described. Echinobothrium mercedesae n. sp. is described from R. cf. miraletus 2 off Senegal. Echinobothrium yiae n. sp. is described from R. cf. miraletus 1 off South Africa. Both species are small worms that differ from their 29 described congeners in the combination of number of cephalic peduncle spines per column, hook formula, number and arrangement of testes, and arrangement of vitelline follicles. They are easily distinguished from one another in that whereas the vitelline follicles of E. yiae n. sp. are circumcortical, they are lateral in E. mercedesae n. sp., and also in number of cephalic peduncle spines per column (14-17 vs. 10-12). Echinobothrium yiae n. sp. is also unusual in that the cephalic peduncle spines stop short of the anterior margin of the peduncle. In addition, although the paucity of available material precluded their formal description, evidence of 2 additional new species parasitizing R. miraletus also from Senegal is presented. In combination these worms provide support for the interpretation that what is currently recognized as Raja miraletus actually consists of a complex of geographically restricted species, rather than a polymorphic species of multiple parapatric or allopatrically distributed populations. This interpretation is not only supported by previously published molecular data, but also by newly collected morphological data involving differences in the color patterns of disc ocelli among host specimens of the 3 forms available as a result of digital efforts to ensure the accuracy of host identifications, which are also presented here.

  18. New species of Cryptosporidium Tyzzer, 1907 (Apicomplexa) from amphibian host: morphology, biology and phylogeny

    Czech Academy of Sciences Publication Activity Database

    Jirků, Miloslav; Valigurová, A.; Koudela, Břetislav; Křížek, Jaroslav; Modrý, David; Šlapeta, J.

    2008-01-01

    Roč. 55, č. 2 (2008), s. 81-94 ISSN 0015-5683 R&D Projects: GA ČR GD524/03/H133; GA ČR GA524/05/0992; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium fragile * new species * Duttaphrynus melanostictus * Host specificity * ultrastructure * global amphibian decline * hylogeny * quarantine Subject RIV: EG - Zoology Impact factor: 1.307, year: 2008

  19. Cross-species Virus-host Protein-Protein Interactions Inhibiting Innate Immunity

    Science.gov (United States)

    2016-07-01

    joule (J) kiloton (kt) (TNT equivalent) 4.184 × 1012 joule (J) British thermal unit (Btu) (thermochemical) 1.054 350 × 10 3 joule (J) foot-pound...Orthomyxoviridae influenza A has an extensively tracked history of host species jumps, including birds, pigs and other mammals , and humans... biology , and protein chemistry, and he presented his research studies at the HWI-UB-RPCI Summer Undergraduate Biomedical Research Day (August 1, 2014

  20. Identification of the same polyomavirus species in different African horseshoe bat species is indicative of short-range host-switching events.

    Science.gov (United States)

    Carr, Michael; Gonzalez, Gabriel; Sasaki, Michihito; Dool, Serena E; Ito, Kimihito; Ishii, Akihiro; Hang'ombe, Bernard M; Mweene, Aaron S; Teeling, Emma C; Hall, William W; Orba, Yasuko; Sawa, Hirofumi

    2017-10-06

    Polyomaviruses (PyVs) are considered to be highly host-specific in different mammalian species, with no well-supported evidence for host-switching events. We examined the species diversity and host specificity of PyVs in horseshoe bats (Rhinolophus spp.), a broadly distributed and highly speciose mammalian genus. We annotated six PyV genomes, comprising four new PyV species, based on pairwise identity within the large T antigen (LTAg) coding region. Phylogenetic comparisons revealed two instances of highly related PyV species, one in each of the Alphapolyomavirus and Betapolyomavirus genera, present in different horseshoe bat host species (Rhinolophus blasii and R. simulator), suggestive of short-range host-switching events. The two pairs of Rhinolophus PyVs in different horseshoe bat host species were 99.9 and 88.8 % identical with each other over their respective LTAg coding sequences and thus constitute the same virus species. To corroborate the species identification of the bat hosts, we analysed mitochondrial cytb and a large nuclear intron dataset derived from six independent and neutrally evolving loci for bat taxa of interest. Bayesian estimates of the ages of the most recent common ancestors suggested that the near-identical and more distantly related PyV species diverged approximately 9.1E4 (5E3-2.8E5) and 9.9E6 (4E6-18E6) years before the present, respectively, in contrast to the divergence times of the bat host species: 12.4E6 (10.4E6-15.4E6). Our findings provide evidence that short-range host-switching of PyVs is possible in horseshoe bats, suggesting that PyV transmission between closely related mammalian species can occur.

  1. Effects of host species and environment on the skin microbiome of Plethodontid salamanders

    Science.gov (United States)

    Muletz-Wolz, Carly R.; Yarwood, Stephanie A.; Grant, Evan H. Campbell; Fleischer, Robert C.; Lips, Karen R.

    2018-01-01

    The amphibian skin microbiome is recognized for its role in defence against pathogens, including the deadly fungal pathogen Batrachochytrium dendrobatidis (Bd). Yet, we have little understanding of evolutionary and ecological processes that structure these communities, especially for salamanders and closely related species. We investigated patterns in the distribution of bacterial communities on Plethodon salamander skin across host species and environments.Quantifying salamander skin microbiome structure contributes to our understanding of how host-associated bacteria are distributed across the landscape, among host species, and their putative relationship with disease.We characterized skin microbiome structure (alpha-diversity, beta-diversity and bacterial operational taxonomic unit [OTU] abundances) using 16S rRNA gene sequencing for co-occurring Plethodon salamander species (35 Plethodon cinereus, 17 Plethodon glutinosus, 10 Plethodon cylindraceus) at three localities to differentiate the effects of host species from environmental factors on the microbiome. We sampled the microbiome of P. cinereus along an elevational gradient (n = 50, 700–1,000 m a.s.l.) at one locality to determine whether elevation predicts microbiome structure. Finally, we quantified prevalence and abundance of putatively anti-Bd bacteria to determine if Bd-inhibitory bacteria are dominant microbiome members.Co-occurring salamanders had similar microbiome structure, but among sites salamanders had dissimilar microbiome structure for beta-diversity and abundance of 28 bacterial OTUs. We found that alpha-diversity increased with elevation, beta-diversity and the abundance of 17 bacterial OTUs changed with elevation (16 OTUs decreasing, 1 OTU increasing). We detected 11 putatively anti-Bd bacterial OTUs that were present on 90% of salamanders and made up an average relative abundance of 83% (SD ± 8.5) per salamander. All salamanders tested negative for Bd.We conclude that

  2. From single-species advice to mixed-species management: taking the next step

    DEFF Research Database (Denmark)

    Vinther, Morten; Reeves, S.A.; Patterson, K.R.

    2004-01-01

    that accounts for mixed-fishery effects, but in the short term there is a need for approaches to resolve the conflicting management advice for different species within the same fishery, and to generate catch or effort advice that accounts for the mixed-species nature of the fishery. This paper documents...... a recent approach used to address these problems. The approach takes the single-species advice for each species in the fishery as a starting point, then attempts to resolve it into consistent catch or effort advice using fleet-disaggregated catch forecasts in combination with explicitly stated management...

  3. A single molecular marker to distinguish between species of Dioscorea.

    Science.gov (United States)

    Techen, Natascha; Parveen, Iffat; Khan, Ikhlas A

    2017-03-01

    Yams are species of the genus Dioscorea (family Dioscoreaceae), which consists of approximately 630 species. The majority of the world production of yams occurs in Africa with 58.8 million t annually, but they are also produced in the Americas and Asia. The saponins in yams have been reported to possess various properties to improve health. The tuber and aerial parts of various species often share morphological similarities, which can cause problems in the proper identification of sample material. For example, the rootstocks and aerial parts of Dioscorea villosa L. share similarities with Dioscorea polystachia Turcz. Dioscorea bulbifera L. may be mistaken for Dioscorea alata L. owing to similar morphologies. Various molecular analyses have been published to help with the identification of species and varieties within the genus Dioscorea. The multi-loci or single-locus analysis has resulted in varying success, some with only a limited discrimination rate. In the present study, a single nuclear genomic region, biparentally inherited, was analyzed for its usefulness as a molecular marker for species identification and discrimination between D. bulbifera, D. villosa, D. nipponica, D. alata, D. caucasica, and D. deltoidea samples. The results of this study show that the LFY genomic region can be useful as a molecular marker to distinguish between samples.

  4. The Effect of Host-Plant Phylogenetic Isolation on Species Richness, Composition and Specialization of Insect Herbivores: A Comparison between Native and Exotic Hosts.

    Directory of Open Access Journals (Sweden)

    Julio Miguel Grandez-Rios

    Full Text Available Understanding the drivers of plant-insect interactions is still a key issue in terrestrial ecology. Here, we used 30 well-defined plant-herbivore assemblages to assess the effects of host plant phylogenetic isolation and origin (native vs. exotic on the species richness, composition and specialization of the insect herbivore fauna on co-occurring plant species. We also tested for differences in such effects between assemblages composed exclusively of exophagous and endophagous herbivores. We found a consistent negative effect of the phylogenetic isolation of host plants on the richness, similarity and specialization of their insect herbivore faunas. Notably, except for Jaccard dissimilarity, the effect of phylogenetic isolation on the insect herbivore faunas did not vary between native and exotic plants. Our findings show that the phylogenetic isolation of host plants is a key factor that influences the richness, composition and specialization of their local herbivore faunas, regardless of the host plant origin.

  5. Small ruminant lentiviruses (SRLVs) break the species barrier to acquire new host range.

    Science.gov (United States)

    Minardi da Cruz, Juliano Cezar; Singh, Dinesh Kumar; Lamara, Ali; Chebloune, Yahia

    2013-07-23

    Zoonotic events of simian immunodeficiency virus (SIV) from non-human primates to humans have generated the acquired immunodeficiency syndrome (AIDS), one of the most devastating infectious disease of the last century with more than 30 million people dead and about 40.3 million people currently infected worldwide. Human immunodeficiency virus (HIV-1 and HIV-2), the two major viruses that cause AIDS in humans are retroviruses of the lentivirus genus. The genus includes arthritis-encephalitis virus (CAEV) and Maedi-Visna virus (MVV), and a heterogeneous group of viruses known as small ruminant lentiviruses (SRLVs), affecting goat and sheep. Lentivirus genome integrates into the host DNA, causing persistent infection associated with a remarkable diversity during viral replication. Direct evidence of mixed infections with these two closely related SRLVs was found in both sheep and goats. The evidence of a genetic continuum with caprine and ovine field isolates demonstrates the absence of an efficient species barrier preventing cross-species transmission. In dual-infected animals, persistent infections with both CAEV and MVV have been described, and viral chimeras have been detected. This not only complicates animal trade between countries but favors the risk that highly pathogenic variants may emerge as has already been observed in the past in Iceland and, more recently, in outbreaks with virulent strains in Spain. SRLVs affecting wildlife have already been identified, demonstrating the existence of emergent viruses adapted to new hosts. Viruses adapted to wildlife ruminants may acquire novel biopathological properties which may endanger not only the new host species but also domestic ruminants and humans. SRLVs infecting sheep and goats follow a genomic evolution similar to that observed in HIV or in other lentiviruses. Lentivirus genetic diversity and host factors leading to the establishment of naturally occurring virulent versus avirulent infections, in addition to

  6. Small Ruminant Lentiviruses (SRLVs Break the Species Barrier to Acquire New Host Range

    Directory of Open Access Journals (Sweden)

    Juliano Cezar Minardi da Cruz

    2013-07-01

    Full Text Available Zoonotic events of simian immunodeficiency virus (SIV from non-human primates to humans have generated the acquired immunodeficiency syndrome (AIDS, one of the most devastating infectious disease of the last century with more than 30 million people dead and about 40.3 million people currently infected worldwide. Human immunodeficiency virus (HIV-1 and HIV-2, the two major viruses that cause AIDS in humans are retroviruses of the lentivirus genus. The genus includes arthritis-encephalitis virus (CAEV and Maedi-Visna virus (MVV, and a heterogeneous group of viruses known as small ruminant lentiviruses (SRLVs, affecting goat and sheep. Lentivirus genome integrates into the host DNA, causing persistent infection associated with a remarkable diversity during viral replication. Direct evidence of mixed infections with these two closely related SRLVs was found in both sheep and goats. The evidence of a genetic continuum with caprine and ovine field isolates demonstrates the absence of an efficient species barrier preventing cross-species transmission. In dual-infected animals, persistent infections with both CAEV and MVV have been described, and viral chimeras have been detected. This not only complicates animal trade between countries but favors the risk that highly pathogenic variants may emerge as has already been observed in the past in Iceland and, more recently, in outbreaks with virulent strains in Spain. SRLVs affecting wildlife have already been identified, demonstrating the existence of emergent viruses adapted to new hosts. Viruses adapted to wildlife ruminants may acquire novel biopathological properties which may endanger not only the new host species but also domestic ruminants and humans. SRLVs infecting sheep and goats follow a genomic evolution similar to that observed in HIV or in other lentiviruses. Lentivirus genetic diversity and host factors leading to the establishment of naturally occurring virulent versus avirulent infections

  7. Evolution of endogenous retroviruses in the Suidae: evidence for different viral subpopulations in African and Eurasian host species

    Directory of Open Access Journals (Sweden)

    Charleston Michael

    2011-05-01

    Full Text Available Abstract Background Porcine endogenous retroviruses (PERVs represent remnants of an exogenous form that have become integrated in the domestic pig (Sus scrofa genome. Although they are usually inactive, the capacity of γ1 ERVs to infect human cells in vitro has raised concerns about xenotransplantation because the viruses could cross the species barrier to humans. Here we have analyzed the evolution of γ1 ERVs in ten species of Suidae (suids, pigs and hogs from Eurasia and Africa using DNA sequences for their coding domains (gag, pro/pol and env genes. For comparison with γ1 PERVs, we have also analysed γ2 ERVs which in domestic pigs are known to be inactive and do not pose a risk to xenotransplantation. Results Phylogenetic analysis using Bayesian inference showed that γ1 and γ2 ERVs have distinctive evolutionary histories. Firstly, two different viral lineages of γ1 ERVs were found and a coevolutionary analysis demonstrated that they correspond broadly to their host phylogeny, one of Eurasian and another of African species, and show no evidence of horizontal transmission. γ2 ERVs, however, show a bush-like evolution, suggesting a rapid viral radiation from a single common ancestor with no correspondence between host and viral evolutionary trees. Furthermore, though γ1 ERV env genes do not possess frequent stop codons, γ2 env genes do. To understand whether γ1 suid ERVs may be still replicating, we have also evaluated their likely mechanism of proliferation by statistically testing internal to terminal branches using nonsynonymous versus synonymous substitution ratios. Our results suggest that γ1 ERVs are increasing in copy number by reinfection, which requires the translocation of the virus from one cell to another. Conclusions Evidence of at least two viral subpopulations was observed in γ1 ERVs from Eurasian and African host species. These results should be taken into account in xenotransplantation since γ1 ERVs appear to be

  8. Host selection of symbiotic cyanobacteria in 31 species of the Australian cycad genus: Macrozamia (Zamiaceae).

    Science.gov (United States)

    Gehringer, Michelle M; Pengelly, Jasper J L; Cuddy, William S; Fieker, Claus; Forster, Paul I; Neilan, Brett A

    2010-06-01

    The nitrogen-fixing cyanobacterium Nostoc is a commonly occurring terrestrial and aquatic cyanobacterium often found in symbiosis with a wide range of plant, algal, and fungal species. We investigated the diversity of cyanobacterial species occurring within the coralloid roots of different Macrozamia cycad species at diverse locations throughout Australia. In all, 74 coralloid root samples were processed and 56 endosymbiotic cyanobacteria were cultured. DNA was isolated from unialgal cultures and a segment of the 16S rRNA gene was amplified and sequenced. Microscopic analysis was performed on representative isolates. Twenty-two cyanobacterial species were identified, comprising mostly Nostoc spp. and a Calothrix sp. No correlation was observed between a cycad species and its resident cyanobiont species. The predominant cyanobacterium isolated from 18 root samples occurred over a diverse range of environmental conditions and within 14 different Macrozamia spp. Phylogenetic analysis indicated that endosymbionts were not restricted to previously described terrestrial species. An isolate clustering with Nostoc PCC7120, an aquatic strain, was identified. This is the first comprehensive study to identify the endosymbionts within a cycad genus using samples obtained from their natural habitats. These results indicate that there is negligible host specialization of cyanobacterial endosymbionts within the cycad genus Macrozamia in the wild.

  9. Secreted effectors in Toxoplasma gondii and related species: determinants of host range and pathogenesis?

    Science.gov (United States)

    English, E D; Adomako-Ankomah, Y; Boyle, J P

    2015-01-01

    Recent years have witnessed the discovery of a number of secreted proteins in Toxoplasma gondii that play important roles in host–pathogen interactions and parasite virulence, particularly in the mouse model. However, the role that these proteins play in driving the unique features of T. gondii compared to some of its nearest apicomplexan relatives (Hammondia hammondi and Neospora caninum) is unknown. These unique features include distinct dissemination characteristics in vivo and a vast host range. In this review we comprehensively survey what is known about disease outcome, the host response and host range for T. gondii, H. hammondi, and N. caninum. We then review what is presently known about recently identified secreted virulence effectors in these three genetically related, but phenotypically distinct, species. Finally we exploit the existence of genome sequences for these three organisms and discuss what is known about the presence, and functionality, of key T. gondii effectors in these three species. PMID:25655311

  10. Antennal sensilla of two female anopheline sibling species with differing host ranges

    Directory of Open Access Journals (Sweden)

    Zwiebel Laurence J

    2006-03-01

    Full Text Available Abstract Background Volatile odors are important sensory inputs that shape the behaviour of insects, including agricultural pests and disease vectors. Anopheles gambiae s.s. is a highly anthropophilic mosquito and is the major vector for human malaria in sub-Sahara Africa, while Anopheles quadriannulatus, largely due to its zoophilic behaviour, is considered a non-vector species in the same region. Careful studies of olfaction in these sibling species may lead to insights about the mechanisms that drive host preference behaviour. In the present study, the external anatomy of the antenna, the principle olfactory organ in the female mosquito of both species, was examined as an initial step toward more detailed comparisons. Methods Scanning electron and light microscopy were used to examine the antennae ultrastructures of adult female An. gambiae s.s. and An. quadriannulatus. Sensory structures, called sensilla, were categorized and counted; their distributions are reported here as well as densities calculated for each species. Results Both An. gambiae s.s. and An. quadriannulatus bear five classes of sensilla on their antennae: chaetica (bristles, trichodea (hairs, basiconica (pegs, coeloconica (pitted pegs, and ampullacea (pegs in tubes. Female An. quadriannulatus antennae have approximately one-third more sensilla, and a proportionally larger surface area, than female An. gambiae s.s. antennae. Conclusion The same types of sensilla are found on the antennae of both species. While An. quadriannulatus has greater numbers of each sensilla type, sensilla densities are very similar for each species, suggesting that other factors may be more important to such olfactory-driven behaviours as host preference.

  11. Host selection and species preference of the Red-Billed Oxpecker Buphagus Erythrorhynchus in the Kruger National Park

    Directory of Open Access Journals (Sweden)

    J. H Grobler

    1980-12-01

    Full Text Available The host selection and species preference of the Red- billed Oxpecker was investigated during January and February 1979, in the southern portion of the Kruger National Park, Republic of South Africa. A total of 19 species of larger mammals were looked at and of these 11 were utilised as hosts. Giraffe Giraffa camelopardalis, were found to be the most import- ant host and ranked well above the others as a preferred species. Published data on oxpeckers were reviewed with the view to possible translocation of the birds as a measure to increase their now limited distribution.

  12. Development of parasitic Maculinea teleius (Lepidoptera, Lycaenidae) larvae in laboratory nests of four Myrmica ant host species.

    Science.gov (United States)

    Witek, M; Skórka, P; Sliwińska, E B; Nowicki, P; Moroń, D; Settele, J; Woyciechowski, M

    2011-08-01

    Maculinea butterflies are social parasites of Myrmica ants. Methods to study the strength of host ant specificity in the Maculinea-Myrmica association include research on chemical and acoustic mimicry as well as experiments on ant adoption and rearing behaviour of Maculinea larvae. Here we present results of laboratory experiments on adoption, survival, development and integration of M. teleius larvae within the nests of different Myrmica host species, with the objective of quantifying the degree of specialization of this Maculinea species. In the laboratory, a total of 94 nests of four Myrmica species: M. scabrinodis, M. rubra, M.ruginodis and M. rugulosa were used. Nests of M. rubra and M. rugulosa adopted M. teleius larvae more readily and quickly than M. ruginodis colonies. No significant differences were found in the survival rates of M. teleius larvae reared by different ant species. Early larval growth of M. teleius larvae differed slightly among nests of four Myrmica host species. Larvae reared by colonies of M. rugulosa which were the heaviest at the beginning of larval development had the lowest mean larval body mass after 18 weeks compared to those reared by other Myrmica species. None of the M.teleius larvae was carried by M. scabrinodis or M. rubra workers after ant nests were destroyed, which suggests a lack of integration with host colonies. Results indicate that Myrmica species coming from the same site differ in their ability to adopt and rear M. teleius larvae but there was no obvious adaptation of this butterfly species to one of the host ant species. This may explain why, under natural conditions, all four ants can be used as hosts of this butterfly species. Slight advantages of particular Myrmica species as hosts at certain points in butterfly larval development can be explained by the ant species biology and colony structure rather than by specialization of M. teleius.

  13. Are gall midge species (Diptera, Cecidomyiidae host-plant specialists? Espécies de moscas galhadoras (Diptera, Cecidomyiidae são especialistas em plantas hospedeiras?

    Directory of Open Access Journals (Sweden)

    Marco Antonio A. Carneiro

    2009-01-01

    Full Text Available Despite the speciose fauna of gall-inducing insects in the Neotropical region, little is known about their taxonomy. On the other hand, gall morphotypes associated with host species have been extensively used as a surrogate of the inducer species worldwide. This study reviewed the described gall midges and their galls to test the generalization on the use of gall morphotypes as surrogates of gall midge species in the Brazilian fauna. We compiled taxonomic and biological data for 196 gall midge species recorded on 128 host plant species. Ninety two percent of those species were monophagous, inducing galls on a single host plant species, whereas only 5.6% species were oligophagous, inducing galls on more than one congeneric host plant species. Only four species induced galls on more than one host plant genus. We conclude that gall morphotypes associated with information on the host plant species and attacked organs are reliable surrogates of the gall-inducing species.Apesar do elevado número de espécies da fauna de insetos indutores de galhas na região Neotropical, muito pouco espécies foram descritas. Por outro lado, o morfotipo da galha associado com a espécie da planta hospedeira é em todo o mundo amplamente utilizado como um indicador da espécie de inseto indutor. Este estudo revê as espécies de cecidommídeos descritos e suas galhas para verificar a generalização do uso da morfologia da galha como indicador da espécie de cecidomíideo na fauna brasileira. Nós compilamos dados biológicos e taxonômicos de 196 espécies de cecidomiídeos em 128 espécies de plantas no Brasil. Noventa e dois porcento destas espécies foram monófagas, induzindo galhas em uma única espécie de planta hospedeira, enquanto somente 5,6% das espécies foram oligófagas, induzindo galhas em mais de uma espécie de planta do mesmo gênero. Somente quatro espécies induzem galhas em espécies de plantas de gêneros diferentes. Nós concluímos que o morfo

  14. Single Mutations in the VP2 300 Loop Region of the Three-Fold Spike of the Carnivore Parvovirus Capsid Can Determine Host Range

    Science.gov (United States)

    Organtini, Lindsey J.; Zhang, Sheng; Hafenstein, Susan L.; Holmes, Edward C.

    2015-01-01

    , varies after transfer to alternative carnivore hosts and may allow infection of previously nonsusceptible hosts in vitro. Here we show that VP2 position 300 is the most variable residue in the parvovirus capsid in nature, suggesting that it is a critical determinant in the cross-species transfer of viruses between different carnivores due to its interactions with the transferrin receptor to mediate infection. To this end, we demonstrated that there are substantial differences in receptor binding and infectivity of various VP2 position 300 mutants for different carnivore species and that single mutations in this region can influence whether a host is susceptible or refractory to virus infection. PMID:26512077

  15. Wildly Growing Asparagus (Asparagus officinalis L.) Hosts Pathogenic Fusarium Species and Accumulates Their Mycotoxins.

    Science.gov (United States)

    Stępień, Łukasz; Waśkiewicz, Agnieszka; Urbaniak, Monika

    2016-05-01

    Asparagus officinalis L. is an important crop in many European countries, likely infected by a number of Fusarium species. Most of them produce mycotoxins in plant tissues, thus affecting the physiology of the host plant. However, there is lack of information on Fusarium communities in wild asparagus, where they would definitely have considerable environmental significance. Therefore, the main scientific aim of this study was to identify the Fusarium species and quantify their typical mycotoxins present in wild asparagus plants collected at four time points of the season. Forty-four Fusarium strains of eight species--Fusarium acuminatum, Fusarium avenaceum, Fusarium culmorum, Fusarium equiseti, Fusarium oxysporum, Fusarium proliferatum, Fusarium sporotrichioides, and Fusarium tricinctum--were isolated from nine wild asparagus plants in 2013 season. It is the first report of F. sporotrichioides isolated from this particular host. Fumonisin B1 was the most abundant mycotoxin, and the highest concentrations of fumonisins B1-B3 and beauvericin were found in the spears collected in May. Moniliformin and enniatins were quantified at lower concentrations. Mycotoxins synthesized by individual strains obtained from infected asparagus tissues were assessed using in vitro cultures on sterile rice grain. Most of the F. sporotrichioides strains synthesized HT-2 toxin and F. equiseti strains were found to be effective zearalenone producers.

  16. Diversity and distribution of host animal species of hantavirus and risk to human health in Jiuhua mountain area, China.

    Science.gov (United States)

    Hu, Xing Qiang; Li, Shi Guang; Liu, Hong; Wang, Jun; Hua, Ri Mao

    2014-11-01

    To investigate the diversity and the distribution of host animal species of hantavirus and the effect on human health in Jiuhua Mountain area, China. The host animal species of hantavirus was surveyed by using the trap method and the species diversity was evaluated by using the Simpson, Shannon-Weaner, and Pielou indices. Hantavirus antigens or antibodies in lung and blood samples of all the captured host animals were detected by direct or indirect immunofluorescence. Nine animal species of hantavirus were distributed in the forest ecosystem of Jiuhua Mountain. Of these, Niviventer confucianus and Apodemus agrarius were predominant, and N. confucianus, Rattus norvegicus, and Mus musculus had relatively large niche breadth index values. The host animals in the eastern and western mountain regions shared similar biodiversity index characteristics, predominant species, and species structures. Hantavirus was detected in 5 host animal species in Jiuhua Mountain area, the carriage rate of hantavirus was 6.03%. The average density of host animals in forest areas of the mountainous area was only 2.20%, and the virus infection rate in the healthy population was 2.33%. The circulation of hantavirus was low in the forest areas of Jiuhua Mountain and did not pose a threat to human health. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  17. Ovicidal effect of Piperaceae species on Biomphalaria glabrata, Schistosoma mansoni host.

    Science.gov (United States)

    Rapado, Ludmila Nakamura; Lopes, Priscila Orechio de Moraes; Yamaguchi, Lydia Fumiko; Nakano, Eliana

    2013-01-01

    Schistosomiasis is a neglected disease with public health importance in tropical and subtropical regions. An alternative to the disease control is the use of molluscicides to eliminate or reduce the intermediate host snail population causing a reduction of transmission in endemic regions. In this study nine extracts from eight Piperaceae species were evaluated against Biomphalaria glabrata embryos at blastula stage. The extracts were evaluated in concentrations ranging from 100 to 10 mg/L. Piper crassinervium and Piper tuberculatum extracts were the most active (100% of mortality at 20 mg/L and 30 mg/L respectively).

  18. OVICIDAL EFFECT OF PIPERACEAE SPECIES ON Biomphalaria glabrata, Schistosoma mansoni HOST

    Directory of Open Access Journals (Sweden)

    Ludmila Nakamura Rapado

    2013-12-01

    Full Text Available SUMMARY Schistosomiasis is a neglected disease with public health importance in tropical and subtropical regions. An alternative to the disease control is the use of molluscicides to eliminate or reduce the intermediate host snail population causing a reduction of transmission in endemic regions. In this study nine extracts from eight Piperaceae species were evaluated against Biomphalaria glabrata embryos at blastula stage. The extracts were evaluated in concentrations ranging from 100 to 10 mg/L. Piper crassinervium and Piper tuberculatum extracts were the most active (100% of mortality at 20 mg/L and 30 mg/L respectively.

  19. The phylogenetic study on Thelohanellus species (Myxosporea) in relation to host specificity and infection site tropism.

    Science.gov (United States)

    Shin, Sang Phil; Nguyen, Van Giap; Jeong, Jae Mook; Jun, Jin Woo; Kim, Ji Hyung; Han, Jee Eun; Baeck, Gun Wook; Park, Se Chang

    2014-03-01

    Thelohanellus kitauei (Myxobolidae) infects cyprinid fish. The evolution of species derived from common ancestors results in the sharing of biological features. To reveal the origin of T. kitauei biological features, the correlation between phylogeny and biological features of Myxobolidae was investigated by Bayesian inference tree and Bayesian tip association significance testing. The results demonstrated that host specificity and infection site tropism were correlated with the phylogeny of Myxobolidae, and that the biological features of T. kitauei originated from the ancient Myxobolidae as exhibited by the non-specific infection site tropism and the ability to infect cyprinids. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Is induction ability of seed germination of Phelipanche ramosa phylogenetically structured among hosts? A case study on Fabaceae species.

    Science.gov (United States)

    Perronne, Rémi; Gibot-Leclerc, Stéphanie; Dessaint, Fabrice; Reibel, Carole; Le Corre, Valérie

    2017-12-01

    Phelipanche ramosa is a major root-holoparasitic damaging weed characterized by a broad host range, including numerous Fabaceae species. In France, the agricultural threat posed by P. ramosa has increased over two decades due to the appearance of a genetically differentiated pathovar presenting a clear host specificity for oilseed rape. The new pathovar has led to a massive expansion of P. ramosa in oilseed rape fields. The germination rate of P. ramosa seeds is currently known to vary among P. ramosa pathovars and host species. However, only a few studies have investigated whether phylogenetic relatedness among potential host species is a predictor of the ability of these species to induce the seed germination of parasitic weeds by testing for phylogenetic signal. We focused on a set of 12 Fabaceae species and we assessed the rate of induction of seed germination by these species for two pathovars based on in vitro co-cultivation experiments. All Fabaceae species tested induced the germination of P. ramosa seeds. The germination rate of P. ramosa seeds varied between Fabaceae species and tribes studied, while pathovars appeared non-influential. Considering oilseed rape as a reference species, we also highlighted a significant phylogenetic signal. Phylogenetically related species therefore showed more similar rates of induction of seed germination than species drawn at random from a phylogenetic tree. In in vitro conditions, only Lotus corniculatus induced a significantly higher germination rate than oilseed rape, and could potentially be used as a catch crop after confirmation of these results under field conditions.

  1. Why is there no impact of the host species on the cold tolerance of a generalist parasitoid?

    Science.gov (United States)

    Alford, Lucy; Kishani Farahani, Hossein; Pierre, Jean-Sébastien; Burel, Françoise; van Baaren, Joan

    2017-11-01

    For generalist parasitoids such as those belonging to the Genus Aphidius, the choice of host species can have profound implications for the emerging parasitoid. Host species is known to affect a variety of life history traits. However, the impact of the host on thermal tolerance has never been studied. Physiological thermal tolerance, enabling survival at unfavourable temperatures, is not a fixed trait and may be influenced by a number of external factors including characteristics of the stress, of the individual exposed to the stress, and of the biological and physical environment. As such, the choice of host species is likely to also have implications for the thermal tolerance of the emerging parasitoid. The current study aimed to investigate the effect of cereal aphid host species (Sitobion avenae, Rhopalosiphum padi and Metopolophium dirhodum) on adult thermal tolerance, in addition to sex and size, of the aphid parasitoids Aphidius avenae, Aphidius matricariae and Aphidius rhopalosiphi. Results revealed no effect of host species on the cold tolerance of the emerging parasitoid, as determined by CT min and Chill Coma, for all parasitoid species. Host species significantly affected the size of the emerging parasitoid for A. rhopalosiphi only, with individuals emerging from R. padi being significantly larger than those emerging from S. avenae, although this did not correspond to a difference in thermal tolerance. Furthermore, a significant difference in the size of male and female parasitoids was observed for A. avenae and A. matricariae, although, once again this did not correspond to a difference in cold tolerance. It is suggested that potential behavioural thermoregulation via host manipulation may act to influence the thermal environment experienced by the wasp and thus wasp thermal tolerance and, in doing so, may negate physiological thermal tolerance or any impact of the aphid host. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Hippobosca longipennis - a potential intermediate host of a species of Acanthocheilonema in dogs in northern India

    Directory of Open Access Journals (Sweden)

    Irwin Peter J

    2011-07-01

    Full Text Available Abstract Background Hippobosca longipennis (the 'dog louse fly' is a blood sucking ectoparasite found on wild carnivores such as cheetahs and lions and domesticated and feral dogs in Africa, the Middle East and Asia, including China. Known as an intermediate host for Acanthocheilonema dracunculoides and a transport host for Cheyletiella yasguri, it has also been suggested that H. longipennis may be a vector for other pathogens, including Acanthocheilonema sp.? nov., which was recently reported to infect up to 48% of dogs in northern India where this species of fly is known to commonly infest dogs. To test this hypothesis, hippoboscid flies feeding on dogs in Ladakh in northern India were collected and subjected to microscopic dissection. Results A total of 12 infective larvae were found in 10 out of 65 flies dissected; 9 from the head, 2 from the thorax and 1 from the abdomen. The larvae averaged 2, 900 (± 60 μm in length and 34 (± 5 μm in width and possessed morphological features characteristic of the family Onchocercidae. Genetic analysis and comparison of the 18S, ITS-2, 12S and cox-1 genes confirmed the identity of the larvae as the Acanthocheilonema sp.? nov. reported in dogs in Ladakh. Conclusion This study provides evidence for a potential intermediate host-parasite relationship between H. longipennis and the canine Acanthocheilonema sp.? nov. in northern India.

  3. Host-associated divergence and incipient speciation in the yucca moth Prodoxus coloradensis (Lepidoptera: Prodoxidae) on three species of host plants.

    Science.gov (United States)

    Drummond, C S; Xue, H-J; Yoder, J B; Pellmyr, O

    2010-08-01

    A wide range of evolutionary processes have been implicated in the diversification of yuccas and yucca moths, which exhibit ecological relationships that extend from obligate plant-pollinator mutualisms to commensalist herbivory. Prodoxus coloradensis (Lepidoptera: Prodoxidae) is a yucca moth, which feeds on the flowering stalks of three Yucca species as larvae, but does not provide pollination service. To test for evidence of host-associated speciation, we examined the genetic structure of P. coloradensis using mitochondrial (cytochrome oxidase I) and nuclear (elongation factor 1 alpha) DNA sequence data. Multilocus coalescent simulations indicate that moths on different host plant species are characterized by recent divergence and low levels of effective migration, with large effective population sizes and considerable retention of shared ancestral polymorphism. Although geographical distance explains a proportion of the mitochondrial and nuclear DNA variation among moths on different species of Yucca, the effect of host specificity on genetic distance remains significant after accounting for spatial isolation. The results of this study indicate that differentiation within P. coloradensis is consistent with the evolution of incipient species affiliated with different host plants, potentially influenced by sex-biased dispersal and female philopatry.

  4. Species Differentiation of Chinese Mollitrichosiphum (Aphididae: Greenideinae Driven by Geographical Isolation and Host Plant Acquirement

    Directory of Open Access Journals (Sweden)

    Gexia Qiao

    2012-08-01

    Full Text Available The impact of both the uplift of the Qinghai-Tibetan Plateau (QTP and the separation of the Taiwan and Hainan Islands on the evolution of the fauna and flora in adjacent regions has been a topic of considerable interest. Mollitrichosiphum is a polyphagous insect group with a wide range of host plants (14 families and distributions restricted to Southeast Asia. Based on the mitochondrial Cytochrome C Oxidase Subunit I (COI and Cytochrome b (Cytb genes, the nuclear elongation factor-1α (EF-1α gene, and the detailed distribution and host plant data, we investigated the species differentiation modes of the Chinese Mollitrichosiphum species. Phylogenetic analyses supported the monophyly of Mollitrichosiphum. The divergence time of Mollitrichosiphum tenuicorpus (c. 11.0 mya (million years ago, Mollitrichosiphum nandii and Mollitrichosiphum montanum (c. 10.6 mya was within the time frame of the uplift of the QTP. Additionally, basal species mainly fed on Fagaceae, while species that fed on multiple plants diverged considerably later. Ancestral state reconstruction suggests that Fagaceae may be the first acquired host, and the acquisition of new hosts and the expansion of host range may have promoted species differentiation within this genus. Overall, it can be concluded that geographical isolation and the expansion of the host plant range may be the main factors driving species differentiation of Mollitrichosiphum.

  5. Variation of parasitism patterns in bats during hibernation: the effect of host species, resources, health status, and hibernation period.

    Science.gov (United States)

    Postawa, Tomasz; Nagy, Zoltan

    2016-10-01

    During critical periods of food shortage or variable climatic conditions, the choice of an appropriate host can increase the survival and reproductive performance of parasites. In turn, one of the unique adaptations to periodical food shortages is hibernation, which is often found among insectivorous bat species in the temperate zone. While hibernating, bats are completely defenseless against both predators and ectoparasites, their immune and endocrine systems are diminished, and survival is dependent on the accumulated fat reserves. Differences in the health status or in the rate of consumption of the resources might also explain species-specific differences in ectoparasite abundance, especially between closely related host species, such as the greater mouse-eared bat (Myotis myotis) and the lesser mouse-eared bat (M. blythii) during hibernation. In the present study, the abundance of two ecologically distinct (summer and winter) types of ectoparasites was examined in terms of its influence on the body condition and hemoglobin content of the two host species. The effects of demographic factors, such as host sex and age, were also investigated. Despite a similar pattern of deteriorating body condition and hemoglobin concentration, M. myotis was more parasitized than was M. blythii. The marked decrease in hemoglobin content in first-year females of both host species correlated with the highest parasite load and indicated a risk of anemia. At the intraspecific level, ectoparasite abundance was not correlated with body condition (resources), but it negatively affected hemoglobin content; however, this mostly concerned M. blythii, which had a lower parasite load. Therefore, it can be concluded that interspecific differences in ectoparasite abundance may result from parasites selecting the host species that is less sensitive to their activity. In turn, in summer ectoparasites, the preference for female hosts is probably attributable to the likelihood of reinfection

  6. Prey species of franciscana Pontoporia blainvillei as paratenic hosts of helminths.

    Science.gov (United States)

    Silveira, Tony; Remião, Mariana H; Robaldo, Ricardo B; Freitas, Kaio; Valente, Ana Luísa S

    2017-03-21

    The distribution of franciscana Pontoporia blainvillei Gervais & d'Orbigny, 1884, is restricted to the estuarine and coastal waters of the southwestern Atlantic. The diet of this dolphin is composed of fishes, squids, and shrimps, many of which harbor helminths that may infect franciscana. Larval forms of the trematode Synthesium pontoporiae and the acanthocephalan Bolbosoma turbinella have been recorded in franciscana; however, they have not yet been identified in any of the prey species of this cetacean. We evaluated 3 components of the diet of franciscana as possible transmission sources of parasitiasis. Specimens of São Paulo squid Doryteuthis sanpaulensis (n = 50), banded croaker Paralonchurus brasiliensis (n = 43), and rough scad Trachurus lathami (n = 50) were necropsied. Organs were washed and examined under a stereomicroscope. Helminths were collected and mounted on slides. None of the species analyzed showed infection by metacercariae of S. pontoporiae. Helminths found in São Paulo squid have not been recorded in franciscana. Cistacanths of Corynosoma australe were found in the coelomic cavity and mesentery of croaker (prevalence [P] = 53.49%; mean infection intensity [MII] = 6.74) and scad (P = 4%; MII = 1.50). Cistacanths of B. turbinella were also found in the same sites in scad (P = 14%; MII = 2.14). Banded croaker and rough scad are recorded in this study as new paratenic hosts for C. australe, while scad is a new paratenic host for B. turbinella.

  7. Are parasite richness and abundance linked to prey species richness and individual feeding preferences in fish hosts?

    Science.gov (United States)

    Cirtwill, Alyssa R; Stouffer, Daniel B; Poulin, Robert; Lagrue, Clément

    2016-01-01

    Variations in levels of parasitism among individuals in a population of hosts underpin the importance of parasites as an evolutionary or ecological force. Factors influencing parasite richness (number of parasite species) and load (abundance and biomass) at the individual host level ultimately form the basis of parasite infection patterns. In fish, diet range (number of prey taxa consumed) and prey selectivity (proportion of a particular prey taxon in the diet) have been shown to influence parasite infection levels. However, fish diet is most often characterized at the species or fish population level, thus ignoring variation among conspecific individuals and its potential effects on infection patterns among individuals. Here, we examined parasite infections and stomach contents of New Zealand freshwater fish at the individual level. We tested for potential links between the richness, abundance and biomass of helminth parasites and the diet range and prey selectivity of individual fish hosts. There was no obvious link between individual fish host diet and helminth infection levels. Our results were consistent across multiple fish host and parasite species and contrast with those of earlier studies in which fish diet and parasite infection were linked, hinting at a true disconnect between host diet and measures of parasite infections in our study systems. This absence of relationship between host diet and infection levels may be due to the relatively low richness of freshwater helminth parasites in New Zealand and high host-parasite specificity.

  8. Determining Intermediate Hosts for Opecoelidae and Microphallidae Species (Platyhelminthes: Trematoda) in the Southeastern Pacific Coast, Using Molecular Markers.

    Science.gov (United States)

    Leiva, Natalia Verónica; López, Zambra; González, María Teresa; Muñoz, Gabriela

    2017-02-01

    Metacercarial stages of digeneans were collected from decapod crustaceans inhabiting intertidal rocky zones in central Chile. The digeneans were identified through a molecular analysis based on the V4 region of the 18S ribosomal RNA gene. We analyzed 356 crustaceans belonging to 10 species, 115 intertidal fish belonging to 6 species, and 4 specimens of 1 coastal bird species. In total, 74.1% of crustaceans were parasitized with metacercariae. We found 1 species of Opecoelidae. This species showed low genetic divergence (0% and 0.1%) with adult digeneans found in intertidal fish and with the species Helicometrina labrisomi infesting a subtidal fish from northern Chile (Labrisomus philippii). Additionally, we found 2 species of Microphallidae, 1 closely related to Maritrema (1.3% genetic distance) and the other related to Microphallus (5% genetic distance). Therefore, our findings showed that the decapod crustaceans are relevant hosts in food webs from the southeastern Pacific coast. Furthermore, we found 5 species of crustaceans as second intermediate hosts for H. labrisomi and 2 species as secondary intermediate hosts for 2 Microphallidae, which contribute to elucidate parts of their life cycles through molecular markers and extended the host distribution of H. labrisomi in the southeastern Pacific coast.

  9. Single-species versus dual-species probiotic supplementation as an emerging therapeutic strategy for obesity.

    Science.gov (United States)

    Karimi, G; Jamaluddin, R; Mohtarrudin, N; Ahmad, Z; Khazaai, H; Parvaneh, M

    2017-10-01

    Recent studies have reported beneficial effects of specific probiotics on obesity. However, the difference in the anti-obesity effects of probiotics as single species and dual species is still uncertain. Therefore, we aimed to compare the efficacy of single and dual species of bacteria on markers of obesity in high-fat diet-induced obese rats. A total of 40 male Sprague-Dawley rats were assigned to one of five groups of varying diets as follows: standard diet, high fat diet (HFD), HFD supplemented with Lactobacillus casei strain Shirota, HFD supplemented with Bifidobacterium longum and HFD supplemented with a mixture of these two bacterial species. After 15 weeks of supplementation, the animals were examined for changes in body weight, body fat, total count of bacteria in fecal, blood serum lipid profile, leptin, adiponectin and inflammatory biomarkers. Histological analysis of the liver and adipose tissue was performed and the hepatic mRNA expression levels of genes related to lipid metabolism were measured. It was found that probiotic supplementation of either B. longum or a mixture of B. longum and LcS bacteria significantly reduced weight and triglycerides in the HFD groups. Supplementation of B. longum bacteria showed better results in terms of modulating leptin level, fat mass, adipocyte size and lipoprotein lipase expression, as well as increasing adiponectin and peroxisome proliferator-activated receptors-γ expression compared to dual species of bacteria. No significant differences were observed in the total count of fecal bacteria, glucose and inflammatory biomarker levels between supplemented groups. B. longum supplementation in obesity was more beneficial in metabolic profile changes than the mixture species. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B

  10. A Distinctive and Host-Restricted Gut Microbiota in Populations of a Cactophilic Drosophila Species.

    Science.gov (United States)

    Martinson, Vincent G; Carpinteyro-Ponce, Javier; Moran, Nancy A; Markow, Therese A

    2017-12-01

    Almost all animals possess gut microbial communities, but the nature of these communities varies immensely. For example, in social bees and mammals, the composition is relatively constant within species and is dominated by specialist bacteria that do not live elsewhere; in laboratory studies and field surveys of Drosophila melanogaster , however, gut communities consist of bacteria that are ingested with food and that vary widely among individuals and localities. We addressed whether an ecological specialist in its natural habitat has a microbiota dominated by gut specialists or by environmental bacteria. Drosophila nigrospiracula is a species that is endemic to the Sonoran Desert and is restricted to decaying tissues of two giant columnar cacti, Pachycereus pringlei (cardón cactus) and Carnegiea gigantea (saguaro cactus). We found that the D. nigrospiracula microbiota differs strikingly from that of the cactus tissue on which the flies feed. The most abundant bacteria in the flies are rare or completely absent in the cactus tissue and are consistently abundant in flies from different cacti and localities. Several of these fly-associated bacterial groups, such as the bacterial order Orbales and the genera Serpens and Dysgonomonas , have been identified in prior surveys of insects from the orders Hymenoptera, Coleoptera, Lepidoptera, and Diptera, including several Drosophila species. Although the functions of these bacterial groups are mostly unexplored, Orbales species studied in bees are known to break down plant polysaccharides and use the resulting sugars. Thus, these bacterial groups appear to be specialized to the insect gut environment, where they may colonize through direct host-to-host transmission in natural settings. IMPORTANCE Flies in the genus Drosophila have become laboratory models for microbiota research, yet the bacteria commonly used in these experiments are rarely found in wild-caught flies and instead represent bacteria also present in the food

  11. Infection structures of host-specialized isolates of Uromyces viciae-fabae and other species of Uromyces infecting leguminous crops

    NARCIS (Netherlands)

    Emeran, A.A.; Sillero, J.C.; Niks, R.E.; Rubiales, D.

    2005-01-01

    A study was made of the morphology of urediniospores and primary infection structures of 12 isolates of six legume-infecting species of Uromyces. Infection structures were sufficient to distinguish among species. Isolates of Uromyces viciae-fabae proved to be specialized with respect to host,

  12. Host range of Cercospora apii and C. beticola, and description of C. apiicola, a novel species from celery

    NARCIS (Netherlands)

    Groenewald, M.; Groenewald, J.Z.; Braun, U.; Crous, P.W.

    2006-01-01

    The genus Cercospora is one of the largest and most heterogeneous genera of hyphomycetes. Cercospora species are distributed worldwide and cause Cercospora leaf spot on most of the major plant families. Numerous species described from diverse hosts and locations are morphologically indistinguishable

  13. Seasonal changes in infection with trematode species utilizing jellyfish as hosts: evidence of transmission to definitive host fish via medusivory

    OpenAIRE

    Kondo Yusuke; Ohtsuka Susumu; Hirabayashi Takeshi; Okada Shoma; Ogawa Nanako O.; Ohkouchi Naohiko; Shimazu Takeshi; Nishikawa Jun

    2016-01-01

    In the Seto Inland Sea of western Japan, metacercariae of three species of trematodes, Lepotrema clavatum Ozaki, 1932, Cephalolepidapedon saba Yamaguti, 1970, and Opechona olssoni (Yamaguti, 1934), were found in the mesoglea of the jellyfish Aurelia aurita s.l., Chrysaora pacifica, and Cyanea nozakii. Moreover, these jellyfish frequently harbored juveniles of the fish species Psenopsis anomala, Thamnaconus modestus, and Trachurus japonicus. The former two fish species are well-known medusivor...

  14. Diversity and host specificity of coccidia (Apicomplexa: Eimeriidae) in native and introduced squirrel species.

    Science.gov (United States)

    Hofmannová, Lada; Romeo, Claudia; Štohanzlová, Lucie; Jirsová, Dagmar; Mazzamuto, Maria Vittoria; Wauters, Lucas Armand; Ferrari, Nicola; Modrý, David

    2016-10-01

    Introduction of alien species into new areas can have detrimental effects on native ecosystems and impact the native species. The present study aims to identify coccidia infecting native and introduced squirrels in Italy, to gain insight into possible transmission patterns and role of monoxenous coccidia in mediating the competition between alien and native hosts. We collected 540 faecal samples of native red squirrels, Sciurus vulgaris, invasive alien grey squirrels, S. carolinensis, and introduced Pallas's squirrels, Callosciurus erythraeus. Total prevalence of Eimeria spp. was 95.6% in S. vulgaris, 95.7% in S. carolinensis and only 4.1% in C. erythraeus. Morphological examination revealed 3 Eimeria morphotypes. Phylogenetic analyses of Eimeria DNA based on 18S, ITS, cox I markers displayed fairly distinct monophyletic clades in the microscopically indistinguishable E2 morphotype, proving indisputable distinction between the isolates from red and grey squirrels. Grey squirrels successfully introduced E. lancasterensis from their native range, but this species does not spill over to native red squirrels. Similarly, there is no evidence for the transmission of E. sciurorum from red to grey squirrels. The possible transmission and the potential role of monoxenous coccidia in mediating the competition between native and invasive squirrels in Italy were not confirmed. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Finding candidate genes under positive selection in Non-model species: examples of genes involved in host specialization in pathogens.

    Science.gov (United States)

    Aguileta, G; Lengelle, J; Marthey, S; Chiapello, H; Rodolphe, F; Gendrault, A; Yockteng, R; Vercken, E; Devier, B; Fontaine, M C; Wincker, P; Dossat, C; Cruaud, C; Couloux, A; Giraud, T

    2010-01-01

    Numerous genes in diverse organisms have been shown to be under positive selection, especially genes involved in reproduction, adaptation to contrasting environments, hybrid inviability, and host-pathogen interactions. Looking for genes under positive selection in pathogens has been a priority in efforts to investigate coevolution dynamics and to develop vaccines or drugs. To elucidate the functions involved in host specialization, here we aimed at identifying candidate sequences that could have evolved under positive selection among closely related pathogens specialized on different hosts. For this goal, we sequenced c. 17,000-32,000 ESTs from each of four Microbotryum species, which are fungal pathogens responsible for anther smut disease on host plants in the Caryophyllaceae. Forty-two of the 372 predicted orthologous genes showed significant signal of positive selection, which represents a good number of candidate genes for further investigation. Sequencing 16 of these genes in 9 additional Microbotryum species confirmed that they have indeed been rapidly evolving in the pathogen species specialized on different hosts. The genes showing significant signals of positive selection were putatively involved in nutrient uptake from the host, secondary metabolite synthesis and secretion, respiration under stressful conditions and stress response, hyphal growth and differentiation, and regulation of expression by other genes. Many of these genes had transmembrane domains and may therefore also be involved in pathogen recognition by the host. Our approach thus revealed fruitful and should be feasible for many non-model organisms for which candidate genes for diversifying selection are needed.

  16. Record number of Yellow-billed Oxpeckers Buphagus africanus Linnaeus, 1766 (Aves: Passeriformes: Buphagidae foraging on a single host

    Directory of Open Access Journals (Sweden)

    Diogo Verissimo

    2017-01-01

    Full Text Available In June 2016, we observed a group of Yellow-billed Oxpeckers foraging on a single male Giraffe, in the Savuti area of Chobe National Park, Botswana.  From photographic evidence we estimate the Oxpecker group numbered between 51 and 60, the highest number on record for a single host

  17. Towards a single host phase ceramic formulation for UK plutonium disposition

    International Nuclear Information System (INIS)

    Stennett, M. C.; Hyatt, N. C.; Gilbert, M.; Livens, F. R.; Maddrell, E. R.

    2008-01-01

    The UK has a considerable stockpile of separated plutonium; a legacy of over 50 years of civilian nuclear programmes. This material has been considered both as an asset for future energy generation and a liability due to the proliferation threat. A proportion of the PuO 2 stocks may be consumed by nuclear fission, in mixed oxide (MOx) or inert matrix (IMF) fuels but a quantity of waste PuO 2 will remain which is unsuitable for fuel manufacture and will require immobilisation. A research program is currently underway to investigate the potential of various single phase ceramic formulations for the immobilisation of this waste PuO 2 fraction. In this work a number of synthetic mineral systems have been considered including titanate, zirconate, phosphate and silicate based matrices. Although a wealth of information on plutonium disposition in some of the systems exists in the literature, the data is not always directly comparable which hinders comparison between different ceramic hosts. The crux of this research has been to compile a database of information on the proposed hosts to allow impartial comparison of the relative merits and shortcomings in each system. (authors)

  18. Role of multiple hosts in the cross-species transmission and emergence of a pandemic parvovirus.

    Science.gov (United States)

    Allison, Andrew B; Harbison, Carole E; Pagan, Israel; Stucker, Karla M; Kaelber, Jason T; Brown, Justin D; Ruder, Mark G; Keel, M Kevin; Dubovi, Edward J; Holmes, Edward C; Parrish, Colin R

    2012-01-01

    Understanding the mechanisms of cross-species virus transmission is critical to anticipating emerging infectious diseases. Canine parvovirus type 2 (CPV-2) emerged as a variant of a feline parvovirus when it acquired mutations that allowed binding to the canine transferrin receptor type 1 (TfR). However, CPV-2 was soon replaced by a variant virus (CPV-2a) that differed in antigenicity and receptor binding. Here we show that the emergence of CPV involved an additional host range variant virus that has circulated undetected in raccoons for at least 24 years, with transfers to and from dogs. Raccoon virus capsids showed little binding to the canine TfR, showed little infection of canine cells, and had altered antigenic structures. Remarkably, in capsid protein (VP2) phylogenies, most raccoon viruses fell as evolutionary intermediates between the CPV-2 and CPV-2a strains, suggesting that passage through raccoons assisted in the evolution of CPV-2a. This highlights the potential role of alternative hosts in viral emergence.

  19. Exploitation of reactive oxygen species by fungi: roles in host-fungus interaction and fungal development.

    Science.gov (United States)

    Kim, Hyo Jin

    2014-11-28

    In the past, reactive oxygen species (ROS) have been considered a harmful byproduct of aerobic metabolism. However, accumulating evidence implicates redox homeostasis, which maintains appropriate ROS levels, in cell proliferation and differentiation in plants and animals. Similarly, ROS generation and signaling are instrumental in fungal development and host-fungus interaction. In fungi, NADPH oxidase, a homolog of human gp91(phox), generates superoxide and is the main source of ROS. The mechanism of activation and signaling by NADPH oxidases in fungi appears to be largely comparable to those in plants and animals. Recent studies have shown that the fungal NADPH oxidase homologs NoxA (Nox1), NoxB (Nox2), and NoxC (Nox3) have distinct functions. In particular, these studies have consistently demonstrated the impact of NoxA on the development of fungal multicellular structures. Both NoxA and NoxB (but not NoxC) are involved in host-fungus interactions, with the function of NoxA being more critical than that of NoxB.

  20. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  1. Dispersal limitation of Tillandsia species correlates with rain and host structure in a central Mexican tropical dry forest.

    Science.gov (United States)

    Victoriano-Romero, Elizabeth; Valencia-Díaz, Susana; Toledo-Hernández, Víctor Hugo; Flores-Palacios, Alejandro

    2017-01-01

    Seed dispersal permits the colonization of favorable habitats and generation of new populations, facilitating escape from habitats that are in decline. There is little experimental evidence of the factors that limit epiphyte dispersion towards their hosts. In a tropical dry forest in central Mexico, we monitored the phenology of dispersion of epiphyte species of the genus Tillandsia; we tested experimentally whether precipitation could cause failures in seed dispersal and whether seed capture differs among vertical strata and between host species with high (Bursera copallifera) and low (Conzattia multiflora) epiphyte loads. With the exception of one species that presents late dispersion and low abundance, all of the species disperse prior to the onset of the rainy season. However, early rains immobilize the seeds, affecting up to 24% of the fruits in species with late dispersion. We observed that Tillandsia seeds reach both Bursera and Conzattia hosts, but found that adherence to the host is 4-5 times higher in Bursera. Furthermore, seeds liberated from Bursera travel shorter distances and up to half may remain within the same crown, while the highest seed capture takes place in the upper strata of the trees. We conclude that dispersion of Tillandsia seeds is limited by early rains and by the capture of seeds within the trees where populations concentrate. This pattern of capture also helps to explain the high concentrations of epiphytes in certain hosts, while trees with few epiphytes can be simultaneously considered deficient receivers and efficient exporters of seeds.

  2. Dispersal limitation of Tillandsia species correlates with rain and host structure in a central Mexican tropical dry forest.

    Directory of Open Access Journals (Sweden)

    Elizabeth Victoriano-Romero

    Full Text Available Seed dispersal permits the colonization of favorable habitats and generation of new populations, facilitating escape from habitats that are in decline. There is little experimental evidence of the factors that limit epiphyte dispersion towards their hosts. In a tropical dry forest in central Mexico, we monitored the phenology of dispersion of epiphyte species of the genus Tillandsia; we tested experimentally whether precipitation could cause failures in seed dispersal and whether seed capture differs among vertical strata and between host species with high (Bursera copallifera and low (Conzattia multiflora epiphyte loads. With the exception of one species that presents late dispersion and low abundance, all of the species disperse prior to the onset of the rainy season. However, early rains immobilize the seeds, affecting up to 24% of the fruits in species with late dispersion. We observed that Tillandsia seeds reach both Bursera and Conzattia hosts, but found that adherence to the host is 4-5 times higher in Bursera. Furthermore, seeds liberated from Bursera travel shorter distances and up to half may remain within the same crown, while the highest seed capture takes place in the upper strata of the trees. We conclude that dispersion of Tillandsia seeds is limited by early rains and by the capture of seeds within the trees where populations concentrate. This pattern of capture also helps to explain the high concentrations of epiphytes in certain hosts, while trees with few epiphytes can be simultaneously considered deficient receivers and efficient exporters of seeds.

  3. Wild cervids are host for tick vectors of babesia species with zoonotic capability in Belgium.

    Science.gov (United States)

    Lempereur, Laetitia; Wirtgen, Marc; Nahayo, Adrien; Caron, Yannick; Shiels, Brian; Saegerman, Claude; Losson, Bertrand; Linden, Annick

    2012-04-01

    Babesiosis is a tick-borne disease caused by different species of intraerythrocytic protozoan parasites within the genus Babesia. Different species of Babesia are described as potentially zoonotic and cause a malaria-like disease mainly in immunocompromised humans. Interest in the zoonotic potential of Babesia is growing and babesiosis has been described by some authors as an emergent zoonotic disease. The role of cervids to maintain tick populations and act as a reservoir host for some Babesia spp. with zoonotic capability is suspected. To investigate the range and infection rate of Babesia species, ticks were collected from wild cervids in southern Belgium during 2008. DNA extraction was performed for individual ticks, and each sample was evaluated for the absence of PCR inhibition using a PCR test. A Babesia spp. genus-specific PCR based on the 18S rRNA gene was applied to validated tick DNA extracts. A total of 1044 Ixodes ricinus ticks were collected and 1023 validated samples were subsequently screened for the presence of Babesia spp. DNA. Twenty-eight tick samples were found to be positive and identified after sequencing as containing DNA representing: Babesia divergens (3), B. divergens-like (5), Babesia sp. EU1 (11), Babesia sp. EU1-like (3), B. capreoli (2), or unknown Babesia sp. (4). This study confirms the presence of potentially zoonotic species and Babesia capreoli in Belgium, with a tick infection rate of 2.7% (95% CI 1.8,3.9%). Knowledge of the most common reservoir source for transmission of zoonotic Babesia spp. will be useful for models assessing the risk potential of this infection to humans.

  4. A checklist of the species of Anastrepha with the families of their host plants and hymenopteran parasitoids in Brazil

    International Nuclear Information System (INIS)

    Zucchi, Roberto Antonio

    2000-01-01

    Many surveys on fruit flies have already been carried out by several researchers in Brazil while others are still going on. Most of these surveys were conducted in areas where no studies had been previously done. With these surveys, new species and new records of species were found in Brazil. Also, in this decade, several surveys on fruit fly braconid parasitoids were conducted. These data have been summarised recently, because of the great interest in the biological control of fruit flies in Brazil. Research on eucoilid fruit fly parasitoids have been largely neglected. However, taxonomic studies are being conducted on eucoilids associated with frugivorous flies (Tephritidae and Lonchaeidae) in Brazil. All the data on fruit flies, host plants and hymenopteran parasitoids are unfortunately scattered in the literature and frequently are only published as dissertations or congress abstracts which are not widely available. Even when submitted for publication, papers take a long time to come out in Brazil. Consequently, it is very difficult to get a list of the Anastrepha species in Brazil, or to determine which host plant species are associated with them. These data are of particular interest in the case of economically important species, especially those considered as quarantine pests. Therefore, such a list is very useful for regulatory entomologists and pest management programmes by listing the Anastrepha species in Brazil and their associated host plants and hymenopteran parasitoids. The objective of this paper is to gather some available records of the Anastrepha species, their host plants and hymenopteran parasitoids (Braconidae and Eucoilidae) published in Brazil. Due to the space limitation of this paper, only families of the host plants of the Anastrepha species are presented. In fact, this work is part of a research which deals with the preparation of a database for the Anastrepha species in Brazil

  5. Redundant species, cryptic host-associated divergence, and secondary shift in Sennertia mites (Acari: Chaetodactylidae) associated with four large carpenter bees (Hymenoptera: Apidae: Xylocopa) in the Japanese island arc.

    Science.gov (United States)

    Kawazoe, Kazuhide; Kawakita, Atsushi; Kameda, Yuichi; Kato, Makoto

    2008-11-01

    Sennertia mites live as inquilines in the nests of carpenter bees and disperse as deutonymphs on newly emerged adult bees. Because their life cycle is tightly linked to that of the host bees, Sennertia may diverge in response to speciation in the hosts. However, the majority of Sennertia species are associated with several closely related carpenter bees, suggesting that host speciation may not be reflected in mite genetic structure. Here we investigate the extent of host-associated genetic differentiation in two Sennertia mites (S. alfkeni and S. japonica) that share four closely related, strictly allopatric large carpenter bees (Xylocopa). Analysis of the mitochondrial cytochrome oxidase subunit I (COI) gene in Sennertia unexpectedly indicates that the two species represent morphological variants of a single species, and they collectively group into four distinct, allopatric clades that are uniquely associated with a single Xylocopa host. An exception is the mites associated with X. amamensis of the northernmost populations, which have genotypes typical of those associated with neighboring X. appendiculatacircumvolans. Additional analysis using amplified fragment length polymorphism (AFLP) further corroborates the presence of four mite clades but contrary to the COI data, suggests that the mites of the southernmost population of X. appendiculatacircumvolans have genetic profiles typical of those associated with X. amamensis. These results indicate that some mites have undergone secondary host switch after the formation of the four mite lineages and further experienced mitochondrial introgression during period of lineage coexistence. Overall, our results strongly urge reappraisal of deutonymph-based mite taxonomy and illuminate the importance of host-associated divergence during incipient stage of speciation in chaetodactylid mites. Furthermore, the occurrence of host switch and introgression between genetically differentiated mites entails that two host species

  6. Deficiency in egg rejection in a host species as a response to the absence of brood parasitism

    OpenAIRE

    Yang, Canchao; Wang, Longwu; Cheng, Shun-Jen; Hsu, Yu-Cheng; Stokke, Bård Gunnar; Røskaft, Eivin; Moksnes, Arne; Liang, Wei; Møller, Anders Pape

    2015-01-01

    Different populations of a host species subject to variable patterns of selection due to cuckoo parasitism provide an optimal situation for studying natural selection and coevolution in action. We compared egg appearance and egg-rejection behavior of 2 common cuckoo (Cuculus canorus) hosts, the ashy-throated parrotbill (Paradoxornis alphonsianus) and the vinous-throated parrotbill (Paradoxornis webbianus) between mainland China and Taiwan population that have been segregated for 2–3 million y...

  7. Contrasting Plasticity in Ovariole Number Induced by A Dietary Effect of the Host Plants between Cactophilic Drosophila Species

    Directory of Open Access Journals (Sweden)

    Daniela Peluso

    2016-05-01

    Full Text Available Under the preference-performance hypothesis, natural selection will favor females that choose oviposition sites that optimize the fitness of their offspring. Such a preference-performance relationship may entail important consequences mainly on fitness-related traits. We used the well-characterized cactus-Drosophila system to investigate the reproductive capacity in the pair of sibling species D. buzzatii and D. koepferae reared in two alternative host plants. According to our hypothesis, ovariole number (as a proxy of reproductive capacity depends on host plant selection. Our results indicate that the capacity of D. buzzatii showed to be mild, only increasing the number of ovarioles by as much as 10% when reared in its preferred host. In contrast, D. koepferae exhibited a similar reproductive capacity across host cacti, even though it showed a preference for its primary host cactus. Our study also revealed that D. buzzatii has a larger genetic variation for phenotypic plasticity than its sibling, although ovariole number did not show clear-cut differences between species. We will discuss the weak preference-performance pattern observed in these cactophilic species in the light of nutritional and toxicological differences found between the natural host plants.

  8. What determines species richness of parasitic organisms? A meta-analysis across animal, plant and fungal hosts.

    Science.gov (United States)

    Kamiya, Tsukushi; O'Dwyer, Katie; Nakagawa, Shinichi; Poulin, Robert

    2014-02-01

    Although a small set of external factors account for much of the spatial variation in plant and animal diversity, the search continues for general drivers of variation in parasite species richness among host species. Qualitative reviews of existing evidence suggest idiosyncrasies and inconsistent predictive power for all proposed determinants of parasite richness. Here, we provide the first quantitative synthesis of the evidence using a meta-analysis of 62 original studies testing the relationship between parasite richness across animal, plant and fungal hosts, and each of its four most widely used presumed predictors: host body size, host geographical range size, host population density, and latitude. We uncover three universal predictors of parasite richness across host species, namely host body size, geographical range size and population density, applicable regardless of the taxa considered and independently of most aspects of study design. A proper match in the primary studies between the focal predictor and both the spatial scale of study and the level at which parasite species richness was quantified (i.e. within host populations or tallied across a host species' entire range) also affected the magnitude of effect sizes. By contrast, except for a couple of indicative trends in subsets of the full dataset, there was no strong evidence for an effect of latitude on parasite species richness; where found, this effect ran counter to the general latitude gradient in diversity, with parasite species richness tending to be higher further from the equator. Finally, the meta-analysis also revealed a negative relationship between the magnitude of effect sizes and the year of publication of original studies (i.e. a time-lag bias). This temporal bias may be due to the increasing use of phylogenetic correction in comparative analyses of parasite richness over time, as this correction yields more conservative effect sizes. Overall, these findings point to common underlying

  9. Aggressiveness and host range of Phoma medicaginis isolated from Medicago species growing in Tunisia

    Directory of Open Access Journals (Sweden)

    Naceur DJEBALI

    2013-05-01

    Full Text Available Aggressiveness of 14 Phoma medicaginis isolates obtained from Medicago truncatula (barrel medic and M. ciliaris (ciliate medic growing in Tunisia was measured after inoculation on leaves and roots of M. truncatula. The ability of one isolate to cause disease on M. sativa (alfalfa, Cicer arietinum (chickpea, Pisum sativum (pea, Lens culinaris (lentil and Phaseolus vulgaris (common bean was also tested. The pathogen caused dark lesions that enlarged and coalesced causing yellowing and premature abscission of leaves, resulting in decreased shoot fresh weight in barrel medic plants. All P. medicaginis isolates infected barrel medic roots causing collar rot, brown root discoloration, yellowing of cotyledons and reduced shoot and root development. The pathogen colonized the cortex and the stele of plants and produced fertile pycnidia on infected roots. Symptoms on leaves allowed for greater discrimination in aggressiveness among isolates in comparison to symptoms on roots. No correlations were observed between the parameters measured on leaves and roots suggesting organ specialization in this pathogen. Phoma medicaginis infected leaves of alfalfa, pea, common bean and chickpea causing necrosis and tissue yellowing at 15 d post inoculation (dpi. Pycnidium production was observed on dead and dying foliar tissues of alfalfa, pea and common bean, but not on chickpea. The pathogen caused symptoms of collar rot and brown root discoloration on alfalfa, chickpea, pea and common bean, but did not cause symptoms on leaves or roots of lentil at 15 dpi. Phoma medicaginis was more pathogenic on barrel medic, the host of origin, in comparison to the other legumes, suggesting that these species are likely to be secondary hosts for this pathogen.

  10. Effect of host diversity and species assemblage composition on bovine tuberculosis (bTB) risk in Ethiopian cattle.

    Science.gov (United States)

    Sintayehu, Dejene W; Heitkönig, Ignas M A; Prins, Herbert H T; Tessema, Zewdu K; DE Boer, Willem F

    2017-05-01

    Current theories on diversity-disease relationships describe host species diversity and species identity as important factors influencing disease risk, either diluting or amplifying disease prevalence in a community. Whereas the simple term 'diversity' embodies a set of animal community characteristics, it is not clear how different measures of species diversity are correlated with disease risk. We therefore tested the effects of species richness, Pielou's evenness and Shannon's diversity on bovine tuberculosis (bTB) risk in cattle in the Afar Region and Awash National Park between November 2013 and April 2015. We also analysed the identity effect of a particular species and the effect of host habitat use overlap on bTB risk. We used the comparative intradermal tuberculin test to assess the number of bTB-infected cattle. Our results suggested a dilution effect through species evenness. We found that the identity effect of greater kudu - a maintenance host - confounded the dilution effect of species diversity on bTB risk. bTB infection was positively correlated with habitat use overlap between greater kudu and cattle. Different diversity indices have to be considered together for assessing diversity-disease relationships, for understanding the underlying causal mechanisms. We posit that unpacking diversity metrics is also relevant for formulating disease control strategies to manage cattle in ecosystems characterized by seasonally limited resources and intense wildlife-livestock interactions.

  11. Blends of pheromones, with and without host plant volatiles, can attract multiple species of Cerambycid beetles simultaneously

    Science.gov (United States)

    L.M. Hanks; J.A. Mongold-Diers; T.H. Atkinson; M.K. Fierke; M.D. Ginzel; E.E. Graham; T.M. Poland; A.B. Richards; M.L. Richardson; J.G.. Millar

    2018-01-01

    Pheromone components of cerambycid beetles are often conserved, with a given compound serving as a pheromone component for multiple related species, including species native to different continents. Consequently, a single synthesized compound may attract multiple species to a trap simultaneously. Furthermore, our previous research in east-central Illinois had...

  12. Asymmetric consequences of host plant occupation on the competition between the whiteflies Bemisia tabaci cryptic species MEAM1 and Trialeurodes vaporariorum (Hemiptera: Aleyrodidae)

    DEFF Research Database (Denmark)

    Zhang, Gui-Fen; Lövei, Gabor L; Hu, Man

    2014-01-01

    BACKGROUND: The two common whitefly species, Bemisia tabaci (Gennadius) MEAM1 and Trialeurodes vaporariorum (Westwood), often co-occur on their host plants. The effect of host plant occupation by one species on later-arriving conspecific individuals or on the other competing species was examined...

  13. Swift sympatric adaptation of a species of cattle tick to a new deer host in New Caledonia.

    Science.gov (United States)

    De Meeûs, T; Koffi, B B; Barré, N; de Garine-Wichatitsky, M; Chevillon, C

    2010-10-01

    The occurrence and frequency of sympatric speciation in natural systems continue to be hotly debated issues in evolutionary biology. This might reflect the timescale over which evolution occurs resulting in there being few compelling observations of the phenomenon (lake fishes, phytophagous insects and Island trees). Despite predictions, few examples of sympatric speciation have been recorded in animal parasites, at least widely accepted as such. Here we show that, in New Caledonia, the monophasic (exploiting one individual host per generation) cattle tick Rhipicephalus microplus has evolved in contact with two sympatric host species into two differentiated genetic pools: on the cattle, its original host and on rusa deer, a new host for this tick. This sympatric isolation has occurred over a relative short period of time (i.e. less than 244 tick generations) as a consequence of differential selection pressure imposed by hosts. It is most likely that this phenomenon has occurred in many other places across the globe where this tick has come in contact with different host species in sympatry with cattle. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Mismatch between herbivore behavior and demographics contributes to scale-dependence of host susceptibility in two pine species

    Science.gov (United States)

    Ylioja, T.; Slone, D.H.; Ayres, M.P.

    2005-01-01

    The impacts on forests of tree-killing bark beetles can depend on the species composition of potential host trees. Host susceptibility might be an intrinsic property of tree species, or it might depend on spatial patterning of alternative host species. We compared the susceptibility of loblolly pine (Pinus taeda) and Virginia pine (P. virginiana) to southern pine beetle (Dendroctonus frontalis) at two hierarchical levels of geographic scale: within beetle infestations in heterospecific stands (extent ranging from 0.28 to 0.65 ha), and across a forest landscape (extent 72,500 ha) that was dominated by monospecific stands. In the former, beetles preferentially attacked Virginia pine (tree mortality = 65-100% in Virginia pine versus 0-66% in loblolly pine), but in the latter, loblolly stands were more susceptible than Virginia stands. This hierarchical transition in host susceptibility was predicted from knowledge of (1) a behavioral preference of beetles for attacking loblolly versus Virginia pine, (2) a negative correlation between preference and performance, and (3) a mismatch in the domain of scale between demographics and host selection by individuals. There is value for forest management in understanding the processes that can produce hierarchical transitions in ecological patterns. Copyright ?? 2005 by the Society of American Foresters.

  15. Host species shapes the co-occurrence patterns rather than diversity of stomach bacterial communities in pikas.

    Science.gov (United States)

    Li, Huan; Li, Tongtong; Tu, Bo; Kou, Yongping; Li, Xiangzhen

    2017-07-01

    The mammalian stomach acts as an important barrier against ingested pathogens into the entire gastrointestinal tract, thereby playing a key role in host health. However, little is known regarding to the stomach microbial compositions in wild mammals and the factors that may influence the community compositions. Using high-throughput sequencing of the 16S rRNA gene, we characterized the stomach bacterial community compositions, diversity, and interactions in two common pika (Ochotona sp.) species in China, including Plateau pikas (Ochotona curzoniae) and Daurian pikas (Ochotona daurica) living in the Qinghai-Tibet Plateau and the Inner Mongolia Grassland, respectively. The bacterial communities can be divided into two distinct phylogenetic clusters. The most dominant bacteria in cluster I were unclassified bacteria. Cluster II was more diverse, predominantly consisting of Bacteroidetes, followed by unclassified bacteria, Firmicutes and Proteobacteria. Three dominant genera (Prevotella, Oscillospira, and Ruminococcus) in pika stomachs were significantly enriched in cluster II. In addition, seasons, host species, and sampling sites as well as body weight and sex had no significant impacts on the composition and diversity of pika stomach communities. Interestingly, Plateau pikas harbored a more complex bacterial network than Daurian pikas, and these two pika species showed different co-occurrence patterns. These results suggested that the pika stomach harbors a diverse but relatively stable and unique bacterial community, which is independent on host (host species, body weight, and sex) and measured environmental factors (sampling sites and seasons). Interestingly, host species shapes the microbial interactions rather than diversity of stomach bacterial communities in pikas, reflecting specific niche adaptation of stomach bacterial communities through species interactions.

  16. Chlorella species as hosts for genetic engineering and expression of heterologous proteins: Progress, challenge and perspective.

    Science.gov (United States)

    Yang, Bo; Liu, Jin; Jiang, Yue; Chen, Feng

    2016-10-01

    The species of Chlorella represent a highly specialized group of green microalgae that can produce high levels of protein. Many Chlorella strains can grow rapidly and achieve high cell density under controlled conditions and are thus considered to be promising protein sources. Many advances in the genetic engineering of Chlorella have occurred in recent years, with significant developments in successful expression of heterologous proteins for various applications. Nevertheless, a lot of obstacles remain to be addressed, and a sophisticated and stable Chlorella expression system has yet to emerge. This review provides a brief summary of current knowledge on Chlorella and an overview of recent progress in the genetic engineering of Chlorella, and highlights the advances in the development of a genetic toolbox of Chlorella for heterologous protein expression. Research directions to further exploit the Chlorella expression system with respect to both challenges and perspectives are also discussed. This paper serves as a comprehensive literature review for the Chlorella community and will provide valuable insights into future exploration of Chlorella as a promising host for heterologous protein expression. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Comparisons of host mitochondrial, nuclear and endosymbiont bacterial genes reveal cryptic fig wasp species and the effects of Wolbachia on host mtDNA evolution and diversity

    Directory of Open Access Journals (Sweden)

    Feng Gui

    2011-04-01

    Full Text Available Abstract Background Figs and fig-pollinating wasp species usually display a highly specific one-to-one association. However, more and more studies have revealed that the "one-to-one" rule has been broken. Co-pollinators have been reported, but we do not yet know how they evolve. They may evolve from insect speciation induced or facilitated by Wolbachia which can manipulate host reproduction and induce reproductive isolation. In addition, Wolbachia can affect host mitochondrial DNA evolution, because of the linkage between Wolbachia and associated mitochondrial haplotypes, and thus confound host phylogeny based on mtDNA. Previous research has shown that fig wasps have the highest incidence of Wolbachia infection in all insect taxa, and Wolbachia may have great influence on fig wasp biology. Therefore, we look forward to understanding the influence of Wolbachia on mitochondrial DNA evolution and speciation in fig wasps. Results We surveyed 76 pollinator wasp specimens from nine Ficus microcarpa trees each growing at a different location in Hainan and Fujian Provinces, China. We found that all wasps were morphologically identified as Eupristina verticillata, but diverged into three clades with 4.22-5.28% mtDNA divergence and 2.29-20.72% nuclear gene divergence. We also found very strong concordance between E. verticillata clades and Wolbachia infection status, and the predicted effects of Wolbachia on both mtDNA diversity and evolution by decreasing mitochondrial haplotypes. Conclusions Our study reveals that the pollinating wasp E. verticillata on F. microcarpa has diverged into three cryptic species, and Wolbachia may have a role in this divergence. The results also indicate that Wolbachia strains infecting E. verticillata have likely resulted in selective sweeps on host mitochondrial DNA.

  18. Conjugal Transfer of Broad-Host-Range Plasmid pAMβ1 into Enteric Species of Lactic Acid Bacteria

    Science.gov (United States)

    Vescovo, M.; Morelli, L.; Bottazzi, V.; Gasson, M. J.

    1983-01-01

    The broad-host-range plasmid pAMβ1, which codes for erythromycin and lincomycin resistance, was transferred by conjugation into Lactobacillus acidophilus, Lactobacillus reuteri, and Lactobacillus salivarius. A novel 17-megadalton plasmid molecule was detected in the transconjugants, confirming the introduction of pAMβ1 into each species. Images PMID:16346389

  19. Role of dung beetle feeding mechanisms in limiting the suitability of species as hosts for the nematode Spirocerca lupi

    DEFF Research Database (Denmark)

    du Toit, C. A.; Holter, P.; Lutermann, H.

    2012-01-01

    Various species of dung beetle serve as intermediate hosts after ingesting the embryonated eggs (1115 x 3037 mu m) of Spirocerca lupi (Spirurida: Spirocercidae) in dog faeces. The feeding mechanisms of coprophagous dung beetles restrict the size of the food particles they can ingest and hence may...

  20. Single-Cell Analysis of the Impact of Host Cell Heterogeneity on Infection with Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Xin, Xiu; Wang, Hailong; Han, Lingling; Wang, Mingzhen; Fang, Hui; Hao, Yao; Li, Jiadai; Zhang, Hu; Zheng, Congyi; Shen, Chao

    2018-05-01

    Viral infection and replication are affected by host cell heterogeneity, but the mechanisms underlying the effects remain unclear. Using single-cell analysis, we investigated the effects of host cell heterogeneity, including cell size, inclusion, and cell cycle, on foot-and-mouth disease virus (FMDV) infection (acute and persistent infections) and replication. We detected various viral genome replication levels in FMDV-infected cells. Large cells and cells with a high number of inclusions generated more viral RNA copies and viral protein and a higher proportion of infectious cells than other cells. Additionally, we found that the viral titer was 10- to 100-fold higher in cells in G 2 /M than those in other cell cycle phases and identified a strong correlation between cell size, inclusion, and cell cycle heterogeneity, which all affected the infection and replication of FMDV. Furthermore, we demonstrated that host cell heterogeneity influenced the adsorption of FMDV due to differences in the levels of FMDV integrin receptors expression. Collectively, these results further our understanding of the evolution of a virus in a single host cell. IMPORTANCE It is important to understand how host cell heterogeneity affects viral infection and replication. Using single-cell analysis, we found that viral genome replication levels exhibited dramatic variability in foot-and-mouth disease virus (FMDV)-infected cells. We also found a strong correlation between heterogeneity in cell size, inclusion number, and cell cycle status and that all of these characteristics affect the infection and replication of FMDV. Moreover, we found that host cell heterogeneity influenced the viral adsorption as differences in the levels of FMDV integrin receptors' expression. This study provided new ideas for the studies of correlation between FMDV infection mechanisms and host cells. Copyright © 2018 American Society for Microbiology.

  1. Comparative Transcriptomic Analyses of Three Species of Placobdella (Rhynchobdellida: Glossiphoniidae) Confirms a Single Origin of Blood Feeding in Leeches.

    Science.gov (United States)

    Siddall, Mark E; Brugler, Mercer R; Kvist, Sebastian

    2016-02-01

    One of the recalcitrant questions regarding the evolutionary history of clitellate annelids involves the feeding preference of the common ancestor of extant rhynchobdellid (proboscis bearing) and arhynchobdellid (jaw bearing) leeches. Whereas early evidence, based on morphological data, pointed towards independent acquisitions of blood feeding in the 2 orders, molecular-based phylogenetic data suggest that the ancestor of modern leeches was a sanguivore. Here, we use a comparative transcriptomic approach in order to increase our understanding of the diversity of anticoagulation factors for 3 species of the genus Placobdella, for which comparative data have been lacking, and inspect these in light of archetypal anticoagulant data for both arhynchobdellid and other rhynchobdellid species. Notwithstanding the varying levels of host specificity displayed by the 3 different species of Placobdella, transcriptomic profiles with respect to anticoagulation factors were largely similar -this despite the fact that Placobdella kwetlumye only retains a single pair of salivary glands, as opposed to the 2 pairs more common in the genus. Results show that 9 different anticoagulant proteins and an additional 5 putative antihemostasis proteins are expressed in salivary secretions of the 3 species. In particular, an ortholog of the archetypal, single-copy, anticoagulant hirudin (not previously available as comparative data for rhynchobdellids) is present in at least 2 of 3 species examined, corroborating the notion of a single origin of blood feeding in the ancestral leech.

  2. Induction of prophage lambda by chlorinated organics: Detection of some single-species/single-site carcinogens

    Energy Technology Data Exchange (ETDEWEB)

    DeMarini, D.M.; Brooks, H.G. (Environmental Protection Agency, Research Triangle Park, NC (United States))

    1992-01-01

    Twenty-eight chlorinated organic compounds were evaluated for their ability to induce DNA damage using the Microscreen prophage-induction assay in Escherichia coli. Comparison of the performance characteristics of the prophage-induction and Salmonella assays to rodent carcinogenicity assays showed that the prophage-induction assay had a somewhat higher specificity than did the Salmonella assay (70% vs. 50%); sensitivity, concordance, and positive and negative predictivity were similar for the two microbial assays. The Microscreen prophage-induction assay failed to detect eight carcinogens, perhaps due to toxicity or other unknown factors; five of these eight carcinogens were detected by the Salmonella assay. However, the prophage-induction assay did detect six carcinogens that were not detected by the Salmonella assay, and five of these were single-species, single-site carcinogens, mostly mouse liver carcinogens. Some of these carcinogens, such as the chloroethanes, produce free radicals, which may be the basis for their carcinogenicity and ability to induce prophage. The prophage-induction (or other SOS) assay may be useful in identifying some genotoxic chlorinated carcinogens that induce DNA damage that do not revert the standard Salmonella tester strains.

  3. Helminth infracommunity structure of Leptodactylus melanonotus (Anura) in Tres Palos, Guerrero, and other records for this host species in Mexico.

    Science.gov (United States)

    Mata-López, Rosario; León-Règagnon, Virginia; García-Prieto, Luis

    2013-06-01

    The amphibian genus Leptodactylus includes around 50 species, of which only 2 are distributed in Mexico; the helminth fauna of these 2 species is poorly known. As part of a research program on amphibian parasites in Mexico from 1997 to 2005, 281 sabinal frogs Leptodactylus melanonotus from 42 localities in 11 Mexican states were examined from a helminthological perspective. A total of 20 taxa of helminths-7 digeneans (5 adults, 2 larvae) and 13 nematodes (8 adults, 5 larvae)-was found to infect this amphibian host species. These data represent 105 new locality records, and 11 taxa are recorded in L. melanonotus for the first time. Infracommunity analyses of the sabinal frogs from Tres Palos indicated that these hosts are depauperate. The helminth community is dominated by specialist species, with Cosmocerca podicipinus the most common in almost 50% of the infracommunities. Percutaneous infection and predator-prey interactions were the 2 most common infection routes by helminths in frogs from Tres Palos, with 79% of the parasites recruited via skin penetration. Finally, our results show that the helminth fauna parasitizing L. melanonotus throughout Mexico has low similarity with the helminth fauna of leptodactylids studied comprehensively in South America, with only 2 digeneans and 3 nematodes being shared by hosts from both regions. As a result of our survey, the number of helminth species parasitizing L. melanonotus increased to 34. Considering its native distribution range, this number is now 36 with the inclusion of the nematodes Oswaldocruzia costaricensis and Cruzia empera in Costa Rica.

  4. Multilocus sequence typing of a global collection of Pasteurella multocida isolates from cattle and other host species demonstrates niche association

    Directory of Open Access Journals (Sweden)

    Lainson F Alex

    2011-05-01

    Full Text Available Abstract Background Pasteurella multocida causes disease in many host species throughout the world. In bovids, it contributes to bovine respiratory disease (BRD and causes haemorrhagic septicaemia (HS. Previous studies have suggested that BRD-associated P. multocida isolates are of limited diversity. A multilocus sequence typing (MLST scheme for P. multocida was used to determine whether the low levels of diversity reported are due to the limited discriminatory power of the typing method used, restricted sample selection or true niche association. Bovine respiratory isolates of P. multocida (n = 133 from the UK, the USA and France, collected between 1984 and 2008 from both healthy and clinically affected animals, were typed using MLST. Isolates of P. multocida from cases of HS, isolates from other host species and data from the MLST database were used as comparison. Results Bovine respiratory isolates were found to be clonal (ISA 0.45 with 105/128 belonging to clonal complex 13 (CC13. HS isolates were not related to bovine respiratory isolates. Of the host species studied, the majority had their own unique sequence types (STs, with few STs being shared across host species, although there was some cross over between porcine and bovine respiratory isolates. Avian, ovine and porcine isolates showed greater levels of diversity compared to cattle respiratory isolates, despite more limited geographic origins. Conclusions The homogeneity of STs of bovine respiratory P. multocida observed, and the differences between these and P. multocida subpopulations from bovine non-respiratory isolates and non-bovine hosts may indicate niche association.

  5. Effects of host species, stage and size on the sex ratio and clutch size of the parasitoid, Dibrachys boarmiae (Walker, 1863) (Hymenoptera: Pteromalidae).

    Science.gov (United States)

    Sarikaya, A; Gülel, A

    2011-06-01

    Effects of host species, stage and size on clutch size and sex ratio of the gregarious, idiobiont ectoparasitoid Dibrachys boarmiae were investigated at 25±2°C and 70±5% relative humidity. The greater wax moth, Galleria mellonella, small wax moth, Achroia grisella, and early stage solitary larvae of the endoparasitoid, Apanteles galleriae, were used as hosts. Clutch size was greatest from prepupae of the largest host, Galleria mellonella, with a mean of 40.07 offspring per host versus 14.73 and 2.93 for Achroia grisella and Apanteles galleriae, respectively. The mean clutch size from pupae was lower than from prepupae, being 17.27, 10.73 and 2.89 for Galleria mellonella, Achroia grisella and Apanteles galleriae, respectively. Within each host species and stage, heavier hosts resulted in larger clutches. The sex ratio of offspring (proportion of male) was approximately 0.20, with only minor differences among host species, stages and sizes.

  6. Host species and environmental effects on bacterial communities associated with Drosophila in the laboratory and in the natural environment.

    Directory of Open Access Journals (Sweden)

    Fabian Staubach

    Full Text Available The fruit fly Drosophila is a classic model organism to study adaptation as well as the relationship between genetic variation and phenotypes. Although associated bacterial communities might be important for many aspects of Drosophila biology, knowledge about their diversity, composition, and factors shaping them is limited. We used 454-based sequencing of a variable region of the bacterial 16S ribosomal RNA gene to characterize the bacterial communities associated with wild and laboratory Drosophila isolates. In order to specifically investigate effects of food source and host species on bacterial communities, we analyzed samples from wild Drosophila melanogaster and D. simulans collected from a variety of natural substrates, as well as from adults and larvae of nine laboratory-reared Drosophila species. We find no evidence for host species effects in lab-reared flies; instead, lab of origin and stochastic effects, which could influence studies of Drosophila phenotypes, are pronounced. In contrast, the natural Drosophila-associated microbiota appears to be predominantly shaped by food substrate with an additional but smaller effect of host species identity. We identify a core member of this natural microbiota that belongs to the genus Gluconobacter and is common to all wild-caught flies in this study, but absent from the laboratory. This makes it a strong candidate for being part of what could be a natural D. melanogaster and D. simulans core microbiome. Furthermore, we were able to identify candidate pathogens in natural fly isolates.

  7. Host specificity in bat ectoparasites: a natural experiment.

    Science.gov (United States)

    Seneviratne, Sampath S; Fernando, H Chandrika; Udagama-Randeniya, Preethi V

    2009-07-15

    We undertook a field study to determine patterns of specialisation of ectoparasites in cave-dwelling bats in Sri Lanka. The hypothesis tested was that strict host specificity (monoxeny) could evolve through the development of differential species preferences through association with the different host groups. Three species of cave-dwelling bats were chosen to represent a wide range of host-parasite associations (monoxeny to polyxeny), and both sympatric and allopatric roosting assemblages. Of the eight caves selected, six caves were "allopatric" roosts where two of each housed only one of the three host species examined: Rousettus leschenaulti (Pteropodidae), Rhinolophus rouxi and Hipposideros speoris (Rhinolophidae). The remaining two caves were "sympatric" roosts and housed all three host species. Thirty bats of each species were examined for ectoparasites in each cave, which resulted in a collection of nycteribiid and streblid flies, an ischnopsyllid bat flea, argasid and ixodid ticks, and mites belonging to three families. The host specificity of bat parasites showed a trend to monoxeny in which 70% of the 30 species reported were monoxenous. Odds ratios derived from chi(2)-tests revealed two levels of host preferences in less-specific parasites (i) the parasite was found on two host species under conditions of both host sympatry and host allopatry, with a preference for a single host in the case of host sympatry and (ii) the preference for a single host was very high, hence under conditions of host sympatry, it was confined to the preferred host only. However, under conditions of host allopatry, it utilized both hosts. There appears to be an increasing prevalence in host preferences of the parasites toward confinement to a single host species. The ecological isolation of the bat hosts and a long history of host-parasite co-existence could have contributed to an overall tendency of bat ectoparasites to become specialists, here reflected in the high percentage

  8. Molecular phylogenetics, systematics and host-plant associations of the Bruchidius albosparsus (Fåhraeus) species group (Coleoptera, Chrysomelidae, Bruchinae) with the description of four new species.

    Science.gov (United States)

    Delobel, Alex; Le Ru, Bruno; Genson, Gwenaëlle; Musyoka, Boaz K; Kergoat, Gael J

    2015-03-16

    Bruchidius Schilsky is a large paraphyletic genus of seed beetles (Coleoptera: Chrysomelidae: Bruchinae) which consists of multiple lineages that are usually associated with narrow sets of host-plants. In this study we focus on a group that mostly develops on wattle trees (acacias) belonging to the genus Vachellia Wight & Arn. This group originally included nine species and was designated as the Bruchidius centromaculatus (Allard) species group, but recent phylogenetic analyses revealed that these species belong to a much wider group of species with similar morphologies. For reasons of anteriority we call this enlarged group Bruchidius albosparsus (Fåhraeus). Here we review the morphology of species in this group and provide new diagnoses and ecological data for 10 species. The following combinations and synonymies are proposed: Bruchidius tanaensis (Pic, 1921) (= Bruchus tanaensis Pic, 1921) comb. nov. and Bruchidius albosparsus (Fåhraeus, 1839) (= Bruchus spadiceus Fåhraeus, 1839) syn. nov. Four new species are also described: B. eminingensis sp. nov., B. gerrardiicola sp. nov., B. glomeratus sp. nov. and B. haladai sp. nov. Finally we carried out molecular phylogenetic analyses on a multi-marker dataset of 59 specimens and 35 species, including 14 species from the group. The resulting trees allow us to confirm the monophyly of the group of interest and provide a more detailed picture of their evolutionary relationships.

  9. Resistance to Arrenurus spp. Parasitism in Odonates: Patterns Across Species and Comparisons Between a Resistant and Susceptible Host.

    Science.gov (United States)

    Worthen, Wade B; Hart, Thomas M

    2016-01-01

    Some adult odonates resist parasitism by larval water mites (Arrenurus spp.) with melanotic encapsulation, in which the mite's stylestome is clogged and the mite starves. In summer 2014, we counted the engorged and resisted mites on 2,729 adult odonates sampled by aerial net at 11 water bodies in Greenville Co. and Pickens Co., SC, and tested the hypothesis that the frequency and intensity of resistance correlates with parasite prevalence (the percentage of parasitized hosts). Resistance prevalence (the percentage of parasitized hosts that resisted at least one mite) varied significantly among host species, exceeding 60% for Argia fumipennis(Burmeister) and Celithemis fasciata Kirby but less than 20% for other species. However, neither resistance prevalence nor mean resistance intensity (mean percentage of resisted mites on resisting hosts) correlated with parasite prevalence. We described potential effects of parasitism on host development ofA. fumipennis and Pachydiplax longipennis(Burmeister) by comparing the percent asymmetry of forewing lengths between parasitized and unparasitized individuals. There was no significant difference in asymmetry for either males or females of A. fumipennis, or males of Pa. longipennis(females were not sampled). We also evaluated differences in melanotic encapsulation between A. fumipennis, which readily encapsulates mites in nature, and Pa. longipennis We inserted a 2.0-mm piece of sterile monofilament line into the thorax of captured individuals for 24 h and compared mean gray value scores of inserted and emergent ends using Image-J software. There was no difference in melanotic encapsulation between species. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  10. Interbacterial Adhesion Networks within Early Oral Biofilms of Single Human Hosts.

    Science.gov (United States)

    Palmer, Robert J; Shah, Nehal; Valm, Alex; Paster, Bruce; Dewhirst, Floyd; Inui, Taichi; Cisar, John O

    2017-06-01

    Specific interbacterial adhesion, termed coaggregation, is well established for three early colonizers of the plaque biofilm: streptococci, actinomyces, and veillonellae. However, little is known about interactions of other early colonizers and about the extent of interactions within the bacterial community from a single host. To address these gaps, subject-specific culture collections from two individuals were established using an intraoral biofilm retrieval device. Molecular taxonomy (Human Oral Microbe Identification Microarray [HOMIM]) analysis of biofilm samples confirmed the integrity and completeness of the collections. HOMIM analysis verified the isolation of Streptococcus gordonii and S. anginosus from only one subject, as well as isolation of a previously uncultivated streptococcal phylotype from the other subject. Strains representative of clonal diversity within each collection were further characterized. Greater than 70% of these streptococcal strains from each subject coaggregated with at least one other coisolate. One-third of the strains carry a known coaggregation mediator: receptor polysaccharide (RPS). Almost all nonstreptococcal isolates coaggregated with other coisolates. Importantly, certain Rothia strains demonstrated more coaggregations with their coisolated bacteria than did any Streptococcus or Actinomyces strain, and certain Haemophilus isolates participated in twice as many. Confocal microscopy of undisturbed biofilms showed that Rothia and Haemophilus each occur in small multispecies microcolonies. However, in confluent high-biomass regions, Rothia occurred in islands whereas Haemophilus was distributed throughout. Together, the data demonstrate that coaggregation networks within an individual's oral microflora are extensive and that Rothia and Haemophilus can be important initiators of cell-cell interactions in the early biofilm. IMPORTANCE Extensive involvement of specific interbacterial adhesion in dental plaque biofilm formation has

  11. A structurally based analytic model of growth and biomass dynamics in single species stands of conifers

    Science.gov (United States)

    Robin J. Tausch

    2015-01-01

    A theoretically based analytic model of plant growth in single species conifer communities based on the species fully occupying a site and fully using the site resources is introduced. Model derivations result in a single equation simultaneously describes changes over both, different site conditions (or resources available), and over time for each variable for each...

  12. From the Atlantic Forest to the borders of Amazonia: species richness, distribution, and host association of ectoparasitic flies (Diptera: Nycteribiidae and Streblidae) in northeastern Brazil.

    Science.gov (United States)

    Barbier, Eder; Bernard, Enrico

    2017-11-01

    Better knowledge of the geographical distribution of parasites and their hosts can contribute to clarifying aspects of host specificity, as well as on the interactions among hosts, parasites, and the environment in which both exist. Ectoparasitic flies of the Nycteribiidae and Streblidae families are highly specialized hematophagous parasites of bats, whose distributional patterns, species richness, and associations with hosts remain underexplored and poorly known in Brazil. Here, we used information available in the literature and unpublished data to verify if the occurrence of bat hosts in a given environment influences the occurrence and distribution of nycteribiid and streblid flies in different ecoregions in the northeastern Brazil. We evaluate species richness and similarity between ecoregions and tested correlations between species richness and the number of studies in each ecoregion and federative unit. We recorded 50 species and 15 genera of bat ectoparasitic flies on 36 species and 27 genera of bat hosts. The Atlantic Forest had the highest fly species richness (n = 31; 62%), followed by Caatinga (n = 27; 54%). We detected the formation of distinct groups, with low species overlap between ecoregions for both flies and bats. Fly species richness was correlated with host species richness and with the number of studies in each federative unit, but not with the number of studies by ecoregion. Due to the formation of distinct groups with low species overlap for both groups, host availability is likely to be one of the factors that most influence the occurrence of highly specific flies. We also discuss host specificity for some species, produced an updated list of species and distribution for both nycteribiid and streblid flies with information on interaction networks, and conclude by presenting recommendations for more effective inventories of bat ectoparasites in the future.

  13. Three new species of Baeoentedon Girault (Hymenoptera: Eulophidae) from China, with the first record of whitefly host association (Hemiptera: Aleyrodidae).

    Science.gov (United States)

    Wang, Zhu-Hong; Huang, Jian; Polaszek, Andrew

    2014-07-01

    Three new species of Baeoentedon Girault (Hymenoptera: Eulophidae) are described from China, Baeoentedon balios Wang, Huang & Polaszek sp. nov., Baeoentedon bouceki Wang, Huang & Polaszek sp. nov. and Baeoentedon virgatus Wang, Huang & Polaszek sp. nov. Both female and male of Baeoentedon balios were reared from the whitefly Pealius spina (Singh) (Hemiptera: Aleyrodidae) on the bodhi tree Ficus religiosa L. (Urticales: Moraceae). The male and the whitefly host association of Baeoentedon are recorded for the first time. A key is also provided to females of the world species of the genus.

  14. Influence of host tree species on isolation and communities of mycorrhizal and endophytic fungi from roots of a tropical epiphytic orchid, Dendrobium sinense (Orchidaceae).

    Science.gov (United States)

    Wang, Xiaoming; Li, Yijia; Song, Xiqiang; Meng, Qianwan; Zhu, Jie; Zhao, Ying; Yu, Wengang

    2017-10-01

    Most studies on the host preference of orchids have focused on the association between orchids and host characteristics, but little is known about the differences of mycorrhizal and endophytic fungal communities in epiphytic orchids growing on different host tree species. We selected Dendrobium sinense, a tropical epiphytic orchid, to determine if fungal endophytes from the roots of D. sinense were preferentially correlated with host tree species. Fifty-six fungal operational taxonomic units (OTUs) from 36 host trees were identified. The results indicated that the species richness and diversity of mycorrhizal and endophytic fungal communities isolated from D. sinense roots were strongly influenced by host tree species. Both species richness and diversity indices showed that D. sinense roots on Syzygium buxifolium harbored the most diverse and abundant endophytic fungi. Species of Tulasnellaceae were dominant on S. buxifolium and Rhododendron moulmainense but infrequent on Cyclobalanopsis disciformis and Podocarpus neriifolius. Our results provide evidence for distinct mycorrhizal and endophytic fungal communities on different host tree species. Further research focusing on fungi-orchid-host preference could be conducted to increase our understanding for the in situ conservation of epiphytic orchids.

  15. Survey of immunoglobulin A protease activity among selected species of Ureaplasma and Mycoplasma: specificity for host immunoglobulin A.

    Science.gov (United States)

    Kapatais-Zoumbos, K; Chandler, D K; Barile, M F

    1985-03-01

    Because immunoglobulin A (IgA) is the predominant immunoglobulin at mucosal surfaces, IgA proteases produced by pathogenic bacteria are considered potential virulence factors for organisms that cause disease or gain entry at mucous membranes. To determine the role of IgA protease in the pathogenicity of mycoplasmal disease, a variety of human and animal mycoplasma and ureaplasma species were examined for IgA protease activity with human, murine, porcine, and canine IgA. None of the mycoplasma species examined showed detectable IgA protease activity with any of the IgAs tested. Twenty-eight strains of Ureaplasma urealyticum isolated from human urogenital tissues cleaved human IgA1, but no cleavage of human IgA2 or murine, porcine, or canine IgA was observed. Ureaplasmas isolated from nonhuman hosts (feline, canine, avian, and bovine [Ureaplasma diversum]) did not cleave human IgA1. Two strains of canine ureaplasmas were able to cleave canine IgA, but not murine IgA. Thus, ureaplasmas from other species can produce IgA protease, but the specificity of the enzyme was restricted to the IgA of the appropriate host. This finding suggests that IgA proteases could play a role in the selective host specificity of mucosal pathogens.

  16. Species distribution modelling for plant communities: Stacked single species or multivariate modelling approaches?

    Science.gov (United States)

    Emilie B. Henderson; Janet L. Ohmann; Matthew J. Gregory; Heather M. Roberts; Harold S.J. Zald

    2014-01-01

    Landscape management and conservation planning require maps of vegetation composition and structure over large regions. Species distribution models (SDMs) are often used for individual species, but projects mapping multiple species are rarer. We compare maps of plant community composition assembled by stacking results from many SDMs with multivariate maps constructed...

  17. Isolation of bacteriophage host strains of Bacteroides species suitable for tracking sources of animal faecal pollution in water.

    Science.gov (United States)

    Gómez-Doñate, Marta; Payán, Andrey; Cortés, Ivania; Blanch, Anicet R; Lucena, Francisco; Jofre, Juan; Muniesa, Maite

    2011-06-01

    Microbial source tracking (MST) methods allow the identification of specific faecal sources. The aim is to detect the sources of faecal pollution in a water body to allow targeted, efficient and cost-effective remediation efforts in the catchment. Bacteriophages infecting selected host strains of Bacteroides species are used as markers to track faecal contaminants in water. By using a suitable Bacteroides host from a given faecal origin, it is possible to specifically detect bacteriophages of this faecal origin. It can thus be used to detect specific phages of Bacteroides for MST. With this objective, we isolated several Bacteroides strains from pig, cow and poultry faeces by applying a previously optimized methodology used to isolate the host strains from humans. The isolated strains belonged to Bacteroides fragilis and Bacteroides thetaiotaomicron. These strains, like most Bacteroides species, detected phages of the Siphoviridae morphology. Using the newly isolated host strains for phage enumeration in a range of samples, we showed that these detect phages in faecal sources that coincide with their own origin (70-100% of the samples), and show no detection or very low percentages of detection of phages from other animal origins (from 0 to 20% of the samples). Only strains isolated from pig wastewater detected phages in 50% of human sewage samples. Nevertheless, those strains detecting phages from faecal origins other than their own detected fewer phages (2-3 log₁₀ pfu·100 ml⁻¹) than the phages detected by the specific strain of the same origin. On the basis of our results, we propose that faecal source tracking with phages infecting specific Bacteroides host strains is a useful method for MST. In addition, the method presented here is feasible in laboratories equipped with only basic microbiological equipment, it is more rapid and cost-effective than other procedures and it does not require highly qualified staff. © 2011 Society for Applied Microbiology

  18. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species

    Directory of Open Access Journals (Sweden)

    Gaasenbeek Cor

    2009-09-01

    Full Text Available Abstract Background Hard ticks have been identified as important vectors of rickettsiae causing the spotted fever syndrome. Tick-borne rickettsiae are considered to be emerging, but only limited data are available about their presence in Western Europe, their natural life cycle and their reservoir hosts. Ixodes ricinus, the most prevalent tick species, were collected and tested from different vegetation types and from potential reservoir hosts. In one biotope area, the annual and seasonal variability of rickettsiae infections of the different tick stages were determined for 9 years. Results The DNA of the human pathogen R. conorii as well as R. helvetica, R. sp. IRS and R. bellii-like were found. Unexpectedly, the DNA of the highly pathogenic R. typhi and R. prowazekii and 4 other uncharacterized Rickettsia spp. related to the typhus group were also detected in I. ricinus. The presence of R. helvetica in fleas isolated from small rodents supported our hypothesis that cross-infection can occur under natural conditions, since R. typhi/prowazekii and R. helvetica as well as their vectors share rodents as reservoir hosts. In one biotope, the infection rate with R. helvetica was ~66% for 9 years, and was comparable between larvae, nymphs, and adults. Larvae caught by flagging generally have not yet taken a blood meal from a vertebrate host. The simplest explanation for the comparable prevalence of R. helvetica between the defined tick stages is, that R. helvetica is vertically transmitted through the next generation with high efficiency. The DNA of R. helvetica was also present in whole blood from mice, deer and wild boar. Conclusion Besides R. helvetica, unexpected rickettsiae are found in I. ricinus ticks. We propose that I. ricinus is a major reservoir host for R. helvetica, and that vertebrate hosts play important roles in the further geographical dispersion of rickettsiae.

  19. Divergence of Borrelia burgdorferi sensu lato spirochetes could be driven by the host: diversity of Borrelia strains isolated from ticks feeding on a single bird

    Science.gov (United States)

    2014-01-01

    Background The controversy surrounding the potential impact of birds in spirochete transmission dynamics and their capacity to serve as a reservoir has existed for a long time. The majority of analyzed bird species are able to infect larval ticks with Borrelia. Dispersal of infected ticks due to bird migration is a key to the establishment of new foci of Lyme borreliosis. The dynamics of infection in birds supports the mixing of different species, the horizontal exchange of genetic information, and appearance of recombinant genotypes. Methods Four Borrelia burgdorferi sensu lato strains were cultured from Ixodes minor larvae and four strains were isolated from Ixodes minor nymphs collected from a single Carolina Wren (Thryothorus ludovicianus). A multilocus sequence analysis that included 16S rRNA, a 5S-23S intergenic spacer region, a 16S-23S internal transcribed spacer, flagellin, p66, and ospC separated 8 strains into 3 distinct groups. Additional multilocus sequence typing of 8 housekeeping genes, clpA, clpX, nifS, pepX, pyrG, recG, rplB, and uvrA was used to resolve the taxonomic status of bird-associated strains. Results Results of analysis of 14 genes confirmed that the level of divergence among strains is significantly higher than what would be expected for strains within a single species. The presence of cross-species recombination was revealed: Borrelia burgdorferi sensu stricto housekeeping gene nifS was incorporated into homologous locus of strain, previously assigned to B. americana. Conclusions Genetically diverse Borrelia strains are often found within the same tick or same vertebrate host, presenting a wide opportunity for genetic exchange. We report the cross-species recombination that led to incorporation of a housekeeping gene from the B. burgdorferi sensu stricto strain into a homologous locus of another bird-associated strain. Our results support the hypothesis that recombination maintains a majority of sequence polymorphism within Borrelia

  20. Discovery of intermediate hosts for two species of blood flukes Cardicola orientalis and Cardicola forsteri (Trematoda: Aporocotylidae) infecting Pacific bluefin tuna in Japan.

    Science.gov (United States)

    Shirakashi, Sho; Tani, Kazuki; Ishimaru, Katsuya; Shin, Sang Phil; Honryo, Tomoki; Uchida, Hiro'omi; Ogawa, Kazuo

    2016-04-01

    Fish blood flukes (Aporocotylidae) are important pathogens of farmed finfish around the world. Among them, Cardicola spp. infecting farmed tuna are considered to be serious threats to tuna farming and have received tremendous attention. We conducted periodical samplings at a tuna farming site in Japan between January and May, 2015 to determine the life cycle of Cardicola spp. We collected over 4700 terebellid polychaetes from ropes, floats and frames of tuna culture cages and found nearly 400 infected worms. Sporocysts and cercariae found in Nicolea gracilibranchis were genetically identified as Cardicola orientalis by 28S and ITS2 ribosomal DNA sequences. This was the first discovery of the intermediate host for this parasite species. Infection prevalence and the abundance of N. gracilibranchis significantly varied between sampling points and the highest number of infected terebellids were collected from ropes. We also demonstrated morphologically and molecularly that asexual stages found in a single Amphitrite sp. (Terebellidae) and adult worms isolated from farmed juvenile tuna were Cardicola forsteri. This is the first report of C. forsteri in Pacific bluefin tuna (PBT) Thunnus orientalis in Japan. Our results demonstrated that all three species of Cardicola orientalis, C. forsteri and Cardicola opisthorchis exist in Japanese farmed PBTs and that they all use terebellid polychaetes as the intermediate hosts. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Species Diversity, Abundance, and Host Preferences of Mosquitoes (Diptera: Culicidae) in Two Different Ecotypes of Madagascar With Recent RVFV Transmission.

    Science.gov (United States)

    Jean Jose Nepomichene, Thiery Nirina; Elissa, Nohal; Cardinale, Eric; Boyer, Sebastien

    2015-09-01

    Mosquito diversity and abundance were examined in six Madagascan villages in either arid (Toliary II district) or humid (Mampikony district) ecotypes, each with a history of Rift Valley fever virus transmission. Centers for Disease Control and Prevention light traps without CO2 (LT) placed near ruminant parks and animal-baited net trap (NT) baited with either zebu or sheep/goat were used to sample mosquitoes, on two occasions between March 2011 and October 2011. Culex tritaeniorhynchus (Giles) was the most abundant species, followed by Culex antennatus (Becker) and Anopheles squamosus/cydippis (Theobald/de Meillon). These three species comprised more than half of all mosquitoes collected. The NT captured more mosquitoes in diversity and in abundance than the LT, and also caught more individuals of each species, except for An. squamosus/cydippis. Highest diversity and abundance were observed in the humid and warm district of Mampikony. No host preference was highlighted, except for Cx. tritaeniorhynchus presenting a blood preference for zebu baits. The description of species diversity, abundance, and host preference described herein can inform the development of control measures to reduce the risk of mosquito-borne diseases in Madagascar. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Intraspecific competition during infection by Aspergillus flavus is influenced by plant host species

    Science.gov (United States)

    Communities of Aspergillus flavus are composed of diverse genotypes that collectively influence incidence and severity of crop aflatoxin contamination. Isolates vary in competitive ability on maize, but empirical data on the extent to which host-specific influences determine outcomes of competition ...

  3. Semiochemical exploitation of host-associated cues by seven Melittobia parasitoid species

    NARCIS (Netherlands)

    González, Jorge M.; Camino, Dakota; Simon, Sabrina; Cusumano, Antonino

    2018-01-01

    Chemical compounds (infochemicals or semiochemicals) play an important role both in intra-specific and inter-specific communication. For example, chemical cues appear to play a key role in the host selection process adopted by insect parasitoids. In recent years significant advances have been made

  4. Checklist of available generic names for Microsporidia with type species and type host

    Science.gov (United States)

    The science of microsporidiology encompasses a diverse assemblage of pathogens from a large and varied group of hosts. Many members of this group have been studied and exploited for their role in the control of insect pests and vectors as well as their detrimental impact on vertebrates including ma...

  5. North American tree squirrels and ground squirrels with overlapping ranges host different Cryptosporidium species and genotypes

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Prediger, Jitka; McEvoy, J.M.

    2015-01-01

    Roč. 36, 2015-Dec (2015), s. 287-293 ISSN 1567-1348 R&D Projects: GA ČR GA15-01090S Institutional support: RVO:60077344 Keywords : Cryptosporidium * Tree squirrels * Ground squirrels * Host specificity * Zoonotic Subject RIV: GJ - Animal Vermins ; Diseases , Veterinary Medicine Impact factor: 2.591, year: 2015

  6. Combined single-cell quantitation of host and SIV genes and proteins ex vivo reveals host-pathogen interactions in individual cells.

    Directory of Open Access Journals (Sweden)

    Diane L Bolton

    2017-06-01

    Full Text Available CD4 T cells harboring HIV-1/SIV represent a formidable hurdle to eradicating infection, and yet their detailed phenotype remains unknown. Here we integrate two single-cell technologies, flow cytometry and highly multiplexed quantitative RT-PCR, to characterize SIV-infected CD4 T cells directly ex vivo. Within individual cells, we correlate the cellular phenotype, in terms of host protein and RNA expression, with stages of the viral life cycle defined by combinatorial expression of viral RNAs. Spliced RNA+ infected cells display multiple memory and activation phenotypes, indicating virus production by diverse CD4 T cell subsets. In most (but not all cells, progressive infection accompanies post-transcriptional downregulation of CD4 protein, while surface MHC class I is largely retained. Interferon-stimulated genes were also commonly upregulated. Thus, we demonstrate that combined quantitation of transcriptional and post-transcriptional regulation at the single-cell level informs in vivo mechanisms of viral replication and immune evasion.

  7. Bloodmeal hosts of Anopheles species (Diptera: Culicidae) in a malaria-endemic area of the Brazilian Amazon.

    Science.gov (United States)

    Zimmerman, Robert H; Galardo, Allan Kardec Ribeiro; Lounibos, L Philip; Arruda, M; Wirtz, R

    2006-09-01

    Hosts of blood-fed anophelines (Diptera: Culicidae) were determined in three riverine villages, 1.5-7.0 km apart, along the Matapí River, Amapá state, Brazil, by enzyme-linked immunosorbent assay midgut analysis for IgG of common vertebrates. Anopheles marajoara Galvão & Damsceno and Anopheles darlingi Root had higher human blood indices (HBI) than Anopheles nuneztovari Gabaldón, Anopheles triannulatus (Neiva and Pinto), and Anopheles intermedius (Chagas), which were relatively zoophilic. HBIs of An. darlingi varied significantly among villages, attributable to a low proportion of human-fed mosquitoes in Santo Antônio. Significantly higher incidence of An. marajoara and An. nuneztovari fed on pig blood at two villages, associated with a low number of pigs in Santo Antônio. The incidences of bovine blood varied significantly among villages for all three of the most common anopheline species. The incidence of mixed meals ranged from 7.1 to 27.6% among common species, and, for An. marajoara, varied significantly among villages. This study demonstrates differences in host selection patterns among villages only a few kilometers apart, which may be influenced by host availability and have important epidemiological consequences.

  8. Genome-Wide Comparison of Magnaporthe Species Reveals a Host-Specific Pattern of Secretory Proteins and Transposable Elements.

    Directory of Open Access Journals (Sweden)

    Meghana Deepak Shirke

    Full Text Available Blast disease caused by the Magnaporthe species is a major factor affecting the productivity of rice, wheat and millets. This study was aimed at generating genomic information for rice and non-rice Magnaporthe isolates to understand the extent of genetic variation. We have sequenced the whole genome of the Magnaporthe isolates, infecting rice (leaf and neck, finger millet (leaf and neck, foxtail millet (leaf and buffel grass (leaf. Rice and finger millet isolates infecting both leaf and neck tissues were sequenced, since the damage and yield loss caused due to neck blast is much higher as compared to leaf blast. The genome-wide comparison was carried out to study the variability in gene content, candidate effectors, repeat element distribution, genes involved in carbohydrate metabolism and SNPs. The analysis of repeat element footprints revealed some genes such as naringenin, 2-oxoglutarate 3-dioxygenase being targeted by Pot2 and Occan, in isolates from different host species. Some repeat insertions were host-specific while other insertions were randomly shared between isolates. The distributions of repeat elements, secretory proteins, CAZymes and SNPs showed significant variation across host-specific lineages of Magnaporthe indicating an independent genome evolution orchestrated by multiple genomic factors.

  9. Diversity of the skin microbiota of fishes: evidence for host species specificity.

    Science.gov (United States)

    Larsen, Andrea; Tao, Zhen; Bullard, Stephen A; Arias, Covadonga R

    2013-09-01

    Skin microbiota of Gulf of Mexico fishes were investigated by ribosomal internal spacer analysis (RISA) and 16S rRNA gene sequencing. A total of 102 fish specimens representing six species (Mugil cephalus, Lutjanus campechanus, Cynoscion nebulosus, Cynoscion arenarius, Micropogonias undulatus, and Lagodon rhomboides) were sampled at regular intervals throughout a year. The skin microbiota from each individual fish was analyzed by RISA and produced complex profiles with 23 bands on average. Similarities between RISA profiles ranged from 97.5% to 4.0%. At 70% similarity, 11 clusters were defined, each grouping individuals from the same fish species. Multidimensional scaling and analysis of similarity correlated the RISA-defined clusters with geographic locality, date, and fish species. Global R values indicated that fish species was the most indicative variable for group separation. Analysis of 16S rRNA gene sequences (from pooled samples of 10 individual fish for each fish species) showed that the Proteobacteria was the predominant phylum in skin microbiota, followed by the Firmicutes and the Actinobacteria. The distribution and abundance of bacterial sequences were different among all species analyzed. Aeribacillus was found in all fish species representing 19% of all clones sequenced, while some genera were fish species-specific (Neorickettsia in M. cephalus and Microbacterium in L. campechanus). Our data provide evidence for the existence of specific skin microbiota associated with particular fish species. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. Single- and multi-photon ionization studies of organosulfur species

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Yu -San [Iowa State Univ., Ames, IA (United States)

    1999-02-12

    Accurate ionization energies (IE`s) for molecular species are used for prediction of chemical reactivity and are of fundamental importance to chemists. The IE of a gaseous molecule can be determined routinely in a photoionization or a photoelectron experiment. IE determinations made in conventional photoionization and photoelectron studies have uncertainties in the range of 3--100 meV (25--250 cm-1). In the past decade, the most exciting development in the field of photoionization and photoelectron spectroscopy has been the availability of high resolution, tunable ultraviolet (UV) and vacuum ultraviolet (VUV) laser sources. The laser pulsed field ionization photoelectron (PFI-PE) scheme is currently the state-of-the-art photoelectron spectroscopic technique and is capable of providing photoelectron energy resolution close to the optical resolution. The author has focused attention on the photoionization processes of some sulfur-containing species. The studies of the photoionization and photodissociation on sulfur-containing compounds [such as CS2, CH3SH, CH3SSCH3, CH3CH2SCH2CH3, HSCH2CH2SH and C4H4S (thiophene) and sulfur-containing radicals, such as HS, CS, CH3S, CH3CH2S and CH3SS], have been the major subjects in the group because sulfur is an important species contributing to air pollution in the atmosphere. The modeling of the combustion and oxidation of sulfur compounds represents important steps for the control of both the production and the elimination of sulfur-containing pollutants. Chapter 1 is a general introduction of the thesis. Chapters 2 and 6 contain five papers published in, or accepted for publication in, academic periodicals. In Chapter 7, the progress of the construction in the laboratory of a new vacuum ultraviolet laser system equipped with a reflectron mass

  11. Microencapsulation of single-cell protein from various microalgae species

    Directory of Open Access Journals (Sweden)

    Purnama Sukardi

    2015-10-01

    Full Text Available ABSTRACT The objective of the research was to evaluate nutritional values of microencapsulated diet made from single cell protein of microalgae. Complete randomized design was applied using three different types of microalgae for inclusion trials i.e. (A Nannochloropsis sp., (B Chlorella sp., and (C Spirulina sp. with five replications respectively. Microencapsulated diet was produced by a modification method based on thermal cross-linking with stable temperature. Phytoplankton was cultured in sea water for which fertilized by a modification of Walne and Guillard fertilizer. The results showed that the highest value of nutrition content was Spirulina sp. and the average composition of protein, crude lipid, carbohydrate, ash, nitrogen free extract, and water content was 34.80%, 0.30%, 18.53%, 20.09%, 26.29%, and 13.32%, respectively. Organoleptically, microcapsule showed that the color of capsule was dark green and smell fresh phytoplankton. Keywords: microcapsule, single-cell protein, thermal cross-linking, microalgae, phytoplankton  ABSTRAK Tujuan penelitian adalah mengevaluasi kandungan nutrisi pakan mikrokapsul protein sel tunggal (single cell protein yang berasal dari berbagai jenis mikroalga (fitoplankton. Rancangan percobaan yang digunakan adalah rancangan acak lengkap, dengan perlakuan inklusi mikrokapsul dari jenis fitoplankton (A Nannochloropsis sp., (B Chlorella sp., dan (C Spirulina sp., masing-masing diulang lima kali. Pembuatan mikrokapsul dilakukan dengan menggunakan modifikasi metode dasar thermal cross-linking, serta menerapkan teknik pengeringan suhu konstan. Proses pembuatan mikrokapsul protein diawali dengan kultur fitoplankton jenis Nannochloropsis sp., Chlorella sp., dan Spirulina sp. Kultur dilakukan di dalam laboratorium menggunakan media air laut dan modifikasi pupuk Walne dan Guillard. Hasil penelitian menunjukkan bahwa kandungan nutrisi tertinggi terdapat pada jenis mikrokapsul protein sel tunggal yang berasal dari

  12. Molecular Techniques for the Detection and Differentiation of Host and Parasitoid Species and the Implications for Fruit Fly Management.

    Science.gov (United States)

    Jenkins, Cheryl; Chapman, Toni A; Micallef, Jessica L; Reynolds, Olivia L

    2012-08-14

    Parasitoid detection and identification is a necessary step in the development and implementation of fruit fly biological control strategies employing parasitoid augmentive release. In recent years, DNA-based methods have been used to identify natural enemies of pest species where morphological differentiation is problematic. Molecular techniques also offer a considerable advantage over traditional morphological methods of fruit fly and parasitoid discrimination as well as within-host parasitoid identification, which currently relies on dissection of immature parasitoids from the host, or lengthy and labour-intensive rearing methods. Here we review recent research focusing on the use of molecular strategies for fruit fly and parasitoid detection and differentiation and discuss the implications of these studies on fruit fly management.

  13. A retrospective analysis of pollen host plant use by stable and declining bumble bee species

    NARCIS (Netherlands)

    Kleijn, D.; Raemakers, I.P.

    2008-01-01

    Understanding population declines has been the objective of a wide range of ecological studies. When species have become rare such studies are complicated because particular behavior or life history traits may be the cause but also the result of the decline of a species. We approached this problem

  14. Tripartite species interaction: eukaryotic hosts suffer more from phage susceptible than from phage resistant bacteria.

    Science.gov (United States)

    Wendling, Carolin C; Piecyk, Agnes; Refardt, Dominik; Chibani, Cynthia; Hertel, Robert; Liesegang, Heiko; Bunk, Boyke; Overmann, Jörg; Roth, Olivia

    2017-04-11

    Evolutionary shifts in bacterial virulence are often associated with a third biological player, for instance temperate phages, that can act as hyperparasites. By integrating as prophages into the bacterial genome they can contribute accessory genes, which can enhance the fitness of their prokaryotic carrier (lysogenic conversion). Hyperparasitic influence in tripartite biotic interactions has so far been largely neglected in empirical host-parasite studies due to their inherent complexity. Here we experimentally address whether bacterial resistance to phages and bacterial harm to eukaryotic hosts is linked using a natural tri-partite system with bacteria of the genus Vibrio, temperate vibriophages and the pipefish Syngnathus typhle. We induced prophages from all bacterial isolates and constructed a three-fold replicated, fully reciprocal 75 × 75 phage-bacteria infection matrix. According to their resistance to phages, bacteria could be grouped into three distinct categories: highly susceptible (HS-bacteria), intermediate susceptible (IS-bacteria), and resistant (R-bacteria). We experimentally challenged pipefish with three selected bacterial isolates from each of the three categories and determined the amount of viable Vibrio counts from infected pipefish and the expression of pipefish immune genes. While the amount of viable Vibrio counts did not differ between bacterial groups, we observed a significant difference in relative gene expression between pipefish infected with phage susceptible and phage resistant bacteria. These findings suggest that bacteria with a phage-susceptible phenotype are more harmful against a eukaryotic host, and support the importance of hyperparasitism and the need for an integrative view across more than two levels when studying host-parasite evolution.

  15. Possible Influence of MLP Regulators in Foliage of Host Species on Invasion of Phyllophagous Insects

    Directory of Open Access Journals (Sweden)

    Vasiliy I. Ponomarev

    2010-01-01

    Full Text Available On the northern border of the Gypsy moth area (Lymantria dispar L., 1758, caterpillars are reorient to exogenous regulators of membrane lipid peroxidation in connection with repeated cold periods during feeding. In case of an introduction of host plants with high contents of exogenous regulators of MLP (e.g. Fe2+ in foliage in these areas that may affect diapause duration, the boundaries of spreading and intensity of outbreaks may change.

  16. The Glycoproteins of All Filovirus Species Use the Same Host Factors for Entry into Bat and Human Cells but Entry Efficiency Is Species Dependent.

    Directory of Open Access Journals (Sweden)

    Markus Hoffmann

    Full Text Available Ebola and marburgviruses, members of the family Filoviridae, can cause severe hemorrhagic fever in humans. The ongoing Ebola virus (EBOV disease epidemic in Western Africa claimed more than 11,300 lives and was associated with secondary cases outside Africa, demonstrating that filoviruses pose a global health threat. Bats constitute an important natural reservoir of filoviruses, including viruses of the recently identified Cuevavirus genus within the Filoviridae family. However, the interactions of filoviruses with bat cells are incompletely understood. Here, we investigated whether filoviruses employ different strategies to enter human and bat cells. For this, we examined host cell entry driven by glycoproteins (GP from all filovirus species into cell lines of human and fruit bat origin. We show that all GPs were able to mediate entry into human and most fruit bat cell lines with roughly comparable efficiency. In contrast, the efficiency of entry into the cell line EidNi/41 derived from a straw-colored fruit bat varied markedly between the GPs of different filovirus species. Furthermore, inhibition studies demonstrated that filoviruses employ the same host cell factors for entry into human, non-human primate and fruit bat cell lines, including cysteine proteases, two pore channels and NPC1 (Niemann-Pick C1 molecule. Finally, processing of GP by furin and the presence of the mucin-like domain in GP were dispensable for entry into both human and bat cell lines. Collectively, these results show that filoviruses rely on the same host cell factors for entry into human and fruit bat cells, although the efficiency of the usage of these factors might differ between filovirus species.

  17. Host specificity and genealogy of the louse Polyplax serrata on field mice, Apodemus species: a case of parasite duplication or colonisation?

    Science.gov (United States)

    Stefka, Jan; Hypsa, Václav

    2008-05-01

    The genealogy, population structure and population dynamics of the sucking louse Polyplax serrata were analysed across four host species of the genus Apodemus. An analysis of 126 sequences of cytochrome c oxidase subunit I using phylogenetic approaches and haplotype networking revealed a clear structure of European samples, forming three distinct and genetically distant clades with different host specificities. Although a clear connection was detected between the host and parasite genealogies/phylogenies, a uniform pattern of co-speciation was not found. For example, a dramatic shift in the degree of host specificity was demonstrated for two related louse lineages living in sympatry and sharing one of their host species. While one of the louse lineages frequently parasitised two different host taxa (Apodemus sylvaticus and Apodemus flavicollis), the other louse lineage was strictly specific to A. flavicollis. The estimate of divergence time between the two louse lineages indicates that they may have arisen due to parasite duplication on A. flavicollis.

  18. Relationship between temperature optima and secreted protease activities of three Pythium species and pathogenicity toward plant and animal hosts.

    Science.gov (United States)

    Davis, Diana J; Lanter, Kelli; Makselan, Stephanie; Bonati, Christopher; Asbrock, Paige; Ravishankar, J P; Money, Nicholas P

    2006-01-01

    The in vitro physiological characteristics of three species of Pythium (oomycetes) that utilize different food sources were compared with their ecological activities: P. insidiosum is a pathogen of mammals (including humans), P. graminicola infects the roots of graminaceous hosts, and P. grandisporangium is an enigmatic water mold isolated from mangrove leaves and marine algae. P. insidiosum and P. graminicola showed peak growth rates at 37 degrees C before complete inhibition of growth at 40 degrees C; P. grandisporangium grew fastest at 22 degrees C. Differences between the invasive pressures exerted by the hyphae of these microorganisms were not considered significant in relation to the substrates colonized by these water molds. All three species showed substantial secreted protease activity, producing three or more serine proteases with weights ranging from 24-38 kDa. Fastest growth rates were supported when collagen was supplied as the sole carbon source, and none of the species were able to grow on purified plant cell wall polysaccharides. The growth and nutritional characteristics of P. graminicola and P. grandisporangium bear little obvious relationship to the ecological niches that they inhabit. This highlights the caution necessary in extrapolating from laboratory analyses to the natural environment, and points to the potential importance of ecological opportunity in determining the host range and food source of certain microorganisms.

  19. Oral vaccination of wildlife against rabies: Differences among host species in vaccine uptake efficiency.

    Science.gov (United States)

    Vos, Ad; Freuling, Conrad M; Hundt, Boris; Kaiser, Christiane; Nemitz, Sabine; Neubert, Andreas; Nolden, Tobias; Teifke, Jens P; Te Kamp, Verena; Ulrich, Reiner; Finke, Stefan; Müller, Thomas

    2017-07-13

    Oral vaccination using attenuated and recombinant rabies vaccines has been proven a powerful tool to combat rabies in wildlife. However, clear differences have been observed in vaccine titers needed to induce a protective immune response against rabies after oral vaccination in different reservoir species. The mechanisms contributing to the observed resistance against oral rabies vaccination in some species are not completely understood. Hence, the immunogenicity of the vaccine virus strain, SPBN GASGAS, was investigated in a species considered to be susceptible to oral rabies vaccination (red fox) and a species refractory to this route of administration (striped skunk). Additionally, the dissemination of the vaccine virus in the oral cavity was analyzed for these two species. It was shown that the palatine tonsils play a critical role in vaccine virus uptake. Main differences could be observed in palatine tonsil infection between both species, revealing a locally restricted dissemination of infected cells in foxes. The absence of virus infected cells in palatine tonsils of skunks suggests a less efficient uptake of or infection by vaccine virus which may lead to a reduced response to oral vaccination. Understanding the mechanisms of oral resistance to rabies virus vaccine absorption and primary replication may lead to the development of novel strategies to enhance vaccine efficacy in problematic species like the striped skunk. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Reconstructing geographical movements and host species transitions of foot-and-mouth disease virus serotype SAT 2.

    Science.gov (United States)

    Hall, Matthew D; Knowles, Nick J; Wadsworth, Jemma; Rambaut, Andrew; Woolhouse, Mark E J

    2013-10-22

    Of the three foot-and-mouth-disease virus SAT serotypes mainly confined to sub-Saharan Africa, SAT 2 is the strain most often recorded in domestic animals and has caused outbreaks in North Africa and the Middle East six times in the last 25 years, with three apparently separate events occurring in 2012. This study updates the picture of SAT 2 phylogenetics by using all available sequences for the VP1 section of the genome available at the time of writing and uses phylogeographic methods to trace the origin of all outbreaks occurring north of the Sahara since 1990 and identify patterns of spread among countries of endemicity. Transitions between different host species are also enumerated. Outbreaks in North Africa appear to have origins in countries immediately south of the Sahara, whereas those in the Middle East are more often from East Africa. The results of the analysis of spread within sub-Saharan Africa are consistent with it being driven by relatively short-distance movements of animals across national borders, and the analysis of host species transitions supports the role of the African buffalo (Syncerus caffer) as an important natural reservoir. Foot-and-mouth disease virus is a livestock pathogen of major economic importance, with seven distinct serotypes occurring globally. The SAT 2 serotype, endemic in sub-Saharan Africa, has caused a number of outbreaks in North Africa and the Middle East during the last decades, including three separate incidents in 2012. A comprehensive analysis of all available RNA sequences for SAT 2 has not been published for some years. In this work, we performed this analysis using all previously published sequences and 49 newly determined examples. We also used phylogenetic methods to infer the source country for all outbreaks occurring outside sub-Saharan Africa since 1990 and to reconstruct the spread of viral lineages between countries where it is endemic and movements between different host species.

  1. Host heterogeneity influences the impact of a non-native disease invasion on populations of a foundation tree species

    Science.gov (United States)

    Jules, Erik S.; Carroll, Allyson L.; Garcia, Andrea M.; Steenbock, Christopher M.; Kauffman, Matthew J.

    2014-01-01

    Invasive pathogens are becoming increasingly important in forested ecosystems, yet they are often difficult to study because of their rapid transmission. The rate and extent of pathogen spread are thought to be partially controlled by variation in host characteristics, such as when host size and location influence susceptibility. Few host-pathogen systems, however, have been used to test this prediction. We used Port Orford cedar (Chamaecyparis lawsoniana), a foundation tree species in riparian areas of California and Oregon (USA), and the invasive oomycete Phytophthora lateralis to assess pathogen impacts and the role of host characteristics on invasion. Across three streams that had been infected for 13–18 years by P. lateralis, we mapped 2241 trees and determined whether they had been infected using dendrochronology. The infection probability of trees was governed by host size (diameter at breast height [DBH]) and geomorphic position (e.g., active channel, stream bank, floodplain, etc.) similarly across streams. For instance, only 23% of trees trees ≥20 cm DBH were infected. Presumably, because spores of P. lateralis are transported downstream in water, they are more likely to encounter well-developed root systems of larger trees. Also because of this water-transport of spores, differences in infection probability were found across the geomorphic positions: 59% of cedar in the active channel and the stream bank (combined) were infected, while 23% of trees found on higher geomorphic types were infected. Overall, 32% of cedar had been infected across the three streams. However, 63% of the total cedar basal area had been killed, because the greatest number of trees, and the largest trees, were found in the most susceptible positions. In the active channel and stream bank, 91% of the basal area was infected, while 46% was infected across higher geomorphic positions. The invasion of Port Orford cedar populations by P. lateralis causes profound impacts to

  2. Leluthia astigma (Ashmead) (Hymenoptera: Braconidae: Doryctinae) as a parasitoid of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae: Agrilinae), with an assessment of host associations for nearctic species of Leluthia Cameron.

    Science.gov (United States)

    Robert R. Kula; Kathleen S. Knight; Joanne Rebbeck; Leah S. Bauer; David L. Cappaert; Kamal J.K. Gandhi

    2010-01-01

    Published host associations are assessed for Leluthia astigma (Ashmead), Leluthia floridensis Marsh, and Leluthia mexicana Cameron, the three known species of Leluthia Cameron in the Nearctic Region. Leluthia astigma is reported as a parasitoid of Agrilus planipennis...

  3. Tree phyllosphere bacterial communities: exploring the magnitude of intra- and inter-individual variation among host species

    Directory of Open Access Journals (Sweden)

    Isabelle Laforest-Lapointe

    2016-08-01

    Full Text Available Background The diversity and composition of the microbial community of tree leaves (the phyllosphere varies among trees and host species and along spatial, temporal, and environmental gradients. Phyllosphere community variation within the canopy of an individual tree exists but the importance of this variation relative to among-tree and among-species variation is poorly understood. Sampling techniques employed for phyllosphere studies include picking leaves from one canopy location to mixing randomly selected leaves from throughout the canopy. In this context, our goal was to characterize the relative importance of intra-individual variation in phyllosphere communities across multiple species, and compare this variation to inter-individual and interspecific variation of phyllosphere epiphytic bacterial communities in a natural temperate forest in Quebec, Canada. Methods We targeted five dominant temperate forest tree species including angiosperms and gymnosperms: Acer saccharum, Acer rubrum, Betula papyrifera, Abies balsamea and Picea glauca. For one randomly selected tree of each species, we sampled microbial communities at six distinct canopy locations: bottom-canopy (1–2 m height, the four cardinal points of mid-canopy (2–4 m height, and the top-canopy (4–6 m height. We also collected bottom-canopy leaves from five additional trees from each species. Results Based on an analysis of bacterial community structure measured via Illumina sequencing of the bacterial 16S gene, we demonstrate that 65% of the intra-individual variation in leaf bacterial community structure could be attributed to the effect of inter-individual and inter-specific differences while the effect of canopy location was not significant. In comparison, host species identity explains 47% of inter-individual and inter-specific variation in leaf bacterial community structure followed by individual identity (32% and canopy location (6%. Discussion Our results suggest that

  4. Molecular species identification, host preference and detection of myxoma virus in the Anopheles maculipennis complex (Diptera: Culicidae) in southern England, UK.

    Science.gov (United States)

    Brugman, Victor A; Hernández-Triana, Luis M; Prosser, Sean W J; Weland, Chris; Westcott, David G; Fooks, Anthony R; Johnson, Nicholas

    2015-08-15

    Determining the host feeding patterns of mosquitoes by identifying the origin of their blood-meals is an important part of understanding the role of vector species in current and future disease transmission cycles. Collecting large numbers of blood-fed mosquitoes from the field is difficult, therefore it is important to maximise the information obtained from each specimen. This study aimed to use mosquito genome sequence to identify the species within Anopheles maculipennis sensu lato (An. maculipennis s.l.), identify the vertebrate hosts of field-caught blood-fed An. maculipennis s.l. , and to test for the presence of myxoma virus (Poxviridae, genus Leporipoxvirus) in specimens found to have fed on the European rabbit (Oryctolagus cuniculus). Blood-fed An. maculipennis s.l. were collected from resting sites at Elmley Nature Reserve, Kent, between June and September 2013. Hosts that An. maculipennis s.l. had fed on were determined by a PCR-sequencing approach based on the partial amplification of the mitochondrial cytochrome C oxidase subunit I gene. Mosquitoes were then identified to species by sequencing a region of the internal transcribed spacer-2. DNA extracts from all mosquitoes identified as having fed on rabbits were subsequently screened using PCR for the presence of myxoma virus. A total of 94 blood-fed Anopheles maculipennis s.l. were collected, of which 43 (46%) provided positive blood-meal identification results. Thirty-six of these specimens were identified as Anopheles atroparvus, which had fed on rabbit (n = 33, 92%) and cattle (n = 3, 8%). Seven mosquitoes were identified as Anopheles messeae, which had fed on cattle (n = 6, 86%) and dog (n = 1, 14%). Of the 33 An. atroparvus that contained rabbit blood, nine (27%) were positive for myxoma virus. Results demonstrate that a single DNA extract from a blood-fed mosquito can be successfully used for molecular identification of members of the An. maculipennis complex, blood

  5. Type VI secretion system contributes to Enterohemorrhagic Escherichia coli virulence by secreting catalase against host reactive oxygen species (ROS).

    Science.gov (United States)

    Wan, Baoshan; Zhang, Qiufen; Ni, Jinjing; Li, Shuxian; Wen, Donghua; Li, Jun; Xiao, Haihan; He, Ping; Ou, Hong-Yu; Tao, Jing; Teng, Qihui; Lu, Jie; Wu, Wenjuan; Yao, Yu-Feng

    2017-03-01

    Enterohemorrhagic Escherichia coli (EHEC) is one major type of contagious and foodborne pathogens. The type VI secretion system (T6SS) has been shown to be involved in the bacterial pathogenicity and bacteria-bacteria competition. Here, we show that EHEC could secrete a novel effector KatN, a Mn-containing catalase, in a T6SS-dependent manner. Expression of katN is promoted by RpoS and OxyR and repressed by H-NS, and katN contributes to bacterial growth under oxidative stress in vitro. KatN could be secreted into host cell cytosol after EHEC is phagocytized by macrophage, which leads to decreased level of intracellular reactive oxygen species (ROS) and facilitates the intramacrophage survival of EHEC. Finally, animal model results show that the deletion mutant of T6SS was attenuated in virulence compared with the wild type strain, while the deletion mutant of katN had comparable virulence to the wild type strain. Taken together, our findings suggest that EHEC could sense oxidative stress in phagosome and decrease the host cell ROS by secreting catalase KatN to facilitate its survival in the host cells.

  6. Patterns of bacteria-host associations suggest different ecological strategies between two reef building cold-water coral species

    Science.gov (United States)

    Meistertzheim, Anne.-Leila; Lartaud, Franck; Arnaud-Haond, Sophie; Kalenitchenko, Dimitri; Bessalam, Manon; Le Bris, Nadine; Galand, Pierre E.

    2016-08-01

    Cold-water corals (CWC) are main ecosystem engineers of the deep sea, and their reefs constitute hot-spots of biodiversity. However, their ecology remains poorly understood, particularly, the nature of the holobiont formed by corals with their associated bacterial communities. Here, we analyzed Madrepora oculata and Lophelia pertusa samples, collected from one location in a Mediterranean canyon in two different seasons (autumn and spring), in order to test for species specificity and temporal stability of the host-bacteria associations. The 16S rRNA sequencing revealed host-specific patterns of bacterial communities associated with L. pertusa and M. oculata, both in terms of community composition and diversity. All analyzed M. oculata polyps exhibited temporally and spatially similar bacterial communities dominated by haplotypes homologous to the known cnidarians-associated genus Endozoicomonas. In contrast, the bacterial communities associated with L. pertusa varied among polyps from the same colony, as well as among distinct colonies and between seasons. While the resilient consortium formed by M. oculata and its bacterial community fit the definition of holobiont, the versatility of the L. pertusa microbiome suggests that this association is more influenced by the environmental conditions or nutritional status. Our results thus highlight distinct host/microbes association strategies for these two closely related Scleractinians sharing the same habitat, suggesting distinct sensitivity to environmental change.

  7. Type VI secretion system contributes to Enterohemorrhagic Escherichia coli virulence by secreting catalase against host reactive oxygen species (ROS.

    Directory of Open Access Journals (Sweden)

    Baoshan Wan

    2017-03-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC is one major type of contagious and foodborne pathogens. The type VI secretion system (T6SS has been shown to be involved in the bacterial pathogenicity and bacteria-bacteria competition. Here, we show that EHEC could secrete a novel effector KatN, a Mn-containing catalase, in a T6SS-dependent manner. Expression of katN is promoted by RpoS and OxyR and repressed by H-NS, and katN contributes to bacterial growth under oxidative stress in vitro. KatN could be secreted into host cell cytosol after EHEC is phagocytized by macrophage, which leads to decreased level of intracellular reactive oxygen species (ROS and facilitates the intramacrophage survival of EHEC. Finally, animal model results show that the deletion mutant of T6SS was attenuated in virulence compared with the wild type strain, while the deletion mutant of katN had comparable virulence to the wild type strain. Taken together, our findings suggest that EHEC could sense oxidative stress in phagosome and decrease the host cell ROS by secreting catalase KatN to facilitate its survival in the host cells.

  8. Redescription of Aposycorax chilensis (Tonnoir) (Diptera, Psychodidae, Sycoracinae) with the first identification of a blood meal host for the species.

    Science.gov (United States)

    Curler, Gregory R; Moulton, John K; Madriz, R Isai

    2015-11-24

    Adults of Aposycorax chilensis were collected from several sites during fieldwork in Chilean Patagonia, December 2013. Specimens were swept or aspirated from roadside seeps and found in greatest numbers during the morning hours. DNA was extracted from a recently blood-fed female and was subjected to the polymerase chain reaction using vertebrate-specific 16S primers. An amplicon was obtained and the resulting sequence was found to have over 99% identity with two frogs in the genus Batrachyla, thus establishing this species' preference for amphibian hosts. The diagnosis and description of adult A. chilensis are revised, including the first description of the complete male genital tract. Habitat characteristics for this species and rotation of the male genitalia are discussed.

  9. Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines

    Directory of Open Access Journals (Sweden)

    Joanne G. Bartlett

    2014-01-01

    Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.

  10. Three-way interactions between Fusarium species, their plant hosts and biocontrol organisms

    DEFF Research Database (Denmark)

    Kosawang, Chatchai

    of the mycoparasitic fungus Clonostachys rosea IK726, which is effective in controlling mycotoxin-producing Fusarium species. This thesis reports on aspects regarding (I) detoxification of ZEA in connection to biocontrol activities of the IK726, (II) mechanisms conferring resistance to DON and ZEA and (III) evolution...... in metabolic processes, e.g., Cytochome P450 55A3, Cytochrome C oxidase and ATP synthase. This provided evidence that metabolic adjustment is a major component contributing to tolerance to DON in C. rosea. On the other hand, substantial upregulation of transcripts encoding ABC transporter species was observed...... are responsible for xenobiotic transport in many organisms, suggesting that the expansion of ABC transporters might be reflected in resistance to broad xenobiotics in C. rosea, while the contraction of subfamily C in T. reesei and T. atroviridae may be reflected in distinct lifestyles in these latter species....

  11. Discrete host-parasitoid models with Allee effects and age structure in the host.

    Science.gov (United States)

    Jang, Sophia R-J

    2010-01-01

    We study a stage-structured single species population model with Allee effects. The asymptotic dynamics of the model depend on the maximal growth rate of the population as well as on its initial population size. We also investigate two models of host-parasitoid interaction with stage-structure and Allee effects in the host. The parasitoid population may drive the host population to extinction in both models even if the initial host population is beyond the Allee threshold.

  12. [Two new species of freshwater crabs (Decapoda: Potamidae) serving as intermediate hosts of Paragonimus in Fujian, China].

    Science.gov (United States)

    Cheng, You-zhu; Lin, Guo-hua; Li, You-song

    2010-08-01

    To investigate the natural resources of the freshwater crab which can serve as the intermediate hosts of Paragonimus in Pinghe and Youxi of Fujian Province. Freshwater crabs were collected. The morphological characteristics of the crabs and the habitats were observed. The crabs were dissected and examined for the presence of Paragonimus metacercariae. Two new species of crabs were described, named as Sinopotamon zhangzhouense sp. nov. and Bottapotamon youxiense sp. nov.. S. zhangzhouense sp. nov., holotype: male, carapace length 35.9 mm, breadth 42.8 mm, thickness 18.6 mm, collected from Pinghe County in southwest of Fujian. (24 degrees 14.206' N, 117 degrees 12.594' E). Distal segment of the first pleopod of male tended flattish, and showed palm nest-shaped concave, which divided into two point leafs, and longitudinal crack clearly identified in back. The end half of distal segment reversed to ventral outwardly. This species usually lived in the sluggish stream. The infection rate of Paragonimus westermani and P. cenocopiosus in S. zhangzhouense sp. nov. was 44.9% (35/78). B. youxiense sp. nov., holotype: male, carapace length 13.35 mm, breadth 16.63 mm, thickness 7.20 mm, collected from Youxi County in central Fujian (26 degrees 10.558' N, 118 degrees 22.012' E). The first pleopod of male was in slightly flat shape, ample and developed, as bow-like uplift. This species usually lived in the relatively flat terrain of stream. The infection rate of P. skrjabini metacercariae in B. youxiense sp. nov. was 92.1% (58/63). Two new species of freshwater crabs (S. zhangzhouense sp nov. and Ryouxiense sp. nov.) serving as the intermediate hosts of Paragonimus have been described.

  13. A new black Aspergillus species, A. vadensis, is a promising host for homologous and heterologous protein production

    DEFF Research Database (Denmark)

    de Vries, R.P.; Burgers, K.; van de Vondervoort, P.J.I

    2004-01-01

    A new species of the group of black aspergilli, Aspergillus vadensis, was analyzed for its potential as a host for homologous and heterologous protein production. Unlike the other black aspergilli, this strain does not acidify the culture medium when nitrate is the nitrogen source and only produc....... vadensis were much higher than those of A. niger. These characteristics make A. vadensis a very promising candidate for homologous, and possibly heterologous, protein production.......A new species of the group of black aspergilli, Aspergillus vadensis, was analyzed for its potential as a host for homologous and heterologous protein production. Unlike the other black aspergilli, this strain does not acidify the culture medium when nitrate is the nitrogen source and only produces....... The production of FaeA in A. vadensis resulted in larger amounts of intact protein than production in A. tubingensis and was similar to production in an A. niger protease disruptant, confirming in vivo the low proteolytic activity of A. vadensis. The protoplast formation and transformation efficiencies of A...

  14. Temporal changes of symbiont density and host fitness after rifampicin treatment in a whitefly of the Bemisia tabaci species complex.

    Science.gov (United States)

    Shan, Hong-Wei; Zhang, Chang-Rong; Yan, Ting-Ting; Tang, Hai-Qin; Wang, Xiao-Wei; Liu, Shu-Sheng; Liu, Yin-Quan

    2016-04-01

    Microbial symbionts are essential or important partners to phloem-feeding insects. Antibiotics have been used to selectively eliminate symbionts from their host insects and establish host lines with or without certain symbionts for investigating functions of the symbionts. In this study, using the antibiotic rifampicin we attempted to selectively eliminate certain symbionts from a population of the Middle East-Asia Minor 1 whitefly of the Bemisia tabaci species complex, which harbors the primary symbiont "Candidatus Portiera aleyrodidarum" and two secondary symbionts "Candidatus Hamiltonella defensa" and Rickettsia. Neither the primary nor the secondary symbionts were completely depleted in the adults (F0) that fed for 48 h on a diet treated with rifampicin at concentrations of 1-100 μg/mL. However, both the primary and secondary symbionts were nearly completely depleted in the offspring (F1) of the rifampicin-treated adults. Although the F1 adults produced some eggs (F2), most of the eggs failed to hatch and none of them reached the second instar, and consequently the rifampicin-treated whitefly colony vanished at the F2 generation. Interestingly, quantitative polymerase chain reaction assays showed that in the rifampicin-treated whiteflies, the density of the primary symbiont was reduced at an obviously slower pace than the secondary symbionts. Mating experiments between rifampicin-treated and untreated adults demonstrated that the negative effects of rifampicin on host fitness were expressed when the females were treated by the antibiotic, and whether males were treated or not by the antibiotic had little contribution to the negative effects. These observations indicate that with this whitefly population it is not feasible to selectively eliminate the secondary symbionts using rifampicin without affecting the primary symbiont and establish host lines for experimental studies. However, the extinction of the whitefly colony at the second generation after

  15. Impact of curly top host plants on accumulation, competitiveness, and durability of curtovirus species.

    Science.gov (United States)

    Curly top disease, caused by viruses in the genus, Curtovirus, has affected sugarbeet production throughout much of the West for over a century; however, over that period the viruses responsible for causing the disease have changed. The two curly top virus species currently affecting production, Bee...

  16. Temporal effects on host-parasite associations in four naturalized goby species living in sympatry

    Czech Academy of Sciences Publication Activity Database

    Ondračková, Markéta; Valová, Zdenka; Hudcová, Iveta; Michálková, Veronika; Šimková, A.; Borcherding, J.; Jurajda, Pavel

    2015-01-01

    Roč. 746, č. 1 (2015), s. 233-243 ISSN 0018-8158 R&D Projects: GA ČR(CZ) GAP505/12/2569 Institutional support: RVO:68081766 Keywords : Fish * Gobiidae * Non-native species * Parasite * Rhine Subject RIV: EG - Zoology Impact factor: 2.051, year: 2015

  17. Foot and mouth disease virus in different host species; the effect of vaccination on transmission

    NARCIS (Netherlands)

    Orsel, K.

    2007-01-01

    Foot and mouth disease (FMD) is a contagious disease, affecting important livestock species like cattle, sheep and pigs. Therefore, FMD is listed as a notifiable disease to the Office International des Epizooties. The outbreaks of FMD in Europe in 2001 triggered the discussion about the use of

  18. Pacific oysters and parasites: Species invasions and their impact on parasite-host interactions

    NARCIS (Netherlands)

    Goedknegt, M.A.

    2017-01-01

    Human-aided introductions of species affect natural communities and ecosystems worldwide. These biological invasions can be considered to be ‘experiments in nature’ to study general ecological and evolutionary processes at large spatial and temporal scales.Studies on biological

  19. The role of host and microbial factors in the pathogenesis of pneumococcal bacteraemia arising from a single bacterial cell bottleneck.

    Science.gov (United States)

    Gerlini, Alice; Colomba, Leonarda; Furi, Leonardo; Braccini, Tiziana; Manso, Ana Sousa; Pammolli, Andrea; Wang, Bo; Vivi, Antonio; Tassini, Maria; van Rooijen, Nico; Pozzi, Gianni; Ricci, Susanna; Andrew, Peter W; Koedel, Uwe; Moxon, E Richard; Oggioni, Marco R

    2014-03-01

    The pathogenesis of bacteraemia after challenge with one million pneumococci of three isogenic variants was investigated. Sequential analyses of blood samples indicated that most episodes of bacteraemia were monoclonal events providing compelling evidence for a single bacterial cell bottleneck at the origin of invasive disease. With respect to host determinants, results identified novel properties of splenic macrophages and a role for neutrophils in early clearance of pneumococci. Concerning microbial factors, whole genome sequencing provided genetic evidence for the clonal origin of the bacteraemia and identified SNPs in distinct sub-units of F0/F1 ATPase in the majority of the ex vivo isolates. When compared to parental organisms of the inoculum, ex-vivo pneumococci with mutant alleles of the F0/F1 ATPase had acquired the capacity to grow at low pH at the cost of the capacity to grow at high pH. Although founded by a single cell, the genotypes of pneumococci in septicaemic mice indicate strong selective pressure for fitness, emphasising the within-host complexity of the pathogenesis of invasive disease.

  20. The role of host and microbial factors in the pathogenesis of pneumococcal bacteraemia arising from a single bacterial cell bottleneck.

    Directory of Open Access Journals (Sweden)

    Alice Gerlini

    2014-03-01

    Full Text Available The pathogenesis of bacteraemia after challenge with one million pneumococci of three isogenic variants was investigated. Sequential analyses of blood samples indicated that most episodes of bacteraemia were monoclonal events providing compelling evidence for a single bacterial cell bottleneck at the origin of invasive disease. With respect to host determinants, results identified novel properties of splenic macrophages and a role for neutrophils in early clearance of pneumococci. Concerning microbial factors, whole genome sequencing provided genetic evidence for the clonal origin of the bacteraemia and identified SNPs in distinct sub-units of F0/F1 ATPase in the majority of the ex vivo isolates. When compared to parental organisms of the inoculum, ex-vivo pneumococci with mutant alleles of the F0/F1 ATPase had acquired the capacity to grow at low pH at the cost of the capacity to grow at high pH. Although founded by a single cell, the genotypes of pneumococci in septicaemic mice indicate strong selective pressure for fitness, emphasising the within-host complexity of the pathogenesis of invasive disease.

  1. A Single Residue in Ebola Virus Receptor NPC1 Influences Cellular Host Range in Reptiles

    Science.gov (United States)

    2016-09-07

    and murine mammary tumor virus (13-18), respectively). Jae and co-workers 76   demonstrated that chicken cells are resistant to infection by an...Rockx B, Donaldson E, Corti D, Baric R. 2008. Pathways of cross-species 435   transmission of synthetically reconstructed zoonotic severe acute...447   16. Wang E, Albritton L, Ross SR. 2006. Identification of the segments of the mouse trans-448   ferrin receptor 1 required for mouse mammary

  2. The life cycle of Prosorhynchoides carvajali (Trematoda: Bucephalidae) involving species of bivalve and fish hosts in the intertidal zone of central Chile.

    Science.gov (United States)

    Muñoz, G; Valdivia, I; López, Z

    2015-09-01

    We describe the life cycle of the bucephalid Prosorhynchoides carvajali from the intertidal rocky zone of central Chile. To elucidate the life cycle of this digenean, two mytilid bivalves, Semimytilus algosus and Perumytilus purpuratus, and ten intertidal fish species belonging to the families Blenniidae, Tripterygiidae, Labrisomidae, Kyphosidae and Gobiesocidae were analysed for natural infections. In addition, experimental infections of fish were undertaken and molecular analyses were performed of several developmental stages of the digeneans in various host species. Experimental infections of fish were made from infected mytilids to determine which fish species were suitable for the metacercarial stage of Prosorhynchoides. We also determined the abundance and prevalence of metacercariae in natural infections in fish and found that they were lower than in the experimental infections. A molecular analysis showed that sporocysts from S. algosus were identical to metacercariae from five fish species and P. carvajali adults. Sporocysts isolated from P. purpuratus were similar to metacercaria found in one fish species only (G. laevifrons) but were different from P. carvajali, with 1.9-2.0% genetic divergence. Therefore, the complete life cycle of P. carvajali consists of the mytilid species S. algosus as the first intermediate host, at least five intertidal fish species as second intermediate hosts (Scartichthys viridis, Auchenionchus microcirrhis, Hypsoblennius sordidus, Helcogrammoides chilensis and Gobiesox marmoratus), two carnivorous fish as definitive hosts (Auchenionchus microcirrhis and A. variolosus) and one occasional definitive host (Syciases sanguineus). This is the second description of a life cycle of a marine digenean from Chile.

  3. Selective logging in tropical forests decreases the robustness of liana-tree interaction networks to the loss of host tree species.

    Science.gov (United States)

    Magrach, Ainhoa; Senior, Rebecca A; Rogers, Andrew; Nurdin, Deddy; Benedick, Suzan; Laurance, William F; Santamaria, Luis; Edwards, David P

    2016-03-16

    Selective logging is one of the major drivers of tropical forest degradation, causing important shifts in species composition. Whether such changes modify interactions between species and the networks in which they are embedded remain fundamental questions to assess the 'health' and ecosystem functionality of logged forests. We focus on interactions between lianas and their tree hosts within primary and selectively logged forests in the biodiversity hotspot of Malaysian Borneo. We found that lianas were more abundant, had higher species richness, and different species compositions in logged than in primary forests. Logged forests showed heavier liana loads disparately affecting slow-growing tree species, which could exacerbate the loss of timber value and carbon storage already associated with logging. Moreover, simulation scenarios of host tree local species loss indicated that logging might decrease the robustness of liana-tree interaction networks if heavily infested trees (i.e. the most connected ones) were more likely to disappear. This effect is partially mitigated in the short term by the colonization of host trees by a greater diversity of liana species within logged forests, yet this might not compensate for the loss of preferred tree hosts in the long term. As a consequence, species interaction networks may show a lagged response to disturbance, which may trigger sudden collapses in species richness and ecosystem function in response to additional disturbances, representing a new type of 'extinction debt'. © 2016 The Author(s).

  4. Arbuscular mycorrhizal fungi spore propagation using single spore as starter inoculum and a plant host.

    Science.gov (United States)

    Gopal, Selvakumar; Shagol, Charlotte C; Kang, Yeongyeong; Chung, Bong Nam; Han, Seung Gab; Tong-Min, Sa

    2018-02-02

    The propagation of pure cultures of AMF is an essential requirement for their large scale agricultural application and commercialization as biofertilizers. The present study aimed to propagate AMF using the single spore inoculation technique and compare their propagation ability with the known reference spores. Arbuscular mycorrhizal fungal spores were collected from the salt-affected Saemangeum reclaimed soil in South Korea. The technique involved inoculation of Sorghum-Sudan grass (Sorghum bicolor L.) seedlings with single, healthy spores on filter paper followed by the transfer of successfully colonized seedlings to 1 kg capacity pots containing sterilized soil. After the first plant cycle, the contents were transferred to 2.5 kg capacity pots containing sterilized soil. Among the 150 inoculants, only 27 seedlings were colonized by AMF spores. After 240 days, five inoculants among the 27 seedlings resulted in the production of over 500 spores. The 18S rDNA sequencing of spores revealed that the spores produced through single spore inoculation method belonged to Gigaspora margarita, Claroideoglomus lamellosum, and Funneliformis mosseae. Furthermore, indigenous spore Funneliformis mosseae M-1 reported a higher spore count than the reference spores. The AMF spores produced using single spore inoculation technique may serve as potential bio-inoculants with an advantage of being more readily adopted by farmers due to the lack of requirement of a skilled technique in spore propagation. The results of the current study describes the feasible and cost effective method to mass produce AMF spores for large scale application. The AMF spores obtained from this method can effectively colonize plant roots and may be easily introduced to the new environment. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. Geographic distribution and host plants of Raoiella indica and associated mite species in northern Venezuela.

    Science.gov (United States)

    Vásquez, Carlos; de Moraes, Gilberto J

    2013-05-01

    The red palm mite (RPM), Raoiella indica Hirst (Acari: Tenuipalpidae), is an invasive pest in the New World, where it is currently considered a serious threat to coconut and banana crops. It was first reported from northern Venezuela in 2007. To determine its current distribution in this country, surveys were carried out from October 2008 to April 2010 on coconut (Cocos nucifera L.), banana (Musa spp.), ornamental plants and weeds in northern Venezuela. Higher population levels of RPM were registered on commercial coconut farms in Falcón and Sucre states but also on other plant species naturally growing along the coastal line in Anzoategui, Aragua, Carabobo, Monagas and Nueva Esparta states. Out of 34 botanical species evaluated, all RPM stages were observed only on eight arecaceous, one musaceous and one streliziaceous species, indicating that the pest developed and reproduced only on these plants. Mite specimens found on weeds were considered spurious events, as immature stages of the pest were never found on these. Amblyseius largoensis (Muma) (Acari: Phytoseiidae) was the most frequent predatory mite associated with RPM in all sampling sites. The results indicate that RPM has spread to extensive areas of northern Venezuela since its initial detection in Güiria, Sucre state. Considering the report of this pest mite in northern Brazil in the late 2009, additional samplings in southern Venezuela should be carried out, to evaluate the possible presence of RPM also in that region.

  6. Interaction of bovine peripheral blood polymorphonuclear cells and Leptospira species; innate responses in the natural bovine reservoir host.

    Directory of Open Access Journals (Sweden)

    Jennifer H Wilson-Welder

    2016-07-01

    Full Text Available Cattle are the reservoir hosts of Leptospira borgpetersenii serovar Hardjo, and can also be reservoir hosts of other Leptospira species such as L. kirschneri, and L. interrogans. As a reservoir host, cattle shed Leptospira, infecting other animals, including humans. Previous studies with human and murine neutrophils have shown activation of neutrophil extracellular trap or NET formation, and upregulation of inflammatory mediators by neutrophils in the presence of Leptospira. Humans, companion animals and most widely studied models of Leptospirosis are of acute infection, hallmarked by systemic inflammatory response, neutrophilia and septicemia. In contrast, cattle exhibit chronic infection with few outward clinical signs aside from reproductive failure. Taking into consideration that there is host species variation in innate immunity, especially in pathogen recognition and response, the interaction of bovine peripheral blood polymorphonuclear cells (PMNs and several Leptospira strains was evaluated. Studies including bovine-adapted strains, human pathogen strains, a saprophyte and inactivated organisms. Incubation of PMNs with Leptospira did induce slight activation of neutrophil NETs, greater than unstimulated cells but less than the quantity from E. coli P4 stimulated PMNs. Very low but significant from non-stimulated, levels of reactive oxygen peroxides were produced in the presence of all Leptospira strains and E. coli P4. Similarly, significant levels of reactive nitrogen intermediaries (NO2 was produced from PMNs when incubated with the Leptospira strains and greater quantities in the presence of E. coli P4. PMNs incubated with Leptospira induced RNA transcripts of IL-1β, MIP-1α, and TNF-α, with greater amounts induced by live organisms when compared to heat-inactivated leptospires. Transcript for inflammatory cytokine IL-8 was also induced, at similar levels regardless of Leptospira strain or viability. However, incubation of

  7. Potential DNA barcodes for Melilotus species based on five single loci and their combinations.

    Directory of Open Access Journals (Sweden)

    Fan Wu

    Full Text Available Melilotus, an annual or biennial herb, belongs to the tribe Trifolieae (Leguminosae and consists of 19 species. As an important green manure crop, diverse Melilotus species have different values as feed and medicine. To identify different Melilotus species, we examined the efficiency of five candidate regions as barcodes, including the internal transcribed spacer (ITS and two chloroplast loci, rbcL and matK, and two non-coding loci, trnH-psbA and trnL-F. In total, 198 individuals from 98 accessions representing 18 Melilotus species were sequenced for these five potential barcodes. Based on inter-specific divergence, we analysed sequences and confirmed that each candidate barcode was able to identify some of the 18 species. The resolution of a single barcode and its combinations ranged from 33.33% to 88.89%. Analysis of pairwise distances showed that matK+rbcL+trnL-F+trnH-psbA+ITS (MRTPI had the greatest value and rbcL the least. Barcode gap values and similarity value analyses confirmed these trends. The results indicated that an ITS region, successfully identifying 13 of 18 species, was the most appropriate single barcode and that the combination of all five potential barcodes identified 16 of the 18 species. We conclude that MRTPI is the most effective tool for Melilotus species identification. Taking full advantage of the barcode system, a clear taxonomic relationship can be applied to identify Melilotus species and enhance their practical production.

  8. The Bifurcation and Control of a Single-Species Fish Population Logistic Model with the Invasion of Alien Species

    Directory of Open Access Journals (Sweden)

    Yi Zhang

    2014-01-01

    Full Text Available The objective of this paper is to study systematically the bifurcation and control of a single-species fish population logistic model with the invasion of alien species based on the theory of singular system and bifurcation. It regards Spartina anglica as an invasive species, which invades the fisheries and aquaculture. Firstly, the stabilities of equilibria in this model are discussed. Moreover, the sufficient conditions for existence of the trans-critical bifurcation and the singularity induced bifurcation are obtained. Secondly, the state feedback controller is designed to eliminate the unexpected singularity induced bifurcation by combining harvested effort with the purification capacity. It obviously inhibits the switch of population and makes the system stable. Finally, the numerical simulation is proposed to show the practical significance of the bifurcation and control from the biological point of view.

  9. Etanercept for steroid-refractory acute graft-versus-host disease: A single center experience.

    Directory of Open Access Journals (Sweden)

    Cornelis N De Jong

    Full Text Available Acute graft-versus-host disease (aGVHD is an important complication of allogeneic stem cell transplantation (alloSCT. High dose glucocorticosteroids, are currently recommended as first-line treatment for grade II-IV aGVHD resulting in overall complete responses (CR in 40%-50% of patients. No standard second-line regimen has been established. Different options have been reported, including anti-TNFα antibodies.We retrospectively reviewed the outcome of 15 patients with steroid-refractory (SR aGVHD treated with etanercept at our institution. Patients were transplanted for a hematological malignancy and received either a myeloablative or a non-myeloablative conditioning regimen. Prophylaxis of GVHD consisted of cyclosporin A and mycophenolic acid.Acute GVHD was diagnosed at a median of 61 days post-transplantation. All patients had grade III aGVHD of the gut. Second-line treatment with etanercept was started at a median of 13 days after initiation of first-line therapy. Overall response rate was 53%, with CR in 3 patients and PR in 5 patients. Median overall survival after initiation of treatment with etanercept was 66 days (range 5-267 for the entire group. Median overall survival was 99 days (range 47-267 days for responders and 17 days (range 5-66 days for non-responders (p<0.01. Nevertheless, all patients died. Causes of death were progressive GVHD in 7 patients (47%, infection in 6 patients (40%, cardiac death in 1 patient (6.7% and relapse in 1 patient (6,7%.Second-line treatment with etanercept does induce responses in SR-aGVHD of the gut but appears to be associated with poor long-term survival even in responding patients.

  10. A camelid single-domain antibody neutralizes botulinum neurotoxin A by blocking host receptor binding

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Guorui; Lam, Kwok-ho; Weisemann, Jasmin; Peng, Lisheng; Krez, Nadja; Perry, Kay; Shoemaker, Charles B.; Dong, Min; Rummel, Andreas; Jin, Rongsheng (BCH); (Cornell); (Tufts CTSI); (UCI); (MHH)

    2017-08-07

    Antibody treatment is currently the only available countermeasure for botulism, a fatal illness caused by flaccid paralysis of muscles due to botulinum neurotoxin (BoNT) intoxication. Among the seven major serotypes of BoNT/A-G, BoNT/A poses the most serious threat to humans because of its high potency and long duration of action. Prior to entering neurons and blocking neurotransmitter release, BoNT/A recognizes motoneurons via a dual-receptor binding process in which it engages both the neuron surface polysialoganglioside (PSG) and synaptic vesicle glycoprotein 2 (SV2). Previously, we identified a potent neutralizing antitoxin against BoNT/A1 termed ciA-C2, derived from a camelid heavy-chain-only antibody (VHH). In this study, we demonstrate that ciA-C2 prevents BoNT/A1 intoxication by inhibiting its binding to neuronal receptor SV2. Furthermore, we determined the crystal structure of ciA-C2 in complex with the receptor-binding domain of BoNT/A1 (HCA1) at 1.68 Å resolution. The structure revealed that ciA-C2 partially occupies the SV2-binding site on HCA1, causing direct interference of HCA1 interaction with both the N-glycan and peptide-moiety of SV2. Interestingly, this neutralization mechanism is similar to that of a monoclonal antibody in clinical trials, despite that ciA-C2 is more than 10-times smaller. Taken together, these results enlighten our understanding of BoNT/A1 interactions with its neuronal receptor, and further demonstrate that inhibiting toxin binding to the host receptor is an efficient countermeasure strategy.

  11. New species of the family Triozidae (Homoptera: Psylloidea) from China, and the first record of Psylloidea as host of Braconidae (Hymenoptera)

    NARCIS (Netherlands)

    Li, F.; Achterberg, van C.; He, J.

    2000-01-01

    Two new species of Triozidae (Psylloidea) from China producing sphere-shaped leaf galls on Ficus hainanensis Merr. & Shun., are illustrated and described. For the first time Psylloidea are reported as host of a species of Braconidae. The parasitoid belonging to the genus Bracon Fabricius, 1804, is

  12. Chrysomelids American diabroticines Hosts and natural enemies. Biology-feasibility for control of pest species (Crisomelidos Diabroticinos americanos Hospederos y enemigos naturales Biologia y factibili manejo especies plagas

    Science.gov (United States)

    The chrysomelids in the Diabroticites include some of the most important pest species of the American continent. The chemical and management techniques used to date to control them are: crop rotation to prevent re-infection of host crops, especially in the species that display an egg diapause; insec...

  13. Geography and host species shape the evolutionary dynamics of U genogroup infectious hematopoietic necrosis virus

    Science.gov (United States)

    Black, Allison; Breyta, Rachel; Bedford, Trevor; Kurath, Gael

    2016-01-01

    Infectious hematopoietic necrosis virus (IHNV) is a negative-sense RNA virus that infects wild and cultured salmonids throughout the Pacific Coastal United States and Canada, from California to Alaska. Although infection of adult fish is usually asymptomatic, juvenile infections can result in high mortality events that impact salmon hatchery programs and commercial aquaculture. We used epidemiological case data and genetic sequence data from a 303 nt portion of the viral glycoprotein gene to study the evolutionary dynamics of U genogroup IHNV in the Pacific Northwestern United States from 1971 to 2013. We identified 114 unique genotypes among 1,219 U genogroup IHNV isolates representing 619 virus detection events. We found evidence for two previously unidentified, broad subgroups within the U genogroup, which we designated ‘UC’ and ‘UP’. Epidemiologic records indicated that UP viruses were detected more frequently in sockeye salmon (Oncorhynchus nerka) and in coastal waters of Washington and Oregon, whereas UC viruses were detected primarily in Chinook salmon (Oncorhynchus tshawytscha) and steelhead trout (Oncorhynchus mykiss) in the Columbia River Basin, which is a large, complex watershed extending throughout much of interior Washington, Oregon, and Idaho. These findings were supported by phylogenetic analysis and by FST. Ancestral state reconstruction indicated that early UC viruses in the Columbia River Basin initially infected sockeye salmon but then emerged via host shifts into Chinook salmon and steelhead trout sometime during the 1980s. We postulate that the development of these subgroups within U genogroup was driven by selection pressure for viral adaptation to Chinook salmon and steelhead trout within the Columbia River Basin.

  14. Species of Lepidoptera defoliators of Eucalyptus as new host for the parasitoid Palmistichus elaeisis (Hymenoptera: Eulophidae

    Directory of Open Access Journals (Sweden)

    Fabricio Fagundes Pereira

    2008-04-01

    Full Text Available Pupae of Thyrinteina arnobia (Stoll and Thyrinteina leucoceraea Rindge (Lepidoptera: Geometridae were obtained from Eucalyptus cloeziana F. Muell and Eucalyptus urophylla S.T. Blake plants, respectively. Specimens of a parasitoid emerged from T. arnobia pupae and also found parasitising T. leucoceraea pupae in the field were identified as Palmistichus elaeisis Delvare and LaSalle (Hymenoptera: Eulophidae. This is the first report on P. elaeisis parasitizing T. arnobia and T. leucoceraea pupae in natural conditions in Brazil. P. elaeisis also parasitized these hosts and Bombyx mori Linnaeus (Lepidoptera: Bombycidae, Anticarsia gemmatalis Hubner, Pseudaletia sequax Franclemont, Alabama argillacea Huebner (Lepidoptera: Noctuidae, Dirphia moderata Bouvier (Lepidoptera: Saturniidae and Halysidota pearsoni Watson (Lepidoptera: Arctiidae in the laboratory. The production and release of P. elaeisis could be an efficient alternative for controlling Lepidoptera defoliators in eucalyptus plantations.Pupas de Thyrinteina arnobia (Stoll e Thyrinteina leucoceraea Rindge (Lepidoptera: Geometridae foram coletadas em Eucalyptus cloeziana F. Muell e Eucalyptus urophylla S.T. Blake, respectivamente. Espécimes de Palmistichus elaeisis Delvare and LaSalle (Hymenoptera: Eulophidae emergiram de T. arnobia e foram encontrados sobre pupas de T. leucoceraea em plantas de eucalipto no campo. Esse é o primeiro relato de P. elaeisis parasitando pupas de T. arnobia e T. leucoceraea em condições naturais no Brasil. Além desses hospedeiros, P. elaeisis parasitou em laboratório Bombyx mori Linnaeus (Lepidoptera: Bombycidae, Anticarsia gemmatalis Hubner, Pseudaletia sequax Franclemont, Alabama argillacea Huebner (Lepidoptera: Noctuidae, Dirphia moderata Bouvier (Lepidoptera: Saturniidae e Halysidota pearsoni Watson (Lepidoptera: Arctiidae. A produção de P. elaeisis e sua liberação em eucaliptais podem representar uma alternativa eficiente de controle de lagartas

  15. [A new species of the genus Nanhaipotamon (Decapoda:Potamidae) serving as intermediate host of Paragonimus skrjabini].

    Science.gov (United States)

    Lin, Guo-Hua; Cheng, You-Zhu; Chen, Shao-Hong

    2013-02-01

    To describe a new species of the genus Nanhaipotamon. Freshwater crabs were collected in the counties of Yongtai, Minqing, Youxi, Songxi, Zhenghe and Shouning, Fujian Province. The morphological characteristics of the crabs were described. The habitats were observed and crabs examined for the presence of Paragonimus metacerariae. A new species of freshwater crabs named as Nanhaipotamon fujianense sp. nov. was described: holotype (FJ6132-1): male, carapace length 18.44 mm, breadth 23.64 mm, thickness 12.61 mm; allotype (FJ6132-2): female, length 18.76 mm, breadth 25.25 mm, thicknes 14.31 mm, collected from Yongtai County in the middle of Fujian (N 25 degrees 44,778'; E118 degrees 32,278', and 232 m above sea lever). Distal segment of the first male pleopod with triangle convex inner-distal angle, and the axe-like expanded out-distal angle. The out-lateral border slightly sloped downwards. The segment length is 2.1 times as long as the subdistal segment. The crabs usually lived in the crevice of small stream. Paragonimus metacerariae were found in the crabs collected from Yongtai, Minqing, Youxi, Songxi and Zhenghe Counties. A new species of freshwater crab (Nanhaipotamon fujianense sp. nov.) has been recorded which serves as the intermediate hosts of Paragonimus skrjabini.

  16. Cyclical changes in seroprevalence of leptospirosis in California sea lions: endemic and epidemic disease in one host species?

    Directory of Open Access Journals (Sweden)

    St Leger Judy

    2007-11-01

    Full Text Available Abstract Background Leptospirosis is a zoonotic disease infecting a broad range of mammalian hosts, and is re-emerging globally. California sea lions (Zalophus californianus have experienced recurrent outbreaks of leptospirosis since 1970, but it is unknown whether the pathogen persists in the sea lion population or is introduced repeatedly from external reservoirs. Methods We analyzed serum samples collected over an 11-year period from 1344 California sea lions that stranded alive on the California coast, using the microscopic agglutination test (MAT for antibodies to Leptospira interrogans serovar Pomona. We evaluated seroprevalence among yearlings as a measure of incidence in the population, and characterized antibody persistence times based on temporal changes in the distribution of titer scores. We conducted multinomial logistic regression to determine individual risk factors for seropositivity with high and low titers. Results The serosurvey revealed cyclical patterns in seroprevalence to L. interrogans serovar Pomona, with 4–5 year periodicity and peak seroprevalence above 50%. Seroprevalence in yearling sea lions was an accurate index of exposure among all age classses, and indicated on-going exposure to leptospires in non-outbreak years. Analysis of titer decay rates showed that some individuals probably maintain high titers for more than a year following exposure. Conclusion This study presents results of an unprecedented long-term serosurveillance program in marine mammals. Our results suggest that leptospirosis is endemic in California sea lions, but also causes periodic epidemics of acute disease. The findings call into question the classical dichotomy between maintenance hosts of leptospirosis, which experience chronic but largely asymptomatic infections, and accidental hosts, which suffer acute illness or death as a result of disease spillover from reservoir species.

  17. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual

  18. The path to host extinction can lead to loss of generalist parasites.

    Science.gov (United States)

    Farrell, Maxwell J; Stephens, Patrick R; Berrang-Ford, Lea; Gittleman, John L; Davies, T Jonathan

    2015-07-01

    Host extinction can alter disease transmission dynamics, influence parasite extinction and ultimately change the nature of host-parasite systems. While theory predicts that single-host parasites are among the parasite species most susceptible to extinction following declines in their hosts, documented parasite extinctions are rare. Using a comparative approach, we investigate how the richness of single-host and multi-host parasites is influenced by extinction risk among ungulate and carnivore hosts. Host-parasite associations for free-living carnivores (order Carnivora) and terrestrial ungulates (orders Perissodactyla + Cetartiodactyla minus cetaceans) were merged with host trait data and IUCN Red List status to explore the distribution of single-host and multi-host parasites among threatened and non-threatened hosts. We find that threatened ungulates harbour a higher proportion of single-host parasites compared to non-threatened ungulates, which is explained by decreases in the richness of multi-host parasites. However, among carnivores threat status is not a significant predictor of the proportion of single-host parasites, or the richness of single-host or multi-host parasites. The loss of multi-host parasites from threatened ungulates may be explained by decreased cross-species contact as hosts decline and habitats become fragmented. Among carnivores, threat status may not be important in predicting patterns of parasite specificity because host decline results in equal losses of both single-host parasites and multi-host parasites through reduction in average population density and frequency of cross-species contact. Our results contrast with current models of parasite coextinction and highlight the need for updated theories that are applicable across host groups and account for both inter- and intraspecific contact. © 2015 The Authors. Journal of Animal Ecology © 2015 British Ecological Society.

  19. Three-way interactions between Fusarium species, their plant hosts and biocontrol organisms

    DEFF Research Database (Denmark)

    Kosawang, Chatchai

    Deoxynivalenol (DON) and Zearalenone (ZEA) are among the most predominant mycotoxins produced by Fusarium head blight pathogens. DON is a potent protein inhibitor while ZEA is a potent estrogenic metabolite. The toxins are known to inhibit growth and development of fungi with the exception...... of the mycoparasitic fungus Clonostachys rosea IK726, which is effective in controlling mycotoxin-producing Fusarium species. This thesis reports on aspects regarding (I) detoxification of ZEA in connection to biocontrol activities of the IK726, (II) mechanisms conferring resistance to DON and ZEA and (III) evolution...... of ABC transporters in mycoparasitic fungi focused on C. rosea and Trichoderma spp. We showed that expression of zhd101 depended on concentrations of ZEA and that the gene was not induced by other agents, suggesting specificity of the enzyme towards ZEA and its derivates. To investigate effects of ZEA...

  20. The New World Gibbobruchus Pic (Coleoptera, Chrysomelidae, Bruchinae): description of a new species and phylogenetic insights into the evolution of host associations and biogeography.

    Science.gov (United States)

    Manfio, Daiara; Jorge, Isaac R; Morse, Geoffrey E; Ribeiro-Costa, Cibele S

    2016-04-18

    The seed beetle Gibbobruchus tridentatus Manfio, Jorge & Ribeiro-Costa sp. nov. is described from the Amazon basin in Brazil (Acre) and Ecuador (Napo), and is included in an updated key to the species of Gibbobruchus Pic. This new species and the recently described G. bergamini Manfio & Ribeiro-Costa are incorporated into a phylogenetic reanalysis of the genus and into a comparative analysis of host plant use and biogeography. Species groups previously proposed were supported and the evolutionary history in host plant-use shows Gibbobruchus conserved at tribe level, Cercideae (Caesalpinioideae), with coordination between biogeographic expansion and host genus shifts. Both species, Gibbobruchus tridentatus Manfio, Jorge & Ribeiro-Costa sp. nov. and G. bergamini, were placed within the group scurra (G. tridentatus (G. scurra (G. cavillator+G. bolivianus+G. bergamini))) and supported by one synapomorphy. Additionally, we update geographic distributions and host plant records. Two hosts, Bauhinia argentinensis Burkart and B. tarapotensis Benth. are recorded for the first time as hosts for the genus and for the subfamily.

  1. Radiation of the red algal parasite Congracilaria babae onto a secondary host species, Hydropuntia sp. (Gracilariaceae, Rhodophyta).

    Science.gov (United States)

    Ng, Poh-Kheng; Lim, Phaik-Eem; Phang, Siew-Moi

    2014-01-01

    Congracilaria babae was first reported as a red alga parasitic on the thallus of Gracilaria salicornia based on Japanese materials. It was circumscribed to have deep spermatangial cavities, coloration similar to its host and the absence of rhizoids. We observed a parasitic red alga with morphological and anatomical features suggestive of C. babae on a Hydropuntia species collected from Sabah, East Malaysia. We addressed the taxonomic affinities of the parasite growing on Hydropuntia sp. based on the DNA sequence of molecular markers from the nuclear, mitochondrial and plastid genomes (nuclear ITS region, mitochondrial cox1 gene and plastid rbcL gene). Phylogenetic analyses based on all genetic markers also implied the monophyly of the parasite from Hydropuntia sp. and C. babae, suggesting their conspecificity. The parasite from Hydropuntia sp. has a DNA signature characteristic to C. babae in having plastid rbcL gene sequence identical to G. salicornia. C. babae is likely to have evolved directly from G. salicornia and subsequently radiated onto a secondary host Hydropuntia sp. We also recommend the transfer of C. babae to the genus Gracilaria and propose a new combination, G. babae, based on the anatomical observations and molecular data.

  2. Radiation of the red algal parasite Congracilaria babae onto a secondary host species, Hydropuntia sp. (Gracilariaceae, Rhodophyta.

    Directory of Open Access Journals (Sweden)

    Poh-Kheng Ng

    Full Text Available Congracilaria babae was first reported as a red alga parasitic on the thallus of Gracilaria salicornia based on Japanese materials. It was circumscribed to have deep spermatangial cavities, coloration similar to its host and the absence of rhizoids. We observed a parasitic red alga with morphological and anatomical features suggestive of C. babae on a Hydropuntia species collected from Sabah, East Malaysia. We addressed the taxonomic affinities of the parasite growing on Hydropuntia sp. based on the DNA sequence of molecular markers from the nuclear, mitochondrial and plastid genomes (nuclear ITS region, mitochondrial cox1 gene and plastid rbcL gene. Phylogenetic analyses based on all genetic markers also implied the monophyly of the parasite from Hydropuntia sp. and C. babae, suggesting their conspecificity. The parasite from Hydropuntia sp. has a DNA signature characteristic to C. babae in having plastid rbcL gene sequence identical to G. salicornia. C. babae is likely to have evolved directly from G. salicornia and subsequently radiated onto a secondary host Hydropuntia sp. We also recommend the transfer of C. babae to the genus Gracilaria and propose a new combination, G. babae, based on the anatomical observations and molecular data.

  3. When history repeats itself: exploring the genetic architecture of host-plant adaptation in two closely related lepidopteran species.

    Science.gov (United States)

    Alexandre, Hermine; Ponsard, Sergine; Bourguet, Denis; Vitalis, Renaud; Audiot, Philippe; Cros-Arteil, Sandrine; Streiff, Réjane

    2013-01-01

    The genus Ostrinia includes two allopatric maize pests across Eurasia, namely the European corn borer (ECB, O. nubilalis) and the Asian corn borer (ACB, O. furnacalis). A third species, the Adzuki bean borer (ABB, O. scapulalis), occurs in sympatry with both the ECB and the ACB. The ABB mostly feeds on native dicots, which probably correspond to the ancestral host plant type for the genus Ostrinia. This situation offers the opportunity to characterize the two presumably independent adaptations or preadaptations to maize that occurred in the ECB and ACB. In the present study, we aimed at deciphering the genetic architecture of these two adaptations to maize, a monocot host plant recently introduced into Eurasia. To this end, we performed a genome scan analysis based on 684 AFLP markers in 12 populations of ECB, ACB and ABB. We detected 2 outlier AFLP loci when comparing French populations of the ECB and ABB, and 9 outliers when comparing Chinese populations of the ACB and ABB. These outliers were different in both countries, and we found no evidence of linkage disequilibrium between any two of them. These results suggest that adaptation or preadaptation to maize relies on a different genetic architecture in the ECB and ACB. However, this conclusion must be considered in light of the constraints inherent to genome scan approaches and of the intricate evolution of adaptation and reproductive isolation in the Ostrinia spp. complex.

  4. Peptide-Recombinant VP6 Protein Based Enzyme Immunoassay for the Detection of Group A Rotaviruses in Multiple Host Species.

    Directory of Open Access Journals (Sweden)

    Naveen Kumar

    Full Text Available We developed a novel enzyme immunoassay for the detection of group A rotavirus (RVA antigen in fecal samples of multiple host species. The assay is based on the detection of conserved VP6 protein using anti-recombinant VP6 antibodies as capture antibodies and anti-multiple antigenic peptide (identified and constructed from highly immunodominant epitopes within VP6 protein antibodies as detector antibodies. The clinical utility of the assay was evaluated using a panel of 914 diarrhoeic fecal samples from four different host species (bovine, porcine, poultry and human collected from diverse geographical locations in India. Using VP6- based reverse transcription-polymerase chain reaction (RT-PCR as the gold standard, we found that the diagnostic sensitivity (DSn and specificity (DSp of the new assay was high [bovine (DSn = 94.2% & DSp = 100%; porcine (DSn = 94.6% & DSp = 93.3%; poultry (DSn = 74.2% & DSp = 97.7% and human (DSn = 82.1% & DSp = 98.7%]. The concordance with RT-PCR was also high [weighted kappa (k = 0.831-0.956 at 95% CI = 0.711-1.0] as compared to RNA-polyacrylamide gel electrophoresis (RNA-PAGE. The performance characteristics of the new immunoassay were comparable to those of the two commercially available ELISA kits. Our results suggest that this peptide-recombinant protein based assay may serve as a preliminary assay for epidemiological surveillance of RVA antigen and for evaluation of vaccine effectiveness especially in low and middle income settings.

  5. Low Po2 conditions induce reactive oxygen species formation during contractions in single skeletal muscle fibers

    OpenAIRE

    Zuo, Li; Shiah, Amy; Roberts, William J.; Chien, Michael T.; Wagner, Peter D.; Hogan, Michael C.

    2013-01-01

    Contractions in whole skeletal muscle during hypoxia are known to generate reactive oxygen species (ROS); however, identification of real-time ROS formation within isolated single skeletal muscle fibers has been challenging. Consequently, there is no convincing evidence showing increased ROS production in intact contracting fibers under low Po2 conditions. Therefore, we hypothesized that intracellular ROS generation in single contracting skeletal myofibers increases during low Po2 compared wi...

  6. Laboratory Investigations of African Pouched Rats (Cricetomys gambianus as a Potential Reservoir Host Species for Monkeypox Virus.

    Directory of Open Access Journals (Sweden)

    Christina L Hutson

    Full Text Available Monkeypox is a zoonotic disease endemic to central and western Africa, where it is a major public health concern. Although Monkeypox virus (MPXV and monkeypox disease in humans have been well characterized, little is known about its natural history, or its maintenance in animal populations of sylvatic reservoir(s. In 2003, several species of rodents imported from Ghana were involved in a monkeypox outbreak in the United States with individuals of three African rodent genera (Cricetomys, Graphiurus, Funisciurus shown to be infected with MPXV. Here, we examine the course of MPXV infection in Cricetomys gambianus (pouched Gambian rats and this rodent species' competence as a host for the virus. We obtained ten Gambian rats from an introduced colony in Grassy Key, Florida and infected eight of these via scarification with a challenge dose of 4X104 plaque forming units (pfu from either of the two primary clades of MPXV: Congo Basin (C-MPXV: n = 4 or West African (W-MPXV: n = 4; an additional 2 animals served as PBS controls. Viral shedding and the effect of infection on activity and physiological aspects of the animals were measured. MPXV challenged animals had significantly higher core body temperatures, reduced activity and increased weight loss than PBS controls. Viable virus was found in samples taken from animals in both experimental groups (C-MPXV and W-MPXV between 3 and 27 days post infection (p.i. (up to 1X108 pfu/ml, with viral DNA found until day 56 p.i. The results from this work show that Cricetomys gambianus (and by inference, probably the closely related species, Cricetomys emini can be infected with MPXV and shed viable virus particles; thus suggesting that these animals may be involved in the maintenance of MPXV in wildlife mammalian populations. More research is needed to elucidate the epidemiology of MPXV and the role of Gambian rats and other species.

  7. [Distribution diversity of integrins and calcium channels on major human and mouse host cells of Leptospira species].

    Science.gov (United States)

    Li, Cheng-xue; Zhao, Xin; Qian, Jing; Yan, Jie

    2012-07-01

    To determine the distribution of integrins and calcium channels on major human and mouse host cells of Leptospira species. The expression of β1, β2 and β3 integrins was detected with immunofluorescence assay on the surface of human monocyte line THP-1, mouse mononuclear-macrophage-like cell line J774A.1, human vascular endothelial cell line HUVEC, mouse vascular endothelial cell EOMA, human hepatocyte line L-02, mouse hepatocyte line Hepa1-6, human renal tubular epithelial cell line HEK-293, mouse glomerular membrane epithelial cell line SV40-MES13, mouse collagen blast line NIH/3T3, human and mouse platelets. The distribution of voltage gate control calcium channels Cav3.1, Cav3.2, Cav3.3 and Cav2.3, and receptor gate calcium channels P(2)X(1), P(2)2X(2), P(2)X(3), P(2)X(4), P(2)X(5), P(2)X(6) and P(2)X(7) were determined with Western blot assay. β1 integrin proteins were positively expressed on the membrane surface of J774A.1, THP-1, HUVEC, EOMA, L-02, Hepa1-6 and HEK-239 cells as well as human and mouse platelets. β2 integrin proteins were expressed on the membrane surface of J774A.1, THP-1, HUVEC, EOMA, and NIH/3T3 cells. β3 integrin proteins were expressed on the membrane surface of J774A.1, THP-1, HUVEC, EOMA, Hepa1-6, HEK-239 and NIH/3T3 cells as well as human and mouse platelets. P(2)X(1) receptor gate calcium channel was expressed on the membrane surface of human and mouse platelets, while P(2)X(5) receptor gate calcium channel was expressed on the membrane surface of J774A.1, THP-1, L-02, Hepa1-6, HEK-239 and HUVEC cells. However, the other calcium channels were not detected on the tested cell lines or platelets. There is a large distribution diversity of integrins and calcium channel proteins on the major human and mouse host cells of Leptospira species, which may be associated with the differences of leptospira-induced injury in different host cells.

  8. An updated concept and revised composition for Hamacreadium Linton, 1910 (Opecoelidae: Plagioporinae) clarifies a previously obscured pattern of host-specificity among species.

    Science.gov (United States)

    Martin, Storm B; Cutmore, Scott C; Ward, Selina; Cribb, Thomas H

    2017-04-12

    The present concept of the trematode genus Hamacreadium Linton, 1910 encompasses considerable morphological variability and includes species reported from a broad range of fishes. These include herbivores and planktivores, despite the life-cycle of the type-species, Hamacreadium mutabile Linton, 1910, being known to use fishes as intermediate hosts. Reports of H. mutabile are numerous, spanning the west Atlantic, east Pacific and Indo-west Pacific, whereas other nominal species are infrequently reported and several inadequately described. Following a comprehensive review, a strict revised morphological definition is proposed for the genus. Several nominal species are excluded, but, conversely, finer distinctions are recognised among the species concluded to genuinely belong in the genus. Justified records for species retained in the genus are overwhelmingly from fishes of the families Lutjanidae Gill (snappers) and Lethrinidae Bonaparte (emperors), revealing a previously concealed pattern of host-specificity. For H. mutabile, it is argued that only records from western Atlantic lutjanid fishes should be considered genuine; those from plausible Indo-Pacific fishes most likely represent different species. In addition to H. mutabile, eight species are recognised: Hamacreadium cribbi Bray & Justine, 2016, Hamacreadium hainanense Shen, 1990, Hamacreadium interruptum Nagaty, 1941, Hamacreadium lethrini Yamaguti, 1934, Hamacreadium longivesiculum (Yamaguti, 1952) n. comb., Hamacreadium lutiani (Shen, 1990) n. comb., Hamacreadium morgani Baz,1946 and Hamacreadium phyllorchis (Bilqees, 1976) Cribb, 2005. A key to species of Hamacreadium and comprehensive lists of all host-locality records are included.

  9. Native trees of the Northeast Argentine: natural hosts of the Cryptococcus neoformans-Cryptococcus gattii species complex.

    Science.gov (United States)

    Cattana, Maria Emilia; Sosa, María de Los Ángeles; Fernández, Mariana; Rojas, Florencia; Mangiaterra, Magdalena; Giusiano, Gustavo

    2014-01-01

    In Argentina, information about epidemiology and environmental distribution of Cryptococcus is scarce. The city of Resistencia borders with Brazil and Paraguay where this fungus is endemic. All these supported the need to investigate the ecology of the genus and the epidemiology of cryptococcosis in this area. The aim was to investigate the presence of species of Cryptococcus neoformans-Cryptococcus gattii complex and their genotypes in trees of the city of Resistencia. One hundred and five trees were sampled by swabbing technique. The isolates were identified using conventional and commercial methods and genotyped by PCR-RFLP (Restriction Fragment Length Polymorphism). Cryptococcus was found in 7 out of the total trees. 6 out of 7 Cryptococcus isolates were identified as C. neoformans and one as C. gattii. C. gattii was isolated from Grevillea robusta. C. neoformans strains were isolated from Tabebuia avellanedae and Peltophorum dubium. Genotyping showed that all C. neoformans belonged to the VNI type and C. gattii belonged to the VGI type. This represents the first study on the ecology of Cryptococcus spp. associated to trees from northeastern Argentina, and the first report describing Grevillea robusta as a host of members of this fungal genus. Another finding is the isolation of C. neoformans from Tabebuia avellanedae and Peltophorum dubium, both tree species native to northeastern Argentina. Copyright © 2012 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  10. Cryptic species and their utilization of indigenous and non-indigenous intermediate hosts in the acanthocephalan Polymorphus minutus sensu lato (Polymorphidae).

    Science.gov (United States)

    Zittel, Maike; Grabner, Daniel; Wlecklik, Andre; Sures, Bernd; Leese, Florian; Taraschewski, Horst; Weigand, Alexander Martin

    2018-02-19

    The bird-infecting acanthocephalan Polymorphus minutus has been suggested to comprise different lineages or even cryptic species using different intermediate hosts. To clarify this open question, we investigated Polymorphus cf. minutus cystacanths originating from amphipod intermediate hosts from 27 sites in Germany and France. Parasites and hosts were identified using integrated datasets (COI and/or morphology for hosts and COI + ITS1-5.8S-ITS2 for parasites). Mitochondrial and nuclear data (ITS1) strongly support the existence of three cryptic species in Polymorphus cf. minutus (type 1-3). These three types reveal a high degree of intermediate host specificity, with Polymorphus type 1 only encountered in Gammarus fossarum type B, Polymorphus type 2 in Echinogammarus sp. and Echinogammarus berilloni, and Polymorphus type 3 in Gammarus pulex and Gammarus roeselii. Our results point to a so far neglected cryptic diversity of the genus Polymorphus in Central Europe. Furthermore, Polymorphus type 2 is most likely a non-native parasite in Germany that co-invaded with E. berilloni from the Mediterranean area. Potentially, type 3 originates from South-East Europe and migrated to Germany by G. roeselii, where it might have captured G. pulex as an intermediate host. Therefore, our findings can be seen in the context of ecological globalization in terms of the anthropogenic displacement of intermediate hosts and its impact on the genetic divergence of the parasites.

  11. An Investigative Alternative to Single-Species Dissection in the Introductory Biology Laboratory

    Science.gov (United States)

    Carlin, Joel L.

    2010-01-01

    Dissections of single species (e.g., fetal pig) are a common student learning activity in introductory biology courses. Such dissections demonstrate location of anatomical parts and provide dissection practice but provide less opportunity for student critical thinking, numeracy and demonstration of the scientific method. A comparative anatomy lab…

  12. Cover crops in mixtures do not use water differently than single-species plantings

    Science.gov (United States)

    Some recent statements have been made about the benefits of growing cover crops in mixtures as compared with single-species plantings of cover crops. One of those stated benefits is greatly reduced water use by cover crops grown in mixtures. The objectives of this study were to characterize soil wat...

  13. Conservation of avian diversity in the Sierra Nevada: moving beyond a single-species management focus.

    Directory of Open Access Journals (Sweden)

    Angela M White

    greater benefit to ecosystem functioning then a single-species management focus.

  14. Conservation of avian diversity in the Sierra Nevada: moving beyond a single-species management focus.

    Science.gov (United States)

    White, Angela M; Zipkin, Elise F; Manley, Patricia N; Schlesinger, Matthew D

    2013-01-01

    ecosystem functioning then a single-species management focus.

  15. A review of Epipenaeon ingens Nobili, 1906 (Isopoda: Bopyridae) host species and documentation of a new host, Metapenaeopsis stridulans (Alcock, 1905) (Decapoda: Penaeidae)

    Science.gov (United States)

    Rajkumar, M.; Manokaran, S.; Sun, Jun; Trilles, J. P.

    2011-01-01

    We collected 3 596 Metapenaeopsis stridulans (Decapoda: Penaeidae) from the southeast coast of India between January and December 2007. Sixty three specimens (43 females and 18 males) were parasitized by the bopyrid isopod Epipenaeon ingens (Isopoda: Bopyridae). This is the first report of the occurrence of E. ingens in this host; therefore, it was considered as a new host record. The highest level of infestation (3.2%) occurred in October 2007, coincident with observations of gravid females (9). The total prevalence and presence of gravid females were 17.46% and 28%, respectively. Infestation caused a characteristic bulge of the branchial chamber, growth retardation, and degeneration of the sex organs, but had no effect on the host weight.

  16. Ralstonia syzygii, the Blood Disease Bacterium and some Asian R. solanacearum strains form a single genomic species despite divergent lifestyles.

    Science.gov (United States)

    Remenant, Benoît; de Cambiaire, Jean-Charles; Cellier, Gilles; Jacobs, Jonathan M; Mangenot, Sophie; Barbe, Valérie; Lajus, Aurélie; Vallenet, David; Medigue, Claudine; Fegan, Mark; Allen, Caitilyn; Prior, Philippe

    2011-01-01

    The Ralstonia solanacearum species complex includes R. solanacearum, R. syzygii, and the Blood Disease Bacterium (BDB). All colonize plant xylem vessels and cause wilt diseases, but with significant biological differences. R. solanacearum is a soilborne bacterium that infects the roots of a broad range of plants. R. syzygii causes Sumatra disease of clove trees and is actively transmitted by cercopoid insects. BDB is also pathogenic to a single host, banana, and is transmitted by pollinating insects. Sequencing and DNA-DNA hybridization studies indicated that despite their phenotypic differences, these three plant pathogens are actually very closely related, falling into the Phylotype IV subgroup of the R. solanacearum species complex. To better understand the relationships among these bacteria, we sequenced and annotated the genomes of R. syzygii strain R24 and BDB strain R229. These genomes were compared to strain PSI07, a closely related Phylotype IV tomato isolate of R. solanacearum, and to five additional R. solanacearum genomes. Whole-genome comparisons confirmed previous phylogenetic results: the three phylotype IV strains share more and larger syntenic regions with each other than with other R. solanacearum strains. Furthermore, the genetic distances between strains, assessed by an in-silico equivalent of DNA-DNA hybridization, unambiguously showed that phylotype IV strains of BDB, R. syzygii and R. solanacearum form one genomic species. Based on these comprehensive data we propose a revision of the taxonomy of the R. solanacearum species complex. The BDB and R. syzygii genomes encoded no obvious unique metabolic capacities and contained no evidence of horizontal gene transfer from bacteria occupying similar niches. Genes specific to R. syzygii and BDB were almost all of unknown function or extrachromosomal origin. Thus, the pathogenic life-styles of these organisms are more probably due to ecological adaptation and genomic convergence during vertical

  17. Ralstonia syzygii, the Blood Disease Bacterium and some Asian R. solanacearum strains form a single genomic species despite divergent lifestyles.

    Directory of Open Access Journals (Sweden)

    Benoît Remenant

    Full Text Available The Ralstonia solanacearum species complex includes R. solanacearum, R. syzygii, and the Blood Disease Bacterium (BDB. All colonize plant xylem vessels and cause wilt diseases, but with significant biological differences. R. solanacearum is a soilborne bacterium that infects the roots of a broad range of plants. R. syzygii causes Sumatra disease of clove trees and is actively transmitted by cercopoid insects. BDB is also pathogenic to a single host, banana, and is transmitted by pollinating insects. Sequencing and DNA-DNA hybridization studies indicated that despite their phenotypic differences, these three plant pathogens are actually very closely related, falling into the Phylotype IV subgroup of the R. solanacearum species complex. To better understand the relationships among these bacteria, we sequenced and annotated the genomes of R. syzygii strain R24 and BDB strain R229. These genomes were compared to strain PSI07, a closely related Phylotype IV tomato isolate of R. solanacearum, and to five additional R. solanacearum genomes. Whole-genome comparisons confirmed previous phylogenetic results: the three phylotype IV strains share more and larger syntenic regions with each other than with other R. solanacearum strains. Furthermore, the genetic distances between strains, assessed by an in-silico equivalent of DNA-DNA hybridization, unambiguously showed that phylotype IV strains of BDB, R. syzygii and R. solanacearum form one genomic species. Based on these comprehensive data we propose a revision of the taxonomy of the R. solanacearum species complex. The BDB and R. syzygii genomes encoded no obvious unique metabolic capacities and contained no evidence of horizontal gene transfer from bacteria occupying similar niches. Genes specific to R. syzygii and BDB were almost all of unknown function or extrachromosomal origin. Thus, the pathogenic life-styles of these organisms are more probably due to ecological adaptation and genomic convergence

  18. In-vitro activity of taurolidine on single species and a multispecies population associated with periodontitis.

    Science.gov (United States)

    Zollinger, Lilly; Schnyder, Simone; Nietzsche, Sandor; Sculean, Anton; Eick, Sigrun

    2015-04-01

    The antimicrobial activity of taurolidine was compared with minocycline against microbial species associated with periodontitis (four single strains and a 12-species mixture). Minimal inhibitory concentrations (MICs) and minimal bactericidal concentrations (MBCs), killing as well as activities on established and forming single-species biofilms and a 12-species biofilm were determined. The MICs of taurolidine against single species were always 0.31 mg/ml, the MBCs were 0.64 mg/ml. The used mixed microbiota was less sensitive to taurolidine, MIC and the MBC was 2.5 mg/ml. The strains and the mixture were completely killed by 2.5 mg/ml taurolidine, whereas 256 μg/ml minocycline reduced the bacterial counts of the mixture by 5 log10 colony forming units (cfu). Coating the surface with 10 mg/ml taurolidine or 256 μg/ml minocycline prevented completely biofilm formation of Porphyromonas gingivalis ATCC 33277 but not of Aggregatibacter actinomycetemcomitans Y4 and the mixture. On 4.5 d old biofilms, taurolidine acted concentration dependent with a reduction by 5 log10 cfu (P. gingivalis ATCC 33277) and 7 log10 cfu (A. actinomycetemcomitans Y4) when applying 10 mg/ml. Minocycline decreased the cfu counts by 1-2 log10 cfu independent of the used concentration. The reduction of the cfu counts in the 4.5 d old multi-species biofilms was about 3 log10 cfu after application of any minocycline concentration and after using 10 mg/ml taurolidine. Taurolidine is active against species associated with periodontitis, even within biofilms. Nevertheless a complete elimination of complex biofilms by taurolidine seems to be impossible and underlines the importance of a mechanical removal of biofilms prior to application of taurolidine. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Emendation of the family Chlamydiaceae: proposal of a single genus, Chlamydia, to include all currently recognized species.

    Science.gov (United States)

    Sachse, Konrad; Bavoil, Patrik M; Kaltenboeck, Bernhard; Stephens, Richard S; Kuo, Cho-Chou; Rosselló-Móra, Ramon; Horn, Matthias

    2015-03-01

    The family Chlamydiaceae (order Chlamydiales, phylum Chlamydiae) comprises important, obligate intracellular bacterial pathogens of humans and animals. Subdivision of the family into the two genera Chlamydia and Chlamydophila has been discussed controversially during the past decade. Here, we have revisited the current classification in the light of recent genomic data and in the context of the unique biological properties of these microorganisms. We conclude that neither generally used 16S rRNA sequence identity cut-off values nor parameters based on genomic similarity consistently separate the two genera. Notably, no easily recognizable phenotype such as host preference or tissue tropism is available that would support a subdivision. In addition, the genus Chlamydophila is currently not well accepted and not used by a majority of research groups in the field. Therefore, we propose the classification of all 11 currently recognized Chlamydiaceae species in a single genus, the genus Chlamydia. Finally, we provide emended descriptions of the family Chlamydiaceae, the genus Chlamydia, as well as the species Chlamydia abortus, Chlamydia caviae and Chlamydia felis. Copyright © 2015 Elsevier GmbH. All rights reserved.

  20. Impact of Anthropogenic Noise on Aquatic Animals: From Single Species to Community-Level Effects.

    Science.gov (United States)

    Sabet, Saeed Shafiei; Neo, Yik Yaw; Slabbekoorn, Hans

    2016-01-01

    Anthropogenic noise underwater is on the rise and may affect aquatic animals of marine and freshwater ecosystems. Many recent studies concern some sort of impact assessment of a single species. Few studies addressed the noise impact on species interactions underwater, whereas there are some studies that address community-level impact but only on land in air. Key processes such as predator-prey or competitor interactions may be affected by the masking of auditory cues, noise-related disturbance, or attentional interference. Noise-associated changes in these interactions can cause shifts in species abundance and modify communities, leading to fundamental ecosystem changes. To gain further insight into the mechanism and generality of earlier findings, we investigated the impact on both a predator and a prey species in captivity, zebrafish (Danio rerio) preying on waterfleas (Daphnia magna).

  1. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  2. Molecular identification of broomrape species from a single seed by High Resolution Melting analysis

    Directory of Open Access Journals (Sweden)

    Mathieu Rolland

    2016-12-01

    Full Text Available Broomrapes are holoparasitic plants spreading through seeds. Each plant produces hundreds of thousands of seeds which remain viable in the soils for decades. To limit their spread, drastic measures are being taken and the contamination of a commercial seed lot by a single broomrape seed can lead to its rejection. Considering that broomrapes species identification from a single seed is extremely difficult even for trained botanists and that among all the described species, only a few are really noxious for the crops, numerous seed lots are rejected because of the contamination by seeds of non-noxious broomrape species. The aim of this study was to develop and evaluate a High Resolution Melting assay identifying the eight most noxious and common broomrape species (P. aegyptiaca, O. cernua, O. crenata, O. cumana, O. foetida, O. hederae, O. minor, and P. ramosa from a single seed. Based on trnL and rbcL plastidial genes amplification, the designed assay successfully identifies O. cumana, O. cernua, O. crenata, O. minor, O. hederae, and O. foetida; P. ramosa and P. aegyptiaca can be differentiated from other species but not from each other. Tested on 50 seed lots, obtained results perfectly matched identifications performed by sequencing. Through the analysis of common seed lots by different analysts, the reproducibility of the assay was evaluated at 90 %. Despite an original sample preparation process it was not possible to extract enough DNA from some seeds (10% of the samples. The described assay fulfils its objectives and allows an accurate identification of the targeted broomrape species. It can be used to identify contaminants in commercial seed lots or for any other purpose. The assay might be extended to vegetative material.

  3. Molecular Identification of Broomrape Species from a Single Seed by High Resolution Melting Analysis.

    Science.gov (United States)

    Rolland, Mathieu; Dupuy, Aurélie; Pelleray, Aude; Delavault, Philippe

    2016-01-01

    Broomrapes are holoparasitic plants spreading through seeds. Each plant produces hundreds of thousands of seeds which remain viable in the soils for decades. To limit their spread, drastic measures are being taken and the contamination of a commercial seed lot by a single broomrape seed can lead to its rejection. Considering that broomrapes species identification from a single seed is extremely difficult even for trained botanists and that among all the described species, only a few are really noxious for the crops, numerous seed lots are rejected because of the contamination by seeds of non-noxious broomrape species. The aim of this study was to develop and evaluate a High Resolution Melting assay identifying the eight most noxious and common broomrape species ( Phelipanche aegyptiaca , Orobanche cernua , O. crenata, O. cumana , O. foetida , O. hederae , O. minor , and P. ramosa ) from a single seed. Based on trn L and rbc L plastidial genes amplification, the designed assay successfully identifies O. cumana , O. cernua , O. crenata , O. minor , O. hederae , and O. foetida ; P. ramosa , and P. aegyptiaca can be differentiated from other species but not from each other. Tested on 50 seed lots, obtained results perfectly matched identifications performed by sequencing. Through the analysis of common seed lots by different analysts, the reproducibility of the assay was evaluated at 90%. Despite an original sample preparation process it was not possible to extract enough DNA from some seeds (10% of the samples). The described assay fulfills its objectives and allows an accurate identification of the targeted broomrape species. It can be used to identify contaminants in commercial seed lots or for any other purpose. The assay might be extended to vegetative material.

  4. Genetic evidence from mitochondrial, nuclear, and endosymbiont markers for the evolution of host plant associated species in the aphid genus Hyalopterus (Hemiptera: Aphididae).

    Science.gov (United States)

    Lozier, Jeffrey D; Roderick, George K; Mills, Nicholas J

    2007-06-01

    Over the past several decades biologists' fascination with plant-herbivore interactions has generated intensive research into the implications of these interactions for insect diversification. The study of closely related phytophagous insect species or populations from an evolutionary perspective can help illuminate ecological and selective forces that drive these interactions. Here we present such an analysis for aphids in the genus Hyalopterus (Hemiptera: Aphididae), a cosmopolitan group that feeds on plants in the genus Prunus (Rosaceae). Hyalopterus currently contains two recognized species associated with different Prunus species, although the taxonomy and evolutionary history of the group is poorly understood. Using mitochondrial COI sequences, 16S rDNA sequences from the aphid endosymbiont Buchnera aphidicola, and nine microsatellite loci we investigated population structure in Hyalopterus from the most commonly used Prunus host species throughout the Mediterranean as well as in California, where the species H. pruni is an invasive pest. We found three deeply divergent lineages structured in large part by specific associations with plum, almond, and peach trees. There was no evidence that geographic or temporal barriers could explain the overall diversity in the genus. Levels of genetic differentiation are consistent with that typically attributed to aphid species and indicate divergence times older than the domestication of Prunus for agriculture. Interestingly, in addition to their typical hosts, aphids from each of the three lineages were frequently found on apricot trees. Apricot also appears to act as a resource mediated hybrid zone for plum and almond associated lineages. Together, results suggest that host plants have played a role in maintaining host-associated differentiation in Hyalopterus for as long as several million years, despite worldwide movement of host plants and the potential for ongoing hybridization.

  5. Commensal Bacteroides species induce colitis in host-genotype-specific fashion in a mouse model of inflammatory bowel disease

    Science.gov (United States)

    Bloom, Seth M.; Bijanki, Vinieth N.; Nava, Gerardo M.; Sun, Lulu; Malvin, Nicole P.; Donermeyer, David L.; Dunne, W. Michael; Allen, Paul M.; Stappenbeck, Thaddeus S.

    2011-01-01

    SUMMARY The intestinal microbiota is important for induction of inflammatory bowel disease (IBD). IBD is associated with complex shifts in microbiota composition, but it is unclear whether specific bacterial subsets induce IBD and, if so, whether their proportions in the microbiota are altered during disease. Here we fulfilled Koch’s postulates in host-genotype-specific fashion using a mouse model of IBD with human-relevant disease-susceptibility mutations. From screening experiments we isolated common commensal Bacteroides species, introduced them into antibiotic-pretreated mice, and quantitatively re-isolated them in culture. The bacteria colonized IBD-susceptible and non-susceptible mice equivalently, but induced disease exclusively in susceptible animals. Conversely, commensal Enterobacteriaceae were >100-fold enriched during spontaneous disease but an Enterobacteriaceae isolate failed to induce disease in antibiotic-pretreated mice despite robust colonization. We thus demonstrate that IBD-associated microbiota alterations do not necessarily reflect underlying disease etiology. These findings establish important experimental criteria and a conceptual framework for understanding microbial contributions to IBD. PMID:21575910

  6. A new and distinct species in the genus Caulimovirus exists as an endogenous plant pararetroviral sequence in its host, Dahlia variabilis.

    Science.gov (United States)

    Pahalawatta, Vihanga; Druffel, Keri; Pappu, Hanu

    2008-07-05

    Viruses in certain genera in family Caulimoviridae were shown to integrate their genomic sequences into their host genomes and exist as endogenous pararetroviral sequences (EPRV). However, members of the genus Caulimovirus remained to be the exception and are known to exist only as episomal elements in the infected cell. We present evidence that the DNA genome of a new and distinct Caulimovirus species, associated with dahlia mosaic, is integrated into its host genome, dahlia (Dahlia variabilis). Using cloned viral genes as probes, Southern blot hybridization of total plant DNA from dahlia seedlings showed the presence of viral DNA in the host DNA. Fluorescent in situ hybridization using labeled DNA probes from the D10 genome localized the viral sequences in dahlia chromosomes. The natural integration of a Caulimovirus genome into its host and its existence as an EPRV suggests the co-evolution of this plant-virus pathosystem.

  7. The Influence of the Host Plant Is the Major Ecological Determinant of the Presence of Nitrogen-Fixing Root Nodule Symbiont Cluster II Frankia Species in Soil.

    Science.gov (United States)

    Battenberg, Kai; Wren, Jannah A; Hillman, Janell; Edwards, Joseph; Huang, Liujing; Berry, Alison M

    2017-01-01

    The actinobacterial genus Frankia establishes nitrogen-fixing root nodule symbioses with specific hosts within the nitrogen-fixing plant clade. Of four genetically distinct subgroups of Frankia, cluster I, II, and III strains are capable of forming effective nitrogen-fixing symbiotic associations, while cluster IV strains generally do not. Cluster II Frankia strains have rarely been detected in soil devoid of host plants, unlike cluster I or III strains, suggesting a stronger association with their host. To investigate the degree of host influence, we characterized the cluster II Frankia strain distribution in rhizosphere soil in three locations in northern California. The presence/absence of cluster II Frankia strains at a given site correlated significantly with the presence/absence of host plants on the site, as determined by glutamine synthetase (glnA) gene sequence analysis, and by microbiome analysis (16S rRNA gene) of a subset of host/nonhost rhizosphere soils. However, the distribution of cluster II Frankia strains was not significantly affected by other potential determinants such as host-plant species, geographical location, climate, soil pH, or soil type. Rhizosphere soil microbiome analysis showed that cluster II Frankia strains occupied only a minute fraction of the microbiome even in the host-plant-present site and further revealed no statistically significant difference in the α-diversity or in the microbiome composition between the host-plant-present or -absent sites. Taken together, these data suggest that host plants provide a factor that is specific for cluster II Frankia strains, not a general growth-promoting factor. Further, the factor accumulates or is transported at the site level, i.e., beyond the host rhizosphere. Biological nitrogen fixation is a bacterial process that accounts for a major fraction of net new nitrogen input in terrestrial ecosystems. Transfer of fixed nitrogen to plant biomass is especially efficient via root nodule

  8. Genetic and morphological diversity of Trisetacus species (Eriophyoidea: Phytoptidae) associated with coniferous trees in Poland: phylogeny, barcoding, host and habitat specialization.

    Science.gov (United States)

    Lewandowski, Mariusz; Skoracka, Anna; Szydło, Wiktoria; Kozak, Marcin; Druciarek, Tobiasz; Griffiths, Don A

    2014-08-01

    Eriophyoid species belonging to the genus Trisetacus are economically important as pests of conifers. A narrow host specialization to conifers and some unique morphological characteristics have made these mites interesting subjects for scientific inquiry. In this study, we assessed morphological and genetic variation of seven Trisetacus species originating from six coniferous hosts in Poland by morphometric analysis and molecular sequencing of the mitochondrial cytochrome oxidase subunit I gene and the nuclear D2 region of 28S rDNA. The results confirmed the monophyly of the genus Trisetacus as well as the monophyly of five of the seven species studied. Both DNA sequences were effective in discriminating between six of the seven species tested. Host-dependent genetic and morphological variation in T. silvestris and T. relocatus, and habitat-dependent genetic and morphological variation in T. juniperinus were detected, suggesting the existence of races or even distinct species within these Trisetacus taxa. This is the first molecular phylogenetic analysis of the Trisetacus species. The findings presented here will stimulate further investigations on the evolutionary relationships of Trisetacus as well as the entire Phytoptidae family.

  9. Variations in infection levels and parasite-induced mortality among sympatric cryptic lineages of native amphipods and a congeneric invasive species: Are native hosts always losing?

    Directory of Open Access Journals (Sweden)

    Matthias Galipaud

    2017-12-01

    Full Text Available Shared parasites can strongly influence the outcome of competition between congeneric, sympatric hosts, and thus host population dynamics. Parasite-mediated competition is commonly hypothesized as an important factor in biological invasion success; invasive species often experience lower infection levels and/or parasite-induced mortality than native congeneric hosts. However, variation in infection levels among sympatric hosts can be due to contrasting abilities to avoid infection or different parasite-induced mortality rates following infection. Low parasite infection levels in a specific host can be due to either factor but have drastically different implications in interaction outcomes between sympatric hosts.We assessed acanthocephalan infection levels (prevalence and abundance among cryptic molecular taxonomic units (MOTU of the native G. pulex/G. fossarum species complex from multiple populations where they occur in sympatry. We concomitantly estimated the same parameters in the invasive Gammarus roeseli commonly found in sympatry with G. pulex/G. fossarum MOTUs. We then tested for potential differences in parasite-induced mortality among these alternative hosts. As expected, the invasive G. roeseli showed relatively low infection level and was not subject to parasite-induced mortality. We also found that both acanthocephalan infection levels and parasite-induced mortality varied greatly among cryptic MOTUs of the native amphipods. Contrary to expectations, some native MOTUs displayed levels of resistance to their local parasites similar to those observed in the invasive G. roeseli. Overall, cryptic diversity in native amphipods coupled with high levels of variability in infection levels and parasite-induced mortality documented here may strongly influence inter-MOTU interactions and native population dynamics as well as invasion success and population dynamics of the congeneric invasive G. roeseli. Keywords: Biological invasion

  10. The Potential of Isolation Source to Predict Colonization in Avian Hosts: A Case Study in Campylobacter jejuni Strains From Three Bird Species

    Directory of Open Access Journals (Sweden)

    Clara Atterby

    2018-03-01

    Full Text Available Campylobacter jejuni is the primary cause of bacterial gastroenteritis worldwide, infecting humans mostly through consumption of contaminated poultry. C. jejuni is common in the gut of wild birds, and shows distinct strain-specific association to particular bird species. This contrasts with farm animals, in which several genotypes co-exist. It is unclear if the barriers restricting transmission between host species of such specialist strains are related to environmental factors such as contact between host species, bacterial survival in the environment, etc., or rather to strain specific adaptation to the intestinal environment of specific hosts. We compared colonization dynamics in vivo between two host-specific C. jejuni from a song thrush (ST-1304 complex and a mallard (ST-995, and a generalist strain from chicken (ST-21 complex in a wild host, the mallard (Anas platyrhynchos. In 18-days infection experiments, the song thrush strain showed only weak colonization and was cleared from all birds after 10 days, whereas both mallard and chicken strains remained stable. When the chicken strain was given 4 days prior to co-infection of the same birds with a mallard strain, it was rapidly outcompeted by the latter. In contrast, when the mallard strain was given 4 days prior to co-infection with the chicken strain, the mallard strain remained and expansion of the chicken strain was delayed. Our results suggest strain-specific differences in the ability of C. jejuni to colonize mallards, likely associated with host origin. This difference might explain observed host association patterns in C. jejuni from wild birds.

  11. Phylogeny and host-plant relationships of the Australian Myrtaceae leafmining moth genus Pectinivalva (Lepidoptera, Nepticulidae), with new subgenera and species

    Science.gov (United States)

    Hoare, Robert J.B.; van Nieukerken, Erik J.

    2013-01-01

    Abstract The phylogeny of the mainly Australian nepticulid genus Pectinivalva Scoble, 1983 is investigated on the basis of morphology, and a division into three monophyletic subgenera is proposed on the basis of these results. These subgenera (Pectinivalva, Casanovula Hoare, subgen. n. and Menurella Hoare, subgen. n. ) are described and diagnosed, the described species of Pectinivalva are assigned to them, and representative new species are described in each: Pectinivalva (Pectinivalva) mystaconota Hoare, sp. n., Pectinivalva (Casanovula) brevipalpa Hoare, sp. n., Pectinivalva (Casanovula) minotaurus Hoare, sp. n., Pectinivalva (Menurella) scotodes Hoare, sp. n., Pectinivalva (Menurella) acmenae Hoare, sp. n., Pectinivalva (Menurella) xenadelpha Van Nieukerken & Hoare, sp. n., Pectinivalva (Menurella) quintiniae Hoare & Van Nieukerken, sp. n., and Pectinivalva (Menurella) tribulatrix Van Nieukerken & Hoare, sp. n. Pectinivalva (Menurella) quintiniae (from Quintinia verdonii, Paracryphiaceae) is the first known member of the genus with a host-plant not belonging to Myrtaceae. Pectinivalva (Menurella) xenadelpha from Mt Gunung Lumut, Kalimantan, Borneo, is the first pectinivalvine reported from outside Australia. Keys to the subgenera of Nepticulidae known from Australia, based on adults, male and female genitalia, and larvae, are presented. Host-plant relationships of Pectinivalva are discussed with relation to the phylogeny, and a list of known host-plants of Pectinivalva, including hosts of undescribed species, is presented. DNA barcodes are provided for most of the new and several unnamed species. PMID:23794827

  12. Laboratory investigations of African Pouched Rats (Cricetomys gambianus) as a potential reservoir host species for Monkeypox Virus

    Science.gov (United States)

    Hutson, Christina L.; Nakazawa, Yoshinori J.; Self, Joshua; Olson, Victoria A.; Regnery, Russell L.; Braden, Zachary; Weiss, Sonja; Malekani, Jean; Jackson, Eddie; Tate, Mallory; Karem, Kevin L.; Rocke, Tonie E.; Osorio, Jorge E.; Damon, Inger K.; Carroll, Darin S.

    2015-01-01

    Monkeypox is a zoonotic disease endemic to central and western Africa, where it is a major public health concern. Although Monkeypox virus (MPXV) and monkeypox disease in humans have been well characterized, little is known about its natural history, or its maintenance in animal populations of sylvatic reservoir(s). In 2003, several species of rodents imported from Ghana were involved in a monkeypox outbreak in the United States with individuals of three African rodent genera (Cricetomys, Graphiurus, Funisciurus) shown to be infected with MPXV. Here, we examine the course of MPXV infection in Cricetomys gambianus (pouched Gambian rats) and this rodent species’ competence as a host for the virus. We obtained ten Gambian rats from an introduced colony in Grassy Key, Florida and infected eight of these via scarification with a challenge dose of 4X104 plaque forming units (pfu) from either of the two primary clades of MPXV: Congo Basin (C-MPXV: n = 4) or West African (W-MPXV: n = 4); an additional 2 animals served as PBS controls. Viral shedding and the effect of infection on activity and physiological aspects of the animals were measured. MPXV challenged animals had significantly higher core body temperatures, reduced activity and increased weight loss than PBS controls. Viable virus was found in samples taken from animals in both experimental groups (C-MPXV and W-MPXV) between 3 and 27 days post infection (p.i.) (up to 1X108pfu/ml), with viral DNA found until day 56 p.i. The results from this work show that Cricetomys gambianus (and by inference, probably the closely related species, Cricetomys emini) can be infected with MPXV and shed viable virus particles; thus suggesting that these animals may be involved in the maintenance of MPXV in wildlife mammalian populations. More research is needed to elucidate the epidemiology of MPXV and the role of Gambian rats and other species.

  13. Estimating trematode prevalence in snail hosts using a single-step duplex PCR: how badly does cercarial shedding underestimate infection rates?

    Czech Academy of Sciences Publication Activity Database

    Born-Torrijos, A.; Poulin, R.; Raga, J. A.; Holzer, Astrid S.

    2014-01-01

    Roč. 7, MAY 2014 (2014), s. 243 ISSN 1756-3305 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : prevalence * detection * snail host * double infection * single-steo duplex PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.430, year: 2014

  14. The Microbiome of Field-Caught and Laboratory-Adapted Australian Tephritid Fruit Fly Species with Different Host Plant Use and Specialisation.

    Science.gov (United States)

    Morrow, J L; Frommer, M; Shearman, D C A; Riegler, M

    2015-08-01

    Tephritid fruit fly species display a diversity of host plant specialisation on a scale from monophagy to polyphagy. Furthermore, while some species prefer ripening fruit, a few are restricted to damaged or rotting fruit. Such a diversity of host plant use may be reflected in the microbial symbiont diversity of tephritids and their grade of dependency on their microbiomes. Here, we investigated the microbiome of six tephritid species from three genera, including species that are polyphagous pests (Bactrocera tryoni, Bactrocera neohumeralis, Bactrocera jarvisi, Ceratitis capitata) and a monophagous specialist (Bactrocera cacuminata). These were compared with the microbiome of a non-pestiferous but polyphagous tephritid species that is restricted to damaged or rotting fruit (Dirioxa pornia). The bacterial community associated with whole fruit flies was analysed by 16S ribosomal DNA (rDNA) amplicon pyrosequencing to detect potential drivers of taxonomic composition. Overall, the dominant bacterial families were Enterobacteriaceae and Acetobacteraceae (both Proteobacteria), and Streptococcaceae and Enterococcaceae (both Firmicutes). Comparisons across species and genera found different microbial composition in the three tephritid genera, but limited consistent differentiation between Bactrocera species. Within Bactrocera species, differentiation of microbial composition seemed to be influenced by the environment, possibly including their diets; beyond this, tephritid species identity or ecology also had an effect. The microbiome of D. pornia was most distinct from the other five species, which may be due to its ecologically different niche of rotting or damaged fruit, as opposed to ripening fruit favoured by the other species. Our study is the first amplicon pyrosequencing study to compare the microbiomes of tephritid species and thus delivers important information about the turnover of microbial diversity within and between fruit fly species and their potential

  15. Host species diversity and post-blood feeding carbohydrate availability enhance survival of females and fecundity in Aedes albopictus (Diptera: Culicidae).

    Science.gov (United States)

    Xue, Rui-De; Ali, Arshad; Barnard, Donald R

    2008-06-01

    Aedes albopictus mosquito is an opportunistic blood feeder and has a broad host range. The feeding behavior and habits of this mosquito are liable to increase the transmission potential of arboviruses. The survival and fecundity in A. albopictus fed on different hosts and post-blood meal provision of sugar were investigated in a laboratory-reared colony. Adult survival of caged female A. albopictus that were fed on blood of two different hosts (double meal) was higher than the females fed only on one host (single meal) (mean survival: 70.2+/-9.6 vs. 55.5+/-5.5%, respectively) when held in the laboratory for 72 h after blood feeding. Mean survival of females provided 10% sucrose solution (in water) after a single or double blood meal was higher (90.5+/-6.4% and 89.3+/-6.5%, respectively) than in the respective groups receiving water only following blood feeding (double meal: 49.0+/-9.6%; single meal: 45.3+/-10.9%). Females receiving a double meal were more fecund on average (89.0+/-6.6 eggs) than females provided a single meal (82.3+/-8.2 eggs).

  16. [Investigation on the hosts with natural Paragonimus infection and species identification in Jinhua Prefecture of Zhejiang Province].

    Science.gov (United States)

    Lou, Hong-Qiang; Hu, Ye; Jin, Yao-Jian; Yu, Xin-Tu; Wang, Lan; He, Xu-Ying; Tu, Ping-Guang

    2011-10-01

    To investigate the natural hosts infected with Paragonimus sp. and identify the species of the parasite in selected counties/districts of Jinhua prefecture in Zhejiang Province. Three townships/towns were randomly sampled from each of the 9 counties/districts in Jinhua as pilot spots for the survey. Fresh-water snails were collected from the fields for examining cercariae. Crabs were collected and detected for metacercariae by routine technique and the metacercariae were fed to dogs purchased in areas free from paragonimiasis. Fecal materials of dogs and cats around the villages and streams where crabs were found infected were collected for examining eggs. The artificially infected dogs were sacrificed 55 d after infection to receive adult worms. The size of cercariae, metacercariae, eggs and adult worms was measured. After the DNA of the adult worm was extracted, PCR was used to amplify the COI gene and ITS2 gene of the mitochondria from the worms. Homology with relative strains/isolates was analyzed and phylogenetic tree constructed. The survey demonstrated that the snail Semisulcospira libertina and the crab Sinopotamon chekiangense served as the first and second intermediate hosts respectively. Natural infection was found in Wucheng District with an infection rate of 0.2% (2/1,088) in snails and 76.7% (46/60) in crabs in Shafan township, and an infection index (II) of 2.0 in crabs, 0.1% (1/1,683) in snails and 53.0% (46/60) in crabs with an II of 0.9 in Langya town. The infection rate was 0 (0/575) in snails and 30.0% (18/60) in crabs with an II of 0.1 in Baimu township of Wuyi County. Paragonimus eggs were detected in feces of stray cats with a positive rate of 8.3% (1/12) in Shafan and 0.6% (1/17) in Langya. The size and morphology of the cercariae, metacercariae, eggs and adult worms were similar to those of Paragonimus westermani. The sequences of the COI and ITS2 genes were with 390 bp and 363 bp respectively, indicating a homology of 88.2%-98.2% and 86

  17. Disentangling Peronospora on Papaver: Phylogenetics, Taxonomy, Nomenclature and Host Range of Downy Mildew of Opium Poppy (Papaver somniferum) and Related Species

    Science.gov (United States)

    Voglmayr, Hermann; Montes-Borrego, Miguel; Landa, Blanca B.

    2014-01-01

    Based on sequence data from ITS rDNA, cox1 and cox2, six Peronospora species are recognised as phylogenetically distinct on various Papaver species. The host ranges of the four already described species P. arborescens, P. argemones, P. cristata and P. meconopsidis are clarified. Based on sequence data and morphology, two new species, P. apula and P. somniferi, are described from Papaver apulum and P. somniferum, respectively. The second Peronospora species parasitizing Papaver somniferum, that was only recently recorded as Peronospora cristata from Tasmania, is shown to represent a distinct taxon, P. meconopsidis, originally described from Meconopsis cambrica. It is shown that P. meconopsidis on Papaver somniferum is also present and widespread in Europe and Asia, but has been overlooked due to confusion with P. somniferi and due to less prominent, localized disease symptoms. Oospores are reported for the first time for P. meconopsidis from Asian collections on Papaver somniferum. Morphological descriptions, illustrations and a key are provided for all described Peronospora species on Papaver. cox1 and cox2 sequence data are confirmed as equally good barcoding loci for reliable Peronospora species identification, whereas ITS rDNA does sometimes not resolve species boundaries. Molecular phylogenetic data reveal high host specificity of Peronospora on Papaver, which has the important phytopathological implication that wild Papaver spp. cannot play any role as primary inoculum source for downy mildew epidemics in cultivated opium poppy crops. PMID:24806292

  18. Host Specificity for Bacterial, Archaeal and Fungal Communities Determined for High- and Low-Microbial Abundance Sponge Species in Two Genera

    Directory of Open Access Journals (Sweden)

    Maryam Chaib De Mares

    2017-12-01

    Full Text Available Sponges are engaged in intimate symbioses with a diversity of microorganisms from all three domains of life, namely Bacteria, Archaea and Eukarya. Sponges have been well studied and categorized for their bacterial communities, some displaying a high microbial abundance (HMA, while others show low microbial abundance (LMA. However, the associated Archaea and Eukarya have remained relatively understudied. We assessed the bacterial, archaeal and eukaryotic diversities in the LMA sponge species Dysidea avara and Dysidea etheria by deep amplicon sequencing, and compared the results to those in the HMA sponges Aplysina aerophoba and Aplysina cauliformis. D. avara and A. aerophoba are sympatric in the Mediterranean Sea, while D. etheria and A. cauliformis are sympatric in the Caribbean Sea. The bacterial communities followed a host-specific pattern, with host species identity explaining most of the variation among samples. We identified OTUs shared by the Aplysina species that support a more ancient association of these microbes, before the split of the two species studied here. These shared OTUs are suitable targets for future studies of the microbial traits that mediate interactions with their hosts. Even though the archaeal communities were not as rich as the bacterial ones, we found a remarkable diversification and specificity of OTUs of the family Cenarchaeaceae and the genus Nitrosopumilus in all four sponge species studied. Similarly, the differences in fungal communities were driven by sponge identity. The structures of the communities of small eukaryotes such as dinophytes and ciliophores (alveolates, and stramenopiles, could not be explained by either sponge host, sponge genus or geographic location. Our analyses suggest that the host specificity that was previously described for sponge bacterial communities also extends to the archaeal and fungal communities, but not to other microbial eukaryotes.

  19. Multiple Phytophthora species associated with a single riparian ecosystem in South Africa.

    Science.gov (United States)

    Nagel, Jan H; Slippers, Bernard; Wingfield, Michael J; Gryzenhout, Marieka

    2015-01-01

    The diversity of Phytophthora spp. in rivers and riparian ecosystems has received considerable international attention, although little such research has been conducted in South Africa. This study determined the diversity of Phytophthora spp. within a single river in Gauteng province of South Africa. Samples were collected over 1 y including biweekly river baiting with Rhododendron indicum leaves. Phytophthora isolates were identified with phylogenetic analyses of sequences for the internal transcribed spacer (ITS) region of the ribosomal DNA and the mitochondrial cytochrome oxidase c subunit I (coxI) gene. Eight Phytophthora spp. were identified, including a new taxon, P. taxon Sisulu-river, and two hybrid species from Cooke's ITS clade 6. Of these, species from Clade 6 were the most abundant, including P. chlamydospora and P. lacustris. Species residing in Clade 2 also were encountered, including P. multivora, P. plurivora and P. citrophthora. The detection of eight species in this investigation of Phytophthora diversity in a single riparian river ecosystem in northern South Africa adds to the known diversity of this genus in South Africa and globally. © 2015 by The Mycological Society of America.

  20. Examining the relationship between total species richness and single island palaeo- and neo-endemics

    Science.gov (United States)

    Kallimanis, A. S.; Panitsa, M.; Bergmeier, E.; Dimopoulos, P.

    2011-03-01

    Recently, Emerson and Kolm (2005) hypothesized that diversity begets speciation (DBS hypothesis). The relationship between total species richness and single island endemic diversity (as a proportion of the total species richness of the island) has been used as evidence for the DBS hypothesis. This relationship has been documented in oceanic archipelagos, but many criticisms have been raised on whether this relationship truly supports the DBS hypothesis. In this study we tested if this hypothesis holds in the Aegean archipelago (a continental archipelago with continuous human presence over millennia). Endemism in the Aegean includes mainly neo-endemic species but also relictual populations of formerly more widespread species (i.e. palaeo-endemics). Contrary to the DBS hypothesis, we found that total species richness was not significantly correlated to single island endemics (neither neo-endemics nor palaeo-endemics) as a proportion of the island flora. Furthermore, we found that neo-endemic diversity (either as species richness or as a proportion of the islands flora) is mainly correlated to island maximum elevation, while area and isolation were less important. So if this ratio is indeed an index of speciation, then an alternative explanation might be that elevation (interpreted as a proxy for habitat heterogeneity) is the driver of speciation in our case. Palaeo-endemics, on the other hand, were present in only six of the largest islands in the Aegean and their diversity was strongly correlated only with island area, perhaps implying that larger islands support larger population sizes that buffer stochastic extinctions risks.

  1. Intraspecific variation between the ITS sequences of Toxocara canis, Toxocara cati and Toxascaris leonina from different host species in south-western Poland.

    Science.gov (United States)

    Fogt-Wyrwas, R; Mizgajska-Wiktor, H; Pacoń, J; Jarosz, W

    2013-12-01

    Some parasitic nematodes can inhabit different definitive hosts, which raises the question of the intraspecific variability of the nematode genotype affecting their preferences to choose particular species as hosts. Additionally, the issue of a possible intraspecific DNA microheterogeneity in specimens from different parts of the world seems to be interesting, especially from the evolutionary point of view. The problem was analysed in three related species - Toxocara canis, Toxocara cati and Toxascaris leonina - specimens originating from Central Europe (Poland). Using specific primers for species identification, internal transcribed spacer (ITS)-1 and ITS-2 regions were amplified and then sequenced. The sequences obtained were compared with sequences previously described for specimens originating from other geographical locations. No differences in nucleotide sequences were established in T. canis isolated from two different hosts (dogs and foxes). A comparison of ITS sequences of T. canis from Poland with sequences deposited in GenBank showed that the scope of intraspecific variability of the species did not exceed 0.4%, while in T. cati the differences did not exceed 2%. Significant differences were found in T. leonina, where ITS-1 differed by 3% and ITS-2 by as much as 7.4% in specimens collected from foxes in Poland and dogs in Australia. Such scope of differences in the nucleotide sequence seems to exceed the intraspecific variation of the species.

  2. Analysis of plant leaf metabolites reveals no common response to insect herbivory by Pieris rapae in three related host-plant species.

    Science.gov (United States)

    Riach, A C; Perera, M V L; Florance, H V; Penfield, S D; Hill, J K

    2015-05-01

    Studying the biochemical responses of different plant species to insect herbivory may help improve our understanding of the evolution of defensive metabolites found in host plants and their role in plant-herbivore interactions. Untargeted metabolic fingerprints measured as individual mass features were used to compare metabolite reactions in three Brassicales host-plant species (Cleome spinosa, Brassica oleracea, and Lunaria annua) to larval herbivore attack (Pieris rapae; Lepidoptera). Principal component analyses of metabolic fingerprints were able to distinguish among the three plant species and between uneaten control plants and plants that had been eaten. A large number of mass features (1186, 13% of mass features measured in control plants) were common to the three plant species. However, there were few similarities in the mass features that were induced (i.e. changed in abundance) following herbivory. Of the 87 and 68 induced mass features in B. oleracea and C. spinosa, respectively, there were only three that were induced in both plant species. By contrast, L. annua only had one mass feature induced by herbivory, and this was not induced in the other two plant species. The growth of the P. rapae larvae was poorer on the host plant L. annua than on B. oleracea and C. spinosa. The absence of common metabolites among the plants meant these induced responses could not be related to the performance of the herbivore. Thus, the response to herbivory by the same herbivore in these three host plants has evolved to be idiosyncratic in terms of the specific metabolites induced. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Host differentiation and variability of Orobanche crenata populations from legume species in Morocco as revealed by cross-infestation and molecular analysis.

    Science.gov (United States)

    Ennami, Mounia; Briache, Fatima Zahra; Gaboun, Fatima; Abdelwahd, Rabha; Ghaouti, Lamiae; Belqadi, Loubna; Westwood, James; Mentag, Rachid

    2017-08-01

    Orobanche crenata represents a major biotic constraint to production of faba bean and lentil in Morocco. While this parasitic plant attacks both of these crops, the extent to which Orobanche biotypes specialise in parasitising specific crops is unknown. To address this question, we studied O. crenata that grew on different hosts and quantified their host specificity to faba bean and lentil. The virulence of O. crenata populations on each host was investigated through field trials, pot and Petri dishes assays. Genetic diversity of the parasite populations was also assessed through molecular analyses. The two legume species showed distinct patterns of specificity. Faba bean was more susceptible to both O. crenata populations, while the specificity for lentil by lentil-grown O. crenata was evident at the final stage of the parasite life cycle as shown by correspondence factorial analyses. Considerable internal variation (81%) within O. crenata populations parasitising both legume species was observed by molecular analyses, but significant divergence (19%; Ø = 0.189; P = 0.010) among the populations was detected. These results indicate that O. crenata can adapt to specific host species, which is important knowledge when developing integrated pest management practices for parasitic weed control. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  4. Contemporary root canal irrigants are able to disrupt and eradicate single- and dual-species biofilms.

    Science.gov (United States)

    Bryce, Graeme; O'Donnell, Darren; Ready, Derren; Ng, Yuan-Ling; Pratten, Jonathan; Gulabivala, Kishor

    2009-09-01

    Clinical/microbiological studies have consistently revealed the persistence of some bacteria after conventional root canal debridement. Although this was originally attributed to the complexity of the root canal anatomy and the difficulty of delivering antibacterial agents effectively, it has emerged that the biofilm encasement of bacterial cells may confer a further mechanism of resistance. The purpose of this study was to investigate the relative disruption and bactericidal effects of root canal irrigants on single- and dual-species biofilms of root canal isolates. Biofilms of Streptococcus sanguinis, Enterococcus faecalis, Fusobacterium nucleatum, and Porphyromonas gingivalis were grown on nitrocellulose membranes for 72 hours and immersed in NaOCl, EDTA, chlorhexidine, and iodine for 1, 5, or 10 minutes. The number of viable and nonviable bacteria disrupted from the biofilm and those remaining adherent were determined by using a viability stain in conjunction with fluorescence microscopy. Gram-negative obligate anaerobe species were more susceptible to cell removal than gram-positive facultative anaerobes. The majority of cells were disrupted after the first minute of exposure; however, the extent varied according to the agent and species. The most effective agent at disrupting biofilms was NaOCl. Iodine was generally effective at bacterial killing but not disruption. Biofilm disruption and cell viability were influenced by the species, their coassociation in dual-species biofilms, the test agent, and the duration of exposure. The effectiveness of NaOCl as an endodontic irrigant was reinforced.

  5. Infection, specificity and host manipulation of Australapatemon sp (Trematoda, Strigeidae) in two sympatric species of leeches (Hirudinea)

    Czech Academy of Sciences Publication Activity Database

    Karvonen, A.; Faltýnková, Anna; Choo, J. M.; Valtonen, E. T.

    2017-01-01

    Roč. 144, č. 10 (2017), s. 1346-1355 ISSN 0031-1820 Institutional support: RVO:60077344 Keywords : complex life cycle * Digenea * host manipulation * host-parasite relationship * spatiotemporal variation * specificity * Trematoda Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.713, year: 2016

  6. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  7. Identifying the Achilles heel of multi-host pathogens: the concept of keystone ‘host’ species illustrated by Mycobacterium ulcerans transmission

    International Nuclear Information System (INIS)

    Roche, Benjamin; Eric Benbow, M; Merritt, Richard; Kimbirauskas, Ryan; McIntosh, Mollie; Small, Pamela L C; Williamson, Heather; Guégan, Jean-François

    2013-01-01

    Pathogens that use multiple host species are an increasing public health issue due to their complex transmission, which makes them difficult to mitigate. Here, we explore the possibility of using networks of ecological interactions among potential host species to identify the particular disease-source species to target to break down transmission of such pathogens. We fit a mathematical model on prevalence data of Mycobacterium ulcerans in western Africa and we show that removing the most abundant taxa for this category of pathogen is not an optimal strategy to decrease the transmission of the mycobacterium within aquatic ecosystems. On the contrary, we reveal that the removal of some taxa, especially Oligochaeta worms, can clearly reduce rates of pathogen transmission, and these should be considered as keystone organisms for its transmission because they lead to a substantial reduction in pathogen prevalence regardless of the network topology. Besides their potential application for the understanding of M. ulcerans ecology, we discuss how networks of species interactions can modulate transmission of multi-host pathogens. (letter)

  8. Identifying the Achilles heel of multi-host pathogens: the concept of keystone ‘host’ species illustrated by Mycobacterium ulcerans transmission

    Science.gov (United States)

    Roche, Benjamin; Benbow, M. Eric; Merritt, Richard; Kimbirauskas, Ryan; McIntosh, Mollie; Small, Pamela L. C.; Williamson, Heather; Guégan, Jean-François

    2013-12-01

    Pathogens that use multiple host species are an increasing public health issue due to their complex transmission, which makes them difficult to mitigate. Here, we explore the possibility of using networks of ecological interactions among potential host species to identify the particular disease-source species to target to break down transmission of such pathogens. We fit a mathematical model on prevalence data of Mycobacterium ulcerans in western Africa and we show that removing the most abundant taxa for this category of pathogen is not an optimal strategy to decrease the transmission of the mycobacterium within aquatic ecosystems. On the contrary, we reveal that the removal of some taxa, especially Oligochaeta worms, can clearly reduce rates of pathogen transmission, and these should be considered as keystone organisms for its transmission because they lead to a substantial reduction in pathogen prevalence regardless of the network topology. Besides their potential application for the understanding of M. ulcerans ecology, we discuss how networks of species interactions can modulate transmission of multi-host pathogens.

  9. Native aphids of New Zealand--diversity and host associations.

    Science.gov (United States)

    Teulon, D A J; Stufkens, M A W; Drayton, G M; Maw, H E L; Scott, I A W; Bulman, S R; Carver, M; Von Dohlen, C D; Eastop, V F; Foottit, R G

    2013-01-01

    At least 15 species of aphids are now recognised as New Zealand natives and most of these are very likely to be endemic. Most native aphids belong in the subfamily Aphidinae (Aphidini), with a possible single species in Aphidinae-Macrosiphini, at least two in Neophyllaphidinae and one in Taiwanaphidinae. With one exception, native aphids are restricted to a single host plant genus, and these hosts are from 13 genera and 12 plant families in the Pinales and Angiospermae-Eudicotyledonae, suggesting that the aphids are a remnant fauna. No known native aphids have host plants from the Pteridophyta or Angiospermae-Monocotyledonae, with the possible exception of two possibly native species extracted from native tussock grassland turfs. Most host plant genera have some degree of Gondwanan distribution, but only two indigenous species are found on large forest trees and only one host is deciduous. Native aphids have been recorded from sea level to the subalpine zone, reflecting their host plant distributions. Sexual reproduction, followed by several parthenogenetic generations on the same host plant, appears to be the norm for most species. Eggs appear to be used for surviving winter conditions in some species and summer conditions in others. Native aphid distribution and abundance varies with five species considered to be scarce, one species localised, two species sparse and three relatively common based on current knowledge.

  10. Addressing challenges in single species assessments via a simple state-space assessment model

    DEFF Research Database (Denmark)

    Nielsen, Anders

    Single-species and age-structured fish stock assessments still remains the main tool for managing fish stocks. A simple state-space assessment model is presented as an alternative to (semi) deterministic procedures and the full parametric statistical catch at age models. It offers a solution...... to some of the key challenges of these models. Compared to the deterministic procedures it solves a list of problems originating from falsely assuming that age classified catches are known without errors and allows quantification of uncertainties of estimated quantities of interest. Compared to full...

  11. Wolbachia and the insect immune system: What reactive oxygen species can tell us about the mechanisms of Wolbachia—host interactions

    Directory of Open Access Journals (Sweden)

    Roman eZug

    2015-10-01

    Full Text Available Wolbachia are intracellular bacteria that infect a vast range of arthropod species, making them one of the most prevalent endosymbionts in the world. Wolbachia's stunning evolutionary success is mostly due to their reproductive parasitism but also to mutualistic effects such as increased host fecundity or protection against pathogens. However, the mechanisms underlying Wolbachia phenotypes, both parasitic and mutualistic, are only poorly understood. Moreover, it is unclear how the insect immune system is involved in these phenotypes and why it is not more successful in eliminating the bacteria. Here we argue that reactive oxygen species (ROS are likely to be key in elucidating these issues. ROS are essential players in the insect immune system, and Wolbachia infection can affect ROS levels in the host. Based on recent findings, we elaborate a hypothesis that considers the different effects of Wolbachia on the oxidative environment in novel vs. native hosts. We propose that newly introduced Wolbachia trigger an immune response and cause oxidative stress, whereas in coevolved symbioses, infection is not associated with oxidative stress, but rather with restored redox homeostasis. Redox homeostasis can be restored in different ways, depending on whether Wolbachia or the host is in charge. This hypothesis offers a mechanistic explanation for several of the observed Wolbachia phenotypes.

  12. Live Attenuated Tetravalent Dengue Virus Host Range Vaccine Is Immunogenic in African Green Monkeys following a Single Vaccination

    Science.gov (United States)

    Smith, Katherine M.; Piper, Amanda; Huitt, Emerson; Spears, Carla J.; Quiles, Michelle; Ribeiro, Mariana; Thomas, Malcolm E.; Brown, Dennis T.; Hernandez, Raquel

    2014-01-01

    ABSTRACT The causative agent of dengue fever, dengue virus (DENV), is transmitted by mosquitoes, and as distribution of these insects has expanded, so has dengue-related disease. DENV is a member of the Flaviviridae family and has 4 distinct serotypes (DENV-1, -2, -3, and -4). No lasting cross protection is afforded to heterologous serotypes following infection by any one of the individual serotypes. The presence of nonneutralizing antibodies to one serotype can facilitate the occurrence of more-severe dengue hemorrhagic fever through immune enhancement upon infection with a second serotype. For this reason, the development of a safe, tetravalent vaccine to produce a balanced immune response to all four serotypes is critical. We have developed a novel approach to produce safe and effective live-attenuated vaccines for DENV and other insect-borne viruses. Host range (HR) mutants of each DENV serotype were created by truncating transmembrane domain 1 of the E protein and selecting for strains of DENV that replicated well in insect cells but not mammalian cells. These vaccine strains were tested for immunogenicity in African green monkeys (AGMs). No vaccine-related adverse events occurred. The vaccine strains were confirmed to be attenuated in vivo by infectious center assay (ICA). Analysis by 50% plaque reduction neutralization test (PRNT50) established that by day 62 postvaccination, 100% of animals seroconverted to DENV-1, -2, -3, and -4. Additionally, the DENV HR tetravalent vaccine (HR-Tet) showed a tetravalent anamnestic immune response in 100% (16/16) of AGMs after challenge with wild-type (WT) DENV strains. IMPORTANCE We have generated a live attenuated viral (LAV) vaccine capable of eliciting a strong immune response in African green monkeys (AGMs) in a single dose. This vaccine is delivered by injecting one of four attenuated serotypes into each limb of the animal. 100% of animals given the vaccine generated antibodies against all 4 serotypes, and this

  13. Live attenuated tetravalent dengue virus host range vaccine is immunogenic in African green monkeys following a single vaccination.

    Science.gov (United States)

    Briggs, Caitlin M; Smith, Katherine M; Piper, Amanda; Huitt, Emerson; Spears, Carla J; Quiles, Michelle; Ribeiro, Mariana; Thomas, Malcolm E; Brown, Dennis T; Hernandez, Raquel

    2014-06-01

    The causative agent of dengue fever, dengue virus (DENV), is transmitted by mosquitoes, and as distribution of these insects has expanded, so has dengue-related disease. DENV is a member of the Flaviviridae family and has 4 distinct serotypes (DENV-1, -2, -3, and -4). No lasting cross protection is afforded to heterologous serotypes following infection by any one of the individual serotypes. The presence of nonneutralizing antibodies to one serotype can facilitate the occurrence of more-severe dengue hemorrhagic fever through immune enhancement upon infection with a second serotype. For this reason, the development of a safe, tetravalent vaccine to produce a balanced immune response to all four serotypes is critical. We have developed a novel approach to produce safe and effective live-attenuated vaccines for DENV and other insect-borne viruses. Host range (HR) mutants of each DENV serotype were created by truncating transmembrane domain 1 of the E protein and selecting for strains of DENV that replicated well in insect cells but not mammalian cells. These vaccine strains were tested for immunogenicity in African green monkeys (AGMs). No vaccine-related adverse events occurred. The vaccine strains were confirmed to be attenuated in vivo by infectious center assay (ICA). Analysis by 50% plaque reduction neutralization test (PRNT50) established that by day 62 postvaccination, 100% of animals seroconverted to DENV-1, -2, -3, and -4. Additionally, the DENV HR tetravalent vaccine (HR-Tet) showed a tetravalent anamnestic immune response in 100% (16/16) of AGMs after challenge with wild-type (WT) DENV strains. We have generated a live attenuated viral (LAV) vaccine capable of eliciting a strong immune response in African green monkeys (AGMs) in a single dose. This vaccine is delivered by injecting one of four attenuated serotypes into each limb of the animal. 100% of animals given the vaccine generated antibodies against all 4 serotypes, and this response was found to be

  14. Host plant quality of Tamarix ramosissima and T. parviflora for three sibling species of the biocontrol insect Diorhabda elongata (Coleoptera: Chrysomelidae).

    Science.gov (United States)

    Dalin, Peter; O'Neal, Melissa J; Dudley, Tom; Bean, Daniel W

    2009-10-01

    Several sibling species of the leaf beetle Diorhabda elongata (Brullé) have been introduced into North America for the biocontrol of saltcedars (Tamarix spp.), but only one, D. carinulata (Desbrochers), has been extensively used in the field. The first open releases took place in 2001, and widespread defoliation occurred at sites infested by Tamarix ramosissima, T. chinensis, and their hybrid forms. The beetles failed, however, to establish at sites where other Tamarix species are targeted for control. In this study, we compared the preference and performance of three Diorhabda sibling species using adult choice and larval performance experiments on the two formally targeted Tamarix species: T. ramosissima and T. parviflora. In the adult choice experiment, a greater proportion of D. carinulata was found on T. ramosissima than on T. parviflora. For the other two sibling species, D. elongata (Brullé) and D. carinata (Faldermann), adults were found in similar proportions on the two host plants. In the larval performance experiment, larval growth and survival did not differ between Tamarix species for any Diorhabda type; however, D. carinata larval biomass was 35-50% greater than the other beetles regardless of host species. Based on the few adults of D. carinulata found on T. parviflora in the adult choice experiment, we do not recommend introducing this beetle at sites where T. parviflora is targeted for biological control. The species D. carinata seems especially promising for future release because its larvae gained substantially more biomass than the other beetles during the same time period on both Tamarix species.

  15. Near infra-red spectroscopy quantitative modelling of bivalve protein, lipid and glycogen composition using single-species versus multi-species calibration and validation sets

    Science.gov (United States)

    Bartlett, Jill K.; Maher, William A.; Purss, Matthew B. J.

    2018-03-01

    Near infrared spectroscopy (NIRS) quantitative modelling was used to measure the protein, lipid and glycogen composition of five marine bivalve species (Saccostrea glomerata, Ostrea angasi, Crassostrea gigas, Mytilus galloprovincialis and Anadara trapezia) from multiple locations and seasons. Predictive models were produced for each component using individual species and aggregated sample populations for the three oyster species (S. glomerata, O. angasi and C. gigas) and for all five bivalve species. Whole animal tissues were freeze dried, ground to > 20 μm and scanned by NIRS. Protein, lipid and glycogen composition were determined by traditional chemical analyses and calibration models developed to allow rapid NIRS-measurement of these components in the five bivalve species. Calibration modelling was performed using wavelet selection, genetic algorithms and partial least squares analysis. Model quality was assessed using RPIQ and RMESP. For protein composition, single species model results had RPIQ values between 2.4 and 3.5 and RMSEP between 8.6 and 18%, the three oyster model had an RPIQ of 2.6 and an RMSEP of 10.8% and the five bivalve species had an RPIQ of 3.6 and RMSEP of 8.7% respectively. For lipid composition, single species models achieved RPIQ values between 2.9 and 5.3 with RMSEP between 9.1 and 11.2%, the oyster model had an RPIQ of 3.6 and RMSEP of 6.8 and the five bivalve model had an RPIQ of 5.2 and RMSEP of 6.8% respectively. For glycogen composition, the single species models had RPIQs between 3.8 and 18.9 with RMSEP between 3.5 and 9.2%, the oyster model had an RPIQ of 5.5 and RMSEP of 7.1% and the five bivalve model had an RPIQ of 4 and RMSEP of 7.6% respectively. Comparison between individual species models and aggregated models for three oyster species and five bivalve species for each component indicate that aggregating data from like species produces high quality models with robust and reliable quantitative application. The benefit of

  16. Host identity matters in the amphibian-Batrachochytrium dendrobatidis system: fine-scale patterns of variation in responses to a multi-host pathogen

    Science.gov (United States)

    Stephanie Gervasi; Carmen Gondhalekar; Deanna H. Olson; Andrew R. Blaustein

    2013-01-01

    Species composition within ecological assemblages can drive disease dynamics including pathogen invasion, spread, and persistence. In multi-host pathogen systems, interspecific variation in responses to infection creates important context dependency when predicting the outcome of disease. Here, we examine the responses of three sympatric host species to a single fungal...

  17. Effect of Simulated Climate Warming on the Ectomycorrhizal Fungal Community of Boreal and Temperate Host Species Growing Near Their Shared Ecotonal Range Limits.

    Science.gov (United States)

    Mucha, Joanna; Peay, Kabir G; Smith, Dylan P; Reich, Peter B; Stefański, Artur; Hobbie, Sarah E

    2018-02-01

    Ectomycorrhizal (ECM) fungi can influence the establishment and performance of host species by increasing nutrient and water absorption. Therefore, understanding the response of ECM fungi to expected changes in the global climate is crucial for predicting potential changes in the composition and productivity of forests. While anthropogenic activity has, and will continue to, cause global temperature increases, few studies have investigated how increases in temperature will affect the community composition of ectomycorrhizal fungi. The effects of global warming are expected to be particularly strong at biome boundaries and in the northern latitudes. In the present study, we analyzed the effects of experimental manipulations of temperature and canopy structure (open vs. closed) on ectomycorrhizal fungi identified from roots of host seedlings through 454 pyrosequencing. The ecotonal boundary site selected for the study was between the southern boreal and temperate forests in northern Minnesota, USA, which is the southern limit range for Picea glauca and Betula papyrifera and the northern one for Pinus strobus and Quercus rubra. Manipulations that increased air and soil temperature by 1.7 and 3.4 °C above ambient temperatures, respectively, did not change ECM richness but did alter the composition of the ECM community in a manner dependent on host and canopy structure. The prediction that colonization of boreal tree species with ECM symbionts characteristic of temperate species would occur was not substantiated. Overall, only a small proportion of the ECM community appears to be strongly sensitive to warming.

  18. Genetic characterization of oropharyngeal trichomonad isolates from wild birds indicates that genotype is associated with host species, diet and presence of pathognomonic lesions.

    Science.gov (United States)

    Martínez-Herrero, M C; Sansano-Maestre, J; López Márquez, I; Obón, E; Ponce, C; González, J; Garijo-Toledo, M M; Gómez-Muñoz, M T

    2014-01-01

    Oropharyngeal trichomonad isolates of wild birds from Spain were studied. A total of 1688 samples (1214 of predator birds and 474 of prey species) from wildlife recovery centres and scientific bird-ringing campaigns were analysed from 2011 to 2013. The overall infection prevalence was 20.3% (11.4% in predator birds and 43.3% in prey species). Pathognomonic lesions were present in 26% of the infected birds (57.3% in predator birds and 4.9% in prey species). The most commonly parasitized species were the goshawk (Accipiter gentilis, 74.5%) and the rock pigeon (Columba livia, 79.4%). Host species in which the parasite has not been previously analysed by polymerase chain reaction and sequencing in Spain are also reported: Columba palumbus, Streptopelia turtur, Pica pica, A. gentilis, Accipiter nisus, Asio otus, Bubo bubo, Buteo buteo, Circus aeruginosus, Circus cyaneus, Falco naumanni, Falco peregrinus, Neophron percnopterus, Otus scops, Pernis apivorus and Strix aluco. Sequence analysis of the ITS1/5.8S/ITS2 region revealed five different genotypes and also some mixed infections. A relationship between genotype and host species was observed, but only two genotypes (ITS-OBT-Tg-1and ITS-OBT-Tg-2) were widely distributed. Genotype ITS-OBT-Tg-1 was most frequently found in predator birds and statistically associated with pathognomonic lesions. Non-strict ornithophagous species were at higher risk to develop disease than ornithophagous ones. Genotypes ITS-OBT-Tcl-1 and ITS-OBT-Tcl-2 are new reports, and ITS-OBT-Tvl-5 is reported for the first time in Spain. They showed higher genetic homology to Trichomonas canistomae and Trichomonas vaginalis than to Trichomonas gallinae, indicating the possibility of new species within this genus.

  19. Are single odorous components of a predator sufficient to elicit defensive behaviors in prey species?

    Directory of Open Access Journals (Sweden)

    Raimund eApfelbach

    2015-07-01

    Full Text Available When exposed to the odor of a sympatric predator, prey animals typically display escape or defensive responses. These phenomena have been well-documented, especially in rodents, when exposed to the odor of a cat, ferret or fox. As a result of these experiments new discussions center on the following questions: 1 is a single volatile compound such as a major or a minor mixture constituent in urine or feces, emitted by the predator sufficient to cause defensive reactions in a potential prey species or 2 is a whole array of odors required to elicit a response and 3 will the relative size or escapability of the prey as compared to the predator influence responsiveness. Most predator-prey studies on this topic have been performed in the laboratory or under semi-natural conditions. Field studies could help to find answers to these questions. Australian mammals are completely naïve towards the introduced placental carnivores. That offers ideal opportunities to analyze in the field the responses of potential prey species to unknown predator odors. During the last decades researchers have accumulated an enormous amount of data exploring the effects of eutherian predator odors on native marsupial mammals. In this review, we will give a survey about the development of olfactory research, chemical signals and their influence on the behavior and - in some cases - physiology of prey species. In addition, we report on the effects of predator odor experiments performed under natural conditions in Australia. When studying all these literature we learned that data gained under controlled laboratory conditions elucidate the role of individual odors on brain structures and ultimately on a comparatively narrow range behaviors. In contrast to single odors odor arrays mimic much more the situation prey animals are confronted to in nature. Therefore, a broad range of methodology — from chemistry to ecology including anatomy, physiology and behavior — is needed to

  20. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    Science.gov (United States)

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. A nonlocal and periodic reaction-diffusion-advection model of a single phytoplankton species.

    Science.gov (United States)

    Peng, Rui; Zhao, Xiao-Qiang

    2016-02-01

    In this article, we are concerned with a nonlocal reaction-diffusion-advection model which describes the evolution of a single phytoplankton species in a eutrophic vertical water column where the species relies solely on light for its metabolism. The new feature of our modeling equation lies in that the incident light intensity and the death rate are assumed to be time periodic with a common period. We first establish a threshold type result on the global dynamics of this model in terms of the basic reproduction number R0. Then we derive various characterizations of R0 with respect to the vertical turbulent diffusion rate, the sinking or buoyant rate and the water column depth, respectively, which in turn give rather precise conditions to determine whether the phytoplankton persist or become extinct. Our theoretical results not only extend the existing ones for the time-independent case, but also reveal new interesting effects of the modeling parameters and the time-periodic heterogeneous environment on persistence and extinction of the phytoplankton species, and thereby suggest important implications for phytoplankton growth control.

  2. Response of brown-headed cowbirds and three host species to thinning treatments in low-elevation ponderosa pine forests along the northern Colorado Front Range

    Science.gov (United States)

    Keeley, W.H.; Germaine, Stephen S.; Stanley, Thomas R.; Spaulding, Sarah A.; Wanner, C.E.

    2013-01-01

    Thinning ponderosa pine (Pinus ponderosa) forests to achieve desired ecological conditions remains a priority in the North American west. In addition to reducing the risk of high-severity wildfires in unwanted areas, stand thinning may increase wildlife and plant diversity and provide increased opportunity for seedling recruitment. We initiated conservative (i.e. minimal removal of trees) ponderosa stand thinning treatments with the goals of reducing fire risk and improving habitat conditions for native wildlife and flora. We then compared site occupancy of brown-headed cowbirds (Molothrus ater), chipping sparrows (Spizella passerina), plumbeous vireos (Vireo plumbeus), and western wood-pewees (Contopus sordidulus) in thinned and unthinned (i.e., control) forest stands from 2007 to 2009. Survey stations located in thinned stands had 64% fewer trees/ha, 25% less canopy cover, and 23% less basal area than stations in control stands. Occupancy by all three host species was negatively associated with tree density, suggesting that these species respond favorably to forest thinning treatments in ponderosa pine forests. We also encountered plumbeous vireos more frequently in plots closer to an ecotonal (forest/grassland) edge, an association that may increase their susceptibility to edge-specialist, brood parasites like brown-headed cowbirds. Occupancy of brown-headed cowbirds was not related to forest metrics but was related to occupancy by plumbeous vireos and the other host species in aggregate, supporting previous reports on the affiliation between these species. Forest management practices that promote heterogeneity in forest stand structure may benefit songbird populations in our area, but these treatments may also confer costs associated with increased cowbird occupancy. Further research is required to understand more on the complex relationships between occupancy of cowbirds and host species, and between cowbird occupancy and realized rates of nest parasitism.

  3. Host Fish of Four Species of Unionid Mussels and the Dispersal of their Larvae with the Fish Movement

    Science.gov (United States)

    Kondo, Mio; Ito, Kengo; Senge, Masateru

    Host fish of each mussel was examined in a biotope pond, a drainage canal and fishway between them in Gifu Prefecture from May to October 2008. The main host fish was Zacco platypus in Unio douglasiae and Lanceolaria grayana, Nipponocypris sieboldii in Anodonta sp. and Pronodularia japonensis. In the fish caught at fishway, intensity and total number of glochidium were more the descending fish from the biotope pond than the ascending one from the drainage canal, which suggests that the biotope pond is now the base of supply of juveniles to the neighboring areas.

  4. Effects of phylogenetic reconstruction method on the robustness of species delimitation using single-locus data.

    Science.gov (United States)

    Tang, Cuong Q; Humphreys, Aelys M; Fontaneto, Diego; Barraclough, Timothy G; Paradis, Emmanuel

    2014-10-01

    Coalescent-based species delimitation methods combine population genetic and phylogenetic theory to provide an objective means for delineating evolutionarily significant units of diversity. The generalised mixed Yule coalescent (GMYC) and the Poisson tree process (PTP) are methods that use ultrametric (GMYC or PTP) or non-ultrametric (PTP) gene trees as input, intended for use mostly with single-locus data such as DNA barcodes. Here, we assess how robust the GMYC and PTP are to different phylogenetic reconstruction and branch smoothing methods. We reconstruct over 400 ultrametric trees using up to 30 different combinations of phylogenetic and smoothing methods and perform over 2000 separate species delimitation analyses across 16 empirical data sets. We then assess how variable diversity estimates are, in terms of richness and identity, with respect to species delimitation, phylogenetic and smoothing methods. The PTP method generally generates diversity estimates that are more robust to different phylogenetic methods. The GMYC is more sensitive, but provides consistent estimates for BEAST trees. The lower consistency of GMYC estimates is likely a result of differences among gene trees introduced by the smoothing step. Unresolved nodes (real anomalies or methodological artefacts) affect both GMYC and PTP estimates, but have a greater effect on GMYC estimates. Branch smoothing is a difficult step and perhaps an underappreciated source of bias that may be widespread among studies of diversity and diversification. Nevertheless, careful choice of phylogenetic method does produce equivalent PTP and GMYC diversity estimates. We recommend simultaneous use of the PTP model with any model-based gene tree (e.g. RAxML) and GMYC approaches with BEAST trees for obtaining species hypotheses.

  5. Comparison of light out-coupling enhancements in single-layer blue-phosphorescent organic light emitting diodes using small-molecule or polymer hosts

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Yung-Ting [Institute of Chemistry, Academia Sinica, Taipei, Taiwan 11529, Taiwan (China); Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan 10617, Taiwan (China); Liu, Shun-Wei [Department of Electronic Engineering, Mingchi University of Technology, New Taipei, Taiwan 24301, Taiwan (China); Yuan, Chih-Hsien; Lee, Chih-Chien [Department of Electronic Engineering, National Taiwan University of Science and Technology, Taipei, Taiwan 10607, Taiwan (China); Ho, Yu-Hsuan; Wei, Pei-Kuen [Research Center for Applied Science Academia Sinica, Taipei, Taiwan 11527, Taiwan (China); Chen, Kuan-Yu [Chilin Technology Co., LTD, Tainan City, Taiwan 71758, Taiwan (China); Lee, Yi-Ting; Wu, Min-Fei; Chen, Chin-Ti, E-mail: cchen@chem.sinica.edu.tw, E-mail: chihiwu@cc.ee.ntu.edu.tw [Institute of Chemistry, Academia Sinica, Taipei, Taiwan 11529, Taiwan (China); Wu, Chih-I, E-mail: cchen@chem.sinica.edu.tw, E-mail: chihiwu@cc.ee.ntu.edu.tw [Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei, Taiwan 10617, Taiwan (China)

    2013-11-07

    Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less light than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts.

  6. Low Po2 conditions induce reactive oxygen species formation during contractions in single skeletal muscle fibers

    Science.gov (United States)

    Shiah, Amy; Roberts, William J.; Chien, Michael T.; Wagner, Peter D.; Hogan, Michael C.

    2013-01-01

    Contractions in whole skeletal muscle during hypoxia are known to generate reactive oxygen species (ROS); however, identification of real-time ROS formation within isolated single skeletal muscle fibers has been challenging. Consequently, there is no convincing evidence showing increased ROS production in intact contracting fibers under low Po2 conditions. Therefore, we hypothesized that intracellular ROS generation in single contracting skeletal myofibers increases during low Po2 compared with a value approximating normal resting Po2. Dihydrofluorescein was loaded into single frog (Xenopus) fibers, and fluorescence was used to monitor ROS using confocal microscopy. Myofibers were exposed to two maximal tetanic contractile periods (1 contraction/3 s for 2 min, separated by a 60-min rest period), each consisting of one of the following treatments: high Po2 (30 Torr), low Po2 (3–5 Torr), high Po2 with ebselen (antioxidant), or low Po2 with ebselen. Ebselen (10 μM) was administered before the designated contractile period. ROS formation during low Po2 treatment was greater than during high Po2 treatment, and ebselen decreased ROS generation in both low- and high-Po2 conditions (P Po2. Force was reduced >30% for each condition except low Po2 with ebselen, which only decreased ∼15%. We concluded that single myofibers under low Po2 conditions develop accelerated and more oxidative stress than at Po2 = 30 Torr (normal human resting Po2). Ebselen decreases ROS formation in both low and high Po2, but only mitigates skeletal muscle fatigue during reduced Po2 conditions. PMID:23576612

  7. Elevation, space and host plant species structure Ericaceae root-associated fungal communities in Papua New Guinea

    Czech Academy of Sciences Publication Activity Database

    Kohout, Petr; Bahram, M.; Polme, S.; Tedersoo, L.

    2017-01-01

    Roč. 30, Dec 2017 (2017), s. 112-121 ISSN 1754-5048 Institutional support: RVO:67985939 Keywords : ericoid mycorrhiza * fungal diversity * host effect Subject RIV: EH - Ecology , Behaviour OBOR OECD: Ecology Impact factor: 3.219, year: 2016

  8. Host specificity and genealogy of Polyplax serrata on Apodemus species: a case of parasite duplication or colonisation?

    Czech Academy of Sciences Publication Activity Database

    Štefka, Jan; Hypša, Václav

    2008-01-01

    Roč. 38, č. 6 (2008), s. 731-741 ISSN 0020-7519 R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z60220518 Keywords : parasite duplication * host specificity * genealogy * speciation * Polyplax * Apodemus Subject RIV: EH - Ecology, Behaviour Impact factor: 3.752, year: 2008

  9. Expression of human CD81 differently affects host cell susceptibility to malaria sporozoites depending on the Plasmodium species.

    NARCIS (Netherlands)

    Silvie, O.; Greco, C.; Franetich, J.F.; Dubart-Kupperschmitt, A.; Hannoun, L.; Gemert, G.J.A. van; Sauerwein, R.W.; Levy, S.; Boucheix, C.; Rubinstein, E.; Mazier, D.

    2006-01-01

    Plasmodium sporozoites can enter host cells by two distinct pathways, either through disruption of the plasma membrane followed by parasite transmigration through cells, or by formation of a parasitophorous vacuole (PV) where the parasite further differentiates into a replicative exo-erythrocytic

  10. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species.

    NARCIS (Netherlands)

    Sprong, H.; Wielinga, P.R.; Fonville, M.; Reusken, C.; Brandenburg, A.H.; Borgsteede, F.H.M.

    2009-01-01

    Background - Hard ticks have been identified as important vectors of rickettsiae causing the spotted fever syndrome. Tick-borne rickettsiae are considered to be emerging, but only limited data are available about their presence in Western Europe, their natural life cycle and their reservoir hosts.

  11. Series solution for continuous population models for single and interacting species by the homotopy analysis method

    Directory of Open Access Journals (Sweden)

    Magdy A. El-Tawil

    2012-07-01

    Full Text Available The homotopy analysis method (HAM is used to find approximate analytical solutions of continuous population models for single and interacting species. The homotopy analysis method contains the auxiliary parameter $hbar,$ which provides us with a simple way to adjust and control the convergence region of series solution. the solutions are compared with the numerical results obtained using NDSolve, an ordinary differential equation solver found in the Mathematica package and a good agreement is found. Also the solutions are compared with the available analytic results obtained by other methods and more accurate and convergent series solution found. The convergence region is also computed which shows the validity of the HAM solution. This method is reliable and manageable.

  12. Complete Genome sequence of Burkholderia phymatum STM815, a broad host range and efficient nitrogen-fixing symbiont of Mimosa species

    Energy Technology Data Exchange (ETDEWEB)

    Moulin, Lionel [UMR, France; Klonowska, Agnieszka [UMR, France; Caroline, Bournaud [UMR, France; Booth, Kristina [University of Massachusetts; Vriezen, Jan A.C. [University of Massachusetts; Melkonian, Remy [UMR, France; James, Euan [James Hutton Institute, Dundee, United Kingdom; Young, Peter W. [University of York, United Kingdom; Bena, Gilles [UMR, France; Hauser, Loren John [ORNL; Land, Miriam L [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Copeland, A [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Lizotte-Waniewski, Michelle [University of Massachusetts; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Riley, Monica [Woods Hole Oceanographic Institution (WHOI), Woods Hole

    2014-01-01

    Burkholderia phymatum is a soil bacterium able to develop a nitrogen-fixing symbiosis with species of the legume genus Mimosa, and is frequently found associated specifically with Mimosa pudica. The type strain of the species, STM 815T, was isolated from a root nodule in French Guiana in 2000. The strain is an aerobic, motile, non-spore forming, Gram-negative rod, and is a highly competitive strain for nodulation compared to other Mimosa symbionts, as it also nodulates a broad range of other legume genera and species. The 8,676,562 bp genome is composed of two chromosomes (3,479,187 and 2,697,374 bp), a megaplasmid (1,904,893 bp) and a plasmid hosting the symbiotic functions (595,108 bp).

  13. Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775) collected from different cherry tree species in Europe (Hemiptera, Aphididae).

    Science.gov (United States)

    Rakauskas, Rimantas; Havelka, Jekaterina; Zaremba, Audrius; Bernotienė, Rasa

    2014-01-01

    Partial sequences of the mitochondrial COI gene of forty eight European and two Turkish population samples of Myzus cerasi from different winter hosts (Prunus spp.) were subjected to phylogenetic analyses. The analysed M. cerasi samples emerged as paraphyletic relative to a Myzus borealis sample used as an out-group, and formed two major clades in neighbor joining, maximum parsimony, maximum likelihood and Bayesian inference trees, corresponding to subspecies living specifically on Prunus avium and P. cerasus. Multivariate discriminant analysis (method of canonical variates) was applied to find out if morphological variation of samples correlated with mitochondrial COI and host plant information. Mean scores on the first two canonical variables clustered samples fully in accordance with their COI haplotypes and host plants confirming the existence of two morphologically similar winter host - specific subspecies of M. cerasi in Europe. No single morphological character enabled satisfactory discrimination between apterous viviparous females of the two subspecies. A three-character linear discriminant function enabled 92.37% correct identification of apterous viviparous females of M. cerasi cerasi (n = 118) and 93.64% of M. cerasi pruniavium (n = 110). A key for the morphological identification of the two subspecies is presented and their taxonomic status is discussed.

  14. Mitochondrial COI and morphological evidence for host specificity of the black cherry aphids Myzus cerasi (Fabricius, 1775 collected from different cherry tree species in Europe (Hemiptera, Aphididae

    Directory of Open Access Journals (Sweden)

    Rimantas Rakauskas

    2014-03-01

    Full Text Available Partial sequences of the mitochondrial COI gene of forty eight European and two Turkish population samples of Myzus cerasi from different winter hosts (Prunus spp. were subjected to phylogenetic analyses. The analysed M. cerasi samples emerged as paraphyletic relative to a Myzus borealis sample used as an out-group, and formed two major clades in neighbor joining, maximum parsimony, maximum likelihood and Bayesian inference trees, corresponding to subspecies living specifically on Prunus avium and P. cerasus. Multivariate discriminant analysis (method of canonical variates was applied to find out if morphological variation of samples correlated with mitochondrial COI and host plant information. Mean scores on the first two canonical variables clustered samples fully in accordance with their COI haplotypes and host plants confirming the existence of two morphologically similar winter host - specific subspecies of M.cerasi in Europe. No single morphological character enabled satisfactory discrimination between apterous viviparous females of the two subspecies. A three-character linear discriminant function enabled 92.37% correct identification of apterous viviparous females of M. cerasi cerasi (n=118 and 93.64% of M. cerasi pruniavium (n=110. A key for the morphological identification of the two subspecies is presented and their taxonomic status is discussed.

  15. Genome-wide single-nucleotide polymorphism data reveal cryptic species within cryptic freshwater snail species-The case of theAncylus fluviatilisspecies complex.

    Science.gov (United States)

    Weiss, Martina; Weigand, Hannah; Weigand, Alexander M; Leese, Florian

    2018-01-01

    DNA barcoding utilizes short standardized DNA sequences to identify species and is increasingly used in biodiversity assessments. The technique has unveiled an unforeseeably high number of morphologically cryptic species. However, if speciation has occurred relatively recently and rapidly, the use of single gene markers, and especially the exclusive use of mitochondrial markers, will presumably fail in delimitating species. Therefore, the true number of biological species might be even higher. One mechanism that can result in rapid speciation is hybridization of different species in combination with polyploidization, that is, allopolyploid speciation. In this study, we analyzed the population genetic structure of the polyploid freshwater snail Ancylus fluviatilis , for which allopolyploidization was postulated as a speciation mechanism. DNA barcoding has already revealed four cryptic species within A. fluviatilis (i.e., A. fluviatilis s. str., Ancylus sp. A-C), but early allozyme data even hint at the presence of additional cryptic lineages in Central Europe. We combined COI sequencing with high-resolution genome-wide SNP data (ddRAD data) to analyze the genetic structure of A. fluviatilis populations in a Central German low mountain range (Sauerland). The ddRAD data results indicate the presence of three cryptic species within A. fluviatilis s. str. occurring in sympatry and even syntopy, whereas mitochondrial sequence data only support the existence of one species, with shared haplotypes between species. Our study hence points to the limitations of DNA barcoding when dealing with organismal groups where speciation is assumed to have occurred rapidly, for example, through the process of allopolyploidization. We therefore emphasize that single marker DNA barcoding can underestimate the true species diversity and argue in strong favor of using genome-wide data for species delimitation in such groups.

  16. A new species of Australotaenia (Cestoda: Proteocephalidea) from a snake in Cambodia: host switching or postcyclic parasitism in a distant region?

    Science.gov (United States)

    de Chambrier, Alain; Scholz, Tomás

    2012-12-01

    Australotaenia de Chambrier et de Chambrier, 2010 has been proposed to accommodate two species of proteocephalidean cestodes from hylid frogs (Litoria spp.) in Australia. Recently, apparently congeneric cestode, for which the name A. bunthangi sp. n. is proposed, was found in the homalopsid snake Enhydris enhydris (Schneider) (Serpentes: Homalopsidae) from South-East Asia (Cambodia). This finding indicates a much wider range of definitive hosts of species of this genus, i.e. amphibians and reptiles, which is exceptional among proteocephalideans. Postcyclic parasitism, i.e. predation of the definitive host infected with sexually mature parasites, cannot be excluded but does not seem to be probable. In addition, the occurrence of A. bunthangi in the former Indochina extends the range of the geographical distribution of the genus to another zoogeographical region. The new species differs from both species of Australotaenia in the relative size of an apical organ, the diameter of which equals to that of suckers (versus much smaller in the remaining species, in which the width of the apical organ represents less than 2/3 of the diameter of the suckers), much smaller scolex and suckers (width 150 microm and diameter of suckers 50-55 microm versus 245-420 microm and 100-140 microm, respectively), and longer body (224 mm versus 57-121 mm). In addition, A. bunthangi differs from A. hylae (Johnston, 1912) (type-species of the genus) by the number of testes (46-64 versus 74-106 in A. hylae) and by the ovary width/proglottis width ratio (55-65% versus 68-71% in A. hylae). Australotaenia bunthangi differs from A. grobeli de Chambrier et de Chambrier, 2010 by relative size of the cirrus-sac (its length represents 18-24% of the width of the proglottis versus 27-33% in A. grobeli) and by the diameter of the embryophore (25-27 microm versus 18-23 microm in A. grobeli).

  17. Separation of rhodium(III and iridium(IV chlorido species by quaternary diammonium centres hosted on silica microparticles

    Directory of Open Access Journals (Sweden)

    A. Majavu

    2017-12-01

    Full Text Available Silica gel was functionalized with six different quaternary diammonium centres derived from ethylenediamine (EDA, tetramethylenediamine (TMDA, hexamethylenediamine (HMDA, 1,8-diaminooctane (OMDA, 1,10-diaminodecane (DMDA and 1,12-diaminododecane (DDMDA to produce Si-QUAT EDA, Si-QUAT TMDA, Si-QUAT HMDA, Si-QUAT OMDA, Si-QUAT DMDA and Si-QUAT DDMDA, respectively. The synthesized silica-based resins were characterized by means of FTIR, XPS, SEM, BET surface area, thermogravimetric analysis and elemental analysis. The materials were used to investigate the adsorption and separation of [RhCl5(H2O]2− and [IrCl6]2−. Batch studies (equilibrium and kinetic studies were conducted to study the adsorption of [RhCl5(H2O]2− and [IrCl6]2− onto Si-QUAT EDA, Si-QUAT TMDA, Si-QUAT HMDA, Si-QUAT OMDA, Si-QUAT DMDA and Si-QUAT DDMDA using single metal aqueous solutions. The Freundlich isotherm confirmed multilayer adsorption and the Freundlich constant (kf displayed the following ascending order; Si-QUAT EDA, Si-QUAT TMDA, Si-QUAT HMDA, Si-QUAT OMDA and Si-QUAT DMDA, and a decrease in kf for Si-QUAT DDMDA. Kinetic studies suggest a pseudo-first order kinetic model. Column studies were also conducted for a binary mixture of these metal ion chlorido species ([RhCl5(H2O]2− and [IrCl6]2−. The iridium loading capacities increased as the carbon spacer between the diammonium centres increased in the following order; Si-QUAT EDA, Si-QUAT TMDA, Si-QUAT HMDA, Si-QUAT OMDA and Si-QUAT DMDA (4.56 mg/g, 6.88 mg/g, 14.63 mg/g, 19.01 mg/g and 29.35 mg/g, respectively. It was observed that the iridium loading capacity of Si-QUAT DDMDA decreased to 8.90 mg/g. This paper presents iridium-specific materials that could be applied in solutions of secondary PGMs sources containing rhodium and iridium as well as in feed solutions from ore processing. Keywords: Silica gel, Quaternary diammonium centres, Rhodium, Iridium, Separation

  18. Bat lung epithelial cells show greater host species-specific innate resistance than MDCK cells to human and avian influenza viruses.

    Science.gov (United States)

    Slater, Tessa; Eckerle, Isabella; Chang, Kin-Chow

    2018-04-10

    With the recent discovery of novel H17N10 and H18N11 influenza viral RNA in bats and report on high frequency of avian H9 seroconversion in a species of free ranging bats, an important issue to address is the extent bats are susceptible to conventional avian and human influenza A viruses. To this end, three bat species (Eidolon helvum, Carollia perspicillata and Tadarida brasiliensis) of lung epithelial cells were separately infected with two avian and two human influenza viruses to determine their relative host innate immune resistance to infection. All three species of bat cells were more resistant than positive control Madin-Darby canine kidney (MDCK) cells to all four influenza viruses. TB1-Lu cells lacked sialic acid α2,6-Gal receptors and were most resistant among the three bat species. Interestingly, avian viruses were relatively more replication permissive in all three bat species of cells than with the use of human viruses which suggest that bats could potentially play a role in the ecology of avian influenza viruses. Chemical inhibition of the JAK-STAT pathway in bat cells had no effect on virus production suggesting that type I interferon signalling is not a major factor in resisting influenza virus infection. Although all three species of bat cells are relatively more resistant to influenza virus infection than control MDCK cells, they are more permissive to avian than human viruses which suggest that bats could have a contributory role in the ecology of avian influenza viruses.

  19. Multi-species call-broadcast improved detection of endangered Yuma clapper rail compared to single-species call-broadcast

    Science.gov (United States)

    Nadeau, Christopher P.; Conway, Courtney J.; Piest, Linden; Burger, William P.

    2013-01-01

    Broadcasting calls of marsh birds during point-count surveys increases their detection probability and decreases variation in the number of birds detected across replicate surveys. However, multi-species monitoring using call-broadcast may reduce these benefits if birds are reluctant to call once they hear broadcasted calls of other species. We compared a protocol that uses call-broadcast for only one species (Yuma clapper rail [Rallus longirostris yumanensis]) to a protocol that uses call-broadcast for multiple species. We detected more of each of the following species using the multi-species protocol: 25 % more pied-billed grebes, 160 % more American bitterns, 52 % more least bitterns, 388 % more California black rails, 12 % more Yuma clapper rails, 156 % more Virginia rails, 214 % more soras, and 19 % more common gallinules. Moreover, the coefficient of variation was smaller when using the multi-species protocol: 10 % smaller for pied-billed grebes, 38 % smaller for American bitterns, 19 % smaller for least bitterns, 55 % smaller for California black rails, 5 % smaller for Yuma clapper rails, 38 % smaller for Virginia rails, 44 % smaller for soras, and 8 % smaller for common gallinules. Our results suggest that multi-species monitoring approaches may be more effective and more efficient than single-species approaches even when using call-broadcast.

  20. Potato virus X TGBp1 induces plasmodesmata gating and moves between cells in several host species whereas CP moves only in N. benthamiana leaves

    International Nuclear Information System (INIS)

    Howard, Amanda R.; Heppler, Marty L.; Ju, Ho-Jong; Krishnamurthy, Konduru; Payton, Mark E.; Verchot-Lubicz, Jeanmarie

    2004-01-01

    Experiments were conducted to compare the plasmodesmal transport activities of Potato virus X (PVX) TGBp1 and coat protein (CP) in several plant species. Microinjection experiments indicated that TGBp1 gates plasmodesmata in Nicotiana tabacum leaves. These results support previous microinjection studies indicating that TGBp1 gates plasmodesmata in Nicotiana benthamiana and Nicotiana clevelandii leaves. To study protein movement, plasmids expressing the green fluorescent protein (GFP) gene fused to the PVX TGBp1 or CP genes were biolistically bombarded to leaves taken from four different PVX host species. GFP/TGBp1 moved between adjacent cells in N. tabacum, N. clevelandii, N. benthamiana, and Lycopersicon esculentum, whereas GFP/CP moved only in N. benthamiana leaves. Mutations m12 and m13 were introduced into the TGBp1 gene and both mutations eliminated TGBp1 ATPase active site motifs, inhibited PVX movement, reduced GFP/TGBp1 cell-to-cell movement in N. benthamiana leaves, and eliminated GFP/TGBp1 movement in N. tabacum, N. clevelandii, and L. esculentum leaves. GFP/TGBp1m13 formed aggregates in tobacco cells. The ability of GFP/CP and mutant GFP/TGBp1 fusion proteins to move in N. benthamiana and not in the other PVX host species suggests that N. benthamiana plants have a unique ability to promote protein intercellular movement

  1. A new multiplex PCR assay to distinguish among three cryptic Galba species, intermediate hosts of Fasciola hepatica.

    Science.gov (United States)

    Alda, Pilar; Lounnas, Manon; Vázquez, Antonio Alejandro; Ayaqui, Rolando; Calvopiña, Manuel; Celi-Erazo, Maritza; Dillon, Robert T; Jarne, Philippe; Loker, Eric S; Muñiz Pareja, Flavia Caroll; Muzzio-Aroca, Jenny; Nárvaez, Alberto Orlando; Noya, Oscar; Robles, Luiggi Martini; Rodríguez-Hidalgo, Richar; Uribe, Nelson; David, Patrice; Pointier, Jean-Pierre; Hurtrez-Boussès, Sylvie

    2018-02-15

    A molecular tool described here allows in one step for specific discrimination among three cryptic freshwater snail species (genus Galba) involved in fasciolosis transmission, a worldwide infectious disease of humans and livestock. The multiplex PCR approach taken targets for each species a distinctive, known microsatellite locus which is amplified using specific primers designed to generate an amplicon of a distinctive size that can be readily separated from the amplicons of the other two species on an agarose gel. In this way, the three Galba species (G. cubensis, G. schirazensis, and G. truncatula) can be differentiated from one another, including even if DNA from all three were present in the same reaction. The accuracy of this new molecular tool was tested and validated by comparing multiplex PCR results with species identification based on sequences at mitochondrial and nuclear markers. This new method is accurate, inexpensive, simple, rapid, and can be adapted to handle large sample sizes. It will be helpful for monitoring invasion of Galba species and for developing strategies to limit the snail species involved in the emergence or re-emergence of fasciolosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Growth response of drought-stressed Pinus sylvestris seedlings to single- and multi-species inoculation with ectomycorrhizal fungi.

    Directory of Open Access Journals (Sweden)

    Tabea Kipfer

    Full Text Available Many trees species form symbiotic associations with ectomycorrhizal (ECM fungi, which improve nutrient and water acquisition of their host. Until now it is unclear whether the species richness of ECM fungi is beneficial for tree seedling performance, be it during moist conditions or drought. We performed a pot experiment using Pinus sylvestris seedlings inoculated with four selected ECM fungi (Cenococcum geophilum, Paxillus involutus, Rhizopogon roseolus and Suillus granulatus to investigate (i whether these four ECM fungi, in monoculture or in species mixtures, affect growth of P. sylvestris seedlings, and (ii whether this effect can be attributed to species number per se or to species identity. Two different watering regimes (moist vs. dry were applied to examine the context-dependency of the results. Additionally, we assessed the activity of eight extracellular enzymes in the root tips. Shoot growth was enhanced in the presence of S. granulatus, but not by any other ECM fungal species. The positive effect of S. granulatus on shoot growth was more pronounced under moist (threefold increase than under dry conditions (twofold increase, indicating that the investigated ECM fungi did not provide additional support during drought stress. The activity of secreted extracellular enzymes was higher in S. granulatus than in any other species. In conclusion, our findings suggest that ECM fungal species composition may affect seedling performance in terms of aboveground biomass.

  3. Synthetical Analysis for Morphology, biological Species, and stable Isotopes (SAMSI) of single-cell planktonic foraminifer

    Science.gov (United States)

    Ujiie, Y.; Kimoto, K.; Ishimura, T.

    2017-12-01

    Planktonic foraminifers are widely used in the studies of paleontology and paleoceanography, because the morphology of their calcareous shells is enough highly variable to identify the morphospecies and the chemical composition of the shells reflect ambient seawater condition. Although the morphospecies were believed to represent environments associating with latitudinal temperature range of the world ocean, molecular phylogeographic studies have unveiled the presence of multiple biological species in a single morphospecies and their species-specific distributions. This implicates the actual complexity of planktonic foraminiferal ecology. Conversely, these biological species have a high potential for providing novel ecological and environmental information to us. In order to reassess the morphological and geochemical characters of biological species, the DNA extraction method with the guanidium isothiocyanate buffer was developed to preserve the calcareous shells. The present study carefully tested the physical and chemical damages of the DNA extraction process to the shells, by our novel approaches with geochemical analysis of the shells after non-destructive analysis for morphometrics on a same specimen. First, we checked the changes of the shell densities between pre- and post-DNA extraction by using the micro-focus X-ray CT (MXCT) scanning. Based on the simultaneous measurement of a sample and the standard material, we confirmed no significant changes to the shell densities through the DNA extraction process. As a next step, we compared stable oxygen and carbon isotopes among individuals of three sample sets: (1) no chemical and incubation as control, (2) incubation in the DNA extraction buffer at 65-70°C for 40 minutes as standard way, and (3) incubation in the DNA extraction buffer at 65-70°C for 120 minutes, by using the microscale isotopic analytical system (MICAL3c). Consequently, there were no significant differences among the three sample sets. These

  4. Geographical variation in host-ant specificity of the parasitic butterfly Maculinea alcon in Denmark

    DEFF Research Database (Denmark)

    Als, Thomas Damm; Nash, David Richard; Boomsma, J. J.

    2002-01-01

    1. Maculinea alcon uses three different species of Myrmica host ants along a north-south gradient in Europe. Based on this geographical variation in host ant use, Elmes et al. (1994) suggested that M. alcon might consist of three or more cryptic species or host races, each using a single and diff......1. Maculinea alcon uses three different species of Myrmica host ants along a north-south gradient in Europe. Based on this geographical variation in host ant use, Elmes et al. (1994) suggested that M. alcon might consist of three or more cryptic species or host races, each using a single...... and different host-ant species.2. Population-specific differences in allozyme genotypes of M. alcon in Denmark (Gadeberg Boomsma, 1997) have suggested that genetically differentiated forms may occur in a gradient across Denmark, possibly in relation to the use of different host ants.3. It was found that two....... The geographical mosaic of host specificity and demography of M. alcon in Denmark probably reflects the co-evolution of M. alcon with two alternative host species. This system therefore provides an interesting opportunity for studying details of the evolution of parasite specificity and the dynamics of host-race...

  5. New species of leaf-mining Nepticulidae (Lepidoptera) from the Neotropical and Ando-Patagonian regions, with new data on host plants.

    Science.gov (United States)

    Stonis, Jonas R; Remeikis, Andrius; Diškus, Arūnas; Megoran, Nick

    2017-05-26

    The paper treats fifteen species of leaf-mining pygmy moths (Insecta, Lepidoptera, Nepticulidae) discovered in the Neotropics (British Virgin Islands, Belize, Costa Rica, Venezuela, and Ecuador), and Ando-Patagonian region (Argentina and Chile). Except for two species, all belong to Stigmella Schrank. Twelve species are new, and are named and described in the current paper: Stigmella apicibrunella Diškus & Stonis, sp. nov.; S. decora Diškus & Stonis, sp. nov.; S. unicaudata Remeikis & Stonis, sp. nov.; S. sanmartini Remeikis & Stonis, sp. nov.; S. patula Remeikis & Stonis, sp. nov.; S. torosa Remeikis & Stonis, sp. nov.; S. monstrata Remeikis & Stonis, sp. nov.; S. huahumi Remeikis & Stonis, sp. nov.; S. venezuelica Remeikis & Stonis, sp. nov.; S. virginica Remeikis & Stonis, sp. nov.; Fomoria miranda Diškus & Stonis, sp. nov.; and Hesperolyra robinsoni Stonis, sp. n. Newly discovered variation of male genitalia of the Andean Stigmella rudis Puplesis & Robinson, 2000 is briefly discussed, and the formerly poorly understood Stigmella hylomaga (Meyrick, 1931) is redescribed and documented with photographs for the first time. We also present more photographs and add some addtional information on Stigmella gallicola van Nieukerken & Nishida, a recently described gall-maker from Costa Rica.The paper also provides new host-plant data: some of the described (or redescribed) species are reported for the first time as leaf-miners on plants belonging to Euphorbiaceae (Acalypha padifolia Kunth), Salicaceae (Azara microphylla Hook. f.), Fabaceae (Inga spectabilis (Vahl) Willd. or I. edulis Mart.), Rhamnaceae (Colletia spinosissima J. F. Gmel.), Geraniaceae or Vivianiaceae (Rhynchotheca spinosa Ruiz & Pav.), and Asteraceae (Mutisia decurrens Cav.). All species treated in the paper are illustrated with photographs of the adults and genitalia, a distribution map, and also photographs of the leaf-mines and host plants when available.

  6. Phylogeography of two parthenogenetic sawfly species (Hymenoptera: Tenthredinidae): relationship of population genetic differentiation to host plant distribution

    NARCIS (Netherlands)

    Müller, C.; Barker, A.; Boevé, J.L.; Jong, de P.W.; Vos, de H.; Brakefield, P.M.

    2004-01-01

    This study compares the population genetic structure of two obligate parthenogenetic sawfly species, Aneugmenus padi (L.) Zhelochovtsev and Eurhadinoceraea ventralis (Panzer) Enslin (Hymenoptera: Tenthredinidae). Allozymes were used to detect genetic differences in larvae collected at different

  7. HOST PLANTS AND CLIMATIC PREFERENCES OF THE INVASIVE SPECIES METCALFA PRUINOSA (SAY 1830 (HEMIPTERA: FLATIDAE IN SOME PLACES FROM SOUTHERN ROMANIA

    Directory of Open Access Journals (Sweden)

    Daniela Barbuceanu

    2015-12-01

    Full Text Available Observations carried out in May-September 2015 in two sites of Southern Romania reveal a rich spectrum of host plants for Metcalfa pruinosa, which consists of 204 species in 56 families. The species it is noticed on weeds and cultivated plants. The remarkable polyphagia of this species, the lack of natural enemies, and the climatic conditions of 2015 - warm and dry summer, had lead to an invasion of M. pruinosa, in the researched areas; the highest numerical abundances are noticed in shady habitats. Furthermore, on herbs, such as Levisticum officinale, Artemisia dracunculus, Ocimum basilicum, Mentha spp., usually avoided by pests, were observed colonies of the species. It is recorded high numerical abundance on fruit trees and shrubs: Hippophaë rhamnoides, Juglans regia, Prunus cerasus, Vitis vinifera, Rubus idaeus. The harmful effect occurs on apple trees Romus 1 variety as a result of the association with another pest of American origin, Eriosoma lanigerum, situation that favors the attack of the Erwinia amylovora bacteria, causing the collapse of the tree. It is found that altitudes higher than 200 m do not represent a limitative factor in the spreading of species, one of the investigated sites being located at 304 m altitude.

  8. A key to American genus Merobruchus Bridwell (Coleoptera: Chrysomelidae: Bruchinae) with descriptions of species and two new host plant records for the subfamily.

    Science.gov (United States)

    Manfio, Daiara; Ribeiro-Costa, Cibele Stramare

    2016-02-09

    Merobruchus Bridwell is placed in the group Merobruchus of Acanthoscelidina (Bruchini) being distinguished from all bruchines mainly by the apical projections in the last abdominal ventrite of females and some males. All 25 species of Merobruchus are distributed in the New World, mainly in the Neotropical Region, feeding on seeds of Mimosoideae (Acacieae, Ingeae and Mimoseae). As well as some other bruchine genera, Merobruchus shows considerable morphological variation both in external and in internal (male genitalia) characters. Moreover, some species are very similar to each other in their colour and distribution pattern of pubescence on the dorsal surface, sometimes making species recognition difficult. Thus, the main objective of this paper is to provide a key including coloured illustrations for Merobruchus species to facilitate the process of identification and to avoid misunderstandings. Images of dorsal habitus, male and female pygidium and male genitalia are provided for all species. In addition, M. machadoi sp. nov. (Holotype male deposited in DZUP: Brazil, Rio Grande do Sul State) is described; M. bicoloripes (Pic) and M. pickeli (Pic) are redescribed; and a new synonymy is proposed: Pseudopachymerus pickeli Pic, 1927 = Pseudopachymerus pickeli var. subnotatus Pic, 1927 syn. nov. Two new host plants are recorded for Bruchinae: Parapiptadenia rigida (Benth.) Brenan (Mimosoideae) and Pterogyne nitens Tul. (Caesalpinioideae).

  9. Smart SERS Hot Spots: Single Molecules Can Be Positioned in a Plasmonic Nanojunction Using Host-Guest Chemistry.

    Science.gov (United States)

    Kim, Nam Hoon; Hwang, Wooseup; Baek, Kangkyun; Rohman, Md Rumum; Kim, Jeehong; Kim, Hyun Woo; Mun, Jungho; Lee, So Young; Yun, Gyeongwon; Murray, James; Ha, Ji Won; Rho, Junsuk; Moskovits, Martin; Kim, Kimoon

    2018-03-01

    Single-molecule surface-enhanced Raman spectroscopy (SERS) offers new opportunities for exploring the complex chemical and biological processes that cannot be easily probed using ensemble techniques. However, the ability to place the single molecule of interest reliably within a hot spot, to enable its analysis at the single-molecule level, remains challenging. Here we describe a novel strategy for locating and securing a single target analyte in a SERS hot spot at a plasmonic nanojunction. The "smart" hot spot was generated by employing a thiol-functionalized cucurbit[6]uril (CB[6]) as a molecular spacer linking a silver nanoparticle to a metal substrate. This approach also permits one to study molecules chemically reluctant to enter the hot spot, by conjugating them to a moiety, such as spermine, that has a high affinity for CB[6]. The hot spot can accommodate at most a few, and often only a single, analyte molecule. Bianalyte experiments revealed that one can reproducibly treat the SERS substrate such that 96% of the hot spots contain a single analyte molecule. Furthermore, by utilizing a series of molecules each consisting of spermine bound to perylene bisimide, a bright SERS molecule, with polymethylene linkers of varying lengths, the SERS intensity as a function of distance from the center of the hot spot could be measured. The SERS enhancement was found to decrease as 1 over the square of the distance from the center of the hot spot, and the single-molecule SERS cross sections were found to increase with AgNP diameter.

  10. The structure and dynamics of complex microbe-host interaction networks

    OpenAIRE

    Björk, Johannes

    2016-01-01

    Microbes form intricate and intimate relationships with most animals and plants, many of which are crucial for host development, health and functioning. Microbe--host symbiotic associations are poorly explored in comparison with other species interaction networks. The current paradigm on symbiosis research stems from species-poor systems where pairwise and reciprocally specialised interactions between a single microbe and host that coevolve are the norm. These symbioses involving just a few s...

  11. Native bacterial endophytes promote host growth in a species-specific manner; phytohormone manipulations do not result in common growth responses.

    Directory of Open Access Journals (Sweden)

    Hoang Hoa Long

    Full Text Available BACKGROUND: All plants in nature harbor a diverse community of endophytic bacteria which can positively affect host plant growth. Changes in plant growth frequently reflect alterations in phytohormone homoeostasis by plant-growth-promoting (PGP rhizobacteria which can decrease ethylene (ET levels enzymatically by 1-aminocyclopropane-1-carboxylate (ACC deaminase or produce indole acetic acid (IAA. Whether these common PGP mechanisms work similarly for different plant species has not been rigorously tested. METHODOLOGY/PRINCIPAL FINDINGS: We isolated bacterial endophytes from field-grown Solanum nigrum; characterized PGP traits (ACC deaminase activity, IAA production, phosphate solubilization and seedling colonization; and determined their effects on their host, S. nigrum, as well as on another Solanaceous native plant, Nicotiana attenuata. In S. nigrum, a majority of isolates that promoted root growth were associated with ACC deaminase activity and IAA production. However, in N. attenuata, IAA but not ACC deaminase activity was associated with root growth. Inoculating N. attenuata and S. nigrum with known PGP bacteria from a culture collection (DSMZ reinforced the conclusion that the PGP effects are not highly conserved. CONCLUSIONS/SIGNIFICANCE: We conclude that natural endophytic bacteria with PGP traits do not have general and predictable effects on the growth and fitness of all host plants, although the underlying mechanisms are conserved.

  12. Brief communication: Is variation in the cranial capacity of the Dmanisi sample too high to be from a single species?

    Science.gov (United States)

    Lee, Sang-Hee

    2005-07-01

    This study uses data resampling to test the null hypothesis that the degree of variation in the cranial capacity of the Dmanisi hominid sample is within the range variation of a single species. The statistical significance of the variation in the Dmanisi sample is examined using simulated distributions based on comparative samples of modern humans, chimpanzees, and gorillas. Results show that it is unlikely to find the maximum difference observed in the Dmanisi sample in distributions of female-female pairs from comparative single-species samples. Given that two sexes are represented, the difference in the Dmanisi sample is not enough to reject the null hypothesis of a single species. Results of this study suggest no compelling reason to invoke multiple taxa to explain variation in the cranial capacity of the Dmanisi hominids. (c) 2004 Wiley-Liss, Inc

  13. Environmentally transmitted parasites: Host-jumping in a heterogeneous environment.

    Science.gov (United States)

    Caraco, Thomas; Cizauskas, Carrie A; Wang, Ing-Nang

    2016-05-21

    Groups of chronically infected reservoir-hosts contaminate resource patches by shedding a parasite׳s free-living stage. Novel-host groups visit the same patches, where they are exposed to infection. We treat arrival at patches, levels of parasite deposition, and infection of the novel host as stochastic processes, and derive the expected time elapsing until a host-jump (initial infection of a novel host) occurs. At stationarity, mean parasite densities are independent of reservoir-host group size. But within-patch parasite-density variances increase with reservoir group size. The probability of infecting a novel host declines with parasite-density variance; consequently larger reservoir groups extend the mean waiting time for host-jumping. Larger novel-host groups increase the probability of a host-jump during any single patch visit, but also reduce the total number of visits per unit time. Interaction of these effects implies that the waiting time for the first infection increases with the novel-host group size. If the reservoir-host uses resource patches in any non-uniform manner, reduced spatial overlap between host species increases the waiting time for host-jumping. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Additions to the Encyrtidae and Mymaridae (Chalcidoidea of India with new distribution and host records for some species

    Directory of Open Access Journals (Sweden)

    A. Rameshkumar

    2015-06-01

    Results and conclusions. A total of 961 specimens were collected, from which 883 COI sequences were obtained. The sequences generated corresponded to 289 barcoding species and 30 identified genera. The most speciose genera were Heterospilus Haliday (170 spp., Ecphylus Förster (19 spp., Allorhogas Gahan (15 spp. and Callihormius Ashmead (14 spp.. Addition of previously collected material increased the diversity of the subfamily in the region to 34 genera and 290 species. Paraphyly of Heterospilus with respect to Neoheterospilus and Heterospathius was again recovered. Twenty new species and two new genera (Sabinita Belokobylskij, Zaldívar-Riverón et Martínez, Ficobolus Martínez, Belokobylskij et Zaldívar-Riverón have been described so far from the material collected in this work.

  15. Comparative Evaluation of DNA Extraction Methods from Feces of Multiple Host Species for Downstream Next-Generation Sequencing.

    Science.gov (United States)

    Hart, Marcia L; Meyer, Alexandra; Johnson, Philip J; Ericsson, Aaron C

    2015-01-01

    The gastrointestinal tract contains a vast community of microbes that to this day remain largely unculturable, making studies in this area challenging. With the newly affordable advanced sequencing technology, important breakthroughs in this exciting field are now possible. However, standardized methods of sample collection, handling, and DNA extraction have yet to be determined. To help address this, we investigated the use of 5 common DNA extraction methods on fecal samples from 5 different species. Our data show that the method of DNA extraction impacts DNA concentration and purity, successful NGS amplification, and influences microbial communities seen in NGS output dependent on the species of fecal sample and the DNA extraction method used. These data highlight the importance of careful consideration of DNA extraction method used when designing and interpreting data from cross species studies.

  16. Comparative Evaluation of DNA Extraction Methods from Feces of Multiple Host Species for Downstream Next-Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Marcia L Hart

    Full Text Available The gastrointestinal tract contains a vast community of microbes that to this day remain largely unculturable, making studies in this area challenging. With the newly affordable advanced sequencing technology, important breakthroughs in this exciting field are now possible. However, standardized methods of sample collection, handling, and DNA extraction have yet to be determined. To help address this, we investigated the use of 5 common DNA extraction methods on fecal samples from 5 different species. Our data show that the method of DNA extraction impacts DNA concentration and purity, successful NGS amplification, and influences microbial communities seen in NGS output dependent on the species of fecal sample and the DNA extraction method used. These data highlight the importance of careful consideration of DNA extraction method used when designing and interpreting data from cross species studies.

  17. Pleistocene sea level fluctuation and host plant habitat requirement influenced the historical phylogeography of the invasive species Amphiareus obscuriceps (Hemiptera: Anthocoridae) in its native range.

    Science.gov (United States)

    Zhang, Danli; Ye, Zhen; Yamada, Kazutaka; Zhen, Yahui; Zheng, Chenguang; Bu, Wenjun

    2016-08-31

    On account of repeated exposure and submergence of the East China Sea (ECS) land bridge, sea level fluctuation played an important role in shaping the population structure of many temperate species across the ECS during the glacial period. The flower bug Amphiareus obscuriceps (Poppius, 1909) (Hemiptera: Anthocoridae) is an invasive species native to the Sino-Japanese Region (SJR) of East Asia. We tested the hypothesis of the ECS land bridge acting as a dispersal corridor or filter for A. obscuriceps during the glacial period. Specifically, we tested whether and the extent to which dispersal ability and host plant habitat requirement influenced the genetic structure of A. obscuriceps during the exposure of the ECS land bridge. Phylogenetic and network analyses indicated that A. obscuriceps is composed of two major lineages, i.e., China and Japan. Divergence time on both sides of the ECS was estimated to be approximately 1.07 (0.79-1.32) Ma, which was about the same period that the sea level increased. No significant Isolation by Distance (IBD) relationship was found between Фst and Euclidean distances in the Mantel tests, which is consistent with the hypothesis that this species has a good dispersal ability. Our Last Glacial Maximum (LGM) niche modeling of plants that constitute preferred habitats for A. obscuriceps exhibited a similar habitat gap on the exposed ECS continental shelf between China and Japan, but showed a continuous distribution across the Taiwan Strait. Our results suggest that ecological properties (habitat requirement and dispersal ability), together with sea level fluctuation during the Pleistocene across the ECS, have shaped the genetic structure and demographic history of A. obscuriceps in its native area. The host plant habitat requirement could also be a key to the colonization of the A. obscuriceps species during the exposure of the ECS land bridge. Our findings will shed light on the potential role of habitat requirement in the process of

  18. Soil Type Has a Stronger Role than Dipterocarp Host Species in Shaping the Ectomycorrhizal Fungal Community in a Bornean Lowland Tropical Rain Forest

    Directory of Open Access Journals (Sweden)

    Adam L. Essene

    2017-10-01

    Full Text Available The role that mycorrhizal fungal associations play in the assembly of long-lived tree communities is poorly understood, especially in tropical forests, which have the highest tree diversity of any ecosystem. The lowland tropical rain forests of Southeast Asia are characterized by high levels of species richness within the family Dipterocarpaceae, the entirety of which has been shown to form obligate ectomycorrhizal (ECM fungal associations. Differences in ECM assembly between co-occurring species of dipterocarp have been suggested, but never tested in adult trees, as a mechanism for maintaining the coexistence of closely related tree species in this family. Testing this hypothesis has proven difficult because the assembly of both dipterocarps and their ECM associates co-varies with the same edaphic variables. In this study, we used high-throughput DNA sequencing of soils and Sanger sequencing of root tips to evaluate how ECM fungi were structured within and across a clay–sand soil nutrient ecotone in a mixed-dipterocarp rain forest in Malaysian Borneo. We compared assembly patterns of ECM fungi in bulk soil to ECM root tips collected from three ecologically distinct species of dipterocarp. This design allowed us to test whether ECM fungi are more strongly structured by soil type or host specificity. As with previous studies of ECM fungi on this plot, we observed that clay vs. sand soil type strongly structured both the bulk soil and root tip ECM fungal communities. However, we also observed significantly different ECM communities associated with two of the three dipterocarp species evaluated on this plot. These results suggest that ECM fungal assembly on these species is shaped by a combination of biotic and abiotic factors, and that the soil edaphic niche occupied by different dipterocarp species may be mediated by distinct ECM fungal assemblages.

  19. Soil Type Has a Stronger Role than Dipterocarp Host Species in Shaping the Ectomycorrhizal Fungal Community in a Bornean Lowland Tropical Rain Forest.

    Science.gov (United States)

    Essene, Adam L; Shek, Katherine L; Lewis, J D; Peay, Kabir G; McGuire, Krista L

    2017-01-01

    The role that mycorrhizal fungal associations play in the assembly of long-lived tree communities is poorly understood, especially in tropical forests, which have the highest tree diversity of any ecosystem. The lowland tropical rain forests of Southeast Asia are characterized by high levels of species richness within the family Dipterocarpaceae, the entirety of which has been shown to form obligate ectomycorrhizal (ECM) fungal associations. Differences in ECM assembly between co-occurring species of dipterocarp have been suggested, but never tested in adult trees, as a mechanism for maintaining the coexistence of closely related tree species in this family. Testing this hypothesis has proven difficult because the assembly of both dipterocarps and their ECM associates co-varies with the same edaphic variables. In this study, we used high-throughput DNA sequencing of soils and Sanger sequencing of root tips to evaluate how ECM fungi were structured within and across a clay-sand soil nutrient ecotone in a mixed-dipterocarp rain forest in Malaysian Borneo. We compared assembly patterns of ECM fungi in bulk soil to ECM root tips collected from three ecologically distinct species of dipterocarp. This design allowed us to test whether ECM fungi are more strongly structured by soil type or host specificity. As with previous studies of ECM fungi on this plot, we observed that clay vs. sand soil type strongly structured both the bulk soil and root tip ECM fungal communities. However, we also observed significantly different ECM communities associated with two of the three dipterocarp species evaluated on this plot. These results suggest that ECM fungal assembly on these species is shaped by a combination of biotic and abiotic factors, and that the soil edaphic niche occupied by different dipterocarp species may be mediated by distinct ECM fungal assemblages.

  20. Can we predict performance and spatial structure of two-species mixtures using only single species information from monocultures?

    Czech Academy of Sciences Publication Activity Database

    Yu, F.-H.; Herben, Tomáš; Wildová, Radka; Hershock, C.; Goldberg, D. E.

    2012-01-01

    Roč. 234, Sp. iss. (2012), s. 31-37 ISSN 0304-3800 R&D Projects: GA ČR GA206/09/1471 Institutional research plan: CEZ:AV0Z60050516 Institutional support: RVO:67985939 Keywords : model * mixture * species Subject RIV: EF - Botanics Impact factor: 2.069, year: 2012

  1. Reconciling single-species TACs in the North Sea demersal fisheries using the Fcube mixed-fisheries advice framework

    DEFF Research Database (Denmark)

    Ulrich, Clara; Reeves, Stuart A.; Vermard, Youen

    2011-01-01

    be exhausted before the TAC of another, leading to catches of valuable fish that cannot be landed legally. This important issue is, however, usually not quantified and not accounted for in traditional management advice. A simple approach using traditional catch and effort information was developed, estimating...... in the North Sea and shaped into the advice framework. The substantial overquota catches of North Sea cod likely under the current fisheries regimes are quantified, and it is estimated that the single-species management targets for North Sea cod cannot be achieved unless substantial reductions in TACs of all......Single-species management is a cause of discarding in mixed fisheries, because individual management objectives may not be consistent with each other and the species are caught simultaneously in relatively unselective fishing operations. As such, the total allowable catch (TAC) of one species may...

  2. Potential parasite transmission in multi-host networks based on parasite sharing.

    Directory of Open Access Journals (Sweden)

    Shai Pilosof

    Full Text Available Epidemiological networks are commonly used to explore dynamics of parasite transmission among individuals in a population of a given host species. However, many parasites infect multiple host species, and thus multi-host networks may offer a better framework for investigating parasite dynamics. We investigated the factors that influence parasite sharing--and thus potential transmission pathways--among rodent hosts in Southeast Asia. We focused on differences between networks of a single host species and networks that involve multiple host species. In host-parasite networks, modularity (the extent to which the network is divided into subgroups of rodents that interact with similar parasites was higher in the multi-species than in the single-species networks. This suggests that phylogeny affects patterns of parasite sharing, which was confirmed in analyses showing that it predicted affiliation of individuals to modules. We then constructed "potential transmission networks" based on the host-parasite networks, in which edges depict the similarity between a pair of individuals in the parasites they share. The centrality of individuals in these networks differed between multi- and single-species networks, with species identity and individual characteristics influencing their position in the networks. Simulations further revealed that parasite dynamics differed between multi- and single-species networks. We conclude that multi-host networks based on parasite sharing can provide new insights into the potential for transmission among hosts in an ecological community. In addition, the factors that determine the nature of parasite sharing (i.e. structure of the host-parasite network may impact transmission patterns.

  3. Identification of two-step chemical mechanisms using small temperature oscillations and a single tagged species.

    Science.gov (United States)

    Closa, F; Gosse, C; Jullien, L; Lemarchand, A

    2015-05-07

    In order to identify two-step chemical mechanisms, we propose a method based on a small temperature modulation and on the analysis of the concentration oscillations of a single tagged species involved in the first step. The thermokinetic parameters of the first reaction step are first determined. Then, we build test functions that are constant only if the chemical system actually possesses some assumed two-step mechanism. Next, if the test functions plotted using experimental data are actually even, the mechanism is attributed and the obtained constant values provide the rate constants and enthalpy of reaction of the second step. The advantage of the protocol is to use the first step as a probe reaction to reveal the dynamics of the second step, which can hence be relieved of any tagging. The protocol is anticipated to apply to many mechanisms of biological relevance. As far as ligand binding is considered, our approach can address receptor conformational changes or dimerization as well as competition with or modulation by a second partner. The method can also be used to screen libraries of untagged compounds, relying on a tracer whose concentration can be spectroscopically monitored.

  4. Single and dual drug selection for transgenes following bombardment of Caenorhabditis species.

    Science.gov (United States)

    Semple, Jennifer I; Lehner, Ben

    2014-08-01

    The use of drugs and drug resistance genes is a powerful method to select for the presence of a transgene. Unlike methods that require the complementation of a genetic mutation, this system can be used on any genetic background. Drug selection does not require extensive manipulation or costly equipment, yet it is very rapid and can achieve extremely high efficiency, selecting a small number of transgenic worms from among millions of non-transgenic worms. Introducing integrated transgenes into Caenorhabditis elegans by microparticle bombardment represents just such a challenge. Here we describe in detail the protocol we have developed for dual-drug selection in liquid with puromycin and G418 which works well in a variety of Caenorhabditis species. We also show that single drug selection with only puromycin or only G418 is effective in C. elegans. The growing number of drug selection markers that have been adapted to C. elegans are an important addition to the genetic toolkit at our disposal. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. A deep-sea agglutinated foraminifer tube constructed with planktonic foraminifer shells of a single species

    Science.gov (United States)

    Pearson, Paul N.; Expedition 363 Shipboard Scientific Party, IODP

    2018-01-01

    Agglutinated foraminifera are marine protists that show apparently complex behaviour in constructing their shells, involving selecting suitable sedimentary grains from their environment, manipulating them in three dimensions, and cementing them precisely into position. Here we illustrate a striking and previously undescribed example of complex organisation in fragments of a tube-like foraminifer (questionably assigned to Rhabdammina) from 1466 m water depth on the northwest Australian margin. The tube is constructed from well-cemented siliciclastic grains which form a matrix into which hundreds of planktonic foraminifer shells are regularly spaced in apparently helical bands. These shells are of a single species, Turborotalita clarkei, which has been selected to the exclusion of all other bioclasts. The majority of shells are set horizontally in the matrix with the umbilical side upward. This mode of construction, as is the case with other agglutinated tests, seems to require either an extraordinarily selective trial-and-error process at the site of cementation or an active sensory and decision-making system within the cell.

  6. Comparative Analysis of Single-Species and Polybacterial Wound Biofilms Using a Quantitative, In Vivo, Rabbit Ear Model

    Science.gov (United States)

    2012-08-08

    biofilm behavior of mixed-species cultures with dental and periodontal pathogens. PLoS One 5(10): 131–135. 47. Ma H, Bryers JD (2010) Non-invasive method...Comparative Analysis of Single-Species and Polybacterial Wound Biofilms Using a Quantitative, In Vivo, Rabbit Ear Model Akhil K. Seth1*, Matthew R...Northwestern University, Chicago, Illinois, United States of America, 2 Microbiology Branch, US Army Dental and Trauma Research Detachment, Institute of Surgical

  7. Diversity, composition and host-species relationships of epiphytic orchids and ferns in two forest in Nepal

    Czech Academy of Sciences Publication Activity Database

    Adhikari, Y. P.; Fischer, A.; Fischer, H. S.; Rokaya, Maan Bahadur; Bhattarai, P.; Gruppe, A.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 1065-1075 ISSN 1672-6316 Grant - others:European Comission(XE) 212459 Program:FP7 Institutional support: RVO:67985939 Keywords : environmental factors * epiphytes * large trees * indicator species * multivariate and univariate analyses * permutations tests Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 1.016, year: 2016

  8. Genetics of resistance in lettuce to races 1 and 2 of Verticillium dahliae from different host species

    Science.gov (United States)

    Race 1 resistance against Verticillium dahliae in lettuce was originally shown in the cultivar La Brillante to be conditioned by a single dominant gene (Verticillium resistance 1, Vr1). Multiple, morphologically diverse sources of germplasm have been identified as resistant to race 1. In this study...

  9. Entamoeba Species in South Africa: Correlations With the Host Microbiome, Parasite Burdens, and First Description of Entamoeba bangladeshi Outside of Asia.

    Science.gov (United States)

    Ngobeni, Renay; Samie, Amidou; Moonah, Shannon; Watanabe, Koji; Petri, William A; Gilchrist, Carol

    2017-12-19

    Diarrhea is frequent in communities without clean water, which include low-income South African populations in Giyani and Pretoria. In these populations, the amount of diarrhea caused by Entamoeba histolytica, inclusive of all ages, sexes, and human immunodeficiency virus status, is uncertain. Infection with E. histolytica can modulate the host microbiota, and a key species indicative of this is the Prevotella copri pathobiont. A cross-sectional study of patients attending gastroenterology clinics was conducted to determine the frequency and burden of 4 Entamoeba species and P. copri. Entamoeba species were present in 27% of patients (129/484), with E. histolytica detected in 8.5% (41), E. dispar in 8% (38), E. bangladeshi in 4.75% (23), and E. moshkovskii in 0%. This is the first description of E. bangladeshi outside Bangladesh. In E. histolytica-positive samples, the levels of both the parasite and P. copri were lower in nondiarrheal samples, validating the results of a study in Bangladesh (P = .0034). By contrast, in E. histolytica-negative samples positive for either of the nonpathogenic species E. dispar or E. bangladeshi, neither P. copri nor Entamoeba levels were linked to gastrointestinal status. Nonmorphologic identification of this parasite is essential. In South Africa, 3 morphologically identical Entamoeba were common, but only E. histolytica was linked to both disease and changes in the microbiota. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  10. The genome of African yam (Dioscorea cayenensis-rotundata complex) hosts endogenous sequences from four distinct Badnavirus species.

    Science.gov (United States)

    Umber, Marie; Filloux, Denis; Muller, Emmanuelle; Laboureau, Nathalie; Galzi, Serge; Roumagnac, Philippe; Iskra-Caruana, Marie-Line; Pavis, Claudie; Teycheney, Pierre-Yves; Seal, Susan E

    2014-10-01

    Several endogenous viral elements (EVEs) have been identified in plant genomes, including endogenous pararetroviruses (EPRVs). Here, we report the first characterization of EPRV sequences in the genome of African yam of the Dioscorea cayenensis-rotundata complex. We propose that these sequences should be termed 'endogenous Dioscorea bacilliform viruses' (eDBVs). Molecular characterization of eDBVs shows that they constitute sequences originating from various parts of badnavirus genomes, resulting in a mosaic structure that is typical of most EPRVs characterized to date. Using complementary molecular approaches, we show that eDBVs belong to at least four distinct Badnavirus species, indicating multiple, independent, endogenization events. Phylogenetic analyses of eDBVs support and enrich the current taxonomy of yam badnaviruses and lead to the characterization of a new Badnavirus species in yam. The impact of eDBVs on diagnosis, yam germplasm conservation and movement, and breeding is discussed. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. A new species of Smicromorpha (Hymenoptera, Chalcididae from Vietnam, with notes on the host association of the genus

    Directory of Open Access Journals (Sweden)

    Chris Darling

    2009-09-01

    Full Text Available Smicromorpha masneri Darling, sp. n. is described from Bach Ma National Park, Thua Thien-Hue Province, Vietnam. This is the first confirmed record for the genus on mainland southeast Asia. It is generally accepted that species of Smicromorpha are parasitoids of green tree or weaver ants, Oecophylla smaragdina (Fabricius but this is first rearing record of these parasitoids from the nests of weaver ants.

  12. Lacanobia oleracea nucleopolyhedrovirus (LaolNPV): A new European species of alphabaculovirus with a narrow host range.

    Science.gov (United States)

    Simón, Oihane; Erlandson, Martin A; Frayssinet, Marie; Williams, Trevor; Theilmann, David A; Volkoff, Anne-Nathalie; Caballero, Primitivo

    2017-01-01

    During an insect sampling program in alfalfa crops near Montpellier, France in 2011, Lacanobia oleracea larvae were collected that died due to nucleopolyhedrovirus infection (LaolNPV). This virus was subjected to molecular and biological characterization. The virus was a multiple nucleocapsid NPV that showed similar restriction profiles to Mamestra configurata NPV-A (MacoNPV-A) but with significant differences. Polypeptide analysis demonstrated similar proteins in occlusion bodies and occlusion derived virions, to those observed in NPVs from Mamestra spp. Terminal sequencing revealed that the genome organization shared similarity with that of MacoNPV-A. The most homologous virus was MacoNPV-A 90/2 isolate (95.63% identity and 96.47% similarity), followed by MacoNPV-A 90/4 strain (95.37% and 96.26%), MacoNPV-B (89.21% and 93.53%) and M. brassicae MNPV (89.42% and 93.74%). Phylogenetic analysis performed with lef-8, lef-9, polh and a concatenated set of genes showed that LaolNPV and the Mamestra spp. NPVs clustered together with HaMNPV, but with a closer genetic distance to MacoNPV-A strains. The Kimura 2-parameter (K-2-P) distances of the complete genes were greater than 0.05 between LaolNPV and the MbMNPV/MacoNPV-B/HaMNPV complex, which indicates that LaolNPV is a distinct species. K-2-P distances were in the range 0.015-0.050 for comparisons of LaolNPV with MacoNPV-A strains, such that additional biological characteristics should be evaluated to determine species status. While MacoNPV-A was pathogenic to seven lepidopteran species tested, LaolNPV was only pathogenic to Chrysodeixis chalcites. Given these findings, Lacanobia oleracea nucleopolyhedrovirus should be considered as a new species in the Alphabaculovirus genus.

  13. Lacanobia oleracea nucleopolyhedrovirus (LaolNPV: A new European species of alphabaculovirus with a narrow host range.

    Directory of Open Access Journals (Sweden)

    Oihane Simón

    Full Text Available During an insect sampling program in alfalfa crops near Montpellier, France in 2011, Lacanobia oleracea larvae were collected that died due to nucleopolyhedrovirus infection (LaolNPV. This virus was subjected to molecular and biological characterization. The virus was a multiple nucleocapsid NPV that showed similar restriction profiles to Mamestra configurata NPV-A (MacoNPV-A but with significant differences. Polypeptide analysis demonstrated similar proteins in occlusion bodies and occlusion derived virions, to those observed in NPVs from Mamestra spp. Terminal sequencing revealed that the genome organization shared similarity with that of MacoNPV-A. The most homologous virus was MacoNPV-A 90/2 isolate (95.63% identity and 96.47% similarity, followed by MacoNPV-A 90/4 strain (95.37% and 96.26%, MacoNPV-B (89.21% and 93.53% and M. brassicae MNPV (89.42% and 93.74%. Phylogenetic analysis performed with lef-8, lef-9, polh and a concatenated set of genes showed that LaolNPV and the Mamestra spp. NPVs clustered together with HaMNPV, but with a closer genetic distance to MacoNPV-A strains. The Kimura 2-parameter (K-2-P distances of the complete genes were greater than 0.05 between LaolNPV and the MbMNPV/MacoNPV-B/HaMNPV complex, which indicates that LaolNPV is a distinct species. K-2-P distances were in the range 0.015-0.050 for comparisons of LaolNPV with MacoNPV-A strains, such that additional biological characteristics should be evaluated to determine species status. While MacoNPV-A was pathogenic to seven lepidopteran species tested, LaolNPV was only pathogenic to Chrysodeixis chalcites. Given these findings, Lacanobia oleracea nucleopolyhedrovirus should be considered as a new species in the Alphabaculovirus genus.

  14. High field electron paramagnetic resonance spectroscopy under ultrahigh vacuum conditions—A multipurpose machine to study paramagnetic species on well defined single crystal surfaces

    Science.gov (United States)

    Rocker, J.; Cornu, D.; Kieseritzky, E.; Seiler, A.; Bondarchuk, O.; Hänsel-Ziegler, W.; Risse, T.; Freund, H.-J.

    2014-08-01

    A new ultrahigh vacuum (UHV) electron paramagnetic resonance (EPR) spectrometer operating at 94 GHz to investigate paramagnetic centers on single crystal surfaces is described. It is particularly designed to study paramagnetic centers on well-defined model catalysts using epitaxial thin oxide films grown on metal single crystals. The EPR setup is based on a commercial Bruker E600 spectrometer, which is adapted to ultrahigh vacuum conditions using a home made Fabry Perot resonator. The key idea of the resonator is to use the planar metal single crystal required to grow the single crystalline oxide films as one of the mirrors of the resonator. EPR spectroscopy is solely sensitive to paramagnetic species, which are typically minority species in such a system. Hence, additional experimental characterization tools are required to allow for a comprehensive investigation of the surface. The apparatus includes a preparation chamber hosting equipment, which is required to prepare supported model catalysts. In addition, surface characterization tools such as low energy electron diffraction (LEED)/Auger spectroscopy, temperature programmed desorption (TPD), and infrared reflection absorption spectroscopy (IRAS) are available to characterize the surfaces. A second chamber used to perform EPR spectroscopy at 94 GHz has a room temperature scanning tunneling microscope attached to it, which allows for real space structural characterization. The heart of the UHV adaptation of the EPR experiment is the sealing of the Fabry-Perot resonator against atmosphere. To this end it is possible to use a thin sapphire window glued to the backside of the coupling orifice of the Fabry Perot resonator. With the help of a variety of stabilization measures reducing vibrations as well as thermal drift it is possible to accumulate data for a time span, which is for low temperature measurements only limited by the amount of liquid helium. Test measurements show that the system can detect paramagnetic

  15. Novel IgG-Degrading Enzymes of the IgdE Protease Family Link Substrate Specificity to Host Tropism of Streptococcus Species.

    Science.gov (United States)

    Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J; Paton, Lois; Woof, Jenny M; von Pawel-Rammingen, Ulrich

    2016-01-01

    Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.

  16. Discontinuous genetic variation among mesophilic Naegleria isolates: further evidence that N. gruberi is not a single species.

    Science.gov (United States)

    Robinson, B S; Christy, P; Hayes, S J; Dobson, P J

    1992-01-01

    Naegleria isolates which are currently placed in the type species N. gruberi display great genetic, physiological and morphological heterogeneity. There are two possible interpretations of the nature of this species--that N. gruberi is a species complex or that it is a single continuously variable species. To distinguish between these alternatives, allelic states were determined for 33 loci in 74 new isolates selected to represent wide geographic sources and diverse temperature limits for growth. The results were compared with data for culture collection strains of N. gruberi and other species in the genus. The isolates formed a discontinuous series of clusters, separated by genetic distances similar to those separating the better-characterised taxa N. fowleri, N. lovaniensis, N. jadini, N. australiensis australiensis and N. australiensis italica. Culture collection strains assigned to N. gruberi fell into six distinct clusters, while other clusters were not represented by reference strains. The data are most consistent with the interpretation that N. gruberi is a group of several distinct species, each equivalent to the recently described species in the genus. Naegleria andersoni andersoni and N. andersoni jamiesoni also formed two distinct clusters, equivalent to species. Characteristics temperature limits for growth show that the mesophilic species are ecological as well as genetic entities.

  17. Sea lamprey mark type, marking rate, and parasite-host relationships for lake trout and other species in Lake Ontario

    Science.gov (United States)

    Lantry, Brian F.; Adams, Jean V.; Christie, Gavin; Schaner, Teodore; Bowlby, James; Keir, Michael; Lantry, Jana; Sullivan, Paul; Bishop, Daniel; Treska, Ted; Morrison, Bruce

    2015-01-01

    We examined how attack frequency by sea lampreys on fishes in Lake Ontario varied in response to sea lamprey abundance and preferred host abundance (lake trout > 433 mm). For this analysis we used two gill net assessment surveys, one angler creel survey, three salmonid spawning run datasets, one adult sea lamprey assessment, and a bottom trawl assessment of dead lake trout. The frequency of fresh sea lamprey marks observed on lake trout from assessment surveys was strongly related to the frequency of sea lamprey attacks observed on salmon and trout from the creel survey and spawning migrations. Attack frequencies on all salmonids examined were related to the ratio between the abundances of adult sea lampreys and lake trout. Reanalysis of the susceptibility to sea lamprey attack for lake trout strains stocked into Lake Ontario reaffirmed that Lake Superior strain lake trout were among the most and Seneca Lake strain among the least susceptible and that Lewis Lake strain lake trout were even more susceptible than the Superior strain. Seasonal attack frequencies indicated that as the number of observed sea lamprey attacks decreased during June–September, the ratio of healing to fresh marks also decreased. Simulation of the ratios of healing to fresh marks indicated that increased lethality of attacks by growing sea lampreys contributed to the decline in the ratios and supported laboratory studies about wound healing duration.

  18. MIR and FIR Analysis of Inorganic Species in a Single Data Acquisition

    Science.gov (United States)

    Wang, Peng; Shilov, Sergey

    2017-06-01

    The extension of the mid IR towards the far IR spectral range below 400 \\wn is of great interest for molecular vibrational analysis for inorganic and organometallic chemistry, for geological, pharmaceutical, and physical applications, polymorph screening and crystallinity analysis as well as for matrix isolation spectroscopy. In these cases, the additional far infrared region offers insight to low energy vibrations which are observable only there. This includes inorganic species, lattice vibrations or intermolecular vibrations in the ordered solid state. The spectral range of a FTIR spectrometer is defined by the major optical components such as the source, beamsplitter, and detector. The globar source covers a broad spectral range from 8000 to 20 \\wn. However a bottle neck exists with respect to the beamsplitter and detector. To extend the spectral range further into the far IR and THz spectral ranges, one or more additional far IR beam splitters and detectors have been previously required. Two new optic components have been incorporated in a spectrometer to achieve coverage of both the mid and far infrared in a single scan: a wide range MIR-FIR beam splitter and the wide range DLaTGS detector that utilizes a diamond window. The use of a standard SiC IR source with these components yields a spectral range of 6000 down to 50 \\wn in one step for all types of transmittance, reflectance and ATR measurements. Utilizing the external water cooled mercury arc high power lamp the spectral range can be ultimately extended down to 10 \\wn. Examples of application will include emission in MIR-THz range, identification of pigments, additives in polymers, and polymorphism studies.

  19. One Shroom to Rule Them All: Identifying the mechanisms employed in ectomycorrhizal mutualisms for the generalist fungus Thelephora terrestris and seven genetically diverse host tree species

    Science.gov (United States)

    Francis, N.; Laura, B.; Peay, K.

    2016-12-01

    This summer, through the Stanford EARTH Young Investigators Internship, I worked in the Peay fungal ecology lab to set up an experiment to identify what fungal mechanisms are at work in ectomycorrhizal mutualisms between seven phylogenetically distinct tree species and the generalist fungus Thelephora terrestris. Ectomycorrhizal fungi occupy an important niche in terrestrial ecology through their symbiotic mutualisms with plant hosts that allow for the exchange of carbon and nitrogen. However, very little is known about what determines partner choice for ectomycorrhizal fungal mutualists. Among pathogenic fungi, specialization on particular hosts is common, likely because the pathogen must work in specialized ways with the host's immune system. Ectomycorrhizal mutualists, however, tend to be generalists, even though their associations with plants are physically intimate and chemically complex. In order to understand how ectomycorrhizal fungi maintain a broad host range, I grew and planted seedlings and cuttings of Pinus muricata (bishop pine), Pseudotsuga menziesii (Douglas fir), Salix lasiolepis (arroyo willow), Populus trichocarpa (black cottonwood), Quercus agrifolia (coastal live oak), Eucalyptus globulus (blue gum), and Arbutus menziesii (Pacific madrone). Within each pot, the seven seedlings was planted around a previously planted donor bishop pine in potting mixture inoculated with Thelephora terrestris so that the fungus could spread from the donor pine to the others. I also helped analyze the extent of Thelephora terrestris growth on the plant roots from a preliminary round of the experiment in order to refine the data collection protocol for the coming experiment. Several months from now, my research mentor will label the carbon and nitrogen moving between the fungus and the plant to find out how well the symbiosis is working for each partner, and will sequence the RNA from the fungus to see if it uses different genes to communicate and associate with

  20. Two Positive Periodic Solutions for a Neutral Delay Model of Single-Species Population Growth with Harvesting

    OpenAIRE

    Fang, Hui

    2012-01-01

    By coincidence degree theory for k-set-contractive mapping, this paper establishes a new criterion for the existence of at least two positive periodic solutions for a neutral delay model of single-species population growth with harvesting. An example is given to illustrate the effectiveness of the result.

  1. Two Positive Periodic Solutions for a Neutral Delay Model of Single-Species Population Growth with Harvesting

    Directory of Open Access Journals (Sweden)

    Hui Fang

    2012-01-01

    Full Text Available By coincidence degree theory for k-set-contractive mapping, this paper establishes a new criterion for the existence of at least two positive periodic solutions for a neutral delay model of single-species population growth with harvesting. An example is given to illustrate the effectiveness of the result.

  2. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    NARCIS (Netherlands)

    Quevedo, Beatrice; Giertsen, Elin; Zijnge, Vincent; Luethi-Schaller, Helga; Guggenheim, Bernhard; Thurnheer, Thomas; Gmuer, Rudolf

    2011-01-01

    Background: The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to

  3. Diversity, composition and host-species relationships of epiphytic orchids and ferns in two forests in Nepal

    Czech Academy of Sciences Publication Activity Database

    Adhikari, Y. P.; Fischer, A.; Fischer, H. S.; Rokaya, Maan Bahadur; Bhattarai, P.; Gruppe, A.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 1065-1075 ISSN 1672-6316 R&D Projects: GA ČR GB14-36098G Institutional support: RVO:86652079 Keywords : vascular epiphytes * kathmandu valley * managed forests * dry forest * land-use * richness * conservation * biodiversity * assemblages * preferences * Environmental factors * Epiphytes * Large trees * Indicator species * Multivariate and univariate analyses * Permutations tests Subject RIV: EF - Botanics OBOR OECD: Environmental sciences (social aspects to be 5.7) Impact factor: 1.016, year: 2016

  4. Host specialization and species richness of root-feeding chrysomelid larvae (Chrysomelidae, Coleoptera) in a New Guinea rain forest

    Czech Academy of Sciences Publication Activity Database

    Pokon, R.; Novotný, Vojtěch; Samuelson, G. A.

    2005-01-01

    Roč. 21, č. 6, (2005), s. 595-604 ISSN 0266-4674 R&D Projects: GA AV ČR(CZ) IAA6007106; GA MŠk 1P05ME744 Grant - others: Darwin Initiative for the Survival of Species(GB) 162/10/030; U.S. National Science Foundation(US) DEB-97-07928; U.S. National Science Foundation(US) DEB-02-11591 Institutional research plan: CEZ:AV0Z50070508 Keywords : herbivore communities * insect-plant interactions * leaf beetles Subject RIV: EH - Ecology, Behaviour Impact factor: 1.013, year: 2005

  5. Host specialist clownfishes are environmental niche generalists.

    Science.gov (United States)

    Litsios, Glenn; Kostikova, Anna; Salamin, Nicolas

    2014-11-22

    Why generalist and specialist species coexist in nature is a question that has interested evolutionary biologists for a long time. While the coexistence of specialists and generalists exploiting resources on a single ecological dimension has been theoretically and empirically explored, biological systems with multiple resource dimensions (e.g. trophic, ecological) are less well understood. Yet, such systems may provide an alternative to the classical theory of stable evolutionary coexistence of generalist and specialist species on a single resource dimension. We explore such systems and the potential trade-offs between different resource dimensions in clownfishes. All species of this iconic clade are obligate mutualists with sea anemones yet show interspecific variation in anemone host specificity. Moreover, clownfishes developed variable environmental specialization across their distribution. In this study, we test for the existence of a relationship between host-specificity (number of anemones associated with a clownfish species) and environmental-specificity (expressed as the size of the ecological niche breadth across climatic gradients). We find a negative correlation between host range and environmental specificities in temperature, salinity and pH, probably indicating a trade-off between both types of specialization forcing species to specialize only in a single direction. Trade-offs in a multi-dimensional resource space could be a novel way of explaining the coexistence of generalist and specialists. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  6. Combining a Climatic Niche Model of an Invasive Fungus with Its Host Species Distributions to Identify Risks to Natural Assets: Puccinia psidii Sensu Lato in Australia

    Science.gov (United States)

    Kriticos, Darren J.; Morin, Louise; Leriche, Agathe; Anderson, Robert C.; Caley, Peter

    2013-01-01

    Puccinia psidii sensu lato (s.l.) is an invasive rust fungus threatening a wide range of plant species in the family Myrtaceae. Originating from Central and South America, it has invaded mainland USA and Hawai'i, parts of Asia and Australia. We used CLIMEX to develop a semi-mechanistic global climatic niche model based on new data on the distribution and biology of P. psidii s.l. The model was validated using independent distribution data from recently invaded areas in Australia, China and Japan. We combined this model with distribution data of its potential Myrtaceae host plant species present in Australia to identify areas and ecosystems most at risk. Myrtaceaeous species richness, threatened Myrtaceae and eucalypt plantations within the climatically suitable envelope for P. psidii s.l in Australia were mapped. Globally the model identifies climatically suitable areas for P. psidii s.l. throughout the wet tropics and sub-tropics where moist conditions with moderate temperatures prevail, and also into some cool regions with a mild Mediterranean climate. In Australia, the map of species richness of Myrtaceae within the P. psidii s.l. climatic envelope shows areas where epidemics are hypothetically more likely to be frequent and severe. These hotspots for epidemics are along the eastern coast of New South Wales, including the Sydney Basin, in the Brisbane and Cairns areas in Queensland, and in the coastal region from the south of Bunbury to Esperance in Western Australia. This new climatic niche model for P. psidii s.l. indicates a higher degree of cold tolerance; and hence a potential range that extends into higher altitudes and latitudes than has been indicated previously. The methods demonstrated here provide some insight into the impacts an invasive species might have within its climatically suited range, and can help inform biosecurity policies regarding the management of its spread and protection of valued threatened assets. PMID:23704988

  7. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  8. Molecular analysis of the freshwater prawn Macrobrachium olfersii (Decapoda, Palaemonidae) supports the existence of a single species throughout its distribution.

    Science.gov (United States)

    Rossi, Natália; Mantelatto, Fernando Luis

    2013-01-01

    Macrobrachium olfersii is an amphidromous freshwater prawn, widespread along the eastern coasts of the Americas. This species shows great morphological modifications during ontogenesis, and several studies have verified the existence of a wide intraspecific variation. Because of this condition, the species is often misidentified, and several synonyms have been documented. To elucidate these aspects, individuals of M. olfersii from different populations along its range of distribution were investigated. The taxonomic limit was established, and the degree of genetic variability of this species was described. We extracted DNA from 53 specimens of M. olfersii, M. americanum, M. digueti and M. faustinum, which resulted in 84 new sequences (22 of 16S mtDNA, 45 of Cythocrome Oxidase I (COI) mtDNA, and 17 of Histone (H3) nDNA). Sequences of three genes (single and concatenated) from these species were used in the Maximum Likelihood and Bayesian Inference phylogenetic analyses and COI sequences from M. olfersii were used in population analysis. The genetic variation was evaluated through the alignment of 554 bp from the 16S, 638 bp from the COI, and 338 bp from the H3. The rates of genetic divergence among populations were lower at the intraspecific level. This was confirmed by the haplotype net, which showed a continuous gene flow among populations. Although a wide distribution and high morphological intraspecific variation often suggest the existence of more than one species, genetic similarity of Caribbean and Brazilian populations of M. olfersii supported them as a single species.

  9. Molecular analysis of the freshwater prawn Macrobrachium olfersii (Decapoda, Palaemonidae supports the existence of a single species throughout its distribution.

    Directory of Open Access Journals (Sweden)

    Natália Rossi

    Full Text Available Macrobrachium olfersii is an amphidromous freshwater prawn, widespread along the eastern coasts of the Americas. This species shows great morphological modifications during ontogenesis, and several studies have verified the existence of a wide intraspecific variation. Because of this condition, the species is often misidentified, and several synonyms have been documented. To elucidate these aspects, individuals of M. olfersii from different populations along its range of distribution were investigated. The taxonomic limit was established, and the degree of genetic variability of this species was described. We extracted DNA from 53 specimens of M. olfersii, M. americanum, M. digueti and M. faustinum, which resulted in 84 new sequences (22 of 16S mtDNA, 45 of Cythocrome Oxidase I (COI mtDNA, and 17 of Histone (H3 nDNA. Sequences of three genes (single and concatenated from these species were used in the Maximum Likelihood and Bayesian Inference phylogenetic analyses and COI sequences from M. olfersii were used in population analysis. The genetic variation was evaluated through the alignment of 554 bp from the 16S, 638 bp from the COI, and 338 bp from the H3. The rates of genetic divergence among populations were lower at the intraspecific level. This was confirmed by the haplotype net, which showed a continuous gene flow among populations. Although a wide distribution and high morphological intraspecific variation often suggest the existence of more than one species, genetic similarity of Caribbean and Brazilian populations of M. olfersii supported them as a single species.

  10. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  11. Host factors do not influence the colonization or infection by fluconazole resistant Candida species in hospitalized patients

    Directory of Open Access Journals (Sweden)

    Ho Yu-Huai

    2008-12-01

    Full Text Available Abstract Nosocomial yeast infections have significantly increased during the past two decades in industrialized countries, including Taiwan. This has been associated with the emergence of resistance to fluconazole and other antifungal drugs. The medical records of 88 patients, colonized or infected with Candida species, from nine of the 22 hospitals that provided clinical isolates to the Taiwan Surveillance of Antimicrobial Resistance of Yeasts (TSARY program in 1999 were reviewed. A total of 35 patients contributed fluconazole resistant strains [minimum inhibitory concentrations (MICs ≧ 64 mg/l], while the remaining 53 patients contributed susceptible ones (MICs ≦ 8 mg/l. Fluconazole resistance was more frequent among isolates of Candida tropicalis (46.5% than either C. albicans (36.8% or C. glabrata (30.8%. There was no significant difference in demographic characteristics or underlying diseases among patients contributing strains different in drug susceptibility.

  12. The paralogous salivary anti-complement proteins IRAC I and IRAC II encoded by Ixodes ricinus ticks have broad and complementary inhibitory activities against the complement of different host species.

    Science.gov (United States)

    Schroeder, Hélène; Daix, Virginie; Gillet, Laurent; Renauld, Jean-Christophe; Vanderplasschen, Alain

    2007-02-01

    Several observations suggest that inhibition of the host complement alternative pathway by Ixodes tick saliva is crucial to achieve blood feeding. We recently described two paralogous anti-complement proteins called Ixodes ricinus anti-complement (IRAC) proteins I and II co-expressed in I. ricinus salivary glands. Phylogenetic analyses suggested that these sequences were diversifying by a process of positive Darwinian selection, possibly leading to molecules with different biological properties. In the present study, we tested the hypothesis that each paralogue may have different inhibitory activities against the complement of different natural host species, thereby contributing to broaden the host range of I. ricinus ticks. IRAC I and IRAC II were tested against the complement of eight I. ricinus natural host species (six mammals and two birds). The results demonstrate that IRAC I and IRAC II have broad and complementary inhibition activities against the complement of different host species. This report is the first description of paralogous anti-complement molecules encoded by a pathogen with broad and complementary inhibitory activities against the complement of different host species.

  13. Insights into the relationships of Palearctic and Nearctic lymnaeids (Mollusca : Gastropoda by rDNA ITS-2 sequencing and phylogeny of stagnicoline intermediate host species of Fasciola hepatica

    Directory of Open Access Journals (Sweden)

    Bargues M.D.

    2003-09-01

    Full Text Available Fascioliasis by Fasciola hepatica is the vector-borne disease presenting the widest latitudinal, longitudinal and altitudinal distribution known. F. hepatica shows a great adaptation power to new environmental conditions which is the consequence of its own capacities together with the adaptation and colonization abilities of its specific vector hosts, freshwater snails of the family Lymnaeidae. Several lymnaeid species only considered as secondary contributors to the liver fluke transmission have, however, played a very important role in the geographic expansion of this disease. Many of them belong to the so-called "stagnicoline" type group. Stagnicolines have, therefore, a very important applied interest in the Holarctic region, to which they are geographically restricted. The present knowledge on the genetics of stagnicolines and on their parasite-host interrelationships is, however, far from being sufficient. The present paper analyses the relationships between Palaearctic and Nearctic stagnicoline species on the base of the new light furnished by the results obtained in nuclear rDNA ITS-2 sequencing and corresponding phylogenetic studies of the lymnaeid taxa Lymnaea (Stagnicola occulta, L. (S. palustris palustris (topotype specimens and L.(S. p. turricula from Europe. Natural infections with F. hepatica have been reported in all of them. Surprisingly, ITS-2 length and G C content of L. occulta were similar and perfectly fitted within the respective ranges known in North American stagnicolines. Nucleotide differences and genetic distances were higher between L. occulta and the other European stagnicolines than between L. occulta and the North American ones. The ITS-2 sequence of L. p. turricula from Poland differed from the other genotypes known from turricula in Europe. The phylogenetic trees using the maximum-parsimony, distance and maximum-likelihood methods confirmed (i the inclusion of L. occulta in the branch of North American

  14. A global phylogenetic analysis in order to determine the host species and geography dependent features present in the evolution of avian H9N2 influenza hemagglutinin

    Directory of Open Access Journals (Sweden)

    Andrew R. Dalby

    2014-10-01

    Full Text Available A complete phylogenetic analysis of all of the H9N2 hemagglutinin sequences that were collected between 1966 and 2012 was carried out in order to build a picture of the geographical and host specific evolution of the hemagglutinin protein. To improve the quality and applicability of the output data the sequences were divided into subsets based upon location and host species.The phylogenetic analysis of hemagglutinin reveals that the protein has distinct lineages between China and the Middle East, and that wild birds in both regions retain a distinct form of the H9 molecule, from the same lineage as the ancestral hemagglutinin. The results add further evidence to the hypothesis that the current predominant H9N2 hemagglutinin lineage might have originated in Southern China. The study also shows that there are sampling problems that affect the reliability of this and any similar analysis. This raises questions about the surveillance of H9N2 and the need for wider sampling of the virus in the environment.The results of this analysis are also consistent with a model where hemagglutinin has predominantly evolved by neutral drift punctuated by occasional selection events. These selective events have produced the current pattern of distinct lineages in the Middle East, Korea and China. This interpretation is in agreement with existing studies that have shown that there is widespread intra-country sequence evolution.

  15. Constraints on host choice: why do parasitic birds rarely exploit some common potential hosts?

    Science.gov (United States)

    Grim, Tomáš; Samaš, Peter; Moskát, Csaba; Kleven, Oddmund; Honza, Marcel; Moksnes, Arne; Røskaft, Eivin; Stokke, Bård G

    2011-05-01

    1. Why are some common and apparently suitable resources avoided by potential users? This interesting ecological and evolutionary conundrum is vividly illustrated by obligate brood parasites. Parasitic birds lay their eggs into nests of a wide range of host species, including many rare ones, but do not parasitize some commonly co-occurring potential hosts. 2. Attempts to explain the absence of parasitism in common potential hosts are limited and typically focused on single-factor explanations while ignoring other potential factors. We tested why thrushes Turdus spp. are extremely rarely parasitized by common cuckoos Cuculus canorus despite breeding commonly in sympatry and building the most conspicuous nests among forest-breeding passerines. 3. No single examined factor explained cuckoo avoidance of thrushes. Life-history traits of all six European thrush species and the 10 most frequently used cuckoo hosts in Europe were similar except body/egg size, nest design and nestling diet. 4. Experiments (n = 1211) in several populations across Europe showed that host defences at egg-laying and incubation stages did not account for the lack of cuckoo parasitism in thrushes. However, cross-fostering experiments disclosed that various factors during the nestling period prevent cuckoos from successfully parasitizing thrushes. Specifically, in some thrush species, the nest cup design forced cuckoo chicks to compete with host chicks with fatal consequences for the parasite. Other species were reluctant to care even for lone cuckoo chicks. 5. Importantly, in an apparently phylogenetically homogenous group of hosts, there were interspecific differences in factors responsible for the absence of cuckoo parasitism. 6. This study highlights the importance of considering multiple potential factors and their interactions for understanding absence of parasitism in potential hosts of parasitic birds. In the present study, comparative and experimental procedures are integrated, which

  16. Temporal Patterns in the Abundance and Species Composition of Spiders on Host Plants of the Invasive Moth Epiphyas postvittana (Lepidoptera: Tortricidae).

    Science.gov (United States)

    Hogg, Brian N; Mills, Nicholas J; Daane, Kent M

    2017-06-01

    Generalist predators such as spiders may help mitigate the spread and impact of exotic herbivores. The lack of prey specificity and long generation times of spiders may allow them to persist when pests are scarce, and to limit the growth of pest populations before they reach damaging levels. We examined whether resident spiders are likely to play a role in maintaining populations of the invasive light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), below outbreak levels in California. We surveyed the spider community on two E. postvittana host plants, the ornamental Australian tea tree, Leptospermum laevigatum, and the weed French broom, Genista monspessulana, to characterize spider and larval E. postvittana abundance and spider species composition throughout the year. Spider densities and species composition showed slight seasonal changes. Spiders were present during periods of high and low E. postvittana abundance. Anyphaenid hunting spiders, Anyphaena aperta Banks in Australian tea tree and Anyphaena pacifica Banks in French broom, dominated spider species composition at four of five sampled sites, and underwent only slight seasonal variation in abundance. Adult A. aperta were rare at all times of the year, suggesting that high mortality among juvenile A. aperta limits the potential of this species as a predator of E. postvittana. Nevertheless, the continued presence of spiders throughout the year indicates that the resident spider community is likely to play a key role in reducing E. postvittana populations in California. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by US Government employees and is in the public domain in the US.

  17. Parasitic worms stimulate host NADPH oxidases to produce reactive oxygen species that limit plant cell death and promote infection.

    Science.gov (United States)

    Siddique, Shahid; Matera, Christiane; Radakovic, Zoran S; Hasan, M Shamim; Gutbrod, Philipp; Rozanska, Elzbieta; Sobczak, Miroslaw; Torres, Miguel Angel; Grundler, Florian M W

    2014-04-08

    Plants and animals produce reactive oxygen species (ROS) in response to infection. In plants, ROS not only activate defense responses and promote cell death to limit the spread of pathogens but also restrict the amount of cell death in response to pathogen recognition. Plants also use hormones, such as salicylic acid, to mediate immune responses to infection. However, there are long-lasting biotrophic plant-pathogen interactions, such as the interaction between parasitic nematodes and plant roots during which defense responses are suppressed and root cells are reorganized to specific nurse cell systems. In plants, ROS are primarily generated by plasma membrane-localized NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidases, and loss of NADPH oxidase activity compromises immune responses and cell death. We found that infection of Arabidopsis thaliana by the parasitic nematode Heterodera schachtii activated the NADPH oxidases RbohD and RbohF to produce ROS, which was necessary to restrict infected plant cell death and promote nurse cell formation. RbohD- and RbohF-deficient plants exhibited larger regions of cell death in response to nematode infection, and nurse cell formation was greatly reduced. Genetic disruption of SID2, which is required for salicylic acid accumulation and immune activation in nematode-infected plants, led to the increased size of nematodes in RbohD- and RbohF-deficient plants, but did not decrease plant cell death. Thus, by stimulating NADPH oxidase-generated ROS, parasitic nematodes fine-tune the pattern of plant cell death during the destructive root invasion and may antagonize salicylic acid-induced defense responses during biotrophic life stages.

  18. Patterns of host ant use by sympatric populations of Maculinea alcon and M. 'rebeli' in the Carpathian Basin

    DEFF Research Database (Denmark)

    Tartally, A.; Nash, David Richard; Lengyel, S.

    2008-01-01

    , including host plant and host ant species. However, recent genetic evidence has questioned their separation as good species. Here we compare the use of host ants by M. alcon and M. ‘rebeli’ at the regional scale in NE-Hungary and Transylvania (Romania), where molecular studies have found no species......Maculinea butterflies show social parasitism via obligatory myrmecophily as their larvae are adopted and raised to pupation by Myrmica ants. Suitable hosts differ for different Maculinea species, and host ant specificity can further differ at the population-level. Although early studies suggested...... single ant species as main hosts for each Maculinea species, it has recently become clear that their host ant specificity is more complex. Maculinea alcon and Maculinea ‘rebeli’ have variously been separated according to adult and larval morphology, phenology, and their use of different ecosystems...

  19. Novel IgG-Degrading Enzymes of the IgdE Protease Family Link Substrate Specificity to Host Tropism of Streptococcus Species.

    Directory of Open Access Journals (Sweden)

    Christian Spoerry

    Full Text Available Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.

  20. Novel IgG-Degrading Enzymes of the IgdE Protease Family Link Substrate Specificity to Host Tropism of Streptococcus Species

    Science.gov (United States)

    Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J.; Paton, Lois; Woof, Jenny M.

    2016-01-01

    Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use. PMID:27749921

  1. Solar light-induced production of reactive oxygen species by single walled carbon nanotubes in water

    Science.gov (United States)

    Photosensitizing processes of engineered nanomaterials (ENMs) which include photo-induced production of reactive oxygen species (ROS) convert light energy into oxidizing chemical energy that mediates transformations of nanomaterials. The oxidative stress associated with ROS may p...

  2. The desert tortoise trichotomy: Mexico hosts a third, new sister-species of tortoise in the Gopherus morafkai–G. agassizii group

    Science.gov (United States)

    Edwards, Taylor; Karl, Alice E.; Vaughn, Mercy; Rosen, Philip C.; Torres, Cristina Meléndez; Murphy, Robert W.

    2016-01-01

    Abstract Desert tortoises (Testudines; Testudinidae; Gopherus agassizii group) have an extensive distribution throughout the Mojave, Colorado, and Sonoran desert regions. Not surprisingly, they exhibit a tremendous amount of ecological, behavioral, morphological and genetic variation. Gopherus agassizii was considered a single species for almost 150 years but recently the species was split into the nominate form and Morafka’s desert tortoise, Gopherus morafkai, the latter occurring south and east of the Colorado River. Whereas a large body of literature focuses on tortoises in the United States, a dearth of investigations exists for Mexican animals. Notwithstanding, Mexican populations of desert tortoises in the southern part of the range of Gopherus morafkai are distinct, particularly where the tortoises occur in tropical thornscrub and tropical deciduous forest. Recent studies have shed light on the ecology, morphology and genetics of these southern ‘desert’ tortoises. All evidence warrants recognition of this clade as a distinctive taxon and herein we describe it as Gopherus evgoodei sp. n. The description of the new species significantly reduces and limits the distribution of Gopherus morafkai to desertscrub habitat only. By contrast, Gopherus evgoodei sp. n. occurs in thornscrub and tropical deciduous forests only and this leaves it with the smallest range of the three sister species. We present conservation implications for the newly described Gopherus evgoodei, which already faces impending threats. PMID:27006625

  3. Complex interactions among host pines and fungi vectored by an invasive bark beetle

    Science.gov (United States)

    Min Lu; Michael J. Wingfield; Nancy E. Gillette; Sylvia R. Mori; Jian-Hua Sun

    2010-01-01

    Recent studies have investigated the relationships between pairs or groups of exotic species to illustrate invasive mechanisms, but most have focused on interactions at a single trophic level.Here, we conducted pathogenicity tests, analyses of host volatiles and fungal growth tests to elucidate an intricate network of interactions between the host...

  4. Effects of host species and life stage on the helminth communities of sympatric northern leopard frogs (Lithobates pipiens) and wood frogs (Lithobates sylvaticus) in the Sheyenne National Grasslands, North Dakota.

    Science.gov (United States)

    Gustafson, Kyle D; Newman, Robert A; Tkach, Vasyl V

    2013-08-01

    We studied helminth communities in sympatric populations of leopard frogs (Lithobates pipiens) and wood frogs (Lithobates sylvaticus) and assessed the effects of host species and life stage on helminth community composition and helminth species richness. We examined 328 amphibians including 218 northern leopard frogs and 110 wood frogs collected between April and August of 2009 and 2010 in the Sheyenne National Grasslands of southeastern North Dakota. Echinostomatid metacercariae were the most common helminths found, with the highest prevalence in metamorphic wood frogs. Host species significantly influenced helminth community composition, and host life stage significantly influenced the component community composition of leopard frogs. In these sympatric populations, leopard frogs were common hosts for adult trematodes whereas wood frogs exhibited a higher prevalence of nematodes with direct life cycles. Metamorphic frogs were commonly infected with echinostomatid metacercariae and other larval trematodes whereas juvenile and adult frogs were most-frequently infected with directly transmitted nematodes and trophically transmitted trematodes. Accordingly, helminth species richness increased with the developmental life stage of the host.

  5. Unravelling mummies: cryptic diversity, host specificity, trophic and coevolutionary interactions in psyllid - parasitoid food webs.

    Science.gov (United States)

    Hall, Aidan A G; Steinbauer, Martin J; Taylor, Gary S; Johnson, Scott N; Cook, James M; Riegler, Markus

    2017-06-06

    Parasitoids are hyperdiverse and can contain morphologically and functionally cryptic species, making them challenging to study. Parasitoid speciation can arise from specialisation on niches or diverging hosts. However, which process dominates is unclear because cospeciation across multiple parasitoid and host species has rarely been tested. Host specificity and trophic interactions of the parasitoids of psyllids (Hemiptera) remain mostly unknown, but these factors are fundamentally important for understanding of species diversity, and have important applied implications for biological control. We sampled diverse parasitoid communities from eight Eucalyptus-feeding psyllid species in the genera Cardiaspina and Spondyliaspis, and characterised their phylogenetic and trophic relationships using a novel approach that forensically linked emerging parasitoids with the presence of their DNA in post-emergence insect mummies. We also tested whether parasitoids have cospeciated with their psyllid hosts. The parasitoid communities included three Psyllaephagus morphospecies (two primary and, unexpectedly, one heteronomous hyperparasitoid that uses different host species for male and female development), and the hyperparasitoid, Coccidoctonus psyllae. However, the number of genetically delimited Psyllaephagus species was three times higher than the number of recognisable morphospecies, while the hyperparasitoid formed a single generalist species. In spite of this, cophylogenetic analysis revealed unprecedented codivergence of this hyperparasitoid with its primary parasitoid host, suggesting that this single hyperparasitoid species is possibly diverging into host-specific species. Overall, parasitoid and hyperparasitoid diversification was characterised by functional conservation of morphospecies, high host specificity and some host switching between sympatric psyllid hosts. We conclude that host specialisation, host codivergence and host switching are important factors driving

  6. Cystic echinococcosis in South America: systematic review of species and genotypes of Echinococcus granulosus sensu lato in humans and natural domestic hosts.

    Science.gov (United States)

    Cucher, Marcela Alejandra; Macchiaroli, Natalia; Baldi, Germán; Camicia, Federico; Prada, Laura; Maldonado, Lucas; Avila, Héctor Gabriel; Fox, Adolfo; Gutiérrez, Ariana; Negro, Perla; López, Raúl; Jensen, Oscar; Rosenzvit, Mara; Kamenetzky, Laura

    2016-02-01

    To systematically review publications on Echinococcus granulosus sensu lato species/genotypes reported in domestic intermediate and definitive hosts in South America and in human cases worldwide, taking into account those articles where DNA sequencing was performed; and to analyse the density of each type of livestock that can act as intermediate host, and features of medical importance such as cyst organ location. Literature search in numerous databases. We included only articles where samples were genotyped by sequencing since to date it is the most accurate method to unambiguously identify all E. granulosus s. l. genotypes. Also, we report new E. granulosus s. l. samples from Argentina and Uruguay analysed by sequencing of cox1 gene. In South America, five countries have cystic echinococcosis cases for which sequencing data are available: Argentina, Brazil, Chile, Peru and Uruguay, adding up 1534 cases. E. granulosus s. s. (G1) accounts for most of the global burden of human and livestock cases. Also, E. canadensis (G6) plays a significant role in human cystic echinococcosis. Likewise, worldwide analysis of human cases showed that 72.9% are caused by E. granulosus s. s. (G1) and 12.2% and 9.6% by E. canadensis G6 and G7, respectively. E. granulosus s. s. (G1) accounts for most of the global burden followed by E. canadensis (G6 and G7) in South America and worldwide. This information should be taken into account to suit local cystic echinococcosis control and prevention programmes according to each molecular epidemiological situation. © 2015 John Wiley & Sons Ltd.

  7. Comparative toxicity of a brominated flame retardant (tetrabromobisphenol A) on microalgae with single and multi-species bioassays.

    Science.gov (United States)

    Debenest, Timothée; Petit, Anne-Nöelle; Gagné, François; Kohli, Mohan; Nguyen, Nien; Blaise, Christian

    2011-09-01

    The potential threat of emerging chemicals to the aquatic flora is a major issue. The purpose of the study was to develop a multispecies microalgae test in order to determine the impact of species interactions on the cytoxicity of an emergent toxic contaminant: the tetrabromobisphenol A (TBBPA). Single and multi-species tests were thus performed to study the effects of this flame retardant on two microalgae (Pseudokirchneriella subcapitata and Nitzschia palea) commonly observed in freshwater. A synthetic medium was designed to allow the growth of both species. The algae were exposed to 1.8, 4.8, 9.2, 12.9 and 16.5 μM of TBBPA for 72 h. After staining with fluorescein diacetate (FDA), viable cells of each alga species were analyzed by flow cytometry based on chlorophyll autofluorescence and intracellular esterase activity. Density and abundance of viable cells were assessed to follow the population growth and the cell viability. In TBBPA treated samples, the growth of the two microalgae was significantly inhibited at the three highest concentrations (9.2, 12.9 and 16.5 μM) in the two tests. At the end of the experiment (t=72 h), the cell viability was also significantly smaller at these concentrations. The decreases of growth rate and viable cell abundance in TBBPA treated populations of N. palea were significantly higher in multi-species test in comparison with the single-species test. No significant differences were noticed between the two tests for P. subcapitata populations exposed to TBBPA. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  8. Design of custom oligonucleotide microarrays for single species or interspecies hybrids using Array Oligo Selector.

    Science.gov (United States)

    Caudy, Amy A

    2011-01-01

    New technologies for DNA sequencing have made it feasible to determine the genome sequence of any organism of interest. This sequence is the resource required to create tools for downstream studies, including DNA microarrays. A number of vendors can produce DNA microarrays containing customer-specified sequences, allowing investigators to design and order arrays customized for any species of interest. Freely available, user-friendly computer programs are available for designing microarray probes. These design programs can be used to create probes that distinguish between two related genomes, allowing investigation of gene expression or gene representation in intra- or interspecies hybrids or in samples containing DNA from multiple species.

  9. Molecular analysis of clonal trichomonad isolates indicate the existence of heterogenic species present in different birds and within the same host.

    Science.gov (United States)

    Grabensteiner, Elvira; Bilic, Ivana; Kolbe, Thomas; Hess, Michael

    2010-08-27

    Trichomonas gallinae is a flagellated protozoon and the etiological agent of avian trichomoniasis. Despite its importance, especially in columbiformes and falconiformes, only a few molecular studies have yet been performed in order to investigate the degree of genetic diversity and cross-transmissibility between different isolates of this parasite. To address these questions 63 clonal cultures of Trichomonas spp. isolates were established by successful isolation of single trichomonads from a mixture of micro-organisms obtained from 17 birds belonging to five different species. All birds were from Austria with the exception of one bird which originated from the Czech Republic. The sequence of the complete genomic region spanning the two ribosomal RNA internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene was determined for all 63 isolates. In addition, in order to compare the results obtained with the ITS1-5.8S-ITS2 region the sequence of the 18S rRNA gene was determined from a subset of isolates. Unrooted phylogenetic trees inferred by distance, parsimony, and likelihood methods suggest the existence of at least three clusters within the T. gallinae species complex, two groups being closely related to the human pathogens, Trichomonas vaginalis and Trichomonas tenax. Furthermore, for the first time two different trichomonad sequence types isolated at the same time from a single bird could be detected in the crops of two pigeons. (c) 2010 Elsevier B.V. All rights reserved.

  10. A single dominant Ganoderma species is responsible for root rot of ...

    African Journals Online (AJOL)

    Ganoderma root rot is the most serious disease affecting commercially planted Acacia mangium in plantations in Indonesia. Numerous Ganoderma spp. have been recorded from diseased trees of this species and to a lesser extent Eucalyptus, causing confusion regarding the primary cause of the disease. In this study, a ...

  11. Beyond the single species climate envelope: A multifaceted approach to mapping climate change vulnerability

    Science.gov (United States)

    Christopher S. Balzotti; Stanley G. Kitchen; Clinton McCarthy

    2016-01-01

    Federal land management agencies and conservation organizations have begun incorporating climate change vulnerability assessments (CCVAs) as an important component in the management and conservation of landscapes. It is often a challenge to translate that knowledge into management plans and actions, even when research infers species risk. Predictive maps can...

  12. Single-tree water use and water-use efficiencies of selected indigenous and introduced species in the Southern Cape region of South Africa

    CSIR Research Space (South Africa)

    Mapeto, P

    2017-03-01

    Full Text Available indigenous tree species can provide an additional low water-use form of forestry. Single-tree water use and water-use efficiencies of three indigenous species (Ilex mitis, Ocotea bullata and Podocarpus latifolius) and one introduced species (Pinus radiata...

  13. Computational approach to predict species-specific type III secretion system (T3SS) effectors using single and multiple genomes.

    Science.gov (United States)

    Hobbs, Christopher K; Porter, Vanessa L; Stow, Maxwell L S; Siame, Bupe A; Tsang, Herbert H; Leung, Ka Yin

    2016-12-19

    Many gram-negative bacteria use type III secretion systems (T3SSs) to translocate effector proteins into host cells. T3SS effectors can give some bacteria a competitive edge over others within the same environment and can help bacteria to invade the host cells and allow them to multiply rapidly within the host. Therefore, developing efficient methods to identify effectors scattered in bacterial genomes can lead to a better understanding of host-pathogen interactions and ultimately to important medical and biotechnological applications. We used 21 genomic and proteomic attributes to create a precise and reliable T3SS effector prediction method called Genome Search for Effectors Tool (GenSET). Five machine learning algorithms were trained on effectors selected from different organisms and a trained (voting) algorithm was then applied to identify other effectors present in the genome testing sets from the same (GenSET Phase 1) or different (GenSET Phase 2) organism. Although a select group of attributes that included the codon adaptation index, probability of expression in inclusion bodies, N-terminal disorder, and G + C content (filtered) were better at discriminating between positive and negative sets, algorithm performance was better when all 21 attributes (unfiltered) were used. Performance scores (sensitivity, specificity and area under the curve) from GenSET Phase 1 were better than those reported for six published methods. More importantly, GenSET Phase 1 ranked more known effectors (70.3%) in the top 40 ranked proteins and predicted 10-80% more effectors than three available programs in three of the four organisms tested. GenSET Phase 2 predicted 43.8% effectors in the top 40 ranked proteins when tested on four related or unrelated organisms. The lower prediction rates from GenSET Phase 2 may be due to the presence of different translocation signals in effectors from different T3SS families. The species-specific GenSET Phase 1 method offers an alternative

  14. Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

    Science.gov (United States)

    Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

    2013-05-16

    The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

  15. NY-ESO-1 TCR single edited stem and central memory T cells to treat multiple myeloma without graft-versus-host disease.

    Science.gov (United States)

    Mastaglio, Sara; Genovese, Pietro; Magnani, Zulma; Ruggiero, Eliana; Landoni, Elisa; Camisa, Barbara; Schiroli, Giulia; Provasi, Elena; Lombardo, Angelo; Reik, Andreas; Cieri, Nicoletta; Rocchi, Martina; Oliveira, Giacomo; Escobar, Giulia; Casucci, Monica; Gentner, Bernhard; Spinelli, Antonello; Mondino, Anna; Bondanza, Attilio; Vago, Luca; Ponzoni, Maurilio; Ciceri, Fabio; Holmes, Michael C; Naldini, Luigi; Bonini, Chiara

    2017-08-03

    Transfer of T-cell receptors (TCRs) specific for tumor-associated antigens is a promising approach for cancer immunotherapy. We developed the TCR gene editing technology that is based on the knockout of the endogenous TCR α and β genes, followed by the introduction of tumor-specific TCR genes, and that proved safer and more effective than conventional TCR gene transfer. Although successful, complete editing requires extensive cell manipulation and 4 transduction procedures. Here we propose a novel and clinically feasible TCR "single editing" (SE) approach, based on the disruption of the endogenous TCR α chain only, followed by the transfer of genes encoding for a tumor-specific TCR. We validated SE with the clinical grade HLA-A2 restricted NY-ESO-1 157-165 -specific TCR. SE allowed the rapid production of high numbers of tumor-specific T cells, with optimal TCR expression and preferential stem memory and central memory phenotype. Similarly to unedited T cells redirected by TCR gene transfer (TCR transferred [TR]), SE T cells efficiently killed NY-ESO-1 pos targets; however, although TR cells proved highly alloreactive, SE cells showed a favorable safety profile. Accordingly, when infused in NSG mice previously engrafted with myeloma, SE cells mediated tumor rejection without inducing xenogeneic graft-versus-host disease, thus resulting in significantly higher survival than that observed in mice treated with TR cells. Overall, single TCR gene editing represents a clinically feasible approach that is able to increase the safety and efficacy of cancer adoptive immunotherapy. © 2017 by The American Society of Hematology.

  16. Development and regulation of single- and multi-species Candida albicans biofilms

    Science.gov (United States)

    Lohse, Matthew B.; Gulati, Megha; Johnson, Alexander D.; Nobile, Clarissa J.

    2017-01-01

    Candida albicans is among the most prevalent fungal species of the human microbiota and asymptomatically colonizes healthy individuals. However, it is also an opportunistic pathogen that can cause severe, and often fatal, bloodstream infections. The medical impact of C. albicans typically depends on its ability to form biofilms, which are closely packed communities of cells that attach to surfaces, such as tissues and implanted medical devices. In this Review, we provide an overview of the processes involved in the formation of C. albicans biofilms and discuss the core transcriptional network that regulates biofilm development. We also consider some of the advantages that biofilms provide to C. albicans in comparison with planktonic growth and explore polymicrobial biofilms that are formed by C. albicans and certain bacterial species. PMID:29062072

  17. Mapping Regional Distribution of a Single Tree Species: Whitebark Pine in the Greater Yellowstone Ecosystem

    Directory of Open Access Journals (Sweden)

    Charles C. Schwartz

    2008-08-01

    Full Text Available Moderate resolution satellite imagery traditionally has been thought to be inadequate for mapping vegetation at the species level. This has made comprehensive mapping of regional distributions of sensitive species, such as whitebark pine, either impractical or extremely time consuming. We sought to determine whether using a combination of moderate resolution satellite imagery (Landsat Enhanced Thematic Mapper Plus, extensive stand data collected by land management agencies for other purposes, and modern statistical classification techniques (boosted classification trees could result in successful mapping of whitebark pine. Overall classification accuracies exceeded 90%, with similar individual class accuracies. Accuracies on a localized basis varied based on elevation. Accuracies also varied among administrative units, although we were not able to determine whether these differences related to inherent spatial variations or differences in the quality of available reference data.

  18. Hapten-Anti-Hapten Technique for Two-Color IHC Detection of Phosphorylated EGFR and H2AX Using Primary Antibodies Raised in the Same Host Species.

    Science.gov (United States)

    Hagen, Jodi; Schwartz, David; Kalyuzhny, Alexander E

    2017-01-01

    Multiplex staining of cell and tissue sections with antibodies raised in the same host species is a serious challenge because of unwanted but inevitable cross-reactivity of secondary antibodies with irrelevant primary antibodies. Several techniques can be used to overcome this obstacle including direct labeling of primary antibodies with fluorescent tags and using tyramide signal amplification. Unfortunately these techniques either lack sensitivity, or require a long multistep protocol which can cause physical damage of specimens. As an alternative, we have developed a protocol based on conjugation of primary antibodies to small-size hapten molecules which can be detected with hapten-specific fluorescent secondary antibodies. This technique has been used for two-color labeling of Y845 phosphorylated Epidermal Growth Factor Receptor (EGFR) and S139 phosphorylated histone H2AX protein in A431 human epidermoid carcinoma cells. Our novel hapten-anti-hapten detection chemistry allows for generating a stronger fluorescent signal and completely avoid cross-interactions of secondary antibodies with irrelevant primary antibodies.

  19. Contrasting root associated fungi of three common oak-woodland plant species based on molecular identification: host specificity or non-specific amplification?

    Science.gov (United States)

    Douhan, Greg W; Petersen, Carolyn; Bledsoe, Caroline S; Rizzo, David M

    2005-07-01

    An increasingly popular approach used to identify arbuscular mycorrhizal (AM) fungi in planta is to amplify a portion of AM fungal small subunit ribosomal DNA (SSU-rDNA) from whole root DNA extractions using the primer pair AM1-NS31, followed by cloning and sequencing. We used this approach to study the AM fungal community composition of three common oak-woodland plant species: a grass (Cynosurus echinatus), blue oak (Quercus douglasii), and a forb (Torilis arvensis). Significant diversity of AM fungi were found in the roots of C. echinatus, which is consistent with previous studies demonstrating a high degree of AM fungal diversity from the roots of various hosts. In contrast, clones from Q. douglasii and T. arvensis were primarily from non-AM fungi of diverse origins within the Ascomycota and Basidiomycota. This work demonstrates that caution must be taken when using this molecular approach to determine in planta AM fungal diversity if non-sequence based methods such as terminal restriction fragment length polymorphisms, denaturing gradient gel electrophoresis, or temperature gradient gel electrophoresis are used.

  20. Calix[8]arene functionalized single-walled carbon nanohorns for dual-signalling electrochemical sensing of aconitine based on competitive host-guest recognition.

    Science.gov (United States)

    Yang, Long; Ran, Xin; Cai, Le; Li, Yucong; Zhao, Hui; Li, Can-Peng

    2016-09-15

    A dual-signalling electrochemical approach has been developed towards aconitine based on competitive host-guest interaction by selecting methylene blue (MB) and p-sulfonated calix[8]arene functionalized single-walled carbon nanohorns (SCX8-SWCNHs) as the "reporter pair". Upon the presence of aconitine to the performed SCX8-SWCNHs·MB complex, the MB molecules are displaced by aconitine. This results in a decreased oxidation peak current of MB and the appearance of an oxidation peak of aconitine, and the changes of these signals correlate linearly with the concentration of aconitine. A linear response range of 1.00-10.00μM for aconitine with a low detection limit of 0.18μM (S/N=3) was obtained by using the proposed method. This method could be successfully utilized to detect aconitine in serum samples. This dual-signalling sensor can provide more sensitive target recognition and will have important applications in the sensitive and selective electrochemical detection of aconitine. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Combined Protein A and size exclusion high performance liquid chromatography for the single-step measurement of mAb, aggregates and host cell proteins.

    Science.gov (United States)

    Gjoka, Xhorxhi; Schofield, Mark; Cvetkovic, Aleksandar; Gantier, Rene

    2014-12-01

    Quantification of monoclonal antibody (mAb) monomer, mAb aggregates, and host cell proteins (HCPs) is critical for the optimization of the mAb production process. The present work describes a single high throughput analytical tool capable of tracking the concentration of mAb, mAb aggregate and HCPs in a growing cell culture batch. By combining two analytical HPLC methods, Protein A affinity and size-exclusion chromatography (SEC), it is possible to detect a relative increase or decrease in the concentration of all three entities simultaneously. A comparison of the combined Protein A-SEC assay to SEC alone was performed, demonstrating that it can be useful tool for the quantification of mAb monomer along with trending data for mAb aggregate and HCP. Furthermore, the study shows that the Protein A-SEC method is at least as accurate as other commonly used analytical methods such as ELISA and Bradford. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Environmental genomics reveals a single species ecosystem deep within the Earth

    Energy Technology Data Exchange (ETDEWEB)

    Chivian, Dylan; Brodie, Eoin L.; Alm, Eric J.; Culley, David E.; Dehal, Paramvir S.; DeSantis, Todd Z.; Gihring, Thomas M.; Lapidus, Alla; Lin, Li-Hung; Lowry, Stephen R.; Moser, Duane P.; Richardson, Paul; Southam, Gordon; Wanger, Greg; Pratt, Lisa M.; Andersen, Gary L.; Hazen, Terry C.; Brockman, Fred J.; Arkin, Adam P.; Onstott, Tullis C.

    2008-09-17

    DNA from low biodiversity fracture water collected at 2.8 km depth in a South African gold mine was sequenced and assembled into a single, complete genome. This bacterium, Candidatus Desulforudis audaxviator, comprises>99.9percent of the microorganisms inhabiting the fluid phase of this particular fracture. Its genome indicates a motile, sporulating, sulfate reducing, chemoautotrophic thermophile that can fix its own nitrogen and carbon using machinery shared with archaea. Candidatus Desulforudis audaxviator is capable of an independent lifestyle well suited to long-term isolation from the photosphere deep within Earth?s crust, and offers the first example of a natural ecosystem that appears to have its biological component entirely encoded within a single genome.

  3. Identification of squid species by melting temperature shifts on fluorescence melting curve analysis (FMCA) using single dual-labeled probe

    Science.gov (United States)

    Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong

    2017-06-01

    Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).

  4. The effect of selected plant extracts on the development of single-species dental biofilms

    International Nuclear Information System (INIS)

    Rahim, Z.H.; Shaikh, S.; Razak, A.; Ismail, W.N.H.W.

    2014-01-01

    To determine the effect of a mixture of plant extracts on the adherence and retention of bacteria in dental biofilm. Study Design: Experimental study. Place and Duration of Study:Department of Oral Biology, Faculty of Dentistry, University of Malaya, Kuala Lumpur, Malaysia, from December 2009 to December 2011. Methodology: For determination of adhering ability, experimental pellicle was first treated with the Plant Extracts Mixture (PEM) before inoculating it with individual bacterial species ( S. mitis / S. sanguinis / S. mutans). For the determination of retention ability, the procedure was repeated with the experimental pellicle being inoculated first with the individual bacterial species and then treating it with the PEM. These two experiments were repeated with deionized distilled water (negative control) and Thymol (0.64%) (positive control). The bacterial populations in biofilms for the two experiments were expressed as Colony Forming Unit (CFU) / mL x 10/sup 4/ and the corresponding values were expressed as mean +- SD. Results: The effect of the Plant Extracts Mixture (PEM) for the two experiments was compared with that of Thymol and deionized distilled water. It was shown that there is a reduced adherence of bacteria to PEM-treated and Thymol (0.064%) treated experimental pellicle compared with the negative control (p < 0.001). It was also found that the retention of bacteria in both treated biofilms is also lower than that of negative control (p = 0.001). Conclusion: Plant Extracts Mixture (PEM) may influence the development of dental biofilm by affecting the adhering and retention capacities of the bacterial species in the dental biofilms. (author)

  5. Intra-Species Bacterial Quorum Sensing Studied at Single Cell Level in a Double Droplet Trapping System

    Directory of Open Access Journals (Sweden)

    Wilhelm T. S. Huck

    2013-05-01

    Full Text Available In this paper, we investigated the intra-species bacterial quorum sensing at the single cell level using a double droplet trapping system. Escherichia coli transformed to express the quorum sensing receptor protein, LasR, were encapsulated in microdroplets that were positioned adjacent to microdroplets containing the autoinducer, N-(3-oxododecanoyl-L-homoserine lactone (OdDHL. Functional activation of the LasR protein by diffusion of the OdDHL across the droplet interface was measured by monitoring the expression of green fluorescent protein (GFP from a LasR-dependent promoter. A threshold concentration of OdDHL was found to induce production of quorum-sensing associated GFP by E. coli. Additionally, we demonstrated that LasR-dependent activation of GFP expression was also initiated when the adjacent droplets contained single E. coli transformed with the OdDHL synthase gene, LasI, representing a simple quorum sensing circuit between two droplets.

  6. Real-Time Visualization of Active Species in a Single-Site Metal–Organic Framework Photocatalyst

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Sizhuo [Department of Chemistry, Marquette University, Milwaukee, Wisconsin 53201, United States; Pattengale, Brian [Department of Chemistry, Marquette University, Milwaukee, Wisconsin 53201, United States; Lee, Sungsik [X-ray Science Division, Argonne National Laboratory, Argonne, Illinois 60349, United States; Huang, Jier [Department of Chemistry, Marquette University, Milwaukee, Wisconsin 53201, United States

    2018-02-06

    In this work, we report a new single-site photocatalyst (Co-Ru-UIO- 67(bpy)) based on a metal-organic framework platform with incorporated molecular photosensitizer and catalyst. We show that this catalyst not only demonstrates exceptional activity for light-driven H2 production but also can be recycled without loss of activity. Using the combination of optical transient absorption spectroscopy and in situ X-ray absorption spectroscopy, we not only captured the key CoI intermediate species formed after ultrafast charge transfer from the incorporated photosensitizer but also identified the rate-limiting step in the catalytic cycle, providing insight into the catalysis mechanism of these single-site metal-organic framework photocatalysts.

  7. Molecular Characterization of Staphylococcus aureus Isolated from Bovine Mastitis and Close Human Contacts in South African Dairy Herds: Genetic Diversity and Inter-Species Host Transmission

    Science.gov (United States)

    Schmidt, Tracy; Kock, Marleen M.; Ehlers, Marthie M.

    2017-01-01

    Staphylococcus aureus is one of the most common etiological agents of contagious bovine mastitis worldwide. The purpose of this study was to genetically characterize a collection of S. aureus isolates (bovine = 146, human = 12) recovered from cases of bovine mastitis and nasal swabs of close human contacts in the dairy environment. Isolates were screened for a combination of clinically significant antimicrobial and virulence gene markers whilst the molecular epidemiology of these isolates and possible inter-species host transmission was investigated using a combination of genotyping techniques. None of the isolates under evaluation tested positive for methicillin or vancomycin resistance encoding genes. Twenty seven percent of the bovine S. aureus isolates tested positive for one or more of the pyrogenic toxin superantigen (PTSAg) genes with the sec and sell genes predominating. Comparatively, 83% of the human S. aureus isolates tested positive for one or more PTSAg genes with a greater variety of genes being detected. Genomic DNA macrorestriction followed by pulsed-field gel electrophoresis (PFGE) of the bovine isolates generated 58 electrophoretic patterns which grouped into 10 pulsotypes at an 80% similarity level. The majority of the bovine isolates, 93.2% (136/146), clustered into four major pulsotypes. Seven sequence types (ST) were identified among the representative bovine S. aureus isolates genotyped, including: ST8 (CC8), ST97 (CC97), ST351 (CC705), ST352 (CC97), ST508 (CC45), ST2992 (CC97) and a novel sequence type, ST3538 (CC97). Based on PFGE analysis, greater genetic diversity was observed among the human S. aureus isolates. Bovine and human isolates from three sampling sites clustered together and were genotypically indistinguishable. Two of the isolates, ST97 and ST352 belong to the common bovine lineage CC97, and their isolation from close human contacts suggests zoonotic transfer. In the context of this study, the third isolate, ST8 (CC8), is

  8. Identification of host fruit volatiles from three mayhaw species (Crataegus series Aestivales) attractive to mayhaw-origin Rhagoletis pomonella flies in the southern United States.

    Science.gov (United States)

    Cha, Dong H; Powell, Thomas H Q; Feder, Jeffrey L; Linn, Charles E

    2011-09-01

    The apple maggot fly, Rhagoletis pomonella, infests several hawthorn species in the southern USA. Here, we tested the hypothesis that these populations could serve as reservoirs for fruit odor discrimination behaviors facilitating sympatric host race formation and speciation, specifically the recent shift from downy hawthorn (Crataegus mollis) to domestic apple (Malus domestica) in the northern USA. Coupled gas chromatography and electroantennographic detection (GC-EAD), gas chromatography with mass spectrometry (GC-MS), and flight tunnel bioassays were used to identify the behaviorally active natal fruit volatile blends for three of the five major southern hawthorns: C. opaca (western mayhaw), C. aestivalis (eastern mayhaw), and C. rufula (a possible hybrid between C. opaca and C. aestivalis). A 6-component blend was developed for C. opaca (3-methylbutan-1-ol [44%], pentyl acetate [6%], butyl butanoate [6%], propyl hexanoate [6%], butyl hexanoate [26%], and hexyl butanoate [12%]); an 8-component blend for C. aestivalis (3-methylbutan-1-ol [2%], butyl acetate [47%], pentyl acetate [2%], butyl butanoate [12%], propyl hexanoate [1%], butyl hexanoate [25%], hexyl butanoate [9%], and pentyl hexanoate [2%]); and a 9-component blend for C. rufula (3-methylbutan-1-ol [1%], butyl acetate [57%], 3-methylbutyl acetate [3%], butyl butanoate [5%], propyl hexanoate [1%], hexyl propionate [1%], butyl hexanoate [23%], hexyl butanoate [6%], and pentyl hexanoate [3%]). Crataegus aestivalis and C. opaca-origin flies showed significantly higher levels of upwind directed flight to their natal blend in flight tunnel assays compared to the non-natal blend and previously developed apple, northern downy hawthorn, and flowering dogwood blends. Eastern and western mayhaw flies also were tested to the C. rufula blend, with eastern flies displaying higher levels of upwind flight compared with the western flies, likely due to the presence of butyl acetate in the C. aestivalis and C. rufula

  9. Isolation of dimorphic chloroplasts from the single-cell C4 species Bienertia sinuspersici

    Directory of Open Access Journals (Sweden)

    Lung Shiu-Cheung

    2012-03-01

    Full Text Available Abstract Three terrestrial plants are known to perform C4 photosynthesis without the dual-cell system by partitioning two distinct types of chloroplasts in separate cytoplasmic compartments. We report herein a protocol for isolating the dimorphic chloroplasts from Bienertia sinuspersici. Hypo-osmotically lysed protoplasts under our defined conditions released intact compartments containing the central chloroplasts and intact vacuoles with adhering peripheral chloroplasts. Following Percoll step gradient purification both chloroplast preparations demonstrated high homogeneities as evaluated from the relative abundance of respective protein markers. This protocol will open novel research directions toward understanding the mechanism of single-cell C4 photosynthesis.

  10. Chasing the hare - Evaluating the phylogenetic utility of a nuclear single copy gene region at and below species level within the species rich group Peperomia (Piperaceae

    Directory of Open Access Journals (Sweden)

    Naumann Julia

    2011-12-01

    Full Text Available Abstract Background The rapidly increasing number of available plant genomes opens up almost unlimited prospects for biology in general and molecular phylogenetics in particular. A recent study took advantage of this data and identified a set of nuclear genes that occur in single copy in multiple sequenced angiosperms. The present study is the first to apply genomic sequence of one of these low copy genes, agt1, as a phylogenetic marker for species-level phylogenetics. Its utility is compared to the performance of several coding and non-coding chloroplast loci that have been suggested as most applicable for this taxonomic level. As a model group, we chose Tildenia, a subgenus of Peperomia (Piperaceae, one of the largest plant genera. Relationships are particularly difficult to resolve within these species rich groups due to low levels of polymorphisms and fast or recent radiation. Therefore, Tildenia is a perfect test case for applying new phylogenetic tools. Results We show that the nuclear marker agt1, and in particular the agt1 introns, provide a significantly increased phylogenetic signal compared to chloroplast markers commonly used for low level phylogenetics. 25% of aligned characters from agt1 intron sequence are parsimony informative. In comparison, the introns and spacer of several common chloroplast markers (trnK intron, trnK-psbA spacer, ndhF-rpl32 spacer, rpl32-trnL spacer, psbA-trnH spacer provide less than 10% parsimony informative characters. The agt1 dataset provides a deeper resolution than the chloroplast markers in Tildenia. Conclusions Single (or very low copy nuclear genes are of immense value in plant phylogenetics. Compared to other nuclear genes that are members of gene families of all sizes, lab effort, such as cloning, can be kept to a minimum. They also provide regions with different phylogenetic content deriving from coding and non-coding parts of different length. Thus, they can be applied to a wide range of

  11. Differential Impacts of Virus Diversity on Biomass Production of a Native and an Exotic Grass Host

    Science.gov (United States)

    Mordecai, Erin A.; Hindenlang, Madeleine; Mitchell, Charles E.

    2015-01-01

    Pathogens are common and diverse in natural communities and have been implicated in the success of host invasions. Yet few studies have experimentally measured how pathogens impact native versus exotic hosts, particularly when individual hosts are simultaneously coinfected by diverse pathogens. To estimate effects of interactions among multiple pathogens within host individuals on both transmission of pathogens and fitness consequences for hosts, we conducted a greenhouse experiment using California grassland species: the native perennial grass Nassella (Stipa) pulchra, the exotic annual grass Bromus hordeaceus, and three virus species, Barley yellow dwarf virus-PAV, Barley yellow dwarf virus-MAV, and Cereal yellow dwarf virus-RPV. In terms of virus transmission, the native host was less susceptible than the exotic host to MAV. Coinfection of PAV and MAV did not occur in any of the 157 co-inoculated native host plants. In the exotic host, PAV infection most strongly reduced root and shoot biomass, and coinfections that included PAV severely reduced biomass. Infection with single or multiple viruses did not affect biomass in the native host. However, in this species the most potentially pathogenic coinfections (PAV + MAV and PAV + MAV + RPV) did not occur. Together, these results suggest that interactions among multiple pathogens can have important consequences for host health, which may not be predictable from interactions between hosts and individual pathogens. This work addresses a key empirical gap in understanding the impact of multiple generalist pathogens on competing host species, with potential implications for population and community dynamics of native and exotic species. It also demonstrates how pathogens with relatively mild impacts independently can more substantially reduce host performance in coinfection. PMID:26230720

  12. Single-Particle Momentum Distributions of Efimov States in Mixed-Species Systems

    DEFF Research Database (Denmark)

    T. Yamashita, M.; F. Bellotti, F.; Frederico, T.

    2013-01-01

    to derive formulas for the scaling factor of the Efimov spectrum for any mass ratio assuming either that two or three of the two-body subsystems have a bound state at zero energy. We consider the single-particle momentum distribution analytically and numerically and analyse the tail of the momentum......We solve the three-body bound state problem in three dimensions for mass imbalanced systems of two identical bosons and a third particle in the universal limit where the interactions are assumed to be of zero-range. The system displays the Efimov effect and we use the momentum-space wave equation...... distribution to obtain the three-body contact parameter. Our finding demonstrate that the functional form of the three-body contact term depends on the mass ratio and we obtain an analytic expression for this behavior. To exemplify our results, we consider mixtures of Lithium with either two Caesium or Rubium...

  13. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  14. A Single Species of Clostridium Subcluster XIVa Decreased in Ulcerative Colitis Patients.

    Science.gov (United States)

    Takeshita, Kozue; Mizuno, Shinta; Mikami, Yohei; Sujino, Tomohisa; Saigusa, Keiichiro; Matsuoka, Katsuyoshi; Naganuma, Makoto; Sato, Tadashi; Takada, Toshihiko; Tsuji, Hirokazu; Kushiro, Akira; Nomoto, Koji; Kanai, Takanori

    2016-12-01

    Imbalance of the intestinal microbiota is associated with gastrointestinal disease and autoimmune disease and metabolic syndrome. Analysis of the intestinal microbiota has recently progressed, and the association with inflammatory bowel disease has been reported at the species level. Such findings suggest that the recovery of homeostasis in the intestinal microbiota could cure inflammatory bowel disease. We aimed to search new probiotic candidates for inflammatory bowel disease through translational research by analysis of ulcerative colitis (UC) patients' intestinal microbiota and clarify the effects of them on inflammation. Here, we focused on Fusicatenibacter saccharivorans, which belongs to Clostridium subcluster XIVa and was successfully isolated and cultured in 2013. We analyzed the association of F. saccharivorans to UC patients' activity and inflammation for the first time. Feces from UC patients and healthy controls were analyzed by 16S ribosomal RNA gene sequences. F. saccharivorans was administered to murine colitis model. Colitic lamina propria mononuclear cells from UC patients and mice were stimulated with F. saccharivorans. The whole fecal bacteria in active UC patients were less than that in quiescent UC patients. Furthermore, F. saccharivorans was decreased in active UC patients and increased in quiescent. The administration of F. saccharivorans improved murine colitis. F. saccharivorans induced interleukin 10 production by lamina propria mononuclear cells from not only colitis model mice but also UC patients. F. saccharivorans decreased in correlation to UC activity and suppresses intestinal inflammation. These results suggest that F. saccharivorans could lead to a novel UC treatment.

  15. Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

    Science.gov (United States)

    Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

    2015-07-01

    Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Effects of Nitrogen Addition on Leaf Decomposition of Single-Species and Litter Mixture in Pinus tabulaeformis Forests

    Directory of Open Access Journals (Sweden)

    Jinsong Wang

    2015-12-01

    Full Text Available The litter decomposition process is closely correlated with nutrient cycling and the maintenance of soil fertility in the forest ecosystem. In particular, the intense environmental concern about atmospheric nitrogen (N deposition requires a better understanding of its influence on the litter decomposition process. This study examines the responses of single-species litter and litter mixture decomposition processes to N addition in Chinese pine (Pinus tabulaeformis Carr. ecosystems. Chinese pine litter, Mongolian oak (Quercus mongolica Fisch. ex Ledeb. litter, and a pine–oak mixture were selected from a plantation and a natural forest of Chinese pine. Four N addition treatments, i.e., control (N0: 0 kg N ha−1·year−1, low-N (N1: 5 kg N ha−1·year−1, medium-N (N2: 10 kg N ha−1·year−1, and high-N (N3: 15 kg N ha−1·year−1, were applied starting May 2010. In the plantation, N addition significantly stimulated the decomposition of the Chinese pine litter. In the natural forest, N addition had variable effects on the decomposition of single-species litter and the litter mixture. A stimulatory effect of the high-N treatment on the Chinese pine litter decomposition could be attributed to a decrease in the substrate C:N ratio. However, an opposite effect was found for the Mongolian oak litter decomposition. The stimulating effect of N addition on the Chinese pine litter may offset the suppressive effect on the Mongolian oak litter, resulting in a neutral effect on the litter mixture. These results suggest that the different responses in decomposition of single-species litter and the litter mixture to N addition are mainly attributed to litter chemical composition. Further investigations are required to characterize the effect of long-term high-level N addition on the litter decomposition as N deposition is likely to increase rapidly in the region where this study was conducted.

  17. Frequency and Distribution of Single-Nucleotide Polymorphisms within mprF in Methicillin-Resistant Staphylococcus aureus Clinical Isolates and Their Role in Cross-Resistance to Daptomycin and Host Defense Antimicrobial Peptides.

    Science.gov (United States)

    Bayer, Arnold S; Mishra, Nagendra N; Chen, Liang; Kreiswirth, Barry N; Rubio, Aileen; Yang, Soo-Jin

    2015-08-01

    MprF is responsible for the lysinylation of phosphatidylglycerol (PG) to synthesize the positively charged phospholipid (PL) species, lysyl-PG (L-PG). It has been proposed that the single-nucleotide polymorphisms (SNPs) within the mprF open reading frame (ORF) are associated with a gain-in-function phenotype in terms of daptomycin resistance in Staphylococcus aureus. (Note that although the official term is daptomycin nonsusceptibility, we use the term daptomycin resistance in this paper for ease of presentation.) Using 22 daptomycin-susceptible (DAP(s))/daptomycin-resistant (DAP(r)) clinical methicillin-resistant S. aureus (MRSA) strain pairs, we assessed (i) the frequencies and distribution of putative mprF gain-in-function SNPs, (ii) the relationships of the SNPs to both daptomycin resistance and cross-resistance to the prototypical endovascular host defense peptide (HDP) thrombin-induced platelet microbicidal protein (tPMP), and (iii) the impact of mprF SNPs on positive surface charge phenotype and modifications of membrane PL profiles. Most of the mprF SNPs identified in our DAP(r) strains were clustered within the two MprF loci, (i) the central bifunctional domain and (ii) the C-terminal synthase domain. Moreover, we were able to correlate the presence and location of mprF SNPs in DAP(r) strains with HDP cross-resistance, positive surface charge, and L-PG profiles. Although DAP(r) strains with mprF SNPs in the bifunctional domain showed higher resistance to tPMPs than DAP(r) strains with SNPs in the synthase domain, this relationship was not observed in positive surface charge assays. These results demonstrated that both charge-mediated and -unrelated mechanisms are involved in DAP resistance and HDP cross-resistance in S. aureus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Conserved host-pathogen PPIs. Globally conserved inter-species bacterial PPIs based conserved host-pathogen interactome derived novel target in C. pseudotuberculosis, C. diphtheriae, M. tuberculosis, C. ulcerans, Y. pestis, and E. coli targeted by Piper betel compounds

    DEFF Research Database (Denmark)

    Barh, Debmalya; Gupta, Krishnakant; Jain, Neha

    2013-01-01

    -species bacterial PPI using conserved proteins in multiple pathogens (Y. pestis, M. tuberculosis, C. diphtheriae, C. ulcerans, E. coli, and all four Cp strains) and E. Coli based experimentally validated PPI data. Furthermore, the interacting proteins in the common conserved inter-species bacterial PPI were used...

  19. Singly protonated dehydronorcantharidin silver coordination polymer induces apoptosis of lung cancer cells via reactive oxygen species-mediated mitochondrial pathway.

    Science.gov (United States)

    Li, Senpeng; Zhang, Shuo; Jin, Xing; Tan, Xuejie; Lou, Jianfang; Zhang, Xiumei; Zhao, Yunxue

    2014-10-30

    Silver complexes have been shown to possess antimicrobial and anticancer properties. Ag-SP-DNC, a novel silver and singly protonated dehydronorcantharidin complex, was synthesized in our previous study. In this study, we offer evidence that Ag-SP-DNC elicits a reactive oxygen species (ROS)-mediated mitochondrial apoptosis in lung cancer cells. Ag-SP-DNC inhibited the growth of A549 cells by inducing G2/M phase cell cycle arrest and apoptosis. Ag-SP-DNC induced apoptosis was associated with the levels of intracellular ROS. The further study revealed that Ag-SP-DNC disrupted the mitochondrial membrane potential, induced the caspase-3 activation and led to the translocation of apoptosis inducing factor and endonucleaseG to the nucleus. These findings have important implications for the development of silver complexes for anticancer applications. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  20. A Single-Center Pilot Prospective Study of Topical Application of Platelet-Derived Eye Drops for Patients with Ocular Chronic Graft-versus-Host Disease.

    Science.gov (United States)

    Zallio, Francesco; Mazzucco, Laura; Monaco, Federico; Astori, Maria Rosa; Passera, Roberto; Drago, Giovanna; Tamiazzo, Stefania; Rapetti, Manuela; Dolcino, Daniela; Guaschino, Roberto; Pini, Massimo; Ladetto, Marco

    2016-09-01

    Ocular involvement of chronic graft-versus-host disease (cGVHD) is a complication that occurs in up to 60% of patients after allogeneic hematopoietic stem cell transplantation. Conventional therapeutic options include medical and surgical procedures that are administered depending on the severity of the condition, but most of them have provided unsatisfactory results and, to date, there is no consensus about treatment. We considered that topical application of a platelet lysate, administered as eye drops, might be considered an alternative worthwhile of investigation to treat ocular surface disorders in patients suffering from cGVHD. Therefore, we conducted a single-center prospective pilot study to assess the efficacy and safety of using eye drops made from reconstituted lysed platelet concentrate. Twenty-six patients with ocular cGVHD were eligible for the study; all but 2 completed their scheduled 1-year treatment and complied with the hematologic and ophthalmic regimen. At their first assessment interviews, after 30 days of treatment, 91% of patients reported an improvement in their symptoms and for 32%, substantive objective differences were measured. Remission of corneal damage was seen for 86% of our cohort, and improved National Institutes of Health scores for 73%, of whom 8% achieved the best score of 0 (ie, non-dry eye). Similar results were seen at later time points. Comparing outcomes for our patient cohort to those determined retrospectively for patients in our institutional database revealed a 5-year overall survival (OS) of 65%. This OS is comparable to patients with limited cGVHD (75%) and is superior to that of patients with nonocular extensive cGVHD or without cGVHD (30% and 59%, respectively) (P = .013). Our results suggest that platelet-derived eye drops are a safe, practical, and well-tolerated therapeutic option that offers substantial benefits for most patients affected by ocular cGVHD at onset. The favorable OS of our patient cohort

  1. Escherichia coli MW005: lambda Red-mediated recombineering and copy-number induction of oriV-equipped constructs in a single host

    Directory of Open Access Journals (Sweden)

    Hope Ian A

    2010-03-01

    Full Text Available Abstract Background Escherichia coli strain EL350 contains chromosomally integrated phage lambda Red recombinase genes enabling this strain to be used for modifying the sequence of resident clones via recombineering. BAC and fosmid clones are highly suitable for modification by recombineering but, because they are present at low (1-2 copies per cell, the DNA is difficult to isolate in high yield and purity. To overcome this limitation vectors, e.g. pCC1FOS, have been constructed that contain the additional replication origin, oriV, which permits copy-number to be induced transiently when propagated in a suitable host strain, e.g. EPI300, that supplies the cognate trans-replication protein TrfA. Previously, we used EL350 and EPI300 sequentially to recombineer oriV-equipped fosmid genomic clones and, subsequently, to induce copy-number of the resulting recombinant clone. To eliminate these intervening DNA isolation and transformation steps we retrofitted EL350 with a PBAD-driven trfA gene generating strain MW005 that supports, independently, both recombineering and copy-number induction. Results The PBAD-driven copy of cre in EL350 was replaced seamlessly with a copy of trfA, PCR-amplified from EPI300 chromosomal DNA, to generate MW005. This new strain has been used to both generate, via recombineering, a number of reporter gene fusions directly from pCC1FOS-based Caenorhabditis elegans genomic clones and to transiently induce copy-number of fosmid and BAC clones prior to DNA preparation. Conclusions By retrofitting EL350, an established 'recombineering' E. coli strain, with a tightly regulated copy of trfA we have produced a new strain, MW005, which combines recombineering capacity with the useful ability to transiently induce copy-number of oriV-equipped clones. By coupling these two steps in a single strain, use of MW005 will enable the more rapid recombineering-mediated production of recombinant clones in the yield and quality necessary for

  2. Plantas cultivadas e invasoras como habitat para predadores do gênero Orius(Wolff (Heteroptera: anthocoridae Crops and weeds as host plants Orius species (Heteroptera: anthocoridae

    Directory of Open Access Journals (Sweden)

    Luís Cláudio Paterno Silveira

    2003-01-01

    Full Text Available O objetivo deste trabalho foi registrar as espécies de Orius associadas a plantas cultivadas e invasoras presentes em uma localidade de Minas Gerais e três de São Paulo, nos anos de 1999 e 2000. As coletas foram realizadas através de batidas das plantas no interior de sacos plásticos para desalojar os insetos. Posteriormente, as espécies foram separadas em laboratório. O predador Orius insidiosus (Say foi coletado nas culturas de milho (Zea mays L., milheto (Pennisetum glaucum (L. R.Br., sorgo (Sorghum spp., feijão (Phaseolus vulgaris L., girassol (Helianthus annuus L., alfafa (Medicago sativa L., soja [Glycine max (L. Merr.], crisântemo (Chrysanthemum spp., tango (Solidago canadensis L. e cartamus (Carthamus tinctorius L. e nas plantas invasoras picão-preto (Bidens pilosa L., caruru (Amaranthus sp., losna-branca (Parthenium hysterophorus L. e apaga-fogo (Alternanthera ficoidea L.. Orius thyestes Herring foi encontrado nas plantas invasoras picão-preto, caruru e apaga-fogo. Orius perpunctatus (Reuter e Orius sp. foram coletados principalmente nas plantas invasoras picão-preto, caruru e apaga-fogo e no milho. Constatou-se que muitas dessas plantas são reservatórios naturais para esses predadores, em termos de habitat, abrigo, presas e pólen.The aim of this research was to record the Orius species present on some crops and weeds in areas located in the southeast region in Brazil, during 1999 and 2000. The insect collections were made through the tapping method to dislodge the insects from the plant into a plastic bag. The identifications of the specimens was done in the laboratory. Orius insidiosus (Say was collected on the following crops: corn (Zea mays L., pearl millet (Pennisetum glaucum (L. R.Br., sorghum (Sorghum spp., bean (Phaseolus vulgaris L., sunflower (Helianthus annuus L., alfalfa (Medicago sativa L., soybean (Glycine max (L. Merr., chrysanthemum (Chrysanthemum spp., tango (Solidago canadensis L. and carthamus

  3. Strain typing of Zygosaccharomyces yeast species using a single molecular method based on polymorphism of the intergenic spacer region (IGS).

    Science.gov (United States)

    Wrent, Petra; Rivas, Eva-María; Peinado, José M; de Silóniz, María-Isabel

    2010-08-15

    Unlike previously reported methods that need a combination of several typing techniques, we have developed a single method for strain typing of the Zygosaccharomyces bailii, Z. mellis and Z. rouxii spoilage species. Strains belonging to other species have also been included for comparison. We have demonstrated that the IGS-PCR RFLP method has a high discriminative power. Considering the three endonucleases used in this work, we have obtained a variability of 100% for Z. mellis and Z. rouxii strains and up to 70% for Z. bailii. We have also detected two misidentified Z. mellis strains (CBS 711 and CBS 7412) which have RFLP patterns with a set of bands characteristic of Z. rouxii strains. Sequencing of 26S rDNA D1/D2 domains and the 5.8-ITS rDNA region confirmed these strains as Z. rouxii. The method also groups three certified hybrid strains of Zygosaccharomyces in a separate cluster. Copyright 2010 Elsevier B.V. All rights reserved.

  4. Identification of the host determinant of two prolate-headed phages infecting lactococcus lactis

    International Nuclear Information System (INIS)

    Stuer-Lauridsen, Birgitte; Janzen, Thomas; Schnabl, Jannie; Johansen, Eric

    2003-01-01

    A gene responsible for host determination was identified in two prolate-headed bacteriophages of the c2 species infecting strains of Lactococcus lactis. The identification of the host determinant gene was based on low DNA sequence homology in a specific open reading frame (ORF) between prolate-headed phages with different host ranges. When a host carrying this ORF from one phage on a plasmid was infected with another phage, we obtained phages with an altered host range at a frequency of 10 -6 to 10 -7 . Sequencing of phage DNA originating from 10 independent single plaques confirmed that a genetic recombination had taken place at different positions between the ORF on the plasmid and the infecting phage. The adsorption of the recombinant phages to their bacterial hosts had also changed to match the phage origin of the ORF. Consequently, it is concluded that this ORF codes for the host range determinant

  5. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    Science.gov (United States)

    2011-01-01

    Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of oral microbiology, as many of

  6. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    Directory of Open Access Journals (Sweden)

    Thurnheer Thomas

    2011-01-01

    Full Text Available Abstract Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of

  7. Mixing state of particles with secondary species by single particle aerosol mass spectrometer in an atmospheric pollution event

    Science.gov (United States)

    Xu, Lingling; Chen, Jinsheng

    2016-04-01

    Single particle aerosol mass spectrometer (SPAMS) was used to characterize size distribution, chemical composition, and mixing state of particles in an atmospheric pollution event during 20 Oct. - 5 Nov., 2015 in Xiamen, Southeast China. A total of 533,012 particle mass spectra were obtained and clustered into six groups, comprising of industry metal (4.5%), dust particles (2.6%), carbonaceous species (70.7%), K-Rich particles (20.7%), seasalt (0.6%) and other particles (0.9%). Carbonaceous species were further divided into EC (70.6%), OC (28.5%), and mixed ECOC (0.9%). There were 61.7%, 58.3%, 4.0%, and 14.6% of particles internally mixed with sulfate, nitrate, ammonium and C2H3O, respectively, indicating that these particles had undergone significant aging processing. Sulfate was preferentially mixed with carbonaceous particles, while nitrate tended to mix with metal-containing and dust particles. Compared to clear days, the fractions of EC-, metal- and dust particles remarkably increased, while the fraction of OC-containing particles decreased in pollution days. The mixing state of particles, excepted for OC-containing particles with secondary species was much stronger in pollution days than that in clear days, which revealed the significant influence of secondary particles in atmospheric pollution. The different activity of OC-containing particles might be related to their much smaller aerodynamic diameter. These results could improve our understanding of aerosol characteristics and could be helpful to further investigate the atmospheric process of particles.

  8. Effects of sediment-spiked lufenuron on benthic macroinvertebrates in outdoor microcosms and single-species toxicity tests.

    Science.gov (United States)

    Brock, T C M; Bas, D A; Belgers, J D M; Bibbe, L; Boerwinkel, M-C; Crum, S J H; Diepens, N J; Kraak, M H S; Vonk, J A; Roessink, I

    2016-08-01

    Sediment ecotoxicity studies were conducted with lufenuron to (i) complement the results of a water-spiked mesocosm experiment with this lipophilic benzoylurea insecticide, (ii) to explore the predictive value of laboratory single-species tests for population and community-level responses of benthic macroinvertebrates, and (iii) to calibrate the tier-1 effect assessment procedure for sediment organisms. For this purpose the concentration-response relationships for macroinvertebrates between sediment-spiked microcosms and those of 28-d sediment-spiked single-species toxicity tests with Chironomus riparius, Hyalella azteca and Lumbriculus variegatus were compared. Lufenuron persisted in the sediment of the microcosms. On average, 87.7% of the initial lufenuron concentration could still be detected in the sediment after 12 weeks. Overall, benthic insects and crustaceans showed treatment-related declines and oligochaetes treatment-related increases. The lowest population-level NOEC in the microcosms was 0.79μg lufenuron/g organic carbon in dry sediment (μg a.s./g OC) for Tanytarsini, Chironomini and Dero sp. Multivariate analysis of the responses of benthic macroinvertebrates revealed a community-level NOEC of 0.79μg a.s./g OC. The treatment-related responses observed in the microcosms are in accordance with the results of the 28-d laboratory toxicity tests. These tests showed that the insect C. riparius and the crustacean H. azteca were approximately two orders of magnitude more sensitive than the oligochaete L. variegatus. In our laboratory tests, using field-collected sediment, the lowest 28-d EC10 (0.49μg a.s./g OC) was observed for C. riparius (endpoint survival), while for the standard OECD test with this species, using artificial sediment, a NOEC of 2.35μg a.s./g OC (endpoint emergence) is reported. In this particular case, the sediment tier-1 effect assessment using the chronic EC10 (field-collected sediment) or chronic NOEC (artificial sediment) of C

  9. A check list of the helminths of guineafowls (Numididae) and a host list of these parasites.

    Science.gov (United States)

    Junker, K; Boomker, J

    2007-12-01

    Published and personal records have been compiled into a reference list of the helminth parasites of guineafowls. Where data on other avian hosts was available these have been included for completeness' sake and to give an indication of host range. The parasite list for the Helmeted guineafowls, Numida meleagris, includes five species of acanthocephalans, all belonging to a single genus, three trematodes belonging to three different genera, 34 cestodes representing 15 genera, and 35 nematodes belonging to 17 genera. The list for the Crested guineafowls, Guttera edouardi, contains a single acanthocephalan together with 10 cestode species belonging to seven genera, and three nematode species belonging to three different genera. Records for two cestode species from genera and two nematode species belonging to a single genus have been found for the guineafowl genus Acryllium. Of the 70 helminths listed for N. meleagris, 29 have been recorded from domestic chickens.

  10. The anionic 3D-framework [Ga.sub.2./sub.(PO.sub.4./sub.).sub.3./sub.].sub.∞./sub.: a microporous host lattice for various species  

    Czech Academy of Sciences Publication Activity Database

    Lesage, J.; Guesdon, A.; Raveau, B.; Petříček, Václav

    2004-01-01

    Roč. 177, - (2004), s. 3581-3589 ISSN 0022-4596 R&D Projects: GA ČR(CZ) GA202/03/0430 Institutional research plan: CEZ:AV0Z1010914 Keywords : ammonium gallium monophosphate * hydrothermal synthesis * single crystal * X-ray diffraction * structure determination * tunnel structure * hydrogen bonds * three-dimensional host lattice * cationic substitution Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.815, year: 2004

  11. Effects of sediment-spiked lufenuron on benthic macroinvertebrates in outdoor microcosms and single-species toxicity tests

    Energy Technology Data Exchange (ETDEWEB)

    Brock, T.C.M., E-mail: theo.brock@wur.nl [Alterra, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands); Bas, D.A. [Institute for Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam (Netherlands); Belgers, J.D.M. [Alterra, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands); Bibbe, L. [Institute for Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam (Netherlands); Boerwinkel, M-C.; Crum, S.J.H. [Alterra, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands); Diepens, N.J. [Department of Aquatic Ecology and Water Quality Management, Wageningen University, P.O. Box 47, 6700 AA Wageningen (Netherlands); Kraak, M.H.S.; Vonk, J.A. [Institute for Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam (Netherlands); Roessink, I. [Alterra, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands)

    2016-08-15

    Highlights: • In outdoor microcosms constructed with lufenuron-spiked sediment we observed that this insecticide persistent in the sediment compartment. • Sediment exposure to lufenuron caused population-level declines (insects and crustaceans) and increases (mainly oligochaete worms) of benthic invertebrates. • The direct and indirect effects observed in the microcosms were supported by results of sediment-spiked single species tests with Chironomus riparius, Hyalella azteca and Lumbriculus variegatus. • The tier-1 effect assessment procedure for sediment organisms recommended by the European Food Safety Authority is protective for the treatment-related responses observed in the microcosm test. - Abstract: Sediment ecotoxicity studies were conducted with lufenuron to (i) complement the results of a water-spiked mesocosm experiment with this lipophilic benzoylurea insecticide, (ii) to explore the predictive value of laboratory single-species tests for population and community-level responses of benthic macroinvertebrates, and (iii) to calibrate the tier-1 effect assessment procedure for sediment organisms. For this purpose the concentration-response relationships for macroinvertebrates between sediment-spiked microcosms and those of 28-d sediment-spiked single-species toxicity tests with Chironomus riparius, Hyalella azteca and Lumbriculus variegatus were compared. Lufenuron persisted in the sediment of the microcosms. On average, 87.7% of the initial lufenuron concentration could still be detected in the sediment after 12 weeks. Overall, benthic insects and crustaceans showed treatment-related declines and oligochaetes treatment-related increases. The lowest population-level NOEC in the microcosms was 0.79 μg lufenuron/g organic carbon in dry sediment (μg a.s./g OC) for Tanytarsini, Chironomini and Dero sp. Multivariate analysis of the responses of benthic macroinvertebrates revealed a community-level NOEC of 0.79 μg a.s./g OC. The treatment

  12. Molecular biology of viroid-host interactions and disease control strategies.

    Science.gov (United States)

    Kovalskaya, Natalia; Hammond, Rosemarie W

    2014-11-01

    Viroids are single-stranded, covalently closed, circular, highly structured noncoding RNAs that cause disease in several economically important crop plants. They replicate autonomously and move systemically in host plants with the aid of the host machinery. In addition to symptomatic infections, viroids also cause latent infections where there is no visual evidence of infection in the host; however, transfer to a susceptible host can result in devastating disease. While there are non-hosts for viroids, no naturally occurring durable resistance has been observed in most host species. Current effective control methods for viroid diseases include detection and eradication, and cultural controls. In addition, heat or cold therapy combined with meristem tip culture has been shown to be effective for elimination of viroids for some viroid-host combinations. An understanding of viroid-host interactions, host susceptibility, and non-host resistance could provide guidance for the design of viroid-resistant plants. Efforts to engineer viroid resistance into host species have been underway for several years, and include the use of antisense RNA, antisense RNA plus ribozymes, a dsRNase, and siRNAs, among others. The results of those efforts and the challenges associated with creating viroid resistant plants are summarized in this review. Published by Elsevier Ireland Ltd.

  13. Development and assessment of multiplex high resolution melting assay as a tool for rapid single-tube identification of five Brucella species.

    Science.gov (United States)

    Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M

    2014-12-11

    The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.

  14. Adaptation of the pathogen, Pseudomonas syringae, during experimental evolution on a native vs. alternative host plant.

    Science.gov (United States)

    Meaden, Sean; Koskella, Britt

    2017-04-01

    The specialization and distribution of pathogens among species has substantial impact on disease spread, especially when reservoir hosts can maintain high pathogen densities or select for increased pathogen virulence. Theory predicts that optimal within-host growth rate will vary among host genotypes/species and therefore that pathogens infecting multiple host