WorldWideScience

Sample records for single common haplotype

  1. Common ataxia telangiectasia mutated haplotypes and risk of breast cancer: a nested case–control study

    International Nuclear Information System (INIS)

    Tamimi, Rulla M; Hankinson, Susan E; Spiegelman, Donna; Kraft, Peter; Colditz, Graham A; Hunter, David J

    2004-01-01

    The ataxia telangiectasia mutated (ATM) gene is a tumor suppressor gene with functions in cell cycle arrest, apoptosis, and repair of DNA double-strand breaks. Based on family studies, women heterozygous for mutations in the ATM gene are reported to have a fourfold to fivefold increased risk of breast cancer compared with noncarriers of the mutations, although not all studies have confirmed this association. Haplotype analysis has been suggested as an efficient method for investigating the role of common variation in the ATM gene and breast cancer. Five biallelic haplotype tagging single nucleotide polymorphisms are estimated to capture 99% of the haplotype diversity in Caucasian populations. We conducted a nested case–control study of breast cancer within the Nurses' Health Study cohort to address the role of common ATM haplotypes and breast cancer. Cases and controls were genotyped for five haplotype tagging single nucleotide polymorphisms. Haplotypes were predicted for 1309 cases and 1761 controls for which genotype information was available. Six unique haplotypes were predicted in this study, five of which occur at a frequency of 5% or greater. The overall distribution of haplotypes was not significantly different between cases and controls (χ 2 = 3.43, five degrees of freedom, P = 0.63). There was no evidence that common haplotypes of ATM are associated with breast cancer risk. Extensive single nucleotide polymorphism detection using the entire genomic sequence of ATM will be necessary to rule out less common variation in ATM and sporadic breast cancer risk

  2. Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

    Science.gov (United States)

    Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

    2009-09-01

    Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

  3. Complete MHC Haplotype Sequencing for Common Disease Gene Mapping

    Science.gov (United States)

    Stewart, C. Andrew; Horton, Roger; Allcock, Richard J.N.; Ashurst, Jennifer L.; Atrazhev, Alexey M.; Coggill, Penny; Dunham, Ian; Forbes, Simon; Halls, Karen; Howson, Joanna M.M.; Humphray, Sean J.; Hunt, Sarah; Mungall, Andrew J.; Osoegawa, Kazutoyo; Palmer, Sophie; Roberts, Anne N.; Rogers, Jane; Sims, Sarah; Wang, Yu; Wilming, Laurens G.; Elliott, John F.; de Jong, Pieter J.; Sawcer, Stephen; Todd, John A.; Trowsdale, John; Beck, Stephan

    2004-01-01

    The future systematic mapping of variants that confer susceptibility to common diseases requires the construction of a fully informative polymorphism map. Ideally, every base pair of the genome would be sequenced in many individuals. Here, we report 4.75 Mb of contiguous sequence for each of two common haplotypes of the major histocompatibility complex (MHC), to which susceptibility to >100 diseases has been mapped. The autoimmune disease-associated-haplotypes HLA-A3-B7-Cw7-DR15 and HLA-A1-B8-Cw7-DR3 were sequenced in their entirety through a bacterial artificial chromosome (BAC) cloning strategy using the consanguineous cell lines PGF and COX, respectively. The two sequences were annotated to encompass all described splice variants of expressed genes. We defined the complete variation content of the two haplotypes, revealing >18,000 variations between them. Average SNP densities ranged from less than one SNP per kilobase to >60. Acquisition of complete and accurate sequence data over polymorphic regions such as the MHC from large-insert cloned DNA provides a definitive resource for the construction of informative genetic maps, and avoids the limitation of chromosome regions that are refractory to PCR amplification. PMID:15140828

  4. Haplotyping a single triploid individual based on genetic algorithm.

    Science.gov (United States)

    Wu, Jingli; Chen, Xixi; Li, Xianchen

    2014-01-01

    The minimum error correction model is an important combinatorial model for haplotyping a single individual. In this article, triploid individual haplotype reconstruction problem is studied by using the model. A genetic algorithm based method GTIHR is presented for reconstructing the triploid individual haplotype. A novel coding method and an effectual hill-climbing operator are introduced for the GTIHR algorithm. This relatively short chromosome code can lead to a smaller solution space, which plays a positive role in speeding up the convergence process. The hill-climbing operator ensures algorithm GTIHR converge at a good solution quickly, and prevents premature convergence simultaneously. The experimental results prove that algorithm GTIHR can be implemented efficiently, and can get higher reconstruction rate than previous algorithms.

  5. Carrier frequency of a nonsense mutation in the adenosine deaminase (ADA) gene implies a high incidence of ADA-deficient severe combined immunodeficiency (SCID) in Somalia and a single, common haplotype indicates common ancestry

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Monaghan, Gemma; Børsting, Claus

    2007-01-01

    Inherited adenosine deaminase (ADA) deficiency is a rare metabolic disorder that causes immunodeficiency, varying from severe combined immunodeficiency (SCID) in the majority of cases to a less severe form in a small minority of patients. Five patients of Somali origin from four unrelated families......, with severe ADA-SCID, were registered in the Greater London area. Patients and their parents were investigated for the nonsense mutation Q3X (ADA c7C>T), two missense mutations K80R (ADA c239A>G) and R142Q (ADA c425G>A), and a TAAA repeat located at the 3' end of an Alu element (AluVpA) positioned 1.1 kb...... upstream of the ADA transcription start site. All patients were homozygous for the haplotype ADA-7T/ADA-239G/ADA-425G/AluVpA7. Among 207 Somali immigrants to Denmark, the frequency of ADA c7C>T and the maximum likelihood estimate of the frequency of the haplotype ADA-7T/ADA-239G/ADA-425G/AluVpA7 were both...

  6. Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

    Science.gov (United States)

    Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

    2011-01-01

    Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

  7. Polymorphism at expressed DQ and DR loci in five common equine MHC haplotypes.

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A; Antczak, Douglas F

    2017-03-01

    The polymorphism of major histocompatibility complex (MHC) class II DQ and DR genes in five common equine leukocyte antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine bacterial artificial chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next generation sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse.

  8. Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

    2016-01-01

    The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

  9. Common SNP-Based Haplotype Analysis of the 4p16.3 Huntington Disease Gene Region

    Science.gov (United States)

    Lee, Jong-Min; Gillis, Tammy; Mysore, Jayalakshmi Srinidhi; Ramos, Eliana Marisa; Myers, Richard H.; Hayden, Michael R.; Morrison, Patrick J.; Nance, Martha; Ross, Christopher A.; Margolis, Russell L.; Squitieri, Ferdinando; Griguoli, Annamaria; Di Donato, Stefano; Gomez-Tortosa, Estrella; Ayuso, Carmen; Suchowersky, Oksana; Trent, Ronald J.; McCusker, Elizabeth; Novelletto, Andrea; Frontali, Marina; Jones, Randi; Ashizawa, Tetsuo; Frank, Samuel; Saint-Hilaire, Marie-Helene; Hersch, Steven M.; Rosas, Herminia D.; Lucente, Diane; Harrison, Madaline B.; Zanko, Andrea; Abramson, Ruth K.; Marder, Karen; Sequeiros, Jorge; MacDonald, Marcy E.; Gusella, James F.

    2012-01-01

    Age at the onset of motor symptoms in Huntington disease (HD) is determined largely by the length of a CAG repeat expansion in HTT but is also influenced by other genetic factors. We tested whether common genetic variation near the mutation site is associated with differences in the distribution of expanded CAG alleles or age at the onset of motor symptoms. To define disease-associated single-nucleotide polymorphisms (SNPs), we compared 4p16.3 SNPs in HD subjects with population controls in a case:control strategy, which revealed that the strongest signals occurred at a great distance from the HD mutation as a result of “synthetic association” with SNP alleles that are of low frequency in population controls. Detailed analysis delineated a prominent ancestral haplotype that accounted for ∼50% of HD chromosomes and extended to at least 938 kb on about half of these. Together, the seven most abundant haplotypes accounted for ∼83% of HD chromosomes. Neither the extended shared haplotype nor the individual local HTT haplotypes were associated with altered CAG-repeat length distribution or residual age at the onset of motor symptoms, arguing against modification of these disease features by common cis-regulatory elements. Similarly, the 11 most frequent control haplotypes showed no trans-modifier effect on age at the onset of motor symptoms. Our results argue against common local regulatory variation as a factor influencing HD pathogenesis, suggesting that genetic modifiers be sought elsewhere in the genome. They also indicate that genome-wide association analysis with a small number of cases can be effective for regional localization of genetic defects, even when a founder effect accounts for only a fraction of the disorder. PMID:22387017

  10. Functional epistasis on a common MHC haplotype associated with multiple sclerosis

    DEFF Research Database (Denmark)

    Gregersen, Jon Waarst; Kranc, Kamil R; Ke, Xiayi

    2006-01-01

    Genes in the major histocompatibility complex (MHC) encode proteins important in activating antigen-specific immune responses. Alleles at adjacent MHC loci are often in strong linkage disequilibrium; however, little is known about the mechanisms responsible for this linkage disequilibrium. Here we...... report that the human MHC HLA-DR2 haplotype, which predisposes to multiple sclerosis, shows more extensive linkage disequilibrium than other common caucasian HLA haplotypes in the DR region and thus seems likely to have been maintained through positive selection. Characterization of two multiple...

  11. Massively Parallel Haplotyping on Microscopic Beads for the High-Throughput Phase Analysis of Single Molecules

    Science.gov (United States)

    Tiemann-Boege, Irene

    2012-01-01

    In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1∶10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases. PMID:22558329

  12. Evolutionary history of DLA class II haplotypes in canine diabetes mellitus through single nucleotide polymorphism genotyping.

    Science.gov (United States)

    Seddon, J M; Berggren, K T; Fleeman, L M

    2010-03-01

    Strong linkage disequilibrium (LD) is a characteristic of the major histocompatibility complex (MHC) region, as well as the genome in general in dogs as a consequence of demographic changes with domestication. Disease association studies of MHC haplotypes may be affected by high LD and the resultant shared genetic backgrounds of haplotypes giving associations with linked but non-causative mutations, and also by convergent haplotypes, in which combinations of alleles have arisen independently. This study provides preliminary tools for dog leukocyte antigen (DLA) class II haplotype analysis with 102 single nucleotide polymorphisms (SNPs) identified in 14.6 kb and genotyping of 20 of these SNPs to tag haplotypes in 60 dogs with diabetes mellitus and in 49 non-diabetic dogs. The pattern of LD and analysis of SNP patterns indicated combinations of exon 2 alleles have arisen through both recombination and convergence. For exon 2 haplotypes associated with susceptibility or protection from diabetes mellitus, a region of fixed differences in SNPs across the DQ region was observed, suggesting a region outside exon 2 may be implicated in disease association. Four new DQB1 promoter alleles restricted to diabetic dogs were identified, as well as a substitution difference in the X1 box of the DQB1 promoter that will potentially modify the effect of the protective haplotypes within diabetic dogs.

  13. [Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

    Science.gov (United States)

    Gu, Ming-liang; Chu, Jia-you

    2007-12-01

    Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

  14. Concurrent Whole-Genome Haplotyping and Copy-Number Profiling of Single Cells

    Science.gov (United States)

    Zamani Esteki, Masoud; Dimitriadou, Eftychia; Mateiu, Ligia; Melotte, Cindy; Van der Aa, Niels; Kumar, Parveen; Das, Rakhi; Theunis, Koen; Cheng, Jiqiu; Legius, Eric; Moreau, Yves; Debrock, Sophie; D’Hooghe, Thomas; Verdyck, Pieter; De Rycke, Martine; Sermon, Karen; Vermeesch, Joris R.; Voet, Thierry

    2015-01-01

    Methods for haplotyping and DNA copy-number typing of single cells are paramount for studying genomic heterogeneity and enabling genetic diagnosis. Before analyzing the DNA of a single cell by microarray or next-generation sequencing, a whole-genome amplification (WGA) process is required, but it substantially distorts the frequency and composition of the cell’s alleles. As a consequence, haplotyping methods suffer from error-prone discrete SNP genotypes (AA, AB, BB) and DNA copy-number profiling remains difficult because true DNA copy-number aberrations have to be discriminated from WGA artifacts. Here, we developed a single-cell genome analysis method that reconstructs genome-wide haplotype architectures as well as the copy-number and segregational origin of those haplotypes by employing phased parental genotypes and deciphering WGA-distorted SNP B-allele fractions via a process we coin haplarithmisis. We demonstrate that the method can be applied as a generic method for preimplantation genetic diagnosis on single cells biopsied from human embryos, enabling diagnosis of disease alleles genome wide as well as numerical and structural chromosomal anomalies. Moreover, meiotic segregation errors can be distinguished from mitotic ones. PMID:25983246

  15. A common haplotype of KIAA0319 contributes to the phonological awareness skill in Chinese children.

    Science.gov (United States)

    Lim, Cadmon King-Poo; Wong, Amabel May-Bo; Ho, Connie Suk-Han; Waye, Mary Mui-Yee

    2014-07-11

    Previous studies have shown that KIAA0319 is a candidate gene for dyslexia in western populations. In view of the different languages used in Caucasian and Chinese populations, the aim of the present study was to investigate whether there is also an association of KIAA0319 in Chinese children with dyslexia and/or to the language-related cognitive skills. A total of twenty six single nucleotide polymorphisms (SNPs) were genotyped from three hundred and ninety three individuals from 131 Chinese families. Four of the SNPs have been reported in the literature and twenty two being tag SNPs at KIAA0319. Analysis for allelic and haplotypic associations was performed with the UNPHASED program and multiple testing was corrected using permutation. Results indicate that KIAA0319 is not associated with Chinese children with dyslexia but a haplotype consisting of rs2760157 and rs807507 SNPs were significantly associated with an onset detection test, a measure of phonological awareness (pnominal = 6.85 10-5 and pcorrected = 0.0029). In conclusion, our findings suggest that KIAA0319 is associated with a reading-related cognitive skill.

  16. Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population.

    Science.gov (United States)

    Allabi, Aurel C; Horsmans, Yves; Issaoui, Bouchra; Gala, Jean-Luc

    2005-04-01

    The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population. Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation-maximization algorithm. We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans. Our data are compatible with a close evolutionary relationship in Black Africans from Benin.

  17. A common SLC26A4-linked haplotype underlying non-syndromic hearing loss with enlargement of the vestibular aqueduct

    DEFF Research Database (Denmark)

    Chattaraj, Parna; Munjal, Tina; Honda, Keiji

    2017-01-01

    BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with EVA.......0042). CONCLUSIONS: The CEVA haplotype causally contributes to most cases of Caucasian M1 EVA and, possibly, some cases of M0 EVA. The CEVA haplotype of SLC26A4 defines the most common allele associated with hereditary hearing loss in Caucasians. The diagnostic yield and prognostic utility of sequence analysis...

  18. A mixed integer linear programming model to reconstruct phylogenies from single nucleotide polymorphism haplotypes under the maximum parsimony criterion.

    Science.gov (United States)

    Catanzaro, Daniele; Ravi, Ramamoorthi; Schwartz, Russell

    2013-01-23

    Phylogeny estimation from aligned haplotype sequences has attracted more and more attention in the recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from medical research, to drug discovery, to epidemiology, to population dynamics. The literature on molecular phylogenetics proposes a number of criteria for selecting a phylogeny from among plausible alternatives. Usually, such criteria can be expressed by means of objective functions, and the phylogenies that optimize them are referred to as optimal. One of the most important estimation criteria is the parsimony which states that the optimal phylogeny T∗for a set H of n haplotype sequences over a common set of variable loci is the one that satisfies the following requirements: (i) it has the shortest length and (ii) it is such that, for each pair of distinct haplotypes hi,hj∈H, the sum of the edge weights belonging to the path from hi to hj in T∗ is not smaller than the observed number of changes between hi and hj. Finding the most parsimonious phylogeny for H involves solving an optimization problem, called the Most Parsimonious Phylogeny Estimation Problem (MPPEP), which is NP-hard in many of its versions. In this article we investigate a recent version of the MPPEP that arises when input data consist of single nucleotide polymorphism haplotypes extracted from a population of individuals on a common genomic region. Specifically, we explore the prospects for improving on the implicit enumeration strategy of implicit enumeration strategy used in previous work using a novel problem formulation and a series of strengthening valid inequalities and preliminary symmetry breaking constraints to more precisely bound the solution space and accelerate implicit enumeration of possible optimal phylogenies. We present the basic formulation and then introduce a series of provable valid constraints to reduce the solution space. We then prove that these

  19. Search for common haplotypes on chromosome 22q in patients with schizophrenia or bipolar disorder from the Faroe Islands

    DEFF Research Database (Denmark)

    Jorgensen, T H; Børglum, A D; Mors, O

    2002-01-01

    Chromosome 22q may harbor risk genes for schizophrenia and bipolar affective disorder. This is evidenced through genetic mapping studies, investigations of cytogenetic abnormalities, and direct examination of candidate genes. Patients with schizophrenia and bipolar affective disorder from the Faroe...... Islands were typed for 35 evenly distributed polymorphic markers on 22q in a search for shared risk genes in the two disorders. No single marker was strongly associated with either disease, but five two-marker segments that cluster within two regions on the chromosome have haplotypes occurring...

  20. Mapping Haplotype-haplotype Interactions with Adaptive LASSO

    Directory of Open Access Journals (Sweden)

    Li Ming

    2010-08-01

    Full Text Available Abstract Background The genetic etiology of complex diseases in human has been commonly viewed as a complex process involving both genetic and environmental factors functioning in a complicated manner. Quite often the interactions among genetic variants play major roles in determining the susceptibility of an individual to a particular disease. Statistical methods for modeling interactions underlying complex diseases between single genetic variants (e.g. single nucleotide polymorphisms or SNPs have been extensively studied. Recently, haplotype-based analysis has gained its popularity among genetic association studies. When multiple sequence or haplotype interactions are involved in determining an individual's susceptibility to a disease, it presents daunting challenges in statistical modeling and testing of the interaction effects, largely due to the complicated higher order epistatic complexity. Results In this article, we propose a new strategy in modeling haplotype-haplotype interactions under the penalized logistic regression framework with adaptive L1-penalty. We consider interactions of sequence variants between haplotype blocks. The adaptive L1-penalty allows simultaneous effect estimation and variable selection in a single model. We propose a new parameter estimation method which estimates and selects parameters by the modified Gauss-Seidel method nested within the EM algorithm. Simulation studies show that it has low false positive rate and reasonable power in detecting haplotype interactions. The method is applied to test haplotype interactions involved in mother and offspring genome in a small for gestational age (SGA neonates data set, and significant interactions between different genomes are detected. Conclusions As demonstrated by the simulation studies and real data analysis, the approach developed provides an efficient tool for the modeling and testing of haplotype interactions. The implementation of the method in R codes can be

  1. Correlation of chitinase 3-like 1 single nucleotide polymorphisms and haplotypes with uterine cervical cancer in Taiwanese women.

    Directory of Open Access Journals (Sweden)

    Yue-Shan Lin

    Full Text Available This study aimed to investigate the relationships of chitinase 3-like 1 (CHI3L1 single nucleotide polymorphisms (SNPs and haplotypes with the development of uterine cervical cancer in Taiwanese women. The SNPs frequencies and haplotypes were also correlated with the clinicopathologic variables of cervical cancer, cancer recurrence, and patient survival.Ninety-nine patients with invasive cancer and 61 with pre-cancerous lesions of the uterine cervix were compared to 310 healthy control subjects. Three SNPs rs6691378 (-1371, G/A, rs10399805 (-247, G/A and rs4950928 (-131, C/G in the promoter region, and one SNP rs880633 (+2950, T/C in exon 5 were analyzed by real time polymerase chain reaction and genotyping. The results showed that the mutant homozygous genotype AA of CHI3L1 SNP rs6691378 and AA of rs10399805, and haplotypes AACC and AACT increased the risk of developing pre-cancerous lesions and invasive cancer. The patients with these risk haplotypes had higher than stage I tumors, larger tumors, and vaginal invasion. In logistic regression model, they also tended to have poor survival event [p = 0.078; odds ratio (OR: 2.99, 95% confidence interval (CI: 0.89-10.08] and a higher probability of recurrence event (p = 0.081; OR: 3.07, 95% CI: 0.87-10.81. There was a significant association between the CHI3L1 risk haplotypes and probability of recurrence (p = 0.002; hazard ratio: 6.21, 95% CI: 1.90-20.41, and a marginal association between the risk haplotypes and overall survival (p = 0.051; hazard ratio: 3.76, 95% CI: 0.99-14.29 in the patients with SCC, using Cox proportional hazard model.The CHI3L1 SNPs rs6691378 and rs10399805 and CHI3L1 haplotypes all correlated with the development of cervical pre-cancerous lesions and invasive cancer. The cervical cancer patients with the CHI3L1 haplotypes AACC or AACT had poor clinicopathologic characteristics and poor recurrence and survival events. These risk haplotypes were associated with higher

  2. Variation analysis and gene annotation of eight MHC haplotypes: the MHC Haplotype Project.

    Science.gov (United States)

    Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J; Almeida, Jeff; Forbes, Simon; Gilbert, James G R; Halls, Karen; Harrow, Jennifer L; Hart, Elizabeth; Howe, Kevin; Jackson, David K; Palmer, Sophie; Roberts, Anne N; Sims, Sarah; Stewart, C Andrew; Traherne, James A; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J; Elliott, John F; Sawcer, Stephen; Todd, John A; Trowsdale, John; Beck, Stephan

    2008-01-01

    The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine.

  3. High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres.

    Science.gov (United States)

    Young, Eleanor; Pastor, Steven; Rajagopalan, Ramakrishnan; McCaffrey, Jennifer; Sibert, Justin; Mak, Angel C Y; Kwok, Pui-Yan; Riethman, Harold; Xiao, Ming

    2017-05-19

    Accurate maps and DNA sequences for human subtelomere regions, along with detailed knowledge of subtelomere variation and long-range telomere-terminal haplotypes in individuals, are critical for understanding telomere function and its roles in human biology. Here, we use a highly automated whole genome mapping technology in nano-channel arrays to analyze large terminal human chromosome segments extending from chromosome-specific subtelomere sequences through subtelomeric repeat regions to terminal (TTAGGG)n repeat tracts. We establish detailed maps for subtelomere gap regions in the human reference sequence, detect many new large subtelomeric variants and demonstrate the feasibility of long-range haplotyping through segmentally duplicated subtelomere regions. These features make the method a uniquely valuable new tool for improving the quality of genome assemblies in complex DNA regions. Based on single molecule mapping of telomere-terminal DNA fragments, we provide proof of principle for a novel method to estimate telomere lengths linked to distinguishable telomeric haplotypes; this single-telomere genotyping method may ultimately enable delineation of human cis elements involved in telomere length regulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. HLA-A and -B alleles and haplotypes in 240 index patients with common variable immunodeficiency and selective IgG subclass deficiency in central Alabama

    OpenAIRE

    Barton James C; Bertoli Luigi F; Acton Ronald T

    2003-01-01

    Abstract Background We wanted to quantify HLA-A and -B phenotype and haplotype frequencies in Alabama index patients with common variable immunodeficiency (CVID) and selective IgG subclass deficiency (IgGSD), and in control subjects. Methods Phenotypes were detected using DNA-based typing (index cases) and microlymphocytotoxicity typing (controls). Results A and B phenotypes were determined in 240 index cases (114 CVID, 126 IgGSD) and 1,321 controls and haplotypes in 195 index cases and 751 c...

  5. HLA-A and -B alleles and haplotypes in 240 index patients with common variable immunodeficiency and selective IgG subclass deficiency in central Alabama

    Directory of Open Access Journals (Sweden)

    Barton James C

    2003-06-01

    Full Text Available Abstract Background We wanted to quantify HLA-A and -B phenotype and haplotype frequencies in Alabama index patients with common variable immunodeficiency (CVID and selective IgG subclass deficiency (IgGSD, and in control subjects. Methods Phenotypes were detected using DNA-based typing (index cases and microlymphocytotoxicity typing (controls. Results A and B phenotypes were determined in 240 index cases (114 CVID, 126 IgGSD and 1,321 controls and haplotypes in 195 index cases and 751 controls. Phenotyping revealed that the "uncorrected" frequencies of A*24, B*14, B*15, B*35, B*40, B*49, and B*50 were significantly greater in index cases, and frequencies of B*35, B*58, B*62 were significantly lower in index cases. After Bonferroni corrections, the frequencies of phenotypes A*24, B*14, and B*40 were significantly greater in index cases, and the frequency of B*62 was significantly lower in index cases. The most common haplotypes in index cases were A*02-B*44 (frequency 0.1385, A*01-B*08 (frequency 0.1308, and A*03-B*07 (frequency 0.1000, and the frequency of each was significantly greater in index cases than in control subjects ("uncorrected" values of p p p = 0.0166. Most phenotype and haplotype frequencies in CVID and IgGSD were similar. 26.7% of index patients were HLA-haploidentical with one or more other index patients. We diagnosed CVID or IgGSD in first-degree or other relatives of 26 of 195 index patients for whom HLA-A and -B haplotypes had been ascertained; A*01-B*08, A*02-B*44, and A*29-B*44 were most frequently associated with CVID or IgGSD in these families. We conservatively estimated the combined population frequency of CVID and IgGSD to be 0.0092 in adults, based on the occurrence of CVID and IgGSD in spouses of the index cases. Conclusions CVID and IgGSD in adults are significantly associated with several HLA haplotypes, many of which are also common in the Alabama Caucasian population. Immunoglobulin phenotype variability

  6. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    Directory of Open Access Journals (Sweden)

    Kim Tae-Ho

    2007-11-01

    Full Text Available Abstract Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63% had been previously identified and 331 (37% were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an

  7. Effects of common haplotypes of the ileal sodium dependent bile acid transporter gene on the development of sporadic and familial colorectal cancer: A case control study

    Directory of Open Access Journals (Sweden)

    Friedrichs Nicolaus

    2008-07-01

    Full Text Available Abstract Background The genetics of sporadic and non-syndromic familial colorectal cancer (CRC is not well defined. However, genetic factors that promote the development of precursor lesions, i.e. adenomas, might also predispose to CRC. Recently, an association of colorectal adenoma with two variants (c.507C>T;p.L169L and c.511G>T;p.A171S of the ileal sodium dependent bile acid transporter gene (SLC10A2 has been reported. Here, we reconstructed haplotypes of the SLC10A2 gene locus and tested for association with non-syndromic familial and sporadic CRC compared to 'hyper-normal' controls who displayed no colorectal polyps on screening colonoscopy. Methods We included 150 patients with sporadic CRC, 93 patients with familial CRC but exclusion of familial adenomatous polyposis and Lynch's syndrome, and 204 'hyper-normal' controls. Haplotype-tagging SLC10A2 gene variants were identified in the Hapmap database and genotyped using PCR-based 5' exonuclease assays with fluorescent dye-labelled probes. Haplotypes were reconstructed using the PHASE algorithm. Association testing was performed with both SNPs and reconstructed haplotypes. Results Minor allele frequencies of all SLC10A2 polymorphisms are within previously reported ranges, and no deviations from Hardy-Weinberg equilibrium are observed. However, we found no association with any of the SLC10A2 haplotypes with sporadic or familial CRC in our samples (all P values > 0.05. Conclusion Common variants of the SLC10A2 gene are not associated with sporadic or familial CRC. Hence, albeit this gene might be associated with early stages of colorectal neoplasia, it appears not to represent a major risk factor for progression to CRC.

  8. Haplotype analysis suggest common founders in carriers of the recurrent BRCA2 mutation, 3398delAAAAG, in French Canadian hereditary breast and/ovarian cancer families

    Directory of Open Access Journals (Sweden)

    Foulkes William D

    2006-03-01

    Full Text Available Abstract Background The 3398delAAAAG mutation in BRCA2 was recently found to recur in breast and/or ovarian cancer families from the French Canadian population of Quebec, a population that has genetic attributes consistent with a founder effect. To characterize the contribution of this mutation in this population, this study established the frequency of this mutation in breast and ovarian cancer cases unselected for family history of cancer, and determined if mutation carriers shared a common ancestry. Methods The frequency was estimated by assaying the mutation in series of French Canadian breast cancer cases diagnosed before age 41 (n = 60 or 80 (n = 127 years of age, and ovarian cancer cases (n = 80 unselected for family history of cancer by mutation analysis. Haplotype analysis was performed to determine if mutation carriers shared a common ancestry. Members from 11 families were analyzed using six polymorphic microsatellite markers (cen-D13S260-D13S1699-D13S1698-D13S1697-D13S1701-D13S171-tel spanning approximately a 3.6 cM interval at the chromosomal region 13q13.1, which contains BRCA2. Allele frequencies were estimated by genotyping 47 unaffected female individuals derived from the same population. Haplotype reconstruction of unaffected individuals was performed using the program PHASE. Results The recurrent BRCA2 mutation occurred in 1 of 60 (1.7% women diagnosed with breast cancer before 41 years of age and one of 80 (1.3% women with ovarian cancer. No mutation carriers were identified in the series of breast cancer cases diagnosed before age 80. Mutation carriers harboured one of two haplotypes, 7-3-9-3 – [3/4]-7, that varied with marker D13S1701 and which occurred at a frequency of 0.001. The genetic analysis of D13S1695, a polymorphic marker located approximately 0.3 cM distal to D13S171, did not favour a genetic recombination event to account for the differences in D13S1701 alleles within the haplotype. Although mutation carriers

  9. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad

    2016-01-01

    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  10. A simple SNP genotyping method reveals extreme invasions of non-native haplotypes in pale chub Opsariichthys platypus, a common cyprinid fish in Japan.

    Directory of Open Access Journals (Sweden)

    Shigeru Kitanishi

    Full Text Available Biological invasion by non-native subspecies or populations is one of the most serious threats to ecosystems, because these species might be easily established in the introduced area and can negatively affect native populations through competition and hybridization. Pale chub Opsariichthys platypus, one of the most common fish in East Asia, exhibits clear genetic differentiation among regional populations; however, introgression and subsequent loss of genetic integrity have been occurring throughout Japan due to the artificial introduction of non-native conspecifics. In this study, we developed a simple SNP genotyping method to discriminate between native and non-native mitochondrial DNA (mtDNA haplotypes in pale chub using real-time PCR assay. We then investigated the distribution patterns of non-native pale chub in Tokai region, located in the center of Honshu Island, Japan and developed a predictive model of the occurrence of non-natives to reveal the factors influencing their invasion. The specificity and accuracy of the genotyping method were confirmed by using samples whose haplotypes were determined previously. Extensive occurrence of non-native haplotypes in Tokai region was detected by this method. In addition, our models suggested that the presence of non-natives varied greatly depending on the river system, and was positively influenced by the impounded water areas. Our method could accurately distinguish between native and non-native haplotypes of pale chub in Japan and suggested key environmental factors associated with the presence of non-natives. This approach can greatly reduce experimental costs be a great contribution for quantitative investigation.

  11. A common haplotype in the G-protein-coupled receptor gene GPR74 is associated with leanness and increased lipolysis

    DEFF Research Database (Denmark)

    Dahlman, Ingrid; Dicker, Andrea; Jiao, Hong

    2007-01-01

    with protection against obesity in two samples selected for obese and lean phenotypes (odds ratio for obesity 0.48 and 0.62; nominal P=.0014 and .014; n=1,013 and 1,423, respectively). In a population-based sample, it was associated with lower waist (P=.02) among 3,937 men and with obesity protection (odds ratio...... 0.36; P=.036) among those selected for obese or lean phenotypes. The ATAG haplotype was associated with increased adipocyte lipid mobilization (lipolysis) in vivo and in vitro. In human fat cells, GPR74 receptor stimulation and inhibition caused a significant and marked decrease and increase...... adipose tissue. The latter involves a cross-talk between GPR74 and beta -adrenoceptor signaling to lipolysis in fat cells....

  12. The diploid origins of allopolyploid rose species studied using single nucleotide polymorphism haplotypes flanking a microsatellite repeat

    NARCIS (Netherlands)

    Zhang, J.; Esselink, G.; Che, D.; Fougère-Danezan, M.; Arens, P.; Smulders, M.J.M.

    2013-01-01

    The taxonomy of the genus Rosa is complex, not least because of hybridisations between species.We aimed to develop a method to connect the diploid Rosa taxa to the allopolyploid taxa to which they contributed, based on the sharing of haplotypes. For this we used an SNPSTR marker, which combines a

  13. H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.

    Science.gov (United States)

    Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao

    2016-12-15

    Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. High density mapping and haplotype analysis of the major stem-solidness locus SSt1 in durum and common wheat

    Science.gov (United States)

    Nilsen, Kirby T.; N’Diaye, Amidou; MacLachlan, P. R.; Clarke, John M.; Ruan, Yuefeng; Cuthbert, Richard D.; Knox, Ron E.; Wiebe, Krystalee; Cory, Aron T.; Walkowiak, Sean; Beres, Brian L.; Graf, Robert J.; Clarke, Fran R.; Sharpe, Andrew G.; Distelfeld, Assaf; Pozniak, Curtis J.

    2017-01-01

    Breeding for solid-stemmed durum (Triticum turgidum L. var durum) and common wheat (Triticum aestivum L.) cultivars is one strategy to minimize yield losses caused by the wheat stem sawfly (Cephus cinctus Norton). Major stem-solidness QTL have been localized to the long arm of chromosome 3B in both wheat species, but it is unclear if these QTL span a common genetic interval. In this study, we have improved the resolution of the QTL on chromosome 3B in a durum (Kofa/W9262-260D3) and common wheat (Lillian/Vesper) mapping population. Coincident QTL (LOD = 94–127, R2 = 78–92%) were localized near the telomere of chromosome 3BL in both mapping populations, which we designate SSt1. We further examined the SSt1 interval by using available consensus maps for durum and common wheat and compared genetic to physical intervals by anchoring markers to the current version of the wild emmer wheat (WEW) reference sequence. These results suggest that the SSt1 interval spans a physical distance of 1.6 Mb in WEW (positions 833.4–835.0 Mb). In addition, minor QTL were identified on chromosomes 2A, 2D, 4A, and 5A that were found to synergistically enhance expression of SSt1 to increase stem-solidness. These results suggest that developing new wheat cultivars with improved stem-solidness is possible by combining SSt1 with favorable alleles at minor loci within both wheat species. PMID:28399136

  15. Candidate gene sequencing of SLC11A2 and TMPRSS6 in a family with severe anaemia: common SNPs, rare haplotypes, no causative mutation.

    Directory of Open Access Journals (Sweden)

    Anita Kloss-Brandstätter

    Full Text Available BACKGROUND: Iron-refractory iron deficiency anaemia (IRIDA is a rare disorder which was linked to mutations in two genes (SLC11A2 and TMPRSS6. Common polymorphisms within these genes were associated with serum iron levels. We identified a family of Serbian origin with asymptomatic non-consanguineous parents with three of four children presenting with IRIDA not responding to oral but to intravenous iron supplementation. After excluding all known causes responsible for iron deficiency anaemia we searched for mutations in SLC11A2 and TMPRSS6 that could explain the severe anaemia in these children. METHODOLOGY/RESULTS: We sequenced the exons and exon-intron boundaries of SLC11A2 and TMPRSS6 in all six family members. Thereby, we found seven known and fairly common SNPs, but no new mutation. We then genotyped these seven SNPs in the population-based SAPHIR study (n = 1,726 and performed genetic association analysis on iron and ferritin levels. Only two SNPs, which were top-hits from recent GWAS on iron and ferritin, exhibited an effect on iron and ferritin levels in SAPHIR. Six SAPHIR participants carrying the same TMPRSS6 genotypes and haplotype-pairs as one anaemic son showed lower ferritin and iron levels than the average. One individual exhibiting the joint SLC11A2/TMPRSS6 profile of the anaemic son had iron and ferritin levels lying below the 5(th percentile of the population's iron and ferritin level distribution. We then checked the genotype constellations in the Nijmegen Biomedical Study (n = 1,832, but the profile of the anaemic son did not occur in this population. CONCLUSIONS: We cannot exclude a gene-gene interaction between SLC11A2 and TMPRSS6, but we can also not confirm it. As in this case candidate gene sequencing did not reveal causative rare mutations, the samples will be subjected to whole exome sequencing.

  16. Common fixed points of single-valued and multivalued maps

    Directory of Open Access Journals (Sweden)

    Yicheng Liu

    2005-01-01

    Full Text Available We define a new property which contains the property (EA for a hybrid pair of single- and multivalued maps and give some new common fixed point theorems under hybrid contractive conditions. Our results extend previous ones. As an application, we give a partial answer to the problem raised by Singh and Mishra.

  17. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  18. In Vivo Characterization of Human APOA5 Haplotypes

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey; Fruchart, Jamila; Pennacchio, Len A.

    2006-10-01

    Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allele (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.

  19. Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

    Directory of Open Access Journals (Sweden)

    Rita de Cassia Mousinho-Ribeiro

    2003-01-01

    Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

  20. Schizophrenia and common sense: study of 3 single cases.

    Science.gov (United States)

    Naudin, J; Azorin, J; Mishara, A L; Wiggins, O P; Schwartz, M

    2000-01-01

    There is new interest in subjective experiences of schizophrenia. This kind of analysis emphasizes the subjective stories of patients, and the methods do not pretend to have the objectivity of science. However, the plausibility and the empathetic resonance of the single case may bring subjective confirmation to the validity of an insight and indicate new directions of research. Following this line, the authors present a study of 3 single cases of 'reflexive' residual type of schizophrenia. The methods for selecting the cases and the philosophical groundings of the concept of 'reflexive schizophrenia' are explained. The analysis of the single cases revealed that (1) schizophrenic persons' cognitive deficit is related to the constitution of common sense; (2) some schizophrenics cope with the cognitive deficit by creating a theoretical corpus of axioms stemming from common sense, namely the 'axioms of everyday life'; (3) this mechanism of coping is described as an inflexible attachment to 'axioms of everydayness', and (4) this attachment to common sense releases the patient from all personal investment of self in the process of anchoring in the living world and, on this basis, allows a relatively solid, although distant, attachment to reality. The nature of deficit in schizophrenia is also discussed by confronting the phenomenological point of view and the neuropsychological, that is the so-called 'theory of mind'. Copyright 2000 S. Karger AG, Basel.

  1. HapCol : Accurate and memory-efficient haplotype assembly from long reads

    NARCIS (Netherlands)

    Pirola, Yuri; Zaccaria, Simone; Dondi, Riccardo; Klau, Gunnar W.; Pisanti, Nadia; Bonizzoni, Paola

    2016-01-01

    Motivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from the advent

  2. HapCol: Accurate and Memory-efficient Haplotype Assembly from Long Reads

    NARCIS (Netherlands)

    Y. Pirola (Yuri); S. Zaccaria (Simone); R. Dondi (Riccardo); G.W. Klau (Gunnar); N. Pisanti (Nadia); P. Bonizzoni (Paola)

    2015-01-01

    htmlabstractMotivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from

  3. Elite Haplotypes of a Protein Kinase GeneTaSnRK2.3Associated with Important Agronomic Traits in Common Wheat.

    Science.gov (United States)

    Miao, Lili; Mao, Xinguo; Wang, Jingyi; Liu, Zicheng; Zhang, Bin; Li, Weiyu; Chang, Xiaoping; Reynolds, Matthew; Wang, Zhenhua; Jing, Ruilian

    2017-01-01

    Plant-specific protein kinase SnRK2s play crucial roles in response to various environmental stimuli. TaSnRK2.3 , a SnRK2 member, was involved in the response to multiple abiotic stresses in wheat. To facilitate the use of TaSnRK2.3 in wheat breeding, the three genomic sequences of TaSnRK2.3 , originating from the A, B, and D genomes of hexaploid wheat, were obtained. Sequence polymorphism assays showing 4 and 10 variations were detected at TaSnRK2.3-1A and at TaSnRK2.3-1B , respectively, yet no variation was identified at TaSnRK2.3-1D . Three haplotypes for A genome, and two main haplotypes for B genome of TaSnRK2.3 were identified in 32 genotypes. Functional markers (2.3AM1, 2.3AM2, 2.3BM1, 2.3BM2) were successfully developed to distinguish different haplotypes. Association analysis was performed with the general linear model in TASSEL 2.1. The results showed that both TaSnRK2.3-1A and TaSnRK2.3-1B were significantly associated with plant height (PH), length of peduncle and penultimate node, as well as 1,000-grain weight (TGW) under different environments. Additionally, TaSnRK2.3-1B was significantly associated with stem water-soluble carbohydrates at flowering and mid-grain filling stages. Hap -1A-1 had higher TGW and lower PH; Hap -1B-1 had higher TGW and stem water-soluble carbohydrates, as well as lower PH, thus the two haplotypes were considered as elite haplotypes. Geographic distribution and allelic frequencies indicated that the two preferred haplotypes Hap -1A-1 and Hap -1B-1 were positively selected in the process of Chinese wheat breeding. These results could be valuable for genetic improvement and germplasm enhancement using molecular marker assisted selection in wheat breeding.

  4. Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Shibaya Taeko

    2010-04-01

    Full Text Available Abstract Background To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. Results The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7× the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67 051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Conclusions Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several

  5. The most common mutation causing medium-chain acyl-CoA dehydrogenase deficiency is strongly associated with a particular haplotype in the region of the gene

    DEFF Research Database (Denmark)

    Kølvraa, S; Gregersen, N; Blakemore, A I

    1991-01-01

    RFLP haplotypes in the region containing the medium-chain acyl-CoA dehydrogenase (MCAD) gene on chromosome 1 have been determined in patients with MCAD deficiency. The RFLPs were detected after digestion of patient DNA with the enzymes BanII. PstI and TaqI and with an MCAD cDNA-clone as a probe....... Of 32 disease-causing alleles studied, 31 possessed the previously published A----G point-mutation at position 985 of the cDNA. This mutation has been shown to result in inactivity of the MCAD enzyme. In at least 30 of the 31 alleles carrying this G985 mutation a specific RFLP haplotype was present...

  6. Plasmodium falciparum isolates from Angola show the StctVMNT haplotype in the pfcrt gene

    Science.gov (United States)

    2010-01-01

    Background Effective treatment remains a mainstay of malaria control, but it is unfortunately strongly compromised by drug resistance, particularly in Plasmodium falciparum, the most important human malaria parasite. Although P. falciparum chemoresistance is well recognized all over the world, limited data are available on the distribution and prevalence of pfcrt and pfmdr1 haplotypes that mediate resistance to commonly used drugs and that show distinct geographic differences. Methods Plasmodium falciparum-infected blood samples collected in 2007 at four municipalities of Luanda, Angola, were genotyped using PCR and direct DNA sequencing. Single nucleotide polymorphisms in the P. falciparum pfcrt and pfmdr1 genes were assessed and haplotype prevalences were determined. Results and Discussion The most prevalent pfcrt haplotype was StctVMNT (representing amino acids at codons 72-76). This result was unexpected, since the StctVMNT haplotype has previously been seen mainly in parasites from South America and India. The CVIET, CVMNT and CVINT drug-resistance haplotypes were also found, and one previously undescribed haplotype (CVMDT) was detected. Regarding pfmdr1, the most prevalent haplotype was YEYSNVD (representing amino acids at codons 86, 130, 184, 1034, 1042, 1109 and 1246). Wild haplotypes for pfcrt and pfmdr1 were uncommon; 3% of field isolates harbored wild type pfcrt (CVMNK), whereas 21% had wild type pfmdr1 (NEYSNVD). The observed predominance of the StctVMNT haplotype in Angola could be a result of frequent travel between Brazil and Angola citizens in the context of selective pressure of heavy CQ use. Conclusions The high prevalence of the pfcrt SVMNT haplotype and the pfmdr1 86Y mutation confirm high-level chloroquine resistance and might suggest reduced efficacy of amodiaquine in Angola. Further studies must be encouraged to examine the in vitro sensitivity of pfcrt SVMNT parasites to artesunate and amodiaquine for better conclusive data. PMID:20565881

  7. Approximation properties of haplotype tagging

    Directory of Open Access Journals (Sweden)

    Dreiseitl Stephan

    2006-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are locations at which the genomic sequences of population members differ. Since these differences are known to follow patterns, disease association studies are facilitated by identifying SNPs that allow the unique identification of such patterns. This process, known as haplotype tagging, is formulated as a combinatorial optimization problem and analyzed in terms of complexity and approximation properties. Results It is shown that the tagging problem is NP-hard but approximable within 1 + ln((n2 - n/2 for n haplotypes but not approximable within (1 - ε ln(n/2 for any ε > 0 unless NP ⊂ DTIME(nlog log n. A simple, very easily implementable algorithm that exhibits the above upper bound on solution quality is presented. This algorithm has running time O((2m - p + 1 ≤ O(m(n2 - n/2 where p ≤ min(n, m for n haplotypes of size m. As we show that the approximation bound is asymptotically tight, the algorithm presented is optimal with respect to this asymptotic bound. Conclusion The haplotype tagging problem is hard, but approachable with a fast, practical, and surprisingly simple algorithm that cannot be significantly improved upon on a single processor machine. Hence, significant improvement in computatational efforts expended can only be expected if the computational effort is distributed and done in parallel.

  8. A phased SNP-based classification of sickle cell anemia HBB haplotypes.

    Science.gov (United States)

    Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

    2017-08-11

    Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

  9. Association analysis of bovine Foxa2 gene single sequence variant and haplotype combinations with growth traits in Chinese cattle.

    Science.gov (United States)

    Liu, Mei; Li, Mijie; Wang, Shaoqiang; Xu, Yao; Lan, Xianyong; Li, Zhuanjian; Lei, Chuzhao; Yang, Dongying; Jia, Yutang; Chen, Hong

    2014-02-25

    Forkhead box A2 (Foxa2) has been recognized as one of the most potent transcriptional activators that is implicated in the control of feeding behavior and energy homeostasis. However, similar researches about the effects of genetic variations of Foxa2 gene on growth traits are lacking. Therefore, this study detected Foxa2 gene polymorphisms by DNA pool sequencing, PCR-RFLP and PCR-ACRS methods in 822 individuals from three Chinese cattle breeds. The results showed that four sequence variants (SVs) were screened, including two mutations (SV1, g. 7005 C>T and SV2, g. 7044 C>G) in intron 4, one mutation (SV3, g. 8449 A>G) in exon 5 and one mutation (SV4, g. 8537 T>C) in the 3'UTR. Notably, association analysis of the single mutations with growth traits in total individuals (at 24months) revealed that significant statistical difference was found in four SVs, and SV4 locus was highly significantly associated with growth traits throughout all three breeds (PFoxa2 gene that was predictive of molecular markers in cattle breeding for the first time. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. A single haplotype hyposensitive to light and requiring strong vernalization dominates Arabidopsis thaliana populations in Patagonia, Argentina.

    Science.gov (United States)

    Kasulin, Luciana; Rowan, Beth A; León, Rolando J C; Schuenemann, Verena J; Weigel, Detlef; Botto, Javier F

    2017-07-01

    The growing collection of sequenced or genotyped Arabidopsis thaliana accessions includes mostly individuals from the native Eurasian and N. African range and introduced North American populations. Here, we describe the genetic and phenotypic diversity, along with habitats and life history, of A. thaliana plants collected at the southernmost end of its worldwide distribution. Seed samples were harvested from plants growing in four sites within a ~3500-km 2 -area in Patagonia, Argentina, and represent the first germplasm to be collected in South America for this species. Whole-genome resequencing revealed that plants from the four sites and a Patagonia herbarium specimen collected in 1967 formed a single haplogroup (Pat), indicating that the phenotypic variation observed in the field reflected plastic responses to the environment. admixture and principal components analyses suggest that the ancestor of the Pat haplogroup either came from Italy or the Balkan/Caucasus regions of Eurasia. In the laboratory, plants from the Pat haplogroup were hyposensitive to continuous red (Rc) and shade light, with corresponding changes in the expression of phytochrome signalling genes. Pat had higher PIF3 and PIF5 and lower HY5 expression under Rc light; and lower expression of PIL1, ATHB2 and HFR1 under shade compared to Col-0. In addition, Pat plants had a strong vernalization requirement associated with high levels of FLC expression. We conclude that including Pat in studies of natural variation and in comparison with other introduced populations will provide additional information for association studies and allow for a more detailed assessment of the demographic events following colonization. © 2017 John Wiley & Sons Ltd.

  11. TP53 mutation p.R337H in gastric cancer tissues of a 12-year-old male child - evidence for chimerism involving a common mutant founder haplotype: case report

    Directory of Open Access Journals (Sweden)

    Prolla Patricia A

    2011-10-01

    Full Text Available Abstract Background Gastric adenocarcinoma is rare in children and adolescents, with about 17 cases under age 21 in the world's literature. We report a case of invasive well-differentiated metastatic gastric cancer in a Brazilian 12-year-old boy without documented familial history of cancer. Case presentation The patient, diagnosed with metastatic disease, died seven months after surgery. DNA from intra-surgical specimens revealed a TP53 mutation at codon 337 (p.R337H in samples with neoplastic cells (dysplasia, tumor and metastasis but not in non-transformed cells (incomplete intestinal metaplasia and non-involved celiac lymph node. In all mutation-positive tissues, p.R337H occurred on the same background, a founder allele identified by a specific haplotype previously described in Brazilian Li-Fraumeni syndrome patients. The same mutant haplotype, corresponding to a founder mutation present in 0.3% of the general population in Southern Brazil, was found in the genome of the father. Presence of this inherited haplotype in the tumor as well as in the father's germline, suggests a rare case of microchimerism in this patient, who may have harbored a small number of mutant cells originating in another individual, perhaps a dizygotic twin that died early in gestation. Conclusion This case represents one of the earliest ages at diagnosis of gastric cancer ever reported. It shows that cancer inheritance can occur in the absence of an obvious germline mutation, calling for caution in assessing early cancers in populations with common founder mutations such as p.R337H in Southern Brazil.

  12. TP53 mutation p.R337H in gastric cancer tissues of a 12-year-old male child: evidence for chimerism involving a common mutant founder haplotype: case report.

    Science.gov (United States)

    da Silva, Edaise M; Achatz, Maria Isabel W; Martel-Planche, Ghyslaine; Montagnini, André L; Olivier, Magali; Prolla, Patricia A; Hainaut, Pierre; Soares, Fernando A

    2011-10-17

    Gastric adenocarcinoma is rare in children and adolescents, with about 17 cases under age 21 in the world's literature. We report a case of invasive well-differentiated metastatic gastric cancer in a Brazilian 12-year-old boy without documented familial history of cancer. The patient, diagnosed with metastatic disease, died seven months after surgery. DNA from intra-surgical specimens revealed a TP53 mutation at codon 337 (p.R337H) in samples with neoplastic cells (dysplasia, tumor and metastasis) but not in non-transformed cells (incomplete intestinal metaplasia and non-involved celiac lymph node). In all mutation-positive tissues, p.R337H occurred on the same background, a founder allele identified by a specific haplotype previously described in Brazilian Li-Fraumeni syndrome patients. The same mutant haplotype, corresponding to a founder mutation present in 0.3% of the general population in Southern Brazil, was found in the genome of the father. Presence of this inherited haplotype in the tumor as well as in the father's germline, suggests a rare case of microchimerism in this patient, who may have harbored a small number of mutant cells originating in another individual, perhaps a dizygotic twin that died early in gestation. This case represents one of the earliest ages at diagnosis of gastric cancer ever reported. It shows that cancer inheritance can occur in the absence of an obvious germline mutation, calling for caution in assessing early cancers in populations with common founder mutations such as p.R337H in Southern Brazil.

  13. δ-Aminolevulinic Acid Dehydratase Single Nucleotide Polymorphism 2 and Peptide Transporter 2*2 Haplotype May Differentially Mediate Lead Exposure in Male Children

    Science.gov (United States)

    Parisi, Natali; Schaub, Tanner; Gutierrez, Marisela; Ortega, Alma X.

    2011-01-01

    Child low-level lead (Pb) exposure is an unresolved public health problem and an unaddressed child health disparity. Particularly in cases of low-level exposure, source removal can be impossible to accomplish, and the only practical strategy for reducing risk may be primary prevention. Genetic biomarkers of increased neurotoxic risk could help to identify small subgroups of children for early intervention. Previous studies have suggested that, by way of a distinct mechanism, δ-aminolevulinic acid dehydratase single nucleotide polymorphism 2 (ALAD2) and/or peptide transporter 2*2 haplotype (hPEPT2*2) increase Pb blood burden in children. Studies have not yet examined whether sex mediates the effects of genotype on blood Pb burden. Also, previous studies have not included blood iron (Fe) level in their analyses. Blood and cheek cell samples were obtained from 306 minority children, ages 5.1 to 12.9 years. 208Pb and 56Fe levels were determined with inductively coupled plasma–mass spectrometry. General linear model analyses were used to examine differences in Pb blood burden by genotype and sex while controlling for blood Fe level. The sample geometric mean Pb level was 2.75 µg/dl. Pb blood burden was differentially higher in ALAD2 heterozygous boys and hPEPT2*2 homozygous boys. These results suggest that the effect of ALAD2 and hPEPT2*2 on Pb blood burden may be sexually dimorphic. ALAD2 and hPEPT2*2 may be novel biomarkers of health and mental health risks in male children exposed to low levels of Pb. PMID:21327641

  14. Combination Testing Using a Single MSH5 Variant alongside HLA Haplotypes Improves the Sensitivity of Predicting Coeliac Disease Risk in the Polish Population.

    Directory of Open Access Journals (Sweden)

    Agnieszka Paziewska

    Full Text Available Assessment of non-HLA variants alongside standard HLA testing was previously shown to improve the identification of potential coeliac disease (CD patients. We intended to identify new genetic variants associated with CD in the Polish population that would improve CD risk prediction when used alongside HLA haplotype analysis. DNA samples of 336 CD and 264 unrelated healthy controls were used to create DNA pools for a genome wide association study (GWAS. GWAS findings were validated with individual HLA tag single nucleotide polymorphism (SNP typing of 473 patients and 714 healthy controls. Association analysis using four HLA-tagging SNPs showed that, as was found in other populations, positive predicting genotypes (HLA-DQ2.5/DQ2.5, HLA-DQ2.5/DQ2.2, and HLA-DQ2.5/DQ8 were found at higher frequencies in CD patients than in healthy control individuals in the Polish population. Both CD-associated SNPs discovered by GWAS were found in the CD susceptibility region, confirming the previously-determined association of the major histocompatibility (MHC region with CD pathogenesis. The two most significant SNPs from the GWAS were rs9272346 (HLA-dependent; localized within 1 Kb of DQA1 and rs3130484 (HLA-independent; mapped to MSH5. Specificity of CD prediction using the four HLA-tagging SNPs achieved 92.9%, but sensitivity was only 45.5%. However, when a testing combination of the HLA-tagging SNPs and the MSH5 SNP was used, specificity decreased to 80%, and sensitivity increased to 74%. This study confirmed that improvement of CD risk prediction sensitivity could be achieved by including non-HLA SNPs alongside HLA SNPs in genetic testing.

  15. Genome-Wide Association Study among Four Horse Breeds Identifies a Common Haplotype Associated with In Vitro CD3+ T Cell Susceptibility/Resistance to Equine Arteritis Virus Infection ▿

    Science.gov (United States)

    Go, Yun Young; Bailey, Ernest; Cook, Deborah G.; Coleman, Stephen J.; MacLeod, James N.; Chen, Kuey-Chu; Timoney, Peter J.; Balasuriya, Udeni B. R.

    2011-01-01

    Previously, we have shown that horses could be divided into susceptible and resistant groups based on an in vitro assay using dual-color flow cytometric analysis of CD3+ T cells infected with equine arteritis virus (EAV). Here, we demonstrate that the differences in in vitro susceptibility of equine CD3+ T lymphocytes to EAV infection have a genetic basis. To investigate the possible hereditary basis for this trait, we conducted a genome-wide association study (GWAS) to compare susceptible and resistant phenotypes. Testing of 267 DNA samples from four horse breeds that had a susceptible or a resistant CD3+ T lymphocyte phenotype using both Illumina Equine SNP50 BeadChip and Sequenom's MassARRAY system identified a common, genetically dominant haplotype associated with the susceptible phenotype in a region of equine chromosome 11 (ECA11), positions 49572804 to 49643932. The presence of a common haplotype indicates that the trait occurred in a common ancestor of all four breeds, suggesting that it may be segregated among other modern horse breeds. Biological pathway analysis revealed several cellular genes within this region of ECA11 encoding proteins associated with virus attachment and entry, cytoskeletal organization, and NF-κB pathways that may be associated with the trait responsible for the in vitro susceptibility/resistance of CD3+ T lymphocytes to EAV infection. The data presented in this study demonstrated a strong association of genetic markers with the trait, representing de facto proof that the trait is under genetic control. To our knowledge, this is the first GWAS of an equine infectious disease and the first GWAS of equine viral arteritis. PMID:21994447

  16. RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.

    Science.gov (United States)

    Mirzaei, Sajad; Wu, Yufeng

    2017-04-01

    : Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+  for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+  builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+  represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+  are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+  is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+  in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+  is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online.

  17. Common variants and haplotypes in the TF, TNF-a, and TMPRSS6 genes are associated with iron status in a female black South African population

    NARCIS (Netherlands)

    Gichohi-Wainaina, W.N.; Boonstra, A.; Swinkels, D.W.; Zimmermann, M.B.; Feskens, E.J.M.; Towers, G.W.

    2015-01-01

    Background: It is unknown whether single nucleotide polymorphisms (SNPs), associated with iron status in European and Asian populations, have the same relation within the African population. Objectives: We aimed to investigate associations of reported SNPs with iron markers in a South African

  18. A common LRP4 haplotype is associated with bone mineral density and hip geometry in men-Data from the Odense Androgen Study (OAS)

    DEFF Research Database (Denmark)

    Boudin, Eveline; Steenackers, Ellen; Freitas, Fenna de

    2013-01-01

    by the association of rs6485702. We suggest, based on these results and the localisation of the variant in the third β-propeller domain of LRP4, that the variant has possibly a functional effect. Hereby, we conclude that common variation in the LRP4 gene determines hip and whole body BMD and thus confirm previous...

  19. Unique Allelic eQTL Clusters in Human MHC Haplotypes.

    Science.gov (United States)

    Lam, Tze Hau; Shen, Meixin; Tay, Matthew Zirui; Ren, Ee Chee

    2017-08-07

    The control of gene regulation within the major histocompatibility complex (MHC) remains poorly understood, despite several expression quantitative trait loci (eQTL) studies revealing an association of MHC gene expression with independent tag-single nucleotide polymorphisms (SNPs). MHC haplotype variation may exert a greater effect on gene expression phenotype than specific single variants. To explore the effect of MHC haplotype sequence diversity on gene expression phenotypes across the MHC, we examined the MHC transcriptomic landscape at haplotype-specific resolution for three prominent MHC haplotypes (A2-B46-DR9, A33-B58-DR3, and A1-B8-DR3) derived from MHC-homozygous B-lymphoblastoid cell lines (B-LCLs). We demonstrate that MHC-wide gene expression patterns are dictated by underlying haplotypes, and identify 36 differentially expressed genes. By mapping these haplotype sequence variations to known eQTL, we provide evidence that unique allelic combinations of eQTL, embedded within haplotypes, are correlated with the level of expression of 17 genes. Interestingly, the influence of haplotype sequence on gene expression is not homogenous across the MHC. We show that haplotype sequence polymorphisms within or proximate to HLA-A, HLA-C, C4A, and HLA-DRB regions exert haplotype-specific gene regulatory effects, whereas the expression of genes in other parts of the MHC region are not affected by the haplotype sequence. Overall, we demonstrate that MHC haplotype sequence diversity can impact phenotypic outcome via the alteration of transcriptional variability, indicating that a haplotype-based approach is fundamental for the assessment of trait associations in the MHC. Copyright © 2017 Lam et al.

  20. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Jungersen, Gregers; Sørensen, Maria Rathmann

    2014-01-01

    of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly...... occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular...

  1. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and the identification of commonly expressed haplotypes using sequence specific low- and high resolution primers

    DEFF Research Database (Denmark)

    Pedersen, Lasse Eggers; Fink, Dorte Rosenbek; Jungersen, Gregers

    The genomic region (SLA) of the swine major histocompatibility complex (MHC), which bind and present endogenous peptides to circulating T cells of the immune system, is extremely polymorphic comprising high numbers of different alleles, many of which encode a distinct MHC class I molecule. Each SLA...... expressed SLA class I alleles in Danish outbred swine. A total of 108 animals from eight different production herds were tested, and with low resolution sequence specific primer (SSP)-PCR typing the top five most commonly expressed SLA class I allele groups were found to be SLA-3*04XX, SLA-1*08XX, SLA-1...... molecule is only able to bind a restricted number of peptides with specific biochemical characteristics matching important anchor positions in the peptide binding groove. Although the diversity of T cells is vast, the individual MHC make-up thus limits the range of potential T cell epitopes for any given...

  2. Genetic analysis of completely sequenced disease-associated MHC haplotypes identifies shuffling of segments in recent human history.

    Directory of Open Access Journals (Sweden)

    James A Traherne

    2006-01-01

    Full Text Available The major histocompatibility complex (MHC is recognised as one of the most important genetic regions in relation to common human disease. Advancement in identification of MHC genes that confer susceptibility to disease requires greater knowledge of sequence variation across the complex. Highly duplicated and polymorphic regions of the human genome such as the MHC are, however, somewhat refractory to some whole-genome analysis methods. To address this issue, we are employing a bacterial artificial chromosome (BAC cloning strategy to sequence entire MHC haplotypes from consanguineous cell lines as part of the MHC Haplotype Project. Here we present 4.25 Mb of the human haplotype QBL (HLA-A26-B18-Cw5-DR3-DQ2 and compare it with the MHC reference haplotype and with a second haplotype, COX (HLA-A1-B8-Cw7-DR3-DQ2, that shares the same HLA-DRB1, -DQA1, and -DQB1 alleles. We have defined the complete gene, splice variant, and sequence variation contents of all three haplotypes, comprising over 259 annotated loci and over 20,000 single nucleotide polymorphisms (SNPs. Certain coding sequences vary significantly between different haplotypes, making them candidates for functional and disease-association studies. Analysis of the two DR3 haplotypes allowed delineation of the shared sequence between two HLA class II-related haplotypes differing in disease associations and the identification of at least one of the sites that mediated the original recombination event. The levels of variation across the MHC were similar to those seen for other HLA-disparate haplotypes, except for a 158-kb segment that contained the HLA-DRB1, -DQA1, and -DQB1 genes and showed very limited polymorphism compatible with identity-by-descent and relatively recent common ancestry (<3,400 generations. These results indicate that the differential disease associations of these two DR3 haplotypes are due to sequence variation outside this central 158-kb segment, and that shuffling of

  3. Haplotypes of catechol-O-methyltransferase modulate intelligence-related brain white matter integrity.

    Science.gov (United States)

    Liu, Bing; Li, Jun; Yu, Chunshui; Li, Yonghui; Liu, Yong; Song, Ming; Fan, Ming; Li, Kuncheng; Jiang, Tianzi

    2010-03-01

    Twin studies have indicated a common genetic origin for intelligence and for variations in brain morphology. Our previous diffusion tensor imaging studies found an association between intelligence and white matter integrity of specific brain regions or tracts. However, specific genetic determinants of the white matter integrity of these brain regions and tracts are still unclear. In this study, we assess whether and how catechol-O-methyltransferase (COMT) gene polymorphisms affect brain white matter integrity. We genotyped twelve single nucleotide polymorphisms (SNPs) within the COMT gene and performed haplotype analyses on data from 79 healthy subjects. Our subjects had the same three major COMT haplotypes (termed the HPS, APS and LPS haplotypes) as previous studies have reported as regulating significantly different levels of enzymatic activity and dopamine. We used the mean fractional anisotropy (FA) values from four regions and five tracts of interest to assess the effect of COMT polymorphisms, including the well-studied val158met SNP and the three main haplotypes that we had identified, on intelligence-related white matter integrity. We identified an association between the mean FA values of two regions in the bilateral prefrontal lobes and the COMT haplotypes, rather than between them and val158met. The haplotype-FA value associations modulated nonlinearly and fit an inverted U-model. Our findings suggest that COMT haplotypes can nonlinearly modulate the intelligence-related white matter integrity of the prefrontal lobes by more significantly influencing prefrontal dopamine variations than does val158met. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  4. G16R single nucleotide polymorphism but not haplotypes of the ß2-adrenergic receptor gene alters cardiac output in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin

    2013-01-01

    studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise.......5 (CI, 0.0 -1.0) l/min greater in ACE I/I carriers compared with I/D and D/D subjects (P=0.054). In conclusion, the ADRB2 Arg16 allele in humans is associated with a lower Q¿ both at rest and during exercise, overriding the effects of haplotypes....

  5. Haplotype-based stratification of Huntington's disease.

    Science.gov (United States)

    Chao, Michael J; Gillis, Tammy; Atwal, Ranjit S; Mysore, Jayalakshmi Srinidhi; Arjomand, Jamshid; Harold, Denise; Holmans, Peter; Jones, Lesley; Orth, Michael; Myers, Richard H; Kwak, Seung; Wheeler, Vanessa C; MacDonald, Marcy E; Gusella, James F; Lee, Jong-Min

    2017-11-01

    Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by expansion of a CAG trinucleotide repeat in HTT, resulting in an extended polyglutamine tract in huntingtin. We and others have previously determined that the HD-causing expansion occurs on multiple different haplotype backbones, reflecting more than one ancestral origin of the same type of mutation. In view of the therapeutic potential of mutant allele-specific gene silencing, we have compared and integrated two major systems of HTT haplotype definition, combining data from 74 sequence variants to identify the most frequent disease-associated and control chromosome backbones and revealing that there is potential for additional resolution of HD haplotypes. We have used the large collection of 4078 heterozygous HD subjects analyzed in our recent genome-wide association study of HD age at onset to estimate the frequency of these haplotypes in European subjects, finding that common genetic variation at HTT can distinguish the normal and CAG-expanded chromosomes for more than 95% of European HD individuals. As a resource for the HD research community, we have also determined the haplotypes present in a series of publicly available HD subject-derived fibroblasts, induced pluripotent cells, and embryonic stem cells in order to facilitate efforts to develop inclusive methods of allele-specific HTT silencing applicable to most HD patients. Our data providing genetic guidance for therapeutic gene-based targeting will significantly contribute to the developments of rational treatments and implementation of precision medicine in HD.

  6. Genome-wide association studies using haplotypes and individual SNPs in Simmental cattle.

    Directory of Open Access Journals (Sweden)

    Yang Wu

    Full Text Available Recent advances in high-throughput genotyping technologies have provided the opportunity to map genes using associations between complex traits and markers. Genome-wide association studies (GWAS based on either a single marker or haplotype have identified genetic variants and underlying genetic mechanisms of quantitative traits. Prompted by the achievements of studies examining economic traits in cattle and to verify the consistency of these two methods using real data, the current study was conducted to construct the haplotype structure in the bovine genome and to detect relevant genes genuinely affecting a carcass trait and a meat quality trait. Using the Illumina BovineHD BeadChip, 942 young bulls with genotyping data were introduced as a reference population to identify the genes in the beef cattle genome significantly associated with foreshank weight and triglyceride levels. In total, 92,553 haplotype blocks were detected in the genome. The regions of high linkage disequilibrium extended up to approximately 200 kb, and the size of haplotype blocks ranged from 22 bp to 199,266 bp. Additionally, the individual SNP analysis and the haplotype-based analysis detected similar regions and common SNPs for these two representative traits. A total of 12 and 7 SNPs in the bovine genome were significantly associated with foreshank weight and triglyceride levels, respectively. By comparison, 4 and 5 haplotype blocks containing the majority of significant SNPs were strongly associated with foreshank weight and triglyceride levels, respectively. In addition, 36 SNPs with high linkage disequilibrium were detected in the GNAQ gene, a potential hotspot that may play a crucial role for regulating carcass trait components.

  7. Evidence and Consequence of a Highly Adapted Clonal Haplotype within the Australian Ascochyta rabiei Population

    Directory of Open Access Journals (Sweden)

    Yasir Mehmood

    2017-06-01

    Full Text Available The Australian Ascochyta rabiei (Pass. Labr. (syn. Phoma rabiei population has low genotypic diversity with only one mating type detected to date, potentially precluding substantial evolution through recombination. However, a large diversity in aggressiveness exists. In an effort to better understand the risk from selective adaptation to currently used resistance sources and chemical control strategies, the population was examined in detail. For this, a total of 598 isolates were quasi-hierarchically sampled between 2013 and 2015 across all major Australian chickpea growing regions and commonly grown host genotypes. Although a large number of haplotypes were identified (66 through short sequence repeat (SSR genotyping, overall low gene diversity (Hexp = 0.066 and genotypic diversity (D = 0.57 was detected. Almost 70% of the isolates assessed were of a single dominant haplotype (ARH01. Disease screening on a differential host set, including three commonly deployed resistance sources, revealed distinct aggressiveness among the isolates, with 17% of all isolates identified as highly aggressive. Almost 75% of these were of the ARH01 haplotype. A similar pattern was observed at the host level, with 46% of all isolates collected from the commonly grown host genotype Genesis090 (classified as “resistant” during the term of collection identified as highly aggressive. Of these, 63% belonged to the ARH01 haplotype. In conclusion, the ARH01 haplotype represents a significant risk to the Australian chickpea industry, being not only widely adapted to the diverse agro-geographical environments of the Australian chickpea growing regions, but also containing a disproportionately large number of aggressive isolates, indicating fitness to survive and replicate on the best resistance sources in the Australian germplasm.

  8. Oestrogen receptor α gene haplotype and postmenopausal breast cancer risk: a case control study

    International Nuclear Information System (INIS)

    Wedrén, Sara; Stiger, Fredrik; Persson, Ingemar; Baron, John; Weiderpass, Elisabete; Lovmar, Lovisa; Humphreys, Keith; Magnusson, Cecilia; Melhus, Håkan; Syvänen, Ann-Christine; Kindmark, Andreas; Landegren, Ulf; Fermér, Maria Lagerström

    2004-01-01

    Oestrogen receptor α, which mediates the effect of oestrogen in target tissues, is genetically polymorphic. Because breast cancer development is dependent on oestrogenic influence, we have investigated whether polymorphisms in the oestrogen receptor α gene (ESR1) are associated with breast cancer risk. We genotyped breast cancer cases and age-matched population controls for one microsatellite marker and four single-nucleotide polymorphisms (SNPs) in ESR1. The numbers of genotyped cases and controls for each marker were as follows: TA n , 1514 cases and 1514 controls; c.454-397C → T, 1557 cases and 1512 controls; c.454-351A → G, 1556 cases and 1512 controls; c.729C → T, 1562 cases and 1513 controls; c.975C → G, 1562 cases and 1513 controls. Using logistic regression models, we calculated odds ratios (ORs) and 95% confidence intervals (CIs). Haplotype effects were estimated in an exploratory analysis, using expectation-maximisation algorithms for case-control study data. There were no compelling associations between single polymorphic loci and breast cancer risk. In haplotype analyses, a common haplotype of the c.454-351A → G or c.454-397C → T and c.975C → G SNPs appeared to be associated with an increased risk for ductal breast cancer: one copy of the c.454-351A → G and c.975C → G haplotype entailed an OR of 1.19 (95% CI 1.06–1.33) and two copies with an OR of 1.42 (95% CI 1.15–1.77), compared with no copies, under a model of multiplicative penetrance. The association with the c.454-397C → T and c.975C → G haplotypes was similar. Our data indicated that these haplotypes were more influential in women with a high body mass index. Adjustment for multiple comparisons rendered the associations statistically non-significant. We found suggestions of an association between common haplotypes in ESR1 and the risk for ductal breast cancer that is stronger in heavy women

  9. Haplotype identity between individuals who share a CFTR mutation allele ''identical by descent'' : Demonstration of the usefulness of the haplotype-sharing concept for gene mapping in real populations

    NARCIS (Netherlands)

    deVries, HG; vanderMeulen, MA; Rozen, R; Halley, DJJ; Scheffer, H; tenKate, LP; Buys, CHCM; teMeerman, GJ

    Cystic fibrosis (CF) patients with the A455E mutation, in both the French Canadian and the Dutch population, share a common haplotype over distances of up to 25 cM. French Canadian patients with the 621+1G-->T mutation share a common haplotype of more than 14 cM. In contrast, haplotypes containing

  10. Haplotype identity between individuals who share a CFTR mutation allele "identical by descent" : demonstration of the usefulness of the haplotype-sharing concept for gene mapping in real populations

    NARCIS (Netherlands)

    de Vries, H G; van der Meulen, M A; Rozen, R; Halley, D J; Scheffer, H; ten Kate, L P; Buys, C H; te Meerman, G J

    Cystic fibrosis (CF) patients with the A455E mutation, in both the French Canadian and the Dutch population, share a common haplotype over distances of up to 25 cM. French Canadian patients with the 621+1G-->T mutation share a common haplotype of more than 14 cM. In contrast, haplotypes containing

  11. Common single nucleotide polymorphisms and keratoconus in the Han Chinese population.

    Science.gov (United States)

    Wang, Yani; Jin, Tianbo; Zhang, Xuehui; Wei, Wei; Cui, Yan; Geng, Tingting; Liu, Qianping; Gao, Jing; Liu, Ming; Chen, Chao; Zhang, Changning; Zhu, Xiuping

    2013-09-01

    To investigate whether the tag single nucleotide polymorphisms (tSNPs) in VSX1, COL4A3, COL4A4, IL1A and IL1B genes were associated with keratoconus (KTCN) in the Han Chinese population. Ninety-seven KTCN patients and 101 healthy controls were enrolled in this study. All cases were diagnosed on the basis of clinical examination. Twenty-one tSNPs were selected for association study in five genes. SNP genotyping was performed by Sequenom MassARRAY RS1000. Sequenom Typer 4.0 Software, PLINK, Haploview and SHEsis software platform were used to perform data management and analyses. Three tSNPs in the VSX1 gene were observed to be associated with KTCN risk at a 5% level by χ(2) test (rs56157240 and rs12480307, p = 0.0499, OR: 6.42, 95% CI: 0.77-53.78; rs6050307, p = 1.22 × 10(-7), OR: 0.05, 95% CI: 0.01-0.23). Rs2071376 in the IL1A gene was also associated with KTCN (p = 0.0487, OR: 1.51, 95% CI: 1.00-2.26). Three haplotypes in the VSX1 gene were found to be associated with risk of KTCN (p < 0.05). Our findings confirmed previous reports that polymorphisms of VSX1 and IL1A genes were associated with risk of KTCN in the Chinese population, suggesting an important determinant of KTCN development by VSX1 and IL1A genes.

  12. Haplotypes of nine single nucleotide polymorphisms on chromosome 19q13.2-3 associated with susceptibility of lung cancer in a Chinese population

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla Birgitte; Ma, Yegang

    2008-01-01

    To evaluate the joint effect of nine single nucleotide polymorphisms for three DNA repair genes in the region of chromosome 19q13.2-3 on susceptibility of lung cancer in a Chinese population, we conducted a hospital-based case-control study consisting of 247 lung cancer cases and 253 cancer...

  13. Content Coverage of Single-Word Tests Used to Assess Common Phonological Error Patterns

    Science.gov (United States)

    Kirk, Cecilia; Vigeland, Laura

    2015-01-01

    Purpose: This review evaluated whether 9 single-word tests of phonological error patterns provide adequate content coverage to accurately identify error patterns that are active in a child's speech. Method: Tests in the current study were considered to display sufficient opportunities to assess common phonological error patterns if they…

  14. Highly conserved extended haplotypes of the major histocompatibility complex and their relationship to multiple sclerosis susceptibility.

    Directory of Open Access Journals (Sweden)

    Douglas S Goodin

    Full Text Available To determine the relationship between highly-conserved extended-haplotypes (CEHs in the major histocompatibility complex (MHC and MS-susceptibility.Among the ~200 MS-susceptibility regions, which are known from genome-wide analyses of single nucleotide polymorphisms (SNPs, the MHC accounts for roughly a third of the currently explained variance and the strongest MS-associations are for certain Class II alleles (e.g., HLA-DRB1*15:01; HLA-DRB1*03:01; and HLA-DRB1*13:03, which frequently reside on CEHs within the MHC.Autosomal SNPs (441,547 from 11,376 MS cases and 18,872 controls in the WTCCC dataset were phased. The most significant MS associated SNP haplotype was composed of 11 SNPs in the MHC Class II region surrounding the HLA-DRB1 gene. We also phased alleles at the HLA-A, HLA-C, HLA-B, HLA-DRB1, and HLA-DQB1 loci. This data was used to probe the relationship between CEHs and MS susceptibility.We phased a total of 59,884 extended haplotypes (HLA-A, HLA-C, HLA-B, HLA-DRB1, HLA-DQB1 and SNP haplotypes from 29,942 individuals. Of these, 10,078 unique extended haplotypes were identified. The 10 most common CEHs accounted for 22% (13,302 of the total. By contrast, the 8,446 least common extended haplotypes also accounted for approximately 20% (12,298 of the total. This extreme frequency-disparity among extended haplotypes necessarily complicates interpretation of reported disease-associations with specific HLA alleles. In particular, the HLA motif HLA-DRB1*15:01~HLA-DQB1*06:02 is strongly associated with MS risk. Nevertheless, although this motif is almost always found on the a1 SNP haplotype, it can rarely be found on others (e.g., a27 and a36, and, in these cases, it seems to have no apparent disease-association (OR = 0.7; CI = 0.3-1.3 and OR = 0.7; CI = 0.2-2.2, respectively. Furthermore, single copy carriers of the a1 SNP-haplotype without this HLA motif still have an increased disease risk (OR = 2.2; CI = 1.2-3.8. In addition, even among the

  15. Haplotype structure of the beta2-adrenergic receptor gene in 814 Danish Caucasian subjects and association with body mass index

    DEFF Research Database (Denmark)

    Jensen, Mette Kamp; Nielsen, Morten; Koefoed, Pernille

    2009-01-01

    . In the total population (mean age +/- SD: 50 +/- 16 years), BMI was not related to haplotype pairs, individual SNPs or allelic haplotypes. However, in subjects levels varied significantly between pairs of major haplotype groups (p = 0.014) but were not related...... with body mass index (BMI). The SNPs showed organization into 13 distinct haplotypes and 41 haplotype pairs. The study identified four common haplotypes: ACCCC (10.1 +/- 0.3 %), ACCCG (27.9 +/- 0.3 %), GCCAC (10.8 +/- 0.1 %) and GGCCG (41.0 +/- 0.2 %) (frequencies (SD), seen in 91 % of the population...... to individual SNPs. In subjects subjects (BMI

  16. A haplotype-based analysis of the LRP5 gene in relation to osteoporosis phenotypes in Spanish postmenopausal women.

    Science.gov (United States)

    Agueda, Lídia; Bustamante, Mariona; Jurado, Susana; Garcia-Giralt, Natalia; Ciria, Manel; Saló, Guillem; Carreras, Ramon; Nogués, Xavier; Mellibovsky, Leonardo; Díez-Pérez, Adolfo; Grinberg, Daniel; Balcells, Susana

    2008-12-01

    LRP5 encodes the low-density lipoprotein receptor-related protein 5, a transmembrane protein involved in Wnt signaling. LRP5 is an important regulator of osteoblast growth and differentiation, affecting bone mass in vertebrates. Whether common variations in LRP5 are associated with normal BMD variation or osteoporotic phenotypes is of great relevance. We used a haplotype-based approach to search for common disease-associated variants in LRP5 in a cohort of 964 Spanish postmenopausal women. Twenty-four SNPs were selected, covering the LRP5 region, including the missense changes p.V667M and p.A1330V. The SNPs were genotyped and evaluated for association with BMD at the lumbar spine (LS) or femoral neck (FN) and with osteoporotic fracture, at single SNP and haplotype levels, by regression methods. Association with LS BMD was found for SNP 1, rs312009, located in the 5'-flanking region (p = 0.011, recessive model). SNP 6, rs2508836, in intron 1, was also associated with BMD, both at LS (p = 0.025, additive model) and FN (p = 0.031, recessive model). Two polymorphisms were associated with fracture: SNP 11, rs729635, in intron 1, and SNP 15, rs643892, in intron 5 (p = 0.007 additive model and p = 0.019 recessive model, respectively). Haplotype analyses did not provide additional information, except for haplotype "GC" of the block located at the 3'end of the gene. This haplotype spans intron 22 and the 3' untranslated region and was associated with FN BMD (p = 0.029, one copy of the haplotype versus none). In silico analyses showed that SNP 1 (rs312009) lies in a putative RUNX2 binding site. Electro-mobility shift assays confirmed RUNX2 binding to this site.

  17. Phenotypic and genetic effects of recessive haplotypes on yield, longevity, and fertility.

    Science.gov (United States)

    Cole, J B; Null, D J; VanRaden, P M

    2016-09-01

    Phenotypes from the August 2015 US national genetic evaluation were used to compute phenotypic effects of 18 recessive haplotypes in Ayrshire (n=1), Brown Swiss (n=5), Holstein (n=10), and Jersey (n=2) cattle on milk, fat, and protein yields, somatic cell score (SCS), single-trait productive life (PL), daughter pregnancy rate (DPR), heifer conception rate (HCR), and cow conception rate (CCR). The haplotypes evaluated were Ayrshire haplotype 1, Brown Swiss haplotypes 1 and 2, spinal dysmyelination, spinal muscular atrophy, Weaver Syndrome, brachyspina, Holstein cholesterol deficiency, Holstein haplotypes 1 to 5, bovine leukocyte adhesion deficiency, complex vertebral malformation, mulefoot (syndactyly), and Jersey haplotypes 1 and 2. When causal variants are unknown and tests are based only on single nucleotide polymorphism haplotypes, it can sometimes be difficult to accurately determine carrier status. For example, 2 Holstein haplotypes for cholesterol deficiency have the same single nucleotide polymorphism genotype, but only one of them carries the causative mutation. Genotyped daughters of carrier bulls included in the analysis ranged from 8 for Weaver Syndrome to 17,869 for Holstein haplotype 3. Lactation records preadjusted for nongenetic factors and direct genomic values (DGV) were used to estimate phenotypic and genetic effects of recessive haplotypes, respectively. We found no phenotypic or genetic differences between carriers and noncarriers of Ayrshire or Brown Swiss defects. Several associations were noted for Holstein haplotypes, including fat and HCR for Holstein haplotype 0 carriers; milk, protein, SCS, PL, and fertility for Holstein haplotype 1; protein, PL, CCR, and HCR for Holstein haplotype 2; milk, protein, and fertility for Holstein haplotype 4; and protein yield and DPR for Holstein haplotype 5. There were no differences among bovine leukocyte adhesion deficiency carriers, but complex vertebral malformation affected fat yield and mulefoot

  18. On the use of multifactor dimensionality reduction (MDR) and classification and regression tree (CART) to identify haplotype-haplotype interactions in genetic studies.

    Science.gov (United States)

    Hsieh, Ai-Ru; Hsiao, Ching-Lin; Chang, Su-Wei; Wang, Hui-Min; Fann, Cathy S J

    2011-02-01

    Haplotype-based approaches may have greater power than single-locus analyses when the SNPs are in strong linkage disequilibrium with the risk locus. To overcome potential complexities owing to large numbers of haplotypes in genetic studies, we evaluated two data mining approaches, multifactor dimensionality reduction (MDR) and classification and regression tree (CART), with the concept of haplotypes considering their haplotype uncertainty to detect haplotype-haplotype (HH) interactions. In evaluation of performance for detecting HH interactions, MDR had higher power than CART, but MDR gave a slightly higher type I error. Additionally, we performed an HH interaction analysis with a publicly available dataset of Parkinson's disease and confirmed previous findings that the RET proto-oncogene is associated with the disease. In this study, we showed that using HH interaction analysis is possible to assist researchers in gaining more insight into identifying genetic risk factors for complex diseases. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Haplotype of platelet receptor P2RY12 gene is associated with residual clopidogrel on-treatment platelet reactivity.

    Science.gov (United States)

    Nie, Xiao-Yan; Li, Jun-Lei; Zhang, Yong; Xu, Yang; Yang, Xue-Li; Fu, Yu; Liang, Guang-Kai; Lu, Yun; Liu, Jian; Shi, Lu-Wen

    To investigate a possible association between common variations of the P2RY12 and the residual clopidogrel on-treatment platelet reactivity after adjusting for the influence of CYP2C19 tested by thromboelastography (TEG). One hundred and eighty patients with acute coronary syndrome (ACS) treated with clopidogrel and aspirin were included and platelet function was assessed by TEG. Five selected P2RY12 single nucleotide polymorphisms (SNPs; rs6798347, rs6787801, rs6801273, rs6785930, and rs2046934), which cover the common variations in the P2RY12 gene and its regulatory regions, and three CYP2C19 SNPs ( * 2, * 3, * 17) were genotyped and possible haplotypes were analyzed. The high on-treatment platelet reactivity (HTPR) prevalence defined by a platelet inhibition rate <30% by TEG in adenosine diphosphate (ADP)-channel was 69 (38.33%). Six common haplotypes were inferred from four of the selected P2RY12 SNPs (denoted H 0 to H 5 ) according to the linkage disequilibrium R square (except for rs2046934). Haplotype H 1 showed a significantly lower incidence of HTPR than the reference haplotype (H 0 ) in the total study population while haplotypes H 1 and H 2 showed significantly lower incidences of HTPR than H 0 in the nonsmoker subgroup after adjusting for CYP2C19 effects and demographic characteristics. rs2046934 (T744C) did not show any significant association with HTPR. The combination of common P2RY12 variations including regulatory regions rather than rs2046934 (T744C) that related to pharmacodynamics of clopidogrel in patients with ACS was independently associated with residual on-clopidogrel platelet reactivity. This is apart from the established association of the CYP2C19. This association seemed more important in the subgroup defined by smoking.

  20. Short communication: casein haplotype variability in sicilian dairy goat breeds.

    Science.gov (United States)

    Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B

    2008-09-01

    In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.

  1. A systematic search for SNPs/haplotypes associated with disease phenotypes using a haplotype-based stepwise procedure

    Directory of Open Access Journals (Sweden)

    Andriesen Jessica

    2008-12-01

    Full Text Available Abstract Background Genotyping technologies enable us to genotype multiple Single Nucleotide Polymorphisms (SNPs within selected genes/regions, providing data for haplotype association analysis. While haplotype-based association analysis is powerful for detecting untyped causal alleles in linkage-disequilibrium (LD with neighboring SNPs/haplotypes, the inclusion of extraneous SNPs could reduce its power by increasing the number of haplotypes with each additional SNP. Methods Here, we propose a haplotype-based stepwise procedure (HBSP to eliminate extraneous SNPs. To evaluate its properties, we applied HBSP to both simulated and real data, generated from a study of genetic associations of the bactericidal/permeability-increasing (BPI gene with pulmonary function in a cohort of patients following bone marrow transplantation. Results Under the null hypothesis, use of the HBSP gave results that retained the desired false positive error rates when multiple comparisons were considered. Under various alternative hypotheses, HBSP had adequate power to detect modest genetic associations in case-control studies with 500, 1,000 or 2,000 subjects. In the current application, HBSP led to the identification of two specific SNPs with a positive validation. Conclusion These results demonstrate that HBSP retains the essence of haplotype-based association analysis while improving analytic power by excluding extraneous SNPs. Minimizing the number of SNPs also enables simpler interpretation and more cost-effective applications.

  2. The LRC haplotype project: a resource for killer immunoglobulin-like receptor-linked association studies

    Science.gov (United States)

    Horton, R.; Coggill, P.; Miretti, M. M.; Sambrook, J. G.; Traherne, J. A.; Ward, R.; Sims, S.; Palmer, S.; Sehra, H.; Harrow, J.; Rogers, J.; Carrington, M.; Trowsdale, J.; Beck, S.

    2009-01-01

    There is increasing evidence for epistatic interactions between gene products (e.g. KIR) encoded within the Leukocyte Receptor Complex (LRC) with those (e.g. HLA) of the Major Histocompatibility Complex (MHC), resulting in susceptibility to disease. Identification of such associations at the DNA level requires comprehensive knowledge of the genetic variation and haplotype structure of the underlying loci. The LRC haplotype project aims to provide this knowledge by sequencing common LRC haplotypes. PMID:17092261

  3. Experimental investigations of a single cylinder genset engine with common rail fuel injection system

    Directory of Open Access Journals (Sweden)

    Gupta Paras

    2014-01-01

    Full Text Available Performance and emissions characteristics of compression ignition (CI engines are strongly dependent on quality of fuel injection. In an attempt to improve engine combustion, engine performance and reduce the exhaust emissions from a single cylinder constant speed genset engine, a common rail direct injection (CRDI fuel injection system was deployed and its injection timings were optimized. Results showed that 34°CA BTDC start of injection (SOI timings result in lowest brake specific fuel consumption (BSFC and smoke opacity. Advanced injection timings showed higher cylinder peak pressure, pressure rise rate, and heat release rate due to relatively longer ignition delay experienced.

  4. Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism

    Science.gov (United States)

    Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David

    2015-01-01

    The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763

  5. Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus

    Energy Technology Data Exchange (ETDEWEB)

    Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States))

    1992-12-01

    Analysis of mutant PAH chromosomes has identified approximately 60 different single-base substitutions and deletions within the PAH locus. Nearly all of these molecular lesions are in strong linkage disequilibrium with specific RFLP haplotypes in different ethnic populations. Thus, haplotype analysis is not only useful for diagnostic purposes but is proving to be a valuable tool in population genetic studies of the origin and spread of phenylketonuria alleles in human populations. PCR-based methods have been developed to detect six of the eight polymorphic restriction sites used for determination of RFLP haplotypes at the PAH locus. A table of the proposed expanded haplotypes is given.

  6. SNV and haplotype analysis reveals new CSRP1 variants associated with growth and carcass traits.

    Science.gov (United States)

    He, Hua; Liu, Xiao-lin; Zhang, Hui-lin; Yang, Jing; Niu, Fu-biao; Li, Zhi-xiong; Liu, Yu; Chen, Ling

    2013-06-15

    The cysteine and glycine-rich protein 1 and 2 genes (CSRP1 and CSRP2) are an effective growth factor in promoting skeletal muscle growth in vitro and vivo. However, in cattle, the information on the CSRP1 and CSRP2 genes is very limited. The aim of this study was to examine the association of the CSRP1 and CSRP2 variants with growth and carcass traits in cattle breeds. Three single nucleotide variants (SNVs) were identified within the bovine CSRP1 gene, whereas CSRP2 gene has not detected any SNVs, using DNA pooled sequencing, PCR-RFLP, and forced PCR-RFLP methods. These SNVs include g. 801T>C (Intron 2), g. 46T>C (Exon 3) and g. 99C>G (Intron 3). Besides, we also investigated haplotype frequencies and linkage disequilibrium (LD) coefficients for three SNVs in all study populations. LD and haplotype structure of CSRP1 were different between breeds. The result of haplotype analysis demonstrated eight haplotype present in QC (Qinchuan) and one haplotype in CH (Chinese Holstein). Only haplotype 1 (TTC), shared by all two populations, comprised 10.74% and 100.00%, of all haplotypes observed in QC and CH, respectively. Haplotype 5 (CTC) had the highest haplotype frequencies in QC (30.98%) and haplotype 1 had the highest haplotype frequencies in CH (100.00%). The statistical analyses indicated that one single SNV and 19 combined haplotypes were significantly or highly significantly associated with growth and carcass traits in the QC cattle population (P<0.05 or P<0.01). Quantitative real-time PCR (qRT-PCR) analyses showed that the bovine CSRP1 and CSRP2 genes were widely expressed in many tissues. The results of this study suggest that the CSRP1 gene possibly is a strong candidate gene that affects growth and carcass traits in the Chinese beef cattle breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Detecting structure of haplotypes and local ancestry

    Science.gov (United States)

    We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

  8. Mitochondrial localization of the OAS1 p46 isoform associated with a common single nucleotide polymorphism

    DEFF Research Database (Denmark)

    Kjær, Karina Hansen; Pahus, Jytte; Hansen, Mariann Fagernæs

    2014-01-01

    cellular RNAs which in turn inhibits protein translation and induces apoptosis. Several single nucleotide polymorphisms (SNPs) in the OAS1 gene have been associated with disease. We have investigated the functional effect of two common SNPs in the OAS1 gene. The SNP rs10774671 affects splicing to one...... vacuoles/lysosomes. By using recombinantly expressed OAS1 mutant proteins, we found that the OAS1 SNP rs1131454 (former rs3741981) did not affect the enzymatic OAS1 activity. Conclusions: The SNP rs10774671 determines differential expression of the OAS1 isoforms. In Daudi and HT1080 cells the p46 isoform......Abstract Background: The expression of 2′-5′-Oligoadenylate synthetases (OASs) is induced by type 1 Interferons (IFNs) in response to viral infection. The OAS proteins have a unique ability to produce 2′-5′ Oligoadenylates, which bind and activate the ribonuclease RNase L. The RNase L degrades...

  9. Grouping preprocess for haplotype inference from SNP and CNV data

    International Nuclear Information System (INIS)

    Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato; Kamatani, Naoyuki

    2009-01-01

    The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.

  10. ParaHaplo 2.0: a program package for haplotype-estimation and haplotype-based whole-genome association study using parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2010-06-01

    Full Text Available Abstract Background The use of haplotype-based association tests can improve the power of genome-wide association studies. Since the observed genotypes are unordered pairs of alleles, haplotype phase must be inferred. However, estimating haplotype phase is time consuming. When millions of single-nucleotide polymorphisms (SNPs are analyzed in genome-wide association study, faster methods for haplotype estimation are required. Methods We developed a program package for parallel computation of haplotype estimation. Our program package, ParaHaplo 2.0, is intended for use in workstation clusters using the Intel Message Passing Interface (MPI. We compared the performance of our algorithm to that of the regular permutation test on both Japanese in Tokyo, Japan and Han Chinese in Beijing, China of the HapMap dataset. Results Parallel version of ParaHaplo 2.0 can estimate haplotypes 100 times faster than a non-parallel version of the ParaHaplo. Conclusion ParaHaplo 2.0 is an invaluable tool for conducting haplotype-based genome-wide association studies (GWAS. The need for fast haplotype estimation using parallel computing will become increasingly important as the data sizes of such projects continue to increase. The executable binaries and program sources of ParaHaplo are available at the following address: http://en.sourceforge.jp/projects/parallelgwas/releases/

  11. AICDA single nucleotide polymorphism in common variable immunodeficiency and selective IgA deficiency.

    Science.gov (United States)

    Farhadi, E; Nemati, S; Amirzargar, A A; Hirbod-Mobarakeh, A; Nabavi, M; Soltani, S; Mahdaviani, S A; Shahinpour, S; Arshi, S; Nikbin, B; Aghamohammadi, A; Rezaei, N

    2014-01-01

    Primary antibody deficiencies (PADs) are a heterogeneous group of disorders, characterised by increased susceptibility to recurrent bacterial infections. Common variable immunodeficiency (CVID) is the most important PAD from the clinical point of view and selective IgA deficiency (IgAD) is the most common PAD. However, the underlying gene defect in both is still unknown. As a recent study in Europe showed an association between a single nucleotide polymorphism (SNP) of AICDA gene with PADs, this study was performed to evaluate such an association in Iranian patients. Fifty-eight patients with PAD, including 39 CVID and 19 IgAD, as well as 34 healthy volunteers, were enrolled in this study. Genotyping was done in all groups for an intronic SNP in AICDA (rs2580874), using real-time PCR genotyping assay. The less frequent genotype of AICDA in IgAD patients was AA, seen in 10.5% of the patients, which was much lower than the 30.8% in CVID patients and 38.2% in the controls. However, these differences were not significant. Indeed the GG genotype in the patients with PADs was seen in 20.7%, compared to 8.8% in the controls without any significant difference. There was no significant association between the previously reported genetic variant of AICDA gene and the development of CVID or IgAD, but further multi-center studies are also needed. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  12. Gene-based single nucleotide polymorphism markers for genetic and association mapping in common bean.

    Science.gov (United States)

    Galeano, Carlos H; Cortés, Andrés J; Fernández, Andrea C; Soler, Álvaro; Franco-Herrera, Natalia; Makunde, Godwill; Vanderleyden, Jos; Blair, Matthew W

    2012-06-26

    In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. In short, this study illustrates the power of intron-based markers for linkage and association mapping in

  13. High-resolution haplotype block structure in the cattle genome

    Directory of Open Access Journals (Sweden)

    Choi Jungwoo

    2009-04-01

    Full Text Available Abstract Background The Bovine HapMap Consortium has generated assay panels to genotype ~30,000 single nucleotide polymorphisms (SNPs from 501 animals sampled from 19 worldwide taurine and indicine breeds, plus two outgroup species (Anoa and Water Buffalo. Within the larger set of SNPs we targeted 101 high density regions spanning up to 7.6 Mb with an average density of approximately one SNP per 4 kb, and characterized the linkage disequilibrium (LD and haplotype block structure within individual breeds and groups of breeds in relation to their geographic origin and use. Results From the 101 targeted high-density regions on bovine chromosomes 6, 14, and 25, between 57 and 95% of the SNPs were informative in the individual breeds. The regions of high LD extend up to ~100 kb and the size of haplotype blocks ranges between 30 bases and 75 kb (10.3 kb average. On the scale from 1–100 kb the extent of LD and haplotype block structure in cattle has high similarity to humans. The estimation of effective population sizes over the previous 10,000 generations conforms to two main events in cattle history: the initiation of cattle domestication (~12,000 years ago, and the intensification of population isolation and current population bottleneck that breeds have experienced worldwide within the last ~700 years. Haplotype block density correlation, block boundary discordances, and haplotype sharing analyses were consistent in revealing unexpected similarities between some beef and dairy breeds, making them non-differentiable. Clustering techniques permitted grouping of breeds into different clades given their similarities and dissimilarities in genetic structure. Conclusion This work presents the first high-resolution analysis of haplotype block structure in worldwide cattle samples. Several novel results were obtained. First, cattle and human share a high similarity in LD and haplotype block structure on the scale of 1–100 kb. Second, unexpected

  14. 4G/5G polymorphism and haplotypes of SERPINE1 in atherosclerotic diseases of coronary arteries.

    Science.gov (United States)

    Koch, Werner; Schrempf, Matthias; Erl, Anna; Mueller, Jakob C; Hoppmann, Petra; Schömig, Albert; Kastrati, Adnan

    2010-06-01

    We assessed the association between common variation at the SERPINE1 (PAI1) locus and myocardial infarction (MI). Haplotype-tagging polymorphisms, including the 4G/5G deletion/insertion polymorphism and seven single nucleotide polymorphisms, were analysed in a German sample containing 3,657 cases with MI and 1,211 controls. The association between the 4G/5G polymorphism and MI was examined in a meta-analysis of data extracted from 32 studies (13,267 cases/14,716 controls). In addition, the relation between the 4G/5G polymorphism and coronary diseases, comprising MI, coronary artery disease, coronary heart disease, or the acute coronary syndrome, was assessed in a combined analysis enclosing 43 studies (17,278 cases/18,039 controls). None of the tagging polymorphisms was associated with MI in the present sample (p 4G allele carriers was 1.02 (95% confidence interval [CI] 0.87-1.19) compared to the 5G5G genotype. None of 13 common (frequency >1.0%) 8-marker haplotypes was related to the risk of MI. In a meta-analysis specifically addressing the association with MI, no elevated risk was found in the carriers of the 4G allele (OR 1.07, 95% CI 0.99-1.16; p = 0.11). A more general combined analysis of coronary diseases showed a marginally increased risk in 4G allele carriers (OR 1.08, 95% CI 1.00-1.16; p = 0.044). In essence, tagging polymorphisms, including the 4G/5G polymorphism, and common haplotypes of the SERPINE1 gene region were not associated with MI in a German sample, and no compelling evidence was obtained for a relationship of the 4G/5G polymorphism to MI and coronary atherosclerosis in a meta-analysis.

  15. Two single mutations commonly cause qualitative change of nonspecific carboxylesterases in insects.

    Science.gov (United States)

    Cui, Feng; Lin, Zhe; Wang, Hongsheng; Liu, Silu; Chang, Haijing; Reeck, Gerald; Qiao, Chuanling; Raymond, Michel; Kang, Le

    2011-01-01

    Carboxylesterases provide key mechanisms of resistance to insecticides, particularly organophosphates (OPs), in insects. One resistance mechanism is a qualitative change in the properties of a carboxylesterase. Two mutant forms, G151D and W271L, have been observed, mostly in dipteran species, to affect substrate specificity of enzymes. But whether these two single mutations can commonly change character of insect carboxylesterases is unknown. In our study carboxylesterase genes from seven insects distributed among four orders were cloned, mutated at position 151 or 271 and expressed in Escherichia coli. The kinetics of the purified recombinant proteins was examined towards an artificial carboxylester and two OP insecticides. The G/A151D and W271L mutation significantly reduced carboxylesterase activity in 87.5% and 100% cases, respectively, and at the same time conferred OP hydrolase activities in 62.5% and 87.5% cases, respectively. Thus, the change at position 271 is more effective to influence substrate specificity than that at position 151. These results may suggest that these two mutations have the potential to cause insecticide resistance broadly in insects. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. On detecting incomplete soft or hard selective sweeps using haplotype structure

    DEFF Research Database (Denmark)

    Ferrer-Admetlla, Anna; Liang, Mason; Korneliussen, Thorfinn Sand

    2014-01-01

    We present a new haplotype-based statistic (nSL) for detecting both soft and hard sweeps in population genomic data from a single population. We compare our new method with classic single-population haplotype and site frequency spectrum (SFS)-based methods and show that it is more robust, particu......We present a new haplotype-based statistic (nSL) for detecting both soft and hard sweeps in population genomic data from a single population. We compare our new method with classic single-population haplotype and site frequency spectrum (SFS)-based methods and show that it is more robust......, particularly to recombination rate variation. However, all statistics show some sensitivity to the assumptions of the demographic model. Additionally, we show that nSL has at least as much power as other methods under a number of different selection scenarios, most notably in the cases of sweeps from standing...

  17. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    Directory of Open Access Journals (Sweden)

    Camille Ribeyre

    2018-02-01

    Full Text Available Human leukocyte antigen (HLA-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC. Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing, thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a

  18. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    Science.gov (United States)

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  19. Haplotype identity between individuals who share a CFTR mutation allele 'identical by descent': Demonstration of the usefulness of the haplotype-sharing concept for gene mapping in real populations

    NARCIS (Netherlands)

    H.G. de Vries (Hendrik); M.A. van der Meulen (Martin); R. Rozen (Rima); D.J.J. Halley (Dicky); H. Scheffer (Hans); L.P. ten Kate; C.H.C.M. Buys; G.J. Te Meerman (Gerard)

    1996-01-01

    markdownabstractAbstract Cystic fibrosis (CF) patients with the A455E mutation, in both the French Canadian and the Dutch population, share a common haplotype over distances of up to 25 cM. French Canadian patients with the 621+1G→T mutation share a common haplotype of more than 14 cM. In

  20. Prion gene haplotypes of U.S. cattle

    Directory of Open Access Journals (Sweden)

    Harhay Gregory P

    2006-11-01

    Full Text Available Abstract Background Bovine spongiform encephalopathy (BSE is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD and haplotype networks within the bovine prion gene (PRNP is important for 1 testing rare or common PRNP variation for an association with BSE and 2 interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb. PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb. Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle.

  1. Rearrangements of the beta-globin gene cluster in apparently typical betaS haplotypes.

    Science.gov (United States)

    Zago, M A; Silva, W A; Gualandro, S; Yokomizu, I K; Araujo, A G; Tavela, M H; Gerard, N; Krishnamoorthy, R; Elion, J

    2001-02-01

    The majority of the chromosomes with the betaS gene have one of the five common haplotypes, designated as Benin, Bantu, Senegal, Cameroon, and Arab-Indian haplotypes. However, 5-10% of the chromosomes have less common haplotypes, usually referred to as atypical haplotypes. We have demonstrated that most atypical haplotypes are generated by recombinations. The present study was carried out in order to explore whether recombination also occurs in chromosomes with the common (or typical) haplotypes. We screened the HS-2 region of the beta-globin gene locus control region (LCR) in 244 sickle cell patients who had typical restriction fragment length polymorphism (RFLP)-defined haplotypes of the betaS-gene cluster. For 14 cases in which the expected and the observed LCR repeat-sequence sizes were discrepant, the analysis was extended to other unexplored polymorphic markers of the bS-globin gene cluster, i.e.: pre-Ggamma framework, pre-Ggamma 6-bp deletion, HS-2 LCR (AT)xR(AT)y and pre-beta(AT)xTy repeats, and the intragenic beta-globin gene framework. In all 14 cases (15 chromosomes) in which the LCR repeat-sequence sizes were discrepant, a recombination involving a typical 3' segment of the betaS globin gene cluster was demonstrated. In most of the cases, the recombination site was located between the beta-globin gene and the betaLCR. Nine cases involving recombination were detected among 156 Brazilian HbS homozygotes and five among 88 African patients homozygotes for the Benin haplotype. INTERPRETATION AND CONCLUSIONS. Thus, 3.1% of apparently typical haplotypes linked to the sickle cell gene involve recombinations similar to those that generate the atypical haplotypes, a finding that reinforces the picture of the beta-globin gene cluster as highly dynamic.

  2. Genome-wide haplotype analysis of cis expression quantitative trait loci in monocytes.

    Directory of Open Access Journals (Sweden)

    Sophie Garnier

    Full Text Available In order to assess whether gene expression variability could be influenced by several SNPs acting in cis, either through additive or more complex haplotype effects, a systematic genome-wide search for cis haplotype expression quantitative trait loci (eQTL was conducted in a sample of 758 individuals, part of the Cardiogenics Transcriptomic Study, for which genome-wide monocyte expression and GWAS data were available. 19,805 RNA probes were assessed for cis haplotypic regulation through investigation of ~2,1 × 10(9 haplotypic combinations. 2,650 probes demonstrated haplotypic p-values >10(4-fold smaller than the best single SNP p-value. Replication of significant haplotype effects were tested for 412 probes for which SNPs (or proxies that defined the detected haplotypes were available in the Gutenberg Health Study composed of 1,374 individuals. At the Bonferroni correction level of 1.2 × 10(-4 (~0.05/412, 193 haplotypic signals replicated. 1000 G imputation was then conducted, and 105 haplotypic signals still remained more informative than imputed SNPs. In-depth analysis of these 105 cis eQTL revealed that at 76 loci genetic associations were compatible with additive effects of several SNPs, while for the 29 remaining regions data could be compatible with a more complex haplotypic pattern. As 24 of the 105 cis eQTL have previously been reported to be disease-associated loci, this work highlights the need for conducting haplotype-based and 1000 G imputed cis eQTL analysis before commencing functional studies at disease-associated loci.

  3. Organelle DNA haplotypes reflect crop-use characteristics and geographic origins of Cannabis sativa.

    Science.gov (United States)

    Gilmore, Simon; Peakall, Rod; Robertson, James

    2007-10-25

    Comparative sequencing of cannabis individuals across 12 chloroplast and mitochondrial DNA loci revealed 7 polymorphic sites, including 5 length variable regions and 2 single nucleotide polymorphisms. Simple PCR assays were developed to assay these polymorphisms, and organelle DNA haplotypes were obtained for 188 cannabis individuals from 76 separate populations, including drug-type, fibre-type and wild populations. The haplotype data were analysed using parsimony, UPGMA and neighbour joining methods. Three haplotype groups were recovered by each analysis method, and these groups are suggestive of the crop-use characteristics and geographical origin of the populations, although not strictly diagnostic. We discuss the relationship between our haplotype data and taxonomic opinions of cannabis, and the implications of organelle DNA haplotyping to forensic investigations of cannabis.

  4. Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease

    DEFF Research Database (Denmark)

    Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F

    2015-01-01

    BACKGROUND: A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group...... of Danish CD patients using the SNP technique. METHODS: Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2......) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). RESULTS: Cohort A: The three applied methods...

  5. Common single nucleotide variants underlying drug addiction: more than a decade of research.

    Science.gov (United States)

    Bühler, Kora-Mareen; Giné, Elena; Echeverry-Alzate, Victor; Calleja-Conde, Javier; de Fonseca, Fernando Rodriguez; López-Moreno, Jose Antonio

    2015-09-01

    Drug-related phenotypes are common complex and highly heritable traits. In the last few years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a huge number of single nucleotide polymorphisms (SNPs) associated with drug use, abuse or dependence, mainly related to alcohol or nicotine. Nevertheless, few of these associations have been replicated in independent studies. The aim of this study was to provide a review of the SNPs that have been most significantly associated with alcohol-, nicotine-, cannabis- and cocaine-related phenotypes in humans between the years of 2000 and 2012. To this end, we selected CGAS, GWAS, family-based association and case-only studies published in peer-reviewed international scientific journals (using the PubMed/MEDLINE and Addiction GWAS Resource databases) in which a significant association was reported. A total of 371 studies fit the search criteria. We then filtered SNPs with at least one replication study and performed meta-analysis of the significance of the associations. SNPs in the alcohol metabolizing genes, in the cholinergic gene cluster CHRNA5-CHRNA3-CHRNB4, and in the DRD2 and ANNK1 genes, are, to date, the most replicated and significant gene variants associated with alcohol- and nicotine-related phenotypes. In the case of cannabis and cocaine, a far fewer number of studies and replications have been reported, indicating either a need for further investigation or that the genetics of cannabis/cocaine addiction are more elusive. This review brings a global state-of-the-art vision of the behavioral genetics of addiction and collaborates on formulation of new hypothesis to guide future work. © 2015 Society for the Study of Addiction.

  6. Differences in meiotic recombination rates in childhood acute lymphoblastic leukemia at an MHC class II hotspot close to disease associated haplotypes.

    Directory of Open Access Journals (Sweden)

    Pamela Thompson

    Full Text Available Childhood Acute Lymphoblastic Leukemia (ALL is a malignant lymphoid disease of which B-cell precursor- (BCP and T-cell- (T ALL are subtypes. The role of alleles encoded by major histocompatibility loci (MHC have been examined in a number of previous studies and results indicating weak, multi-allele associations between the HLA-DPB1 locus and BCP-ALL suggested a role for immunosusceptibility and possibly infection. Two independent SNP association studies of ALL identified loci approximately 37 kb from one another and flanking a strong meiotic recombination hotspot (DNA3, adjacent to HLA-DOA and centromeric of HLA-DPB1. To determine the relationship between this observation and HLA-DPB1 associations, we constructed high density SNP haplotypes of the 316 kb region from HLA-DMB to COL11A2 in childhood ALL and controls using a UK GWAS data subset and the software PHASE. Of four haplotype blocks identified, predicted haplotypes in Block 1 (centromeric of DNA3 differed significantly between BCP-ALL and controls (P = 0.002 and in Block 4 (including HLA-DPB1 between T-ALL and controls (P = 0.049. Of specific common (>5% haplotypes in Block 1, two were less frequent in BCP-ALL, and in Block 4 a single haplotype was more frequent in T-ALL, compared to controls. Unexpectedly, we also observed apparent differences in ancestral meiotic recombination rates at DNA3, with BCP-ALL showing increased and T-ALL decreased levels compared to controls. In silico analysis using LDsplit sotware indicated that recombination rates at DNA3 are influenced by flanking loci, including SNPs identified in childhood ALL association studies. The observed differences in rates of meiotic recombination at this hotspot, and potentially others, may be a characteristic of childhood leukemia and contribute to disease susceptibility, alternatively they may reflect interactions between ALL-associated haplotypes in this region.

  7. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    Science.gov (United States)

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  8. Familial Mediterranean fever with a single MEFV mutation: comparison of rare and common mutations in a Turkish paediatric cohort.

    Science.gov (United States)

    Soylemezoglu, Oguz; Kandur, Yasar; Duzova, Ali; Ozkaya, Ozan; Kasapcopur, Ozgür; Baskin, Esra; Fidan, Kibriya; Yalcinkaya, Fatos

    2015-01-01

    Presence of common MEFV gene mutations strengthened the diagnosis of FMF in addition to the typical clinical characteristics of FMF. However, there are also rare mutations. P369S, A744S, R761H, K695R, F479L are the main rare mutations in Turkish population. We aimed to evaluate FMF patients with a single allele MEFV mutation and to compare patients with common and rare mutations. We retrospectively reviewed the medical records of FMF patients with a single allele mutation who were followed up between 2008 and 2013 in six centres. We compared the patients with rare and common mutations for disease severity score, frequent exacerbations ( >1 attack per month), long attack period (>3 day), symptoms, age at the onset of symptoms, gender, consanguinity, and family history. Two hundred and seventeen patients (M/F=101/116) with the diagnosis of FMF and single mutation were included. Heterozygote mutations were defined as common (M694V, V726A, M68OI) and rare mutations (A744S, P369S, K695R, R761H, F479L). Sixty-seven patients (27 males, 40 females) had one single rare mutation and 150 (74 males, 76 females) had one single common mutation. No difference was found between the rare and common mutations with respect to the disease severity score. There was no significant difference between common and rare heterozygote form of mutations in terms of disease severity. Patients with typical characteristics of FMF, with some rare mutations (A744S, P369S) should be treated in the same manner as patients with a common mutation.

  9. ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics

    Directory of Open Access Journals (Sweden)

    Barratt DT

    2012-04-01

    Full Text Available Daniel T Barratt1, Janet K Coller1, Richard Hallinan2, Andrew Byrne2, Jason M White1, David JR Foster3, Andrew A Somogyi1,41Discipline of Pharmacology, School of Medical Sciences, University of Adelaide, Adelaide, South Australia; 2The Byrne Surgery, Specialist Drug and Alcohol Practice, Redfern, New South Wales; 3Division of Health Sciences, Sansom Institute, School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, South Australia; 4Department of Clinical Pharmacology, Royal Adelaide Hospital, Adelaide, South Australia, AustraliaBackground: Genetic variability in ABCB1, encoding the P-glycoprotein efflux transporter, has been linked to altered methadone maintenance treatment dose requirements. However, subsequent studies have indicated that additional environmental or genetic factors may confound ABCB1 pharmacogenetics in different methadone maintenance treatment settings. There is evidence that genetic variability in OPRM1, encoding the mu opioid receptor, and ABCB1 may interact to affect morphine response in opposite ways. This study aimed to examine whether a similar gene-gene interaction occurs for methadone in methadone maintenance treatment.Methods: Opioid-dependent subjects (n = 119 maintained on methadone (15–300 mg/day were genotyped for five single nucleotide polymorphisms of ABCB1 (61A > G; 1199G > A; 1236C > T; 2677G > T; 3435C > T, as well as for the OPRM1 18A > G single nucleotide polymorphism. Subjects’ methadone doses and trough plasma (R-methadone concentrations (Ctrough were compared between ABCB1 haplotypes (with and without controlling for OPRM1 genotype, and between OPRM1 genotypes (with and without controlling for ABCB1 haplotype.Results: Among wild-type OPRM1 subjects, an ABCB1 variant haplotype group (subjects with a wild-type and 61A:1199G:1236C:2677T:3435T haplotype combination, or homozygous for the 61A:1199G:1236C:2677T:3435T haplotype had significantly lower doses (median ± standard

  10. Association of LRP5 haplotypes with osteoporosis in Mexican women.

    Science.gov (United States)

    Falcón-Ramírez, Edith; Casas-Avila, Leonora; Cerda-Flores, Ricardo M; Castro-Hernández, Clementina; Rubio-Lightbourn, Julieta; Velázquez-Cruz, Rafael; Diez-G, Pilar; Peñaloza-Espinosa, Rosenda; Valdés-Flores, Margarita

    2013-03-01

    Osteoporosis is a common health problem in Mexico, so it is essential to investigate the status of different gene polymorphisms that could serve as genetic susceptibility markers in the Mexican population. Genes with a role in bone metabolism are excellent candidates for association studies. In this study were determined the allelic and genotypic frequencies of four polymorphic markers (C/T rs3736228, G/A rs4988321, T/C rs627174 and T/C rs901824) in the low-density lipoprotein receptor-related protein 5 gene (LRP5) and their association with osteoporosis in 100 pos-menopausal osteoporotic Mexican women and their controls, using real time-PCR and TaqMan probes. Only the G/A polymorphism (rs4988321, Val667Met) showed significant differences (p = 0.039) when genotype frequencies were compared. However, when the haplotypes of these four polymorphisms were analyzed, interesting associations became evident. The CGTT haplotype showed significant association with low risk of osteoporosis (OR 0.629; p = 0.007; [95 % CI, 0.448-0.884]), whereas the TACT haplotype was significantly associated with a higher risk of osteoporosis (OR 7.965; p = 0.006; [95 % CI, 1.557-54.775]). Our results supported the association of LRP5 with osteoporosis and showed the potential value of LRP5 haplotypes to identify risk of osteoporosis in Mexican population.

  11. Estimating haplotype effects for survival data

    DEFF Research Database (Denmark)

    Scheike, Thomas; Martinussen, Torben; Silver, J

    2010-01-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplo...

  12. RFID sensors as the common sensing platform for single-use biopharmaceutical manufacturing

    International Nuclear Information System (INIS)

    Potyrailo, Radislav A; Surman, Cheryl; Monk, David; Morris, William G; Wortley, Timothy; Vincent, Mark; Diana, Rafael; Pizzi, Vincent; Carter, Jeffrey; Gach, Gerard; Klensmeden, Staffan; Ehring, Hanno

    2011-01-01

    The lack of reliable single-use sensors prevents the biopharmaceutical industry from fully embracing single-use biomanufacturing processes. Sensors based on the same detection platform for all critical parameters in single-use bioprocess components would be highly desirable to significantly simplify their installation, calibration and operation. We review here our approach for passive radio-frequency identification (RFID)-based sensing that does not rely on costly proprietary RFID memory chips with an analog input but rather implements ubiquitous passive 13.56 MHz RFID tags as inductively coupled sensors with at least 16 bit resolution provided by a sensor reader. The developed RFID sensors combine several measured parameters from the resonant sensor antenna with multivariate data analysis and deliver unique capability of multiparameter sensing and rejection of environmental interferences with a single sensor. This general sensing approach provides an elegant solution for both analytical measurement and identification and documentation of the measured location. (topical review)

  13. A Genome-Wide Association Study for Agronomic Traits in Soybean Using SNP Markers and SNP-Based Haplotype Analysis.

    Directory of Open Access Journals (Sweden)

    Rodrigo Iván Contreras-Soto

    Full Text Available Mapping quantitative trait loci through the use of linkage disequilibrium (LD in populations of unrelated individuals provides a valuable approach for dissecting the genetic basis of complex traits in soybean (Glycine max. The haplotype-based genome-wide association study (GWAS has now been proposed as a complementary approach to intensify benefits from LD, which enable to assess the genetic determinants of agronomic traits. In this study a GWAS was undertaken to identify genomic regions that control 100-seed weight (SW, plant height (PH and seed yield (SY in a soybean association mapping panel using single nucleotide polymorphism (SNP markers and haplotype information. The soybean cultivars (N = 169 were field-evaluated across four locations of southern Brazil. The genome-wide haplotype association analysis (941 haplotypes identified eleven, seventeen and fifty-nine SNP-based haplotypes significantly associated with SY, SW and PH, respectively. Although most marker-trait associations were environment and trait specific, stable haplotype associations were identified for SY and SW across environments (i.e., haplotypes Gm12_Hap12. The haplotype block 42 on Chr19 (Gm19_Hap42 was confirmed to be associated with PH in two environments. These findings enable us to refine the breeding strategy for tropical soybean, which confirm that haplotype-based GWAS can provide new insights on the genetic determinants that are not captured by the single-marker approach.

  14. Recovery of native genetic background in admixed populations using haplotypes, phenotypes, and pedigree information--using Cika cattle as a case breed.

    Directory of Open Access Journals (Sweden)

    Mojca Simčič

    Full Text Available The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which

  15. The influence of interleukin 7 receptor α chain haplotypes on outcome after allogeneic hematopoietic cell transplantation

    OpenAIRE

    Broux, Bieke; Shamim, Zaiba; Wang, Tao; Spellman, Stephen; Haagenson, Michael; Stinissen, Piet; Ryder, Lars Peter; Müller, Klaus; Hellings, Niels

    2014-01-01

    We investigated the influence of IL-7 receptor -chain (IL-7R) gene haplotypes in donors on the outcome of haematopoietic cell transplantation (HCT). Unlike the association between single donor SNPs and HCT outcome found previously, only trends towards association were found here, due to dilution' of SNPs into haplotypes. This project was funded by Hasselt University, Fonds voor Wetenschappelijk Onderzoek, Belgian Charcot Foundation, University Hospital Rigshospitalet Copenhagen, the Dagmar...

  16. Common-Ground-Type Tansformerless Inverters for Single-Phase Solar Photovoltaic Systems

    DEFF Research Database (Denmark)

    Siwakoti, Yam Prasad; Blaabjerg, Frede

    2018-01-01

    This paper proposes a family of novel flying capacitor transformerless inverters for single-phase photovoltaic (PV) systems. Each of the new topologies proposed is based on a flying capacitor principle and requires only four power switches and/or diodes, one capacitor, and a small filter at the o......This paper proposes a family of novel flying capacitor transformerless inverters for single-phase photovoltaic (PV) systems. Each of the new topologies proposed is based on a flying capacitor principle and requires only four power switches and/or diodes, one capacitor, and a small filter...

  17. Identification of a cryptic lethal mutation in the mouse t(w73) haplotype.

    Science.gov (United States)

    Howell, Gareth R; Bergstrom, Rebecca A; Munroe, Robert J; Masse, Jessica; Schimenti, John C

    2004-12-01

    t haplotypes are naturally occurring, variant forms of the t complex on mouse chromosome 17, characterized by the presence of four inversions with respect to wild-type. They harbour mutations causing male sterility, male transmission ratio distortion (TRD) and embryonic lethality. Mice carrying t haplotypes have been found throughout the world, and genetic studies of the lethal mutations have identified at least 16 complementation groups. The embryonic lethal phenotypes of many t haplotypes have been characterized in detail, and are thought to be the consequence of homozygosity for single gene mutations. However, the existence of additional mutations in genes that function at later stages of development would be obscured. Here we investigated the possibility of multiple mutations in t haplotypes by screening the t(w73) haplotype for the presence of novel mutations. Since genetic analysis of t haplotype mutations is hindered by recombination suppression due to the inversions, deletion complexes covering the proximal two-thirds of the t complex were used to uncover the presence of any new lethal alleles. This analysis revealed a novel mutation between D17Jcs41 and D17Mit100, causing mice carrying both t(w73) and selected deletions to die at birth, prior to feeding. The finding of a new, cryptic lethal mutation in t haplotypes is an indication that these recombinationally isolated chromosomes, which already contain at least one lethal mutation that prevents homozygosity, may serve as sinks for the accumulation of additional recessive mutations.

  18. Revealing complete complex KIR haplotypes phased by long-read sequencing technology.

    Science.gov (United States)

    Roe, D; Vierra-Green, C; Pyo, C-W; Eng, K; Hall, R; Kuang, R; Spellman, S; Ranade, S; Geraghty, D E; Maiers, M

    2017-09-01

    The killer cell immunoglobulin-like receptor (KIR) region of human chromosome 19 contains up to 16 genes for natural killer (NK) cell receptors that recognize human leukocyte antigen (HLA)/peptide complexes and other ligands. The KIR proteins fulfill functional roles in infections, pregnancy, autoimmune diseases and transplantation. However, their characterization remains a constant challenge. Not only are the genes highly homologous due to their recent evolution by tandem duplications, but the region is structurally dynamic due to frequent transposon-mediated recombination. A sequencing approach that precisely captures the complexity of KIR haplotypes for functional annotation is desirable. We present a unique approach to haplotype the KIR loci using single-molecule, real-time (SMRT) sequencing. Using this method, we have-for the first time-comprehensively sequenced and phased sixteen KIR haplotypes from eight individuals without imputation. The information revealed four novel haplotype structures, a novel gene-fusion allele, novel and confirmed insertion/deletion events, a homozygous individual, and overall diversity for the structural haplotypes and their alleles. These KIR haplotypes augment our existing knowledge by providing high-quality references, evolutionary informers, and source material for imputation. The haplotype sequences and gene annotations provide alternative loci for the KIR region in the human genome reference GrCh38.p8.

  19. Strobe sequence design for haplotype assembly

    Science.gov (United States)

    2011-01-01

    Background Humans are diploid, carrying two copies of each chromosome, one from each parent. Separating the paternal and maternal chromosomes is an important component of genetic analyses such as determining genetic association, inferring evolutionary scenarios, computing recombination rates, and detecting cis-regulatory events. As the pair of chromosomes are mostly identical to each other, linking together of alleles at heterozygous sites is sufficient to phase, or separate the two chromosomes. In Haplotype Assembly, the linking is done by sequenced fragments that overlap two heterozygous sites. While there has been a lot of research on correcting errors to achieve accurate haplotypes via assembly, relatively little work has been done on designing sequencing experiments to get long haplotypes. Here, we describe the different design parameters that can be adjusted with next generation and upcoming sequencing technologies, and study the impact of design choice on the length of the haplotype. Results We show that a number of parameters influence haplotype length, with the most significant one being the advance length (distance between two fragments of a clone). Given technologies like strobe sequencing that allow for large variations in advance lengths, we design and implement a simulated annealing algorithm to sample a large space of distributions over advance-lengths. Extensive simulations on individual genomic sequences suggest that a non-trivial distribution over advance lengths results a 1-2 order of magnitude improvement in median haplotype length. Conclusions Our results suggest that haplotyping of large, biologically important genomic regions is feasible with current technologies. PMID:21342554

  20. Evidence for a single loss of mineralized teeth in the common avian ancestor

    DEFF Research Database (Denmark)

    Meredith, Robert W.; Zhang, Guojie; Gilbert, M. Thomas P.

    2014-01-01

    analyses representing lineages of nearly all extant bird orders and recovered shared, inactivating mutations within genes expressed in both the enamel and dentin of teeth of other vertebrate species, indicating that the common ancestor of modern birds lacked mineralized teeth.We estimate that tooth loss...

  1. H-Bridge Transformerless Inverter with Common Ground for Single-Phase Solar-Photovoltaic System

    DEFF Research Database (Denmark)

    Siwakoti, Yam Prasad; Blaabjerg, Frede

    2017-01-01

    IGBT's (RB-IGBT) and two MOSFET's), a capacitor and a small filter at the output stage. The proposed topology share a common ground with the grid and the PV source. A Unipolar Sinusoidal Pulse-Width Modulation (SPWM) technique is used to modulate the inverter to minimize switching loss, output current...

  2. A Feasibility Assessment of a Single Contracting Office for Common-User Transportation Services

    Science.gov (United States)

    1990-09-01

    Defense should establish a single unified command to integrate global air, land, and sea transportation, and should have flexibility to structure this...34provide global land, sea, and air transportation to meet national security needs" (66:22). By meeting the research objectives and answering the research... Bussiness Daily RCAS of Proposal (RFP) (TRCR & LGCR) (CBD) Requirenent Carriers Request Carriers Submit IRCAS Evaluates Award Based on Copy of RFP Proposals

  3. KIR haplotypes defined by segregation analysis in 59 Centre d'Etude Polymorphisme Humain (CEPH) families.

    Science.gov (United States)

    Martin, M P; Single, R M; Wilson, M J; Trowsdale, J; Carrington, M

    2008-12-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity. Variation at the locus is associated with an increasing number of human diseases, reminiscent of the HLA loci. Characterization of diversity at the KIR locus has progressed over the past several years, particularly since the sequence of entire KIR haplotypes have become available. To determine the extent of KIR haplotypic variability among individuals of northern European descent, we genotyped 59 CEPH families for presence/absence of all KIR genes and performed limited allelic subtyping at several KIR loci. A total of 20 unique haplotypes differing in gene content were identified, the most common of which was the previously defined A haplotype (f = 0.52). Several unusual haplotypes that probably arose as a consequence of unequal crossing over events were also identified. Linkage disequilibrium (LD) analysis indicated strong negative and positive LD between several pairs of genes, values that may be useful in determining haplotypic structure when family data are not available. These data provide a resource to aid in the interpretation of disease association data involving individuals of European descent.

  4. KIR haplotypes defined by segregation analysis in 59 Centre d’Etude Polymorphisme Humain (CEPH) families

    Science.gov (United States)

    Martin, M. P.; Single, R. M.; Wilson, M. J.; Trowsdale, J.

    2012-01-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity. Variation at the locus is associated with an increasing number of human diseases, reminiscent of the HLA loci. Characterization of diversity at the KIR locus has progressed over the past several years, particularly since the sequence of entire KIR haplotypes have become available. To determine the extent of KIR haplotypic variability among individuals of northern European descent, we genotyped 59 CEPH families for presence/absence of all KIR genes and performed limited allelic subtyping at several KIR loci. A total of 20 unique haplotypes differing in gene content were identified, the most common of which was the previously defined A haplotype (f=0.52). Several unusual haplotypes that probably arose as a consequence of unequal crossing over events were also identified. Linkage disequilibrium (LD) analysis indicated strong negative and positive LD between several pairs of genes, values that may be useful in determining haplotypic structure when family data are not available. These data provide a resource to aid in the interpretation of disease association data involving individuals of European descent. PMID:18972110

  5. Bilinear common spatial pattern for single-trial ERP-based rapid serial visual presentation triage.

    Science.gov (United States)

    Yu, K; Shen, K; Shao, S; Ng, W C; Li, X

    2012-08-01

    Common spatial pattern (CSP) analysis is a useful tool for the feature extraction of event-related potentials (ERP). However, CSP is essentially time invariant, and thus unable to exploit the temporal information of ERP. This paper proposes a variant of CSP, namely bilinear common spatial pattern (BCSP), which is capable of accommodating both spatial and temporal information. BCSP generalizes CSP through iteratively optimizing bilinear filters. These bilinear filters constitute a spatio-temporal subspace in which the separation between two conditions is maximized. The method is unique in the sense that it is mathematically intuitive and simple, as all the bilinear filters are obtained by maximizing the power ratio as CSP does. The proposed method was evaluated on 20 subjects' ERP data collected in rapid serial visual presentation triage experiments. The results show that BCSP achieved significantly higher average test accuracy (12.3% higher, p < 0.001).

  6. Development of a single-layer Nb3Sn common coil dipole model

    Energy Technology Data Exchange (ETDEWEB)

    Igor Novitski et al.

    2002-12-13

    A high-field dipole magnet based on the common coil design was developed at Fermilab for a future Very Large Hadron Collider. A short model of this magnet with a design field of 11 T in two 40-mm apertures is being fabricated using the react-and-wind technique. In order to study and optimize the magnet design two 165-mm long mechanical models were assembled and tested. A technological model consisting of magnet straight section and ends was also fabricated in order to check the tooling and the winding and assembly procedures. This paper describes the design and technology of the common coil dipole magnet and summarizes the status of short model fabrication.The results of the mechanical model tests and comparison with FE mechanical analysis are also presented.

  7. Nucleotide-binding oligomerization domain containing 1 (NOD1 haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

    Directory of Open Access Journals (Sweden)

    Barclay Murray L

    2009-03-01

    Full Text Available Abstract Background The nucleotide-binding oligomerization domain containing 1 (NOD1 gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD, 405 ulcerative colitis (UC, 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1 was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population.

  8. U.S. Army Field Demonstration of the Single Common Powertrain Lubricant (SCPL)

    Science.gov (United States)

    2015-02-01

    leaching of silicon containing sealant compounds common in a new engines.  LW028 (TEST) showed slightly increase iron and silicon content at EOT...incorrect AOAP sample identification issue.  REC08 (TEST) received necessary oil change between 1st & 2nd QTR due to high silicon (Si) accumulation... Silicon accumulation was attributed to dirt ingestion, which is not uncommon for this vehicle type. The “as found” sample revealed similarly high

  9. Intragenic haplotype analysis of common HFE mutations in the ...

    Indian Academy of Sciences (India)

    OE/SADG/UI0283/2011). References. Adams P. C. 2000 Population screening for hemochromatosis. Gut. 46, 301–303. Beutler E. and West C. 1997 New diallelic markers in the HLA region of chromosome 6. Blood Cells Mol. Dis. 30, 219–229.

  10. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Wellington dos Santos Silva

    2010-01-01

    Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  11. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

    Science.gov (United States)

    Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

    2010-07-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  12. Single-trial detection of visual evoked potentials by common spatial patterns and wavelet filtering for brain-computer interface.

    Science.gov (United States)

    Tu, Yiheng; Huang, Gan; Hung, Yeung Sam; Hu, Li; Hu, Yong; Zhang, Zhiguo

    2013-01-01

    Event-related potentials (ERPs) are widely used in brain-computer interface (BCI) systems as input signals conveying a subject's intention. A fast and reliable single-trial ERP detection method can be used to develop a BCI system with both high speed and high accuracy. However, most of single-trial ERP detection methods are developed for offline EEG analysis and thus have a high computational complexity and need manual operations. Therefore, they are not applicable to practical BCI systems, which require a low-complexity and automatic ERP detection method. This work presents a joint spatial-time-frequency filter that combines common spatial patterns (CSP) and wavelet filtering (WF) for improving the signal-to-noise (SNR) of visual evoked potentials (VEP), which can lead to a single-trial ERP-based BCI.

  13. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    Science.gov (United States)

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  14. Diverticulitis and Crohn's disease have distinct but overlapping tumor necrosis superfamily 15 haplotypes.

    Science.gov (United States)

    Connelly, Tara M; Choi, Christine S; Berg, Arthur S; Harris, Leonard; Coble, Joel; Koltun, Walter A

    2017-06-15

    Diverticulitis (DD) and Crohn's disease (CD) have overlapping features including bowel structuring, inflammation, and infection. Tumor necrosis superfamily 15 (TNFSF15) is an immunoregulatory, anti-angiogenic gene. CD has been previously associated with a haplotype of five TNFSF15 single-nucleotide polymorphism alleles: rs3810936 (G allele), rs6478108 (A), rs6478109 (G), rs7848647 (G), and rs7869487 (A). We aimed to determine the TNFSF15 risk haplotype for DD versus controls with a subgroup analysis of youthful DD patients (aged ≤55 y) versus older controls (aged ≥55 y). A total of 148 diverticulitis patients (90 aged ≤55 y) and 200 controls (87 aged ≥55 y) were genotyped using our custom-designed Illumina Veracode microarray chip. Genotypes from rs3810936, rs6478108, rs6478109, rs7848647, rs7869487 and two additional TNFSF15 single nucleotide polymorphisms, rs3810936 and rs11554257, were analyzed. PHASE version 2.1, R with HaploStats and the Broad Institute's Haploview program were used for statistics and imputed haplotype frequency. Permutation corrected for multiple comparisons. The CD GAGGA haplotype was significantly associated with diverticulitis (P = 0.03) in the all DD versus all controls comparison. A second haplotype, rs6478108 (A), rs6478109 (G), rs7869487 (A), and rs4263839 (G), was also associated with DD in this cohort (P = 0.025). A third haplotype rs6478108 (A), rs6478109 (G), rs7848647 (G) and rs7869487 (A), rs4263839 (G) was demonstrated in the DD 55 comparison (P = 0.045). Distinct but overlapping TNFSF15 haplotypes were demonstrated in diverticulitis patients versus healthy controls when compared with the known Crohn's risk haplotype suggesting similar but distinct genetic predispositions. This study strengthens the role for a genetic predisposition to diverticulitis that involves the TNFSF15 gene. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA

    Directory of Open Access Journals (Sweden)

    Nidia Gutiérrez-López

    2016-04-01

    Full Text Available Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations and genetic origin (based on a previous study. We identified six polymorphic sites, including five insertion/deletion (indels types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038. Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80 with 10 and 12 haplotypes, respectively. The common haplotype (H1 for both networks included cacao trees from all geographic locations (geographic approach and four genetic groups (genetic approach. This common haplotype (ancient derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0 and SAMOVA (FST = 0.04393 results. One population (Mazatán showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding.

  16. Single-Center Experience with Intimal Sarcoma, an Ultra-Orphan, Commonly Fatal Mesenchymal Malignancy.

    Science.gov (United States)

    Van Dievel, Julie; Sciot, Raf; Delcroix, Marion; Vandeweyer, Raf O; Debiec-Rychter, Maria; Dewaele, Barbara; Cornillie, Jasmien; Van Cann, Thomas; Meyns, Bart; Schöffski, Patrick

    2017-01-01

    Intimal sarcoma is a rare malignancy that, clinically and radiographically, often mimics pulmonary embolism. The intravascular tumor tends to disseminate rapidly and metastases can be present at first diagnosis. We reviewed all cases of intimal sarcoma that were diagnosed, treated and followed at the University Hospitals Leuven between April 2006 and April 2016. We identified 13 patients with a median age of 51 years. In 6 patients initial findings were suggestive of thromboembolic disease. Platelet-derived growth factor receptor α (PDGFRA) amplification was the most prevalent molecular finding, present in 11 patients. The MDM2 gene was amplified in 9 cases, and the EGFR gene in 3 patients. The median overall survival was 13 months. 11 patients underwent surgery. In 5 cases with inoperable and/or metastatic disease chemotherapy was given. Treatment with imatinib was initiated in 4 patients. Intimal sarcoma is an extremely rare and aggressive malignancy that has a very poor prognosis. Mimicking thromboembolic disease, diagnosis and treatment can be delayed. Surgery is the mainstay of treatment but is seldom curative. The disease is highly resistant to cytotoxic and targeted treatment. Given the fact that intimal sarcoma commonly expresses more than 1 molecular target, combination therapy might be an option, although toxicity may be a limitation. © 2017 S. Karger GmbH, Freiburg.

  17. Global haplotype partitioning for maximal associated SNP pairs.

    Science.gov (United States)

    Katanforoush, Ali; Sadeghi, Mehdi; Pezeshk, Hamid; Elahi, Elahe

    2009-08-27

    Global partitioning based on pairwise associations of SNPs has not previously been used to define haplotype blocks within genomes. Here, we define an association index based on LD between SNP pairs. We use the Fisher's exact test to assess the statistical significance of the LD estimator. By this test, each SNP pair is characterized as associated, independent, or not-statistically-significant. We set limits on the maximum acceptable proportion of independent pairs within all blocks and search for the partitioning with maximal proportion of associated SNP pairs. Essentially, this model is reduced to a constrained optimization problem, the solution of which is obtained by iterating a dynamic programming algorithm. In comparison with other methods, our algorithm reports blocks of larger average size. Nevertheless, the haplotype diversity within the blocks is captured by a small number of tagSNPs. Resampling HapMap haplotypes under a block-based model of recombination showed that our algorithm is robust in reproducing the same partitioning for recombinant samples. Our algorithm performed better than previously reported models in a case-control association study aimed at mapping a single locus trait, based on simulation results that were evaluated by a block-based statistical test. Compared to methods of haplotype block partitioning, we performed best on detection of recombination hotspots. Our proposed method divides chromosomes into the regions within which allelic associations of SNP pairs are maximized. This approach presents a native design for dimension reduction in genome-wide association studies. Our results show that the pairwise allelic association of SNPs can describe various features of genomic variation, in particular recombination hotspots.

  18. Global haplotype partitioning for maximal associated SNP pairs

    Directory of Open Access Journals (Sweden)

    Pezeshk Hamid

    2009-08-01

    Full Text Available Abstract Background Global partitioning based on pairwise associations of SNPs has not previously been used to define haplotype blocks within genomes. Here, we define an association index based on LD between SNP pairs. We use the Fisher's exact test to assess the statistical significance of the LD estimator. By this test, each SNP pair is characterized as associated, independent, or not-statistically-significant. We set limits on the maximum acceptable proportion of independent pairs within all blocks and search for the partitioning with maximal proportion of associated SNP pairs. Essentially, this model is reduced to a constrained optimization problem, the solution of which is obtained by iterating a dynamic programming algorithm. Results In comparison with other methods, our algorithm reports blocks of larger average size. Nevertheless, the haplotype diversity within the blocks is captured by a small number of tagSNPs. Resampling HapMap haplotypes under a block-based model of recombination showed that our algorithm is robust in reproducing the same partitioning for recombinant samples. Our algorithm performed better than previously reported models in a case-control association study aimed at mapping a single locus trait, based on simulation results that were evaluated by a block-based statistical test. Compared to methods of haplotype block partitioning, we performed best on detection of recombination hotspots. Conclusion Our proposed method divides chromosomes into the regions within which allelic associations of SNP pairs are maximized. This approach presents a native design for dimension reduction in genome-wide association studies. Our results show that the pairwise allelic association of SNPs can describe various features of genomic variation, in particular recombination hotspots.

  19. Homocysteine concentration in coronary artery disease: Influence of three common single nucleotide polymorphisms.

    Science.gov (United States)

    Bickel, C; Schnabel, R B; Zengin, E; Lubos, E; Rupprecht, H; Lackner, K; Proust, C; Tregouet, D; Blankenberg, S; Westermann, D; Sinning, C

    2017-02-01

    Whether single nucleotide polymorphisms (SNPs) of homocysteine metabolism enzymes influence the rate of cardiovascular (CV) events in coronary artery disease (CAD) patients remains controversial. In this analysis, 1126 subjects from the AtheroGene study with CAD and 332 control subjects without known CAD were included. The following SNPs were investigated: methylentetrahydrofolate reductase (MTHFR-C667T), methionin synthetase (MS-D919G), and cystathionin beta synthetase (CBS-I278T). The endpoint was the combination of cardiovascular death, stroke, and non-fatal myocardial infarction (N = 286). The median follow-up time was 6.4 years. Kaplan-Meier curve analysis showed an increasing event rate with rising homocysteine levels (p homocysteine was a predictor of the endpoint with a hazard ratio (HR) of 6.5 (95% CI: 2.9-14.6, p homocysteine levels significantly in patients with CAD and individuals without CAD (both p homocysteine levels in CAD patients or controls. The different SNPs of MTHFR, MS, and CBS were not related to an increased event rate. Homocysteine level is a strong predictor of CV events. Subjects with and without CAD and SNPs in the enzyme MTHFR had increased homocysteine levels. This was not observed for MS and CBS SNPs. Although MTHFR SNPs alter homocysteine levels in patients and controls, these polymorphisms had no impact on prognosis in CAD patients. Copyright © 2016 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  20. Copy number variation leads to considerable diversity for B but not A haplotypes of the human KIR genes encoding NK cell receptors.

    Science.gov (United States)

    Jiang, Wei; Johnson, Chris; Jayaraman, Jyothi; Simecek, Nikol; Noble, Janelle; Moffatt, Miriam F; Cookson, William O; Trowsdale, John; Traherne, James A

    2012-10-01

    The KIR complex appears to be evolving rapidly in humans, and more than 50 different haplotypes have been described, ranging from four to 14 KIR loci. Previously it has been suggested that most KIR haplotypes consist of framework genes, present in all individuals, which bracket a variable number of other genes. We used a new technique to type 793 families from the United Kingdom and United States for both the presence/absence of all individual KIR genes as well as copy number and found that KIR haplotypes are even more complex. It is striking that all KIR loci are subject to copy number variation (CNV), including the so-called framework genes, but CNV is much more frequent in KIR B haplotypes than KIR A haplotypes. These two basic KIR haplotype groups, A and B, appear to be following different evolutionary trajectories. Despite the great diversity, there are 11 common haplotypes, derived by reciprocal recombination near KIR2DL4, which collectively account for 94% of KIR haplotypes determined in Caucasian samples. These haplotypes could be derived from combinations of just three centromeic and two telomeric motifs, simplifying disease analysis for these haplotypes. The remaining 6% of haplotypes displayed novel examples of expansion and contraction of numbers of loci. Conventional KIR typing misses much of this additional complexity, with important implications for studying the genetics of disease association with KIR that can now be explored by CNV analysis.

  1. References for Haplotype Imputation in the Big Data Era.

    Science.gov (United States)

    Li, Wenzhi; Xu, Wei; Li, Qiling; Ma, Li; Song, Qing

    2015-11-01

    Imputation is a powerful in silico approach to fill in those missing values in the big datasets. This process requires a reference panel, which is a collection of big data from which the missing information can be extracted and imputed. Haplotype imputation requires ethnicity-matched references; a mismatched reference panel will significantly reduce the quality of imputation. However, currently existing big datasets cover only a small number of ethnicities, there is a lack of ethnicity-matched references for many ethnic populations in the world, which has hampered the data imputation of haplotypes and its downstream applications. To solve this issue, several approaches have been proposed and explored, including the mixed reference panel, the internal reference panel and genotype-converted reference panel. This review article provides the information and comparison between these approaches. Increasing evidence showed that not just one or two genetic elements dictate the gene activity and functions; instead, cis-interactions of multiple elements dictate gene activity. Cis-interactions require the interacting elements to be on the same chromosome molecule, therefore, haplotype analysis is essential for the investigation of cis-interactions among multiple genetic variants at different loci, and appears to be especially important for studying the common diseases. It will be valuable in a wide spectrum of applications from academic research, to clinical diagnosis, prevention, treatment, and pharmaceutical industry.

  2. Simultaneous dual-wavelength-band common-path swept-source optical coherence tomography with single polygon mirror scanner.

    Science.gov (United States)

    Mao, Youxin; Chang, Shoude; Murdock, Erroll; Flueraru, Costel

    2011-06-01

    We report a novel (to the best of our knowledge) simultaneous 1310/1550 two-wavelength band swept laser source and dual-band common-path swept-source optical coherence tomography (SS-OCT). Synchronized dual-wavelength tuning is performed by using two laser cavities and narrowband wavelength filters with a single dual-window polygonal scanner. Measured average output powers of 60 and 27 mW have been achieved for the 1310 and 1550 nm bands, respectively, while the two wavelengths were swept simultaneously from 1227 to 1387 nm for the 1310 nm band and from 1519 to 1581 nm for the 1550 nm band at an A-scan rate of 65 kHz. Broadband wavelength-division multiplexing is used for coupling two wavelengths into a common-path single-mode GRIN-lensed fiber probe to form dual-band common-path SS-OCT. Simultaneous OCT imaging at 1310 and 1550 nm is achieved. This technique allows for in vivo high-speed OCT imaging with potential application in functional (spectroscopic) investigations. © 2011 Optical Society of America

  3. Endothelial Nitric Oxide Synthase Haplotypes Are Associated with Preeclampsia in Maya Mestizo Women

    Science.gov (United States)

    Díaz-Olguín, Lizbeth; Coral-Vázquez, Ramón Mauricio; Canto-Cetina, Thelma; Canizales-Quinteros, Samuel; Ramírez Regalado, Belem; Fernández, Genny; Canto, Patricia

    2011-01-01

    Preeclampsia is a specific disease of pregnancy and believed to have a genetic component. The aim of this study was to investigate if three polymorphisms in eNOS or their haplotypes are associated with preeclampsia in Maya mestizo women. A case-control study was performed where 127 preeclamptic patients and 263 controls were included. Genotyped and haplotypes for the -768T→C, intron 4 variants, Glu298Asp of eNOS were determined by PCR and real-time PCR allelic discrimination. Logistic regression analysis with adjustment for age and body mass index (BMI) was used to test for associations between genotype and preeclampsia under recessive, codominant and dominant models. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r2, and haplotype analysis was conducted. Women homozygous for the Asp298 allele showed an association of preeclampsia. In addition, analysis of the haplotype frequencies revealed that the -786C-4b-Asp298 haplotype was significantly more frequent in preeclamptic patients than in controls (0.143 vs. 0.041, respectively; OR = 3.01; 95% CI = 1.74–5.23; P = 2.9 × 10−4). Despite the Asp298 genotype in a recessive model associated with the presence of preeclampsia in Maya mestizo women, we believe that in this population the -786C-4b-Asp298 haplotype is a better genetic marker. PMID:21897002

  4. An accurate clone-based haplotyping method by overlapping pool sequencing.

    Science.gov (United States)

    Li, Cheng; Cao, Changchang; Tu, Jing; Sun, Xiao

    2016-07-08

    Chromosome-long haplotyping of human genomes is important to identify genetic variants with differing gene expression, in human evolution studies, clinical diagnosis, and other biological and medical fields. Although several methods have realized haplotyping based on sequencing technologies or population statistics, accuracy and cost are factors that prohibit their wide use. Borrowing ideas from group testing theories, we proposed a clone-based haplotyping method by overlapping pool sequencing. The clones from a single individual were pooled combinatorially and then sequenced. According to the distinct pooling pattern for each clone in the overlapping pool sequencing, alleles for the recovered variants could be assigned to their original clones precisely. Subsequently, the clone sequences could be reconstructed by linking these alleles accordingly and assembling them into haplotypes with high accuracy. To verify the utility of our method, we constructed 130 110 clones in silico for the individual NA12878 and simulated the pooling and sequencing process. Ultimately, 99.9% of variants on chromosome 1 that were covered by clones from both parental chromosomes were recovered correctly, and 112 haplotype contigs were assembled with an N50 length of 3.4 Mb and no switch errors. A comparison with current clone-based haplotyping methods indicated our method was more accurate. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. ANKLE JOINT CONTROL DURING SINGLE-LEGGED BALANCE USING COMMON BALANCE TRAINING DEVICES - IMPLICATIONS FOR REHABILITATION STRATEGIES

    DEFF Research Database (Denmark)

    Strøm, Mark; Thorborg, Kristian; Bandholm, Thomas

    2016-01-01

    BACKGROUND: A lateral ankle sprain is the most prevalent musculoskeletal injury in sports. Exercises that aim to improve balance are a standard part of the ankle rehabilitation process. In an optimal progression model for ankle rehabilitation and prevention of future ankle sprains, it is important...... to characterize different balance exercises based on level of difficulty and sensori-motor training stimulus. PURPOSE: The purpose of this study was to investigate frontal-plane ankle kinematics and associated peroneal muscle activity during single-legged balance on stable surface (floor) and three commonly used...... balance devices (Airex®, BOSU® Ball and wobble board). DESIGN: Descriptive exploratory laboratory study. METHODS: Nineteen healthy subjects performed single-legged balance with eyes open on an Airex® mat, BOSU® Ball, wobble board, and floor (reference condition). Ankle kinematics were measured using...

  6. The association of the JAK2 46/1 haplotype with non-splanchnic venous thrombosis.

    Science.gov (United States)

    Zerjavic, Katja; Zagradisnik, Boris; Lokar, Lidija; Krasevac, Marjana G; Vokac, Nadja K

    2013-08-01

    The inherited JAK2 46/1 haplotype is strongly associated with the development of myeloproliferative neoplasms (MPNs), and its increased frequency has also been reported in splanchnic venous thrombosis (SVT). In the present study, the role of the JAK2 46/1 haplotype in non-splanchnic venous thrombosis (non-SVT) was investigated. We genotyped 438 patients with non-SVT, 226 patients with MPNs and 459 healthy controls for three single nucleotide polymorphisms (SNPs) which tag the JAK2 46/1 haplotype (rs12342421 G>C, rs12343867 T>C and rs10974944 C>G). We found statistically significant association of the rs12342421 GC+CC genotypes (OR=1.40; p=0.023) and the rs12343867 TC+CC genotypes (OR=1.83; p=7.02 x 10(-5)) with non-SVT. We also found that the CC haplotype of these two SNPs was associated with an increased risk of the disease (OR=1.68; p=0.009). Stratification analysis indicated that the observed association of the JAK2 46/1 haplotype with non-SVT was probably largely free of confounding effect of thrombophilic risk factors. In addition, we established a strong association of SNPs rs12342421 and rs10974944 and their CG haplotype with MPNs and with JAK2 V617F-positive MPNs. This study provides statistical evidence that SNPs rs12342421 and rs12343867 are associated with an increased risk of non-SVT. Consistently, haplotypes of the SNPs were also associated with non-SVT risk, suggesting that inherited genetic variation in the JAK2 gene may play a role in the pathogenesis of non-SVT. Furthermore, the reported associations of the JAK2 46/1 haplotype with MPNs as well as with the occurrence of the JAK2 V617F mutation in MPNs were confirmed. © 2013.

  7. A common single nucleotide polymorphism can exacerbate long-QT type 2 syndrome leading to sudden infant death

    DEFF Research Database (Denmark)

    Nof, Eyal; Cordeiro, Jonathan M; Pérez, Guillermo J

    2010-01-01

    and mutation expressed singly and in combination in Chinese ovary (CHO-K1) and COS-1 cells. An asymptomatic woman presenting after the death of her 2-day-old infant and spontaneous abortion of a second baby in the first trimester was referred for genetic analysis. The newborn infant had nearly incessant...... suggest that a common polymorphism (K897T) can markedly accentuate the loss of function of mildly defective HERG channels, leading to long-QT syndrome-mediated arrhythmias and sudden infant death....

  8. Inheritance of Hetero-Diploid Pollen S-Haplotype in Self-Compatible Tetraploid Chinese Cherry (Prunus pseudocerasus Lindl)

    Science.gov (United States)

    Gu, Chao; Liu, Qing-Zhong; Yang, Ya-Nan; Zhang, Shu-Jun; Khan, Muhammad Awais; Wu, Jun; Zhang, Shao-Ling

    2013-01-01

    The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus) cultivars and one diploid sweet cherry (Prunus avium) cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype) was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries. PMID:23596519

  9. Inheritance of hetero-diploid pollen S-haplotype in self-compatible tetraploid Chinese cherry (Prunus pseudocerasus Lindl.

    Directory of Open Access Journals (Sweden)

    Chao Gu

    Full Text Available The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus cultivars and one diploid sweet cherry (Prunus avium cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries.

  10. Estimating haplotype effects for survival data.

    Science.gov (United States)

    Scheike, Thomas H; Martinussen, Torben; Silver, Jeremy D

    2010-09-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplotype effects for survival data. These estimating equations are simple to implement and avoid the use of the EM algorithm, which may be slow in the context of the semiparametric Cox model with incomplete covariate information. These estimating equations also lead to easily computable, direct estimators of standard errors, and thus overcome some of the difficulty in obtaining variance estimators based on the EM algorithm in this setting. We also develop an easily implemented goodness-of-fit procedure for Cox's regression model including haplotype effects. Finally, we apply the procedures presented in this article to investigate possible haplotype effects of the PAF-receptor on cardiovascular events in patients with coronary artery disease, and compare our results to those based on the EM algorithm. © 2009, The International Biometric Society.

  11. Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species.

    Science.gov (United States)

    Curry, Caitlin J; White, Paula A; Derr, James N

    2015-01-01

    Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.

  12. Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species.

    Directory of Open Access Journals (Sweden)

    Caitlin J Curry

    Full Text Available Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47 when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1 appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.

  13. Haplotype block structure and its applications to association studies: power and study designs.

    Science.gov (United States)

    Zhang, Kui; Calabrese, Peter; Nordborg, Magnus; Sun, Fengzhu

    2002-12-01

    Recent studies have shown that the human genome has a haplotype block structure, such that it can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of single-nucleotide polymorphisms (SNPs), referred to as "tag SNPs," can be used to distinguish a large fraction of the haplotypes. These tag SNPs can potentially be extremely useful for association studies, in that it may not be necessary to genotype all SNPs; however, this depends on how much power is lost. Here we develop a simulation study to quantitatively assess the power loss for a variety of study designs, including case-control designs and case-parental control designs. First, a number of data sets containing case-parental or case-control samples are generated on the basis of a disease model. Second, a small fraction of case and control individuals in each data set are genotyped at all the loci, and a dynamic programming algorithm is used to determine the haplotype blocks and the tag SNPs based on the genotypes of the sampled individuals. Third, the statistical power of tests was evaluated on the basis of three kinds of data: (1) all of the SNPs and the corresponding haplotypes, (2) the tag SNPs and the corresponding haplotypes, and (3) the same number of randomly chosen SNPs as the number of tag SNPs and the corresponding haplotypes. We study the power of different association tests with a variety of disease models and block-partitioning criteria. Our study indicates that the genotyping efforts can be significantly reduced by the tag SNPs, without much loss of power. Depending on the specific haplotype block-partitioning algorithm and the disease model, when the identified tag SNPs are only 25% of all the SNPs, the power is reduced by only 4%, on average, compared with a power loss of approximately 12% when the same number of randomly chosen SNPs is used in a two-locus haplotype analysis. When the identified tag SNPs are approximately 14% of all the SNPs, the

  14. A haplotype specific to North European wheat (Triticum aestivum L.)

    Czech Academy of Sciences Publication Activity Database

    Tsombalova, J.; Karafiátová, Miroslava; Vrána, Jan; Kubaláková, Marie; Peusa, H.; Jakobson, I.; Jarve, M.; Valárik, Miroslav; Doležel, Jaroslav; Jarve, K.

    2017-01-01

    Roč. 64, č. 4 (2017), s. 653-664 ISSN 0925-9864 R&D Projects: GA MŠk(CZ) LO1204; GA ČR(CZ) GA14-07164S Institutional support: RVO:61389030 Keywords : bread wheat * genetic diversity * polyploid wheat * introgression lines * molecular analysis * tetraploid wheat * hexaploid wheat * powdery mildew * spelta l. * map * Common wheat * Triticum aestivum L * Spelt * Triticum spelta L * Chromosome 4A * Zeroalleles * Haplotype * Linkage disequilibrium Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 1.294, year: 2016

  15. Reliable reconstruction of HIV-1 whole genome haplotypes reveals clonal interference and genetic hitchhiking among immune escape variants

    Science.gov (United States)

    2014-01-01

    Background Following transmission, HIV-1 evolves into a diverse population, and next generation sequencing enables us to detect variants occurring at low frequencies. Studying viral evolution at the level of whole genomes was hitherto not possible because next generation sequencing delivers relatively short reads. Results We here provide a proof of principle that whole HIV-1 genomes can be reliably reconstructed from short reads, and use this to study the selection of immune escape mutations at the level of whole genome haplotypes. Using realistically simulated HIV-1 populations, we demonstrate that reconstruction of complete genome haplotypes is feasible with high fidelity. We do not reconstruct all genetically distinct genomes, but each reconstructed haplotype represents one or more of the quasispecies in the HIV-1 population. We then reconstruct 30 whole genome haplotypes from published short sequence reads sampled longitudinally from a single HIV-1 infected patient. We confirm the reliability of the reconstruction by validating our predicted haplotype genes with single genome amplification sequences, and by comparing haplotype frequencies with observed epitope escape frequencies. Conclusions Phylogenetic analysis shows that the HIV-1 population undergoes selection driven evolution, with successive replacement of the viral population by novel dominant strains. We demonstrate that immune escape mutants evolve in a dependent manner with various mutations hitchhiking along with others. As a consequence of this clonal interference, selection coefficients have to be estimated for complete haplotypes and not for individual immune escapes. PMID:24996694

  16. Levels of human platelet-derived soluble CD40 ligand depend on haplotypes of CD40LG-CD40-ITGA2

    OpenAIRE

    Aloui, Chaker; Prigent, Antoine; Tariket, Sofiane; Sut, Caroline; Fagan, Jocelyne; Cognasse, Fabrice; Chakroun, Tahar; Garraud, Olivier; Laradi, Sandrine

    2016-01-01

    Increased circulating soluble CD40 ligand (sCD40L) is commonly associated with inflammatory disorders. We aimed to investigate whether gene polymorphisms in CD40LG, CD40 and ITGA2 are associated with a propensity to secrete sCD40L; thus, we examined this issue at the level of human platelets, the principal source of sCD40L. We performed single polymorphism and haplotype analyses to test for the effect of twelve polymorphisms across the CD40LG, CD40 and ITGA2 genes in blood donors. ITGA2 prese...

  17. Inducible nitric oxide synthase haplotype associated with migraine and aura.

    Science.gov (United States)

    de O S Mansur, Thiago; Gonçalves, Flavia M; Martins-Oliveira, Alisson; Speciali, Jose G; Dach, Fabiola; Lacchini, Riccardo; Tanus-Santos, Jose E

    2012-05-01

    Migraine is a complex neurological disorder with a clear neurogenic inflammatory component apparently including enhanced nitric oxide (NO) formation. Excessive NO amounts possibly contributing to migraine are derived from increased expression and activity of inducible NO synthase (iNOS). We tested the hypothesis that two functional, clinically relevant iNOS genetic polymorphisms (C(-1026)A-rs2779249 and G2087A-rs2297518) are associated with migraine with or without aura. We studied 142 healthy women without migraine (control group) and 200 women with migraine divided into two groups: 148 with migraine without aura (MWA) and 52 with aura (MA). Genotypes were determined by real-time polymerase chain reaction using the Taqman(®) allele discrimination assays. The PHASE 2.1 software was used to estimate the haplotypes. The A allele for the G2087A polymorphism was more commonly found in the MA group than in the MWA group (28 vs. 18%; P 0.05). The haplotype combining both A alleles for the two polymorphisms was more commonly found in the MA group than in the control group or in the MWA group (19 vs. 10 or 8%; P = 0.0245 or 0.0027, respectively). Our findings indicate that the G2087A and the C(-1026)A polymorphism in the iNOS gene affect the susceptibility to migraine with aura when their effects are combined within haplotypes, whereas the G2087A affects the susceptibility to aura in migraine patients. These finding may have therapeutic implications when examining the effects of selective iNOS inhibitors.

  18. Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

    Science.gov (United States)

    Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

    1999-07-01

    With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

  19. An ancestral haplotype of the human PERIOD2 gene associates with reduced sensitivity to light-induced melatonin suppression.

    Directory of Open Access Journals (Sweden)

    Tokiho Akiyama

    Full Text Available Humans show various responses to the environmental stimulus in individual levels as "physiological variations." However, it has been unclear if these are caused by genetic variations. In this study, we examined the association between the physiological variation of response to light-stimulus and genetic polymorphisms. We collected physiological data from 43 subjects, including light-induced melatonin suppression, and performed haplotype analyses on the clock genes, PER2 and PER3, exhibiting geographical differentiation of allele frequencies. Among the haplotypes of PER3, no significant difference in light sensitivity was found. However, three common haplotypes of PER2 accounted for more than 96% of the chromosomes in subjects, and 1 of those 3 had a significantly low-sensitive response to light-stimulus (P < 0.05. The homozygote of the low-sensitive PER2 haplotype showed significantly lower percentages of melatonin suppression (P < 0.05, and the heterozygotes of the haplotypes varied their ratios, indicating that the physiological variation for light-sensitivity is evidently related to the PER2 polymorphism. Compared with global haplotype frequencies, the haplotype with a low-sensitive response was more frequent in Africans than in non-Africans, and came to the root in the phylogenetic tree, suggesting that the low light-sensitive haplotype is the ancestral type, whereas the other haplotypes with high sensitivity to light are the derived types. Hence, we speculate that the high light-sensitive haplotypes have spread throughout the world after the Out-of-Africa migration of modern humans.

  20. Antifolate drug resistance: Novel mutations and haplotype ...

    Indian Academy of Sciences (India)

    A total of 249 fever cases from Arunachal Pradesh, NEIndia, were screened for malaria, and of these, 75 were found to be positive for Plasmodium falciparum. Samples weresequenced and analysed with the help of BioEdit and ClustalW. Three novel point mutations were found in the dhps genewith 10 haplotypes along ...

  1. IgA deficiency and the MHC: assessment of relative risk and microheterogeneity within the HLA A1 B8, DR3 (8.1) haplotype.

    Science.gov (United States)

    Mohammadi, Javad; Ramanujam, Ryan; Jarefors, Sara; Rezaei, Nima; Aghamohammadi, Asghar; Gregersen, Peter K; Hammarström, Lennart

    2010-01-01

    Selective IgA deficiency (IgAD; serum IgA concentration of IgA deficiency in a population-based sample of 117 B8, DR3 homozygous individuals. IgA deficiency was found to be present in 2 of 117 (1.7%) of these subjects, a figure that is concordant with estimates of relative risk from large case-control studies in the Swedish population. These data are consistent with a multiplicative model for the 8.1 haplotype contribution to IgA deficiency and contrasts with prior studies, suggesting a much higher risk for 8.1 homozygosity. Using a dense single nucleotide polymorphism marker analysis of the MHC region in HLA B8, DR3, DQ2 homozygous individuals, we did not observe consistent differences between cases (n = 26) and controls (n = 24). Overall, our results do not support the hypothesis that IgA deficiency is associated with a distinct subgroup of 8.1 related haplotypes, but rather indicate that risk is conferred by the common 8.1 haplotype acting in multiplicative manner.

  2. Different patterns of evolution in the centromeric and telomeric regions of group A and B haplotypes of the human killer cell Ig-like receptor locus.

    Directory of Open Access Journals (Sweden)

    Chul-Woo Pyo

    Full Text Available The fast evolving human KIR gene family encodes variable lymphocyte receptors specific for polymorphic HLA class I determinants. Nucleotide sequences for 24 representative human KIR haplotypes were determined. With three previously defined haplotypes, this gave a set of 12 group A and 15 group B haplotypes for assessment of KIR variation. The seven gene-content haplotypes are all combinations of four centromeric and two telomeric motifs. 2DL5, 2DS5 and 2DS3 can be present in centromeric and telomeric locations. With one exception, haplotypes having identical gene content differed in their combinations of KIR alleles. Sequence diversity varied between haplotype groups and between centromeric and telomeric halves of the KIR locus. The most variable A haplotype genes are in the telomeric half, whereas the most variable genes characterizing B haplotypes are in the centromeric half. Of the highly polymorphic genes, only the 3DL3 framework gene exhibits a similar diversity when carried by A and B haplotypes. Phylogenetic analysis and divergence time estimates, point to the centromeric gene-content motifs that distinguish A and B haplotypes having emerged ~6 million years ago, contemporaneously with the separation of human and chimpanzee ancestors. In contrast, the telomeric motifs that distinguish A and B haplotypes emerged more recently, ~1.7 million years ago, before the emergence of Homo sapiens. Thus the centromeric and telomeric motifs that typify A and B haplotypes have likely been present throughout human evolution. The results suggest the common ancestor of A and B haplotypes combined a B-like centromeric region with an A-like telomeric region.

  3. ANKLE JOINT CONTROL DURING SINGLE-LEGGED BALANCE USING COMMON BALANCE TRAINING DEVICES - IMPLICATIONS FOR REHABILITATION STRATEGIES

    DEFF Research Database (Denmark)

    Strøm, Mark; Thorborg, Kristian; Bandholm, Thomas

    2016-01-01

    to characterize different balance exercises based on level of difficulty and sensori-motor training stimulus. PURPOSE: The purpose of this study was to investigate frontal-plane ankle kinematics and associated peroneal muscle activity during single-legged balance on stable surface (floor) and three commonly used...... compared to Airex® and floor. This study can serve as guidance for clinicians who wish to implement a gradual progression of ankle rehabilitation and prevention exercises by taking the related ankle kinematics and muscle activity into account. LEVEL OF EVIDENCE: Level 3.......BACKGROUND: A lateral ankle sprain is the most prevalent musculoskeletal injury in sports. Exercises that aim to improve balance are a standard part of the ankle rehabilitation process. In an optimal progression model for ankle rehabilitation and prevention of future ankle sprains, it is important...

  4. The effect of genealogy-based haplotypes on genomic prediction

    DEFF Research Database (Denmark)

    Edriss, Vahid; Fernando, Rohan L.; Su, Guosheng

    2013-01-01

    on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using...... local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (pi) of the haplotype covariates had zero effect......, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some...

  5. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  6. Identification of the Mislabeled Breast Cancer Samples by Mitochondrial DNA Haplotyping

    Directory of Open Access Journals (Sweden)

    Xiaogang Chen

    2015-01-01

    Full Text Available The task to identify whether an archival malignant tumor specimen had been mislabeled or interchanged is a challenging one for forensic genetics. The nuclear DNA (nDNA markers were affected by the aberration of tumor cells, so they were not suitable for personal identification when the tumor tissues were tested. In this study, we focused on a new solution - mitochondrial single nucleotide polymorphism (mtSNP haplotyping by a multiplex SNaPshot assay. To validate our strategy of haplotyping with 25 mtSNPs, we analyzed 15 pairs of cancerous/healthy tissues taken from patients with ductal breast carcinoma. The haplotypes of all the fifteen breast cancer tissues were matched with their paired breast tissues. The heteroplasmy at 2 sites, 14783A/G and 16519C/T was observed in one breast tissue, which indicated a mixture of related mitochondrial haplotypes. However, only one haplotype was retained in the paired breast cancer tissue, which could be considered the result of proliferation of tumor subclone. The allele drop-out and allele drop-in were observed when 39 STRs and 20 tri-allelic SNPs of nDNA were applied. Compared to nDNA markers applied, 25 mtSNPs were more stable without interference from aberrance of breast cancer. Also, two cases were presented where the investigation of haplotype with 25 mtSNPs was used to prove the origin of biopsy specimen with breast cancer. The mislabeling of biopsy specimen with breast cancer could be certified in one case but could not be supported in the other case. We highlight the importance of stability of mtSNP haplotype in breast cancer. It was implied that our multiplex SNaPshot assay with 25 mtSNPs was a useful strategy to identify mislabeled breast cancer specimen.

  7. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    Directory of Open Access Journals (Sweden)

    Tyson Jess

    2012-12-01

    Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  8. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  9. WhatsHap: Haplotype Assembly for Future-Generation Sequencing Reads

    NARCIS (Netherlands)

    M.D. Patterson (Murray); T. Marschall (Tobias); N. Pisanti (Nadia); L.J.J. van Iersel (Leo); L. Stougie (Leen); G.W. Klau (Gunnar); A. Schönhuth (Alexander)

    2014-01-01

    htmlabstractThe human genome is diploid, that is each of its chromosomes comes in two copies. This requires to phase the single nucleotide polymorphisms (SNPs), that is, to assign them to the two copies, beyond just detecting them. The resulting haplotypes, lists of SNPs belonging to each copy, are

  10. WhatsHap: Haplotype Assembly for Future-Generation Sequencing Reads

    NARCIS (Netherlands)

    Patterson, M.; Marschall, T.; Pisanti, N.; van Iersel, L.J.J.; Stougie, L.; Klau, G.W.; Schoenhuth, A.

    2014-01-01

    The human genome is diploid, that is each of its chromosomes comes in two copies. This requires to phase the single nucleotide polymorphisms (SNPs), that is, to assign them to the two copies, beyond just detecting them. The resulting haplotypes, lists of SNPs belonging to each copy, are crucial for

  11. Melatonin Receptor 1B Gene Polymorphisms, Haplotypes and Susceptibility to Schizophrenia

    Directory of Open Access Journals (Sweden)

    Saravani Ramin

    2017-04-01

    Full Text Available Melatonin has an important role in the regulation of human sleep circadian rhythms. Sleep disturbances commonly exist in schizophrenia (SCZ patients. To begin its performance, melatonin must interact to its receptor. In the present study, Single Nucleotide Polymorphisms (SNPs of melatonin receptor gene 1 B (MTN1B with SCZ development in Iranian population were investigated. The current case-control study was performed on 92 SCZ patients and 92 healthy control (HC subjects. NESTED-PCR and ARMS-PCR modified methods (combination and ARMSPCR method were used on the genotype. The impact of MTN1B rs3781637 (T/C and rs10830963(C/G polymorphism variants on the risk SCZ in the sample of Iranian population was investigated. The findings showed significant association between MTN1B rs10830963(C/G variant and SCZ (OR=2.78, 95%CI=1.25-6.25, P=0.012, GG vs. CC, OR=1.66, 95%CI=1.09-2.51, P=0.021 G vs. C, OR=3.85 95%CI=.89-8.33, P<0.0001, GG vs. CC+CG. There was no association between MTN1B rs3781637 (T/C and SCZ risk. In addition, haplotype analysis revealed that TG and CC haplotype of rs3781637 (T/C and rs10830963 (C/G polymorphisms were associated with SCZ risk (P=0.039 and protective (P<0.0001 effects, respectively. The findings revealed that MTN1B rs10830963 (C/G polymorphism was associated with the risk of SCZ; while another SNP rs3781637 (T/C MTN1B gene did not show any risk/protection association with SCZ. Further studies with larger sample sizes and different ethnicities are required to approve the results.

  12. Characterisation of the genomic architecture of human chromosome 17q and evaluation of different methods for haplotype block definition

    Directory of Open Access Journals (Sweden)

    Ollier William

    2005-04-01

    Full Text Available Abstract Background The selection of markers in association studies can be informed through the use of haplotype blocks. Recent reports have determined the genomic architecture of chromosomal segments through different haplotype block definitions based on linkage disequilibrium (LD measures or haplotype diversity criteria. The relative applicability of distinct block definitions to association studies, however, remains unclear. We compared different block definitions in 6.1 Mb of chromosome 17q in 189 unrelated healthy individuals. Using 137 single nucleotide polymorphisms (SNPs, at a median spacing of 15.5 kb, we constructed haplotype block maps using published methods and additional methods we have developed. Haplotype tagging SNPs (htSNPs were identified for each map. Results Blocks were found to be shorter and coverage of the region limited with methods based on LD measures, compared to the method based on haplotype diversity. Although the distribution of blocks was highly variable, the number of SNPs that needed to be typed in order to capture the maximum number of haplotypes was consistent. Conclusion For the marker spacing used in this study, choice of block definition is not important when used as an initial screen of the region to identify htSNPs. However, choice of block definition has consequences for the downstream interpretation of association study results.

  13. Gender-specific association of methylenetetrahydrofolate reductase genotype and haplotype with the aggressiveness and prognosis of clear cell renal cell carcinoma in Japanese patients.

    Science.gov (United States)

    Sakano, Shigeru; Hinoda, Yuji; Okayama, Naoko; Kawai, Yoshihisa; Ito, Hideaki; Nagao, Kazuhiro; Hara, Takahiko; Matsuyama, Hideyasu

    2010-08-01

    To determine if the two common polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect tumour aggressiveness or prognosis of clear cell renal cell carcinoma (CCRCC) in Japanese patients. MTHFR C677T and A1298C polymorphisms have been reported to cause decreased enzyme activity, which reduces the quantity of methyl groups available for DNA methylation and leads to mis-incorporation of uracil into DNA, resulting in single-strand DNA breaks. These effects might induce the accumulation of several genetic changes, leading to the development and progression of CCRCC. Therefore, we investigated the associations between MTHFR genotypes and haplotypes and the clinicopathological characteristics and survival rates in 240 Japanese patients with histopathologically confirmed CCRCC. MTHFR C677T and A1298C were genotyped and haplotypes were analysed using appropriate software. The variant genotypes of MTHFR A1298C were significantly associated with some advanced characteristics of CCRCC in all patients, and these associations were stronger among men. However, among women, the variant genotypes of MTHFR C677T were associated with some advanced characteristics of CCRCC and the C677T variant genotypes or the 677T-1298A haplotype was significantly associated with decreased overall survival (P = 0.007 and P = 0.009, respectively). To our knowledge, this is the first report on the association between MTHFR polymorphisms and CCRCC aggressiveness or prognosis. These results suggest that the MTHFR genotypes and haplotype might be useful, in a gender-specific manner, as predictive factors for the clinical course of CCRCC. Furthermore, these findings will contribute to the understanding of the mechanisms underlying CCRCC progression.

  14. Tumor Necrosis Factor Receptor Superfamily, Member 1B Haplotypes Increase or Decrease the Risk of Inflammatory Bowel Diseases in a New Zealand Caucasian Population

    Directory of Open Access Journals (Sweden)

    Lynnette R. Ferguson

    2009-01-01

    Full Text Available Inflammatory bowel diseases (IBDs comprising Crohn disease (CD and ulcerative colitis (UC are chronic inflammatory conditions with polygenic susceptibility. Interactions between TNF-alpha and TNF-alpha receptor play a fundamental role in inflammatory response. This study investigates the role that selected single nucleotide polymorphisms (SNPs and haplotypes in the TNF-alpha receptor (TNSFRSF1B gene play in the risk of IBD in a New Zealand Caucasian population. DNA samples from 388 CD, 405 UC, 27 indeterminate colitis patients, and 293 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in TNSFRSF1B: rs1061622 (c.676T>C, rs1061624 (c.∗1663A>G, and rs3397 (c.∗1690T>C, using TaqMan technologies. Carrying the rs1061624 variant decreased the risk of UC in the left colon (OR 0.73, 95% CI=0.54–1.00 and of being a smoker at diagnosis (OR 0.62; 95% CI=0.40–0.96. Carrying the rs3397 variant decreased the risk of penetrating CD (OR 0.62, 95% CI=0.40–0.95. Three marker haplotype analyses revealed highly significant differences between CD patients and control subjects (χ2=29.9, df=7, P=.0001 and UC cases and controls (χ2=46.3, df=7, P<.0001. We conclude that carrying a 3-marker haplotype in the TNSFRSF1B gene may increase (e.g., haplotype of GGC was 2.9-fold more in the CD or UCpatients or decrease (e.g., TGT was 0.47-fold less in UC patients the risk of IBD in a New Zealand Caucasian population.

  15. PADI4 Haplotypes in Association with RA Mexican Patients, a New Prospect for Antigen Modulation

    Directory of Open Access Journals (Sweden)

    Maria Guadalupe Zavala-Cerna

    2013-01-01

    Full Text Available Peptidyl arginine deiminase IV (PAD 4 is the responsible enzyme for a posttranslational modification called citrullination, originating the antigenic determinant recognized by anti-cyclic citrullinated peptide antibodies (ACPA. Four SNPs (single nucleotide polymorphisms have been described in PADI4 gene to form a susceptibility haplotype for rheumatoid arthritis (RA; nevertheless, results in association studies appear contradictory in different populations. The aim of the study was to analyze if the presence of three SNPs in PADI4 gene susceptibility haplotype (GTG is associated with ACPA positivity in patients with RA. This was a cross-sectional study that included 86 RA patients and 98 healthy controls. Polymorphisms PADI4_89, PADI4_90, and PADI4_92 in the PADI4 gene were genotyped. The susceptibility haplotype (GTG was more frequent in RA patients; interestingly, we found a new haplotype associated with RA with a higher frequency (GTC. There were no associations between polymorphisms and high scores in Spanish HAQ-DI and DAS-28, but we did find an association between RARBIS index and PADI4_89, PADI4_90 polymorphisms. We could not confirm an association between susceptibility haplotype presence and ACPA positivity. Further evidence about proteomic expression of this gene will determine its participation in antigenic generation and autoimmunity.

  16. Haplotype-based allele mining in the Japan-MAGIC rice population.

    Science.gov (United States)

    Ogawa, Daisuke; Yamamoto, Eiji; Ohtani, Toshikazu; Kanno, Noriko; Tsunematsu, Hiroshi; Nonoue, Yasunori; Yano, Masahiro; Yamamoto, Toshio; Yonemaru, Jun-Ichi

    2018-03-12

    Multi-parent advanced generation inter-cross (MAGIC) lines have broader genetic variation than bi-parental recombinant inbred lines. Genome-wide association study (GWAS) using high number of DNA polymorphisms such as single-nucleotide polymorphisms (SNPs) is a popular tool for allele mining in MAGIC populations, in which the associations of phenotypes with SNPs are investigated; however, the effects of haplotypes from multiple founders on phenotypes are not considered. Here, we describe an improved method of allele mining using the newly developed Japan-MAGIC (JAM) population, which is derived from eight high-yielding rice cultivars in Japan. To obtain information on the haplotypes in the JAM lines, we predicted the haplotype blocks in the whole chromosomes using 16,345 SNPs identified via genotyping-by-sequencing analysis. Using haplotype-based GWAS, we clearly detected the loci controlling the glutinous endosperm and culm length traits. Information on the alleles of the eight founders, which was based on the effects of mutations revealed by the analysis of next-generation sequencing data, was used to narrow down the candidate genes and reveal the associations between alleles and phenotypes. The haplotype-based allele mining (HAM) proposed in this study is a promising approach to the detection of allelic variation in genes controlling agronomic traits in MAGIC populations.

  17. Haplotyping a quantitative trait with a high-density map in experimental crosses.

    Directory of Open Access Journals (Sweden)

    Wei Hou

    Full Text Available BACKGROUND: The ultimate goal of genetic mapping of quantitative trait loci (QTL is the positional cloning of genes involved in any agriculturally or medically important phenotype. However, only a small portion (< or = 1% of the QTL detected have been characterized at the molecular level, despite the report of hundreds of thousands of QTL for different traits and populations. METHODS/RESULTS: We develop a statistical model for detecting and characterizing the nucleotide structure and organization of haplotypes that underlie QTL responsible for a quantitative trait in an F2 pedigree. The discovery of such haplotypes by the new model will facilitate the molecular cloning of a QTL. Our model is founded on population genetic properties of genes that are segregating in a pedigree, constructed with the mixture-based maximum likelihood context and implemented with the EM algorithm. The closed forms have been derived to estimate the linkage and linkage disequilibria among different molecular markers, such as single nucleotide polymorphisms, and quantitative genetic effects of haplotypes constructed by non-alleles of these markers. Results from the analysis of a real example in mouse have validated the usefulness and utilization of the model proposed. CONCLUSION: The model is flexible to be extended to model a complex network of genetic regulation that includes the interactions between different haplotypes and between haplotypes and environments.

  18. Genome-wide association study identifies new HLA class II haplotypes strongly protective against narcolepsy

    DEFF Research Database (Denmark)

    Hor, Hyun; Kutalik, Zoltán; Dauvilliers, Yves

    2010-01-01

    Narcolepsy is a rare sleep disorder with the strongest human leukocyte antigen (HLA) association ever reported. Since the associated HLA-DRB1*1501-DQB1*0602 haplotype is common in the general population (15-25%), it has been suggested that it is almost necessary but not sufficient for developing ...

  19. Genome-wide association study identifies new HLA class II haplotypes strongly protective against narcolepsy

    DEFF Research Database (Denmark)

    Hor, Hyun; Kutalik, Zoltán; Dauvilliers, Yves

    2010-01-01

    Narcolepsy is a rare sleep disorder with the strongest human leukocyte antigen (HLA) association ever reported. Since the associated HLA-DRB1*1501-DQB1*0602 haplotype is common in the general population (15-25%), it has been suggested that it is almost necessary but not sufficient for developing......*0602. We found association with a protective variant near HLA-DQA2 (rs2858884; P ... ratio = 0.02; P HLA haplotype suggests a virtually causal involvement of the HLA region in narcolepsy susceptibility....

  20. A pilot study on Hla-G locus control region haplotypes and cervical intraepithelial neoplasias.

    Science.gov (United States)

    Cordeiro, Juliana Cochesnki; da Silva, Jose Samuel; Roxo, Valeria Sperandio; da Graça Bicalho, Maria

    2017-03-01

    Human papillomavirus (HPV) can induce cervical intraepithelial neoplasias (CIN) grades 1, 2 and 3. Untreated, these lesions may progress to cervical cancer (CC) which is the third most common cancer in women worldwide. HLA-G plays an immunotolerant role in the immune response. The aim of this study was to characterize the configuration of SNPs located at the distal promoter of HLA-G in patients with CIN2 and CIN3 and control women. The study sample was composed of 207 women as follows: 73 diagnosed with CIN2 lesions, 56 with CIN3 and 78 healthy control women. Genotyping was performed by sequence base typing. Eleven haplotype configurations subdivided in two main haplogroups (H1dist and H2dist), were characterized and compared between patients and controls. The haplotypes H1.1Dist (GAGAACGC) and H2.1Dist (AGGTACAC) were more frequent in Euro-Descendants as well as in Brazilian Mixed. Nevertheless, the haplotype H2.1Dist standed out as a susceptibility haplotype in Brazilian Mixed patients while the H1.1Dist presented a protector effect in this same ethnic group. Whether such LCR haplotype configurations can impact on HLA-G gene expression levels in women who developed cervical intraepithelial neoplasia is still unknown and it is of utmost importance that more investigation on this field be pursued. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  1. Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

    Science.gov (United States)

    Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

    2018-04-01

    HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. HLA Type Inference via Haplotypes Identical by Descent

    Science.gov (United States)

    Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

    The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

  3. Novel harmful recessive haplotypes identified for fertility traits in Nordic Holstein cattle

    DEFF Research Database (Denmark)

    Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen

    2013-01-01

    Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die....... A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions...... carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele...

  4. Fundamental problem of forensic mathematics--the evidential value of a rare haplotype.

    Science.gov (United States)

    Brenner, Charles H

    2010-10-01

    Y-chromosomal and mitochondrial haplotyping offer special advantages for criminal (and other) identification. For different reasons, each of them is sometimes detectable in a crime stain for which autosomal typing fails. But they also present special problems, including a fundamental mathematical one: When a rare haplotype is shared between suspect and crime scene, how strong is the evidence linking the two? Assume a reference population sample is available which contains n-1 haplotypes. The most interesting situation as well as the most common one is that the crime scene haplotype was never observed in the population sample. The traditional tools of product rule and sample frequency are not useful when there are no components to multiply and the sample frequency is zero. A useful statistic is the fraction κ of the population sample that consists of "singletons" - of once-observed types. A simple argument shows that the probability for a random innocent suspect to match a previously unobserved crime scene type is (1-κ)/n - distinctly less than 1/n, likely ten times less. The robust validity of this model is confirmed by testing it against a range of population models. This paper hinges above all on one key insight: probability is not frequency. The common but erroneous "frequency" approach adopts population frequency as a surrogate for matching probability and attempts the intractable problem of guessing how many instances exist of the specific haplotype at a certain crime. Probability, by contrast, depends by definition only on the available data. Hence if different haplotypes but with the same data occur in two different crimes, although the frequencies are different (and are hopelessly elusive), the matching probabilities are the same, and are not hard to find. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

  5. A DAB Converter with Common-Point-Connected Winding Transformers Suitable for a Single-Phase 5-Level SST System

    Directory of Open Access Journals (Sweden)

    Hyeok-Jin Yun

    2018-04-01

    Full Text Available One of the main disadvantages of the multi-level solid-state transformer (SST system is the voltage imbalance on the output of the rectifier modules. This voltage imbalance can be caused by parameter mismatch of the active and passive components, different loads, and the floating structure of the high voltage DC-links. Some studies have been done to solve this voltage imbalance problem. A common way to avoid this imbalance is to balance the voltage of DC-links at the AC/DC conversion stage and balance the power between the modules at the DC/DC conversion stage. Most of these methods require a complex balancing controller or additional circuits. This paper proposes a novel dual active bridge (DAB converter specialized in power balancing in a single-phase 5-level SST system. The proposed DAB converter does not require any additional balancing controllers or techniques for power balancing. The performance of the proposed DAB converter was verified by simulation and experiments using a 3 kW 5-level SST prototype system.

  6. Comparison of skin hydration in combination and single use of common moisturizers (cream, toner, and spray water).

    Science.gov (United States)

    Yuanxi, Li; Wei, Hua; Lidan, Xiiong; Li, Li

    2016-01-01

    This study aims to assess the moisturization in combination or single use (including seven general applications) of three common moisturizers: cream, toner, and spray water. Groups were set as C: cream only; T: toner only; C+T, T+C: cream or toner applied successively within a few minutes; C-T, C-S: cream applied with repeated toner or spray water every 2 h; T-T: toner applied with repeated toner every 2 h; and N: untreated group. Outcomes were the change in skin hydration from baseline at 2, 4, 6, and 8 h after applications. All treated zones displayed a significantly higher degree of hydration compared with the untreated zone ( p 35 a.u.), C-T led to greatest hydration change rate compared with others, followed by C+T, T+C, and C. Those three applications exhibited analogous hydration at each test point ( p > 0.05). The hydration rate of C-S differed slightly from T-T, followed by those four mentioned above, with T being the last. For dry skin (hydration value at baseline 0.05), the other results were identical. When cream and toner were applied successively, the application order has little effect on skin hydration. The application of cream only was an effective and brief way to achieve favorable moisturization especially for dry skin. As a complement, repeated application of toner rather than spray water is efficacious for skin hydration.

  7. Different origin and dispersal of sulfadoxine-resistant Plasmodium falciparum haplotypes between Eastern Africa and Democratic Republic of Congo

    DEFF Research Database (Denmark)

    Baraka, Vito; Delgado-Ratto, Christopher; Nag, Sidsel

    2017-01-01

    .3 and 7.7 kb) flanking the Pfdhps gene were assayed. Evolutionary analysis revealed a shared origin of Pfdhps haplotypes in East Africa, with a distinct population clustering in DR Congo. Furthermore, in Tanzania there was an independent distinct origin of Pfdhps SGEGA resistant haplotype. In Uganda...... and Eastern Africa sites are different. The genetic structure demonstrated a divergent and distinct population cluster predominated by single-mutant Pfdhps haplotypes at the DR Congo site. This reflects the limited dispersal of double- and triple-mutant Pfdhps haplotypes in DR Congo. This study highlights......Sulfadoxine/pyrimethamine (SP) is still used for malaria control in sub-Saharan Africa; however, widespread resistance is a major concern. This study aimed to determine the dispersal and origin of sulfadoxine resistance lineages in the Democratic Republic of the Congo compared with East African...

  8. Y-chromosomal analysis of Greek Cypriots reveals a primarily common pre-Ottoman paternal ancestry with Turkish Cypriots

    Science.gov (United States)

    Fernández-Domínguez, Eva; Bertoncini, Stefania; Chimonas, Marios; Christofi, Vasilis; King, Jonathan; Budowle, Bruce; Manoli, Panayiotis

    2017-01-01

    Genetics can provide invaluable information on the ancestry of the current inhabitants of Cyprus. A Y-chromosome analysis was performed to (i) determine paternal ancestry among the Greek Cypriot (GCy) community in the context of the Central and Eastern Mediterranean and the Near East; and (ii) identify genetic similarities and differences between Greek Cypriots (GCy) and Turkish Cypriots (TCy). Our haplotype-based analysis has revealed that GCy and TCy patrilineages derive primarily from a single gene pool and show very close genetic affinity (low genetic differentiation) to Calabrian Italian and Lebanese patrilineages. In terms of more recent (past millennium) ancestry, as indicated by Y-haplotype sharing, GCy and TCy share much more haplotypes between them than with any surrounding population (7–8% of total haplotypes shared), while TCy also share around 3% of haplotypes with mainland Turks, and to a lesser extent with North Africans. In terms of Y-haplogroup frequencies, again GCy and TCy show very similar distributions, with the predominant haplogroups in both being J2a-M410, E-M78, and G2-P287. Overall, GCy also have a similar Y-haplogroup distribution to non-Turkic Anatolian and Southwest Caucasian populations, as well as Cretan Greeks. TCy show a slight shift towards Turkish populations, due to the presence of Eastern Eurasian (some of which of possible Ottoman origin) Y-haplogroups. Overall, the Y-chromosome analysis performed, using both Y-STR haplotype and binary Y-haplogroup data puts Cypriot in the middle of a genetic continuum stretching from the Levant to Southeast Europe and reveals that despite some differences in haplotype sharing and haplogroup structure, Greek Cypriots and Turkish Cypriots share primarily a common pre-Ottoman paternal ancestry. PMID:28622394

  9. Inferring mechanisms of copy number change from haplotype structures at the human DEFA1A3 locus.

    Science.gov (United States)

    Black, Holly A; Khan, Fayeza F; Tyson, Jess; Al Armour, John

    2014-07-21

    The determination of structural haplotypes at copy number variable regions can indicate the mechanisms responsible for changes in copy number, as well as explain the relationship between gene copy number and expression. However, obtaining spatial information at regions displaying extensive copy number variation, such as the DEFA1A3 locus, is complex, because of the difficulty in the phasing and assembly of these regions. The DEFA1A3 locus is intriguing in that it falls within a region of high linkage disequilibrium, despite its high variability in copy number (n = 3-16); hence, the mechanisms responsible for changes in copy number at this locus are unclear. In this study, a region flanking the DEFA1A3 locus was sequenced across 120 independent haplotypes with European ancestry, identifying five common classes of DEFA1A3 haplotype. Assigning DEFA1A3 class to haplotypes within the 1000 Genomes project highlights a significant difference in DEFA1A3 class frequencies between populations with different ancestry. The features of each DEFA1A3 class, for example, the associated DEFA1A3 copy numbers, were initially assessed in a European cohort (n = 599) and replicated in the 1000 Genomes samples, showing within-class similarity, but between-class and between-population differences in the features of the DEFA1A3 locus. Emulsion haplotype fusion-PCR was used to generate 61 structural haplotypes at the DEFA1A3 locus, showing a high within-class similarity in structure. Structural haplotypes across the DEFA1A3 locus indicate that intra-allelic rearrangement is the predominant mechanism responsible for changes in DEFA1A3 copy number, explaining the conservation of linkage disequilibrium across the locus. The identification of common structural haplotypes at the DEFA1A3 locus could aid studies into how DEFA1A3 copy number influences expression, which is currently unclear.

  10. Hepatitis B virus is still the most common etiologic factor of liver cirrhosis: Results from a single center in Turkey

    Directory of Open Access Journals (Sweden)

    Sebahat Başyigit

    2015-12-01

    Full Text Available Objective: It is important to examine the epidemiology of liver cirrhosis (LC because of it is a preventable disease. In this single-center study, we aimed to determine the epidemiological characteristics and etiology of LC in Central Anatolian region of Turkey. Methods: We reviewed data of patients with liver cirrhosis who presented to outpatient and inpatient clinics of our medical center between January 1, 2011 and September 31, 2014 Results: Overall, 135 patients were included to the study: 91 men (67.4% and 44 women (33% with a mean age of 63±14,3 years (range: 15–87years. The primary causes of cirrhosis were chronic hepatitis B (CHB (n: 52, 38.5% and cryptogenic cirrhosis (n: 33, 24.4%. CHB was the main etiology of cirrhosis in men (49.5% and cryptogenic LC was predominant in women (40.9%. Patients with alcoholic cirrhosis were solely male. Percentage of patients with autoimmune hepatitis was significantly higher among women (70%. The percentage of patients with HBV was similar between patients aged50 years (31.6% and 39.7%, respectively, but percentage of patients with hepatitis C virus was lower (5.3% in patients aged50 years (14.7%. There was no cirrhotic patients under 50 years of age due to a genetic disorder Conclusion: Despite national vaccination program, effective treatment regimens and intensive screening methods against hepatitis B virus, it remains to be the most common cause of LC in our country.

  11. Analysis of Multiallelic CNVs by Emulsion Haplotype Fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2017-01-01

    Emulsion-fusion PCR recovers long-range sequence information by combining products in cis from individual genomic DNA molecules. Emulsion droplets act as very numerous small reaction chambers in which different PCR products from a single genomic DNA molecule are condensed into short joint products, to unite sequences in cis from widely separated genomic sites. These products can therefore provide information about the arrangement of sequences and variants at a larger scale than established long-read sequencing methods. The method has been useful in defining the phase of variants in haplotypes, the typing of inversions, and determining the configuration of sequence variants in multiallelic CNVs. In this description we outline the rationale for the application of emulsion-fusion PCR methods to the analysis of multiallelic CNVs, and give practical details for our own implementation of the method in that context.

  12. Glucose-6-phosphate dehydrogenase mutations and haplotypes in Mexican Mestizos.

    Science.gov (United States)

    Arámbula, E; Aguilar L, J C; Vaca, G

    2000-08-01

    In a screening for glucose-6-phosphate dehydrogenase (G-6-PD) deficiency in 1985 unrelated male subjects from the general population (Groups A and B) belonging to four states of the Pacific coast, 21 G-6-PD-deficient subjects were detected. Screening for mutations at the G-6-PD gene by PCR-restriction enzyme in these 21 G-6-PD-deficient subjects as well as in 14 G-6-PD-deficient patients with hemolytic anemia belonging to several states of Mexico showed two common G-6-PD variants: G-6-PD A-(202A/376G) (19 cases) and G-6-PD A-(376G/968C) (9 cases). In 7 individuals the mutations responsible for the enzyme deficiency remain to be determined. Furthermore, four silent polymorphic sites at the G-6-PD gene (PvuII, PstI, 1311, and NlaIII) were investigated in the 28 individuals with G-6-PD A- variants and in 137 G-6-PD normal subjects. As expected, only 10 different haplotypes were observed. To date, in our project aiming to determine the molecular basis of G-6-PD deficiency in Mexico, 60 unrelated G-6-PD-deficient Mexican males-25 in previous studies and 35 in the present work-have been studied. More than 75% of these individuals are from states of the Pacific coast (Sinaloa, Nayarit, Jalisco, Michoacán, Guerrero, Oaxaca, and Chiapas). The results show that although G-6-PD deficiency is heterogeneous at the DNA level in Mexico, only three polymorphic variants have been observed: G-6-PD A-(202A/376G) (36 cases), G-6-PD A-(376G/968C) (13 cases), and G-6-PD Seattle(844C) (2 cases). G-6-PD A- variants are relatively distributed homogeneously and both variants explain 82% of the overall prevalence of G-6-PD deficiency. The variant G-6-PD A-(202A/376G) represents 73% of the G-6-PD A- alleles. Our data also show that the variant G-6-PD A-(376G/968C)-which has been observed in Mexico in the context of two different haplotypes-is more common than previously supposed. The three polymorphic variants that we observed in Mexico are on the same haplotypes as found in subjects from

  13. A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

    Science.gov (United States)

    Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

    2016-01-01

    Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

  14. [The role of different KIR haplotypes in haplo-identical hematopoietic stem cell transplantation].

    Science.gov (United States)

    Bao, Xiaojing; He, Jun; Wang, Miao; Yuan, Xiaoni; Li, Yang; Zhang, Tengteng; Li, Lingjie; Chen, Luyao; Wu, Depei

    2016-01-01

    To investigate the role of different immunoglobulin- like receptor (KIR)haplotypes in haplo- identical hematopoietic stem cell transplantation (HSCT). Killer cell KIR genotyping was performed on 468 individuals from 156 unrelated families by PCR-SSP. A total of 624 KIR haplotypes from the parents were used for haplotype analysis. Ninety-two patients received haplo-identical HSCT from one of the parents. The family study showed segregation of one A haplotype and at least 20 unique B haplotypes. The frequency of haplotype A was 72.92% (455/624). The most commonly observed haplotypes in group B were B1, B2, and B3, present at a frequency of 10.26%, 5.77%, and 4.48%, respectively. Compared to KIR gene matched donors (n=17), grafts from KIR gene mismatched donors (n= 14) had a positive effect on survival after haplo- identical HSCT for AML/MDS patients (OS: 88.2%vs 42.9%,P=0.015; RFS: 88.2%vs 35.7%,P=0.007). No effect was observed for ALL/NHL patients (OS: 76.0%vs 75.0%,P=0.727; RFS: 68.0%vs 65.0%,P=0.866). A significantly lower survival rate was observed for transplants from AA (n=52) and AB1/AB2 donors (n=15), compared to other group Bx donors (n=25) (OS: 53.3%vs 96.0%,P=0.017; RFS: 53.3%vs 92.0%,P=0.019). Meanwhile, the risk of relapse was much higher in AA group (n=52) compared to Bx group (n=40) (25.0%vs 5.0%,P=0.009). A higher risk of TRM was observed in AB1/AB2 group (P=0.012). In addition, transplant from donors carried Cen-B was associated with an increased survival compared with Cen-A homozygous donors (OS: 94.7%vs 68.5%,P=0.036; RFS: 89.5%vs 64.4%,P=0.045). Overall, KIR genotyping and haplotype analyses should be useful for selection of the most optimal donors with favorable KIR gene grafts. KIR gene mismatch donors should be preferred for AML/MDS patients. Selecting donors carried Cen- B and avoiding the selection of donors of KIR genotype AA/AB1/AB2 was strongly advisable for haplo-identical HSCT.

  15. Temporal fluctuation of multidrug resistant salmonella typhi haplotypes in the mekong river delta region of Vietnam.

    Directory of Open Access Journals (Sweden)

    Kathryn E Holt

    2011-01-01

    Full Text Available typhoid fever remains a public health problem in Vietnam, with a significant burden in the Mekong River delta region. Typhoid fever is caused by the bacterial pathogen Salmonella enterica serovar Typhi (S. Typhi, which is frequently multidrug resistant with reduced susceptibility to fluoroquinolone-based drugs, the first choice for the treatment of typhoid fever. We used a GoldenGate (Illumina assay to type 1,500 single nucleotide polymorphisms (SNPs and analyse the genetic variation of S. Typhi isolated from 267 typhoid fever patients in the Mekong delta region participating in a randomized trial conducted between 2004 and 2005.the population of S. Typhi circulating during the study was highly clonal, with 91% of isolates belonging to a single clonal complex of the S. Typhi H58 haplogroup. The patterns of disease were consistent with the presence of an endemic haplotype H58-C and a localised outbreak of S. Typhi haplotype H58-E2 in 2004. H58-E2-associated typhoid fever cases exhibited evidence of significant geo-spatial clustering along the Sông H u branch of the Mekong River. Multidrug resistance was common in the established clone H58-C but not in the outbreak clone H58-E2, however all H58 S. Typhi were nalidixic acid resistant and carried a Ser83Phe amino acid substitution in the gyrA gene.the H58 haplogroup dominates S. Typhi populations in other endemic areas, but the population described here was more homogeneous than previously examined populations, and the dominant clonal complex (H58-C, -E1, -E2 observed in this study has not been detected outside Vietnam. IncHI1 plasmid-bearing S. Typhi H58-C was endemic during the study period whilst H58-E2, which rarely carried the plasmid, was only transient, suggesting a selective advantage for the plasmid. These data add insight into the outbreak dynamics and local molecular epidemiology of S. Typhi in southern Vietnam.

  16. A class representative model for Pure Parsimony Haplotyping under uncertain data.

    Directory of Open Access Journals (Sweden)

    Daniele Catanzaro

    Full Text Available The Pure Parsimony Haplotyping (PPH problem is a NP-hard combinatorial optimization problem that consists of finding the minimum number of haplotypes necessary to explain a given set of genotypes. PPH has attracted more and more attention in recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from mapping complex disease genes to inferring population histories, passing through designing drugs, functional genomics and pharmacogenetics. In this article we investigate, for the first time, a recent version of PPH called the Pure Parsimony Haplotype problem under Uncertain Data (PPH-UD. This version mainly arises when the input genotypes are not accurate, i.e., when some single nucleotide polymorphisms are missing or affected by errors. We propose an exact approach to solution of PPH-UD based on an extended version of Catanzaro et al.[1] class representative model for PPH, currently the state-of-the-art integer programming model for PPH. The model is efficient, accurate, compact, polynomial-sized, easy to implement, solvable with any solver for mixed integer programming, and usable in all those cases for which the parsimony criterion is well suited for haplotype estimation.

  17. Identification and genetic effect of haplotype in the bovine BMP7 gene.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-12-15

    Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (Pgrowth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

  18. SNP and haplotype analysis reveal IGF2 variants associated with growth traits in Chinese Qinchuan cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Zhan, Zhao-Yang; Li, Xin-Yi; Wu, Sheng-Ru; Sun, Yu-Jia; Xue, Jing; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Jia, Yu-Tang; Chen, Hong

    2014-02-01

    Insulin-like growth factor 2 (IGF2) is a potent cell growth and differentiation factor and is implicated in mammals' growth and development. The objective of this study was to evaluate the effects of the mutations in the bovine IGF2 with growth traits in Chinese Qinchuan cattle. Four single nucleotide polymorphisms (SNPs) were detected of the bovine IGF2 by DNA pool sequencing and forced polymerase chain reaction-restriction fragment length polymorphism (forced PCR-RFLP) methods. We also investigated haplotype structure and linkage disequilibrium (LD) coefficients for four SNPs in 817 individuals representing two main cattle breeds from China. The result of haplotype analysis showed eight different haplotypes and 27 combined genotypes within the study population. The statistical analyses indicated that the four SNPs, combined genotypes and haplotypes are associated with the withers height, body length, chest breadth, chest depth and body weight in Qinchuan cattle population (P growth traits; the heterozygote diplotype was associated with higher growth traits compared to wild-type homozygote. Our results provide evidence that polymorphisms in the IGF2 gene are associated with growth traits, and may be used for marker-assisted selection in beef cattle breeding program.

  19. Haplotype and linkage disequilibrium analysis of the CRMP1 and EVC genes.

    Science.gov (United States)

    Sivakumaran, Theru A; Lesperance, Marci M

    2004-11-01

    In this report, we present the haplotype and linkage disequilibrium (LD) pattern in the Collapsin Response Mediator Protein 1 (CRMP1) and Ellis-van Creveld syndrome (EVC) gene region. We genotyped eight different single nucleotide polymorphisms (SNPs) in the CRMP1 and EVC genes in 90 control individuals of diverse ethnicity. The minor allele frequencies ranged from 3.3-49.4%, with most having a frequency >25%. A total of 37 haplotypes were derived from these eight polymorphisms, with only one haplotype having a frequency >10%. Pairwise LD analysis showed a weak but significant LD between markers located about 243 kb apart in this region. The LD was significant between markers spaced about 208 kb apart in EVC, whereas no LD was found between a pair of markers located about 5 kb apart in CRMP1. However, in general, LD correlated with the distance between loci. The CRMP1 and EVC genes are located near WFS1, the Wolfram syndrome type 1 gene, in which mutations also cause low frequency sensorineural hearing loss (LFSNHL). The haplotypes obtained from these polymorphisms will be useful to track the segregation of phenotypes in families with Ellis-van Creveld syndrome, Weyers acrodental dysostosis, LFSNHL and Wolfram syndrome type 1.

  20. Interleukin-10 haplotypes in Celiac Disease in the Spanish population.

    Science.gov (United States)

    Núñez, Concepción; Alecsandru, Diana; Varadé, Jezabel; Polanco, Isabel; Maluenda, Carlos; Fernández-Arquero, Miguel; de la Concha, Emilio G; Urcelay, Elena; Martínez, Alfonso

    2006-03-31

    Celiac disease (CD) is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10) is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs) and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02) status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  1. Interleukin-10 haplotypes in Celiac Disease in the Spanish population

    Directory of Open Access Journals (Sweden)

    Fernández-Arquero Miguel

    2006-03-01

    Full Text Available Abstract Background Celiac disease (CD is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10 is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. Methods A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. Results No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02 status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. Conclusion The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  2. Major histocompatibility complex haplotypes and class II genes in non-Jewish patients with pemphigus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, A.R. (Harvard School of Dental Medicine, Boston, MA (United States) Center for Blood Research, Boston, MA (United States) American Red Cross Blood Services-Northeast Region, Dedham, MA (United States)); Wagner, R.; Khatri, K.; Notani, G.; Awdeh, Z.; Alper, C.A. (Center for Blood Research, Boston, MA (United States)); Yunis, E.J. (Center for Blood Research, Boston, MA (United States) American Red Cross Blood Services-Northeast Region, Dedham, MA (United States))

    1991-06-01

    Previous studies demonstrated that HLA-DR4 was markedly increased among Ashkenazi Jewish patients with pemphigus vulgaris (PV), almost entirely as the common Jewish extended haplotype (HLA-B38, SC21, DR4, DQw8) or as the haplotype HLA-B35, SC31, DR4, DQw8, and that HLA-DR4, DQw8 was distributed among patients in a manner consistent with dominant expression of a class II (D-region or D-region-linked) susceptibility gene. In the present study of major histocompatibility complex (MHC) halotypes in 25 non-Jewish PV patients, DR4, DQw8 was found in 12 of the patients and DRw6, DQw5 was found in 15. Only 3 patients had neither. The non-Jewish patients were of more Southern European extraction than our controls. This suggests that there are two major MHC susceptibility alleles in American patients with PV. The more ancient apparently arose on a haplotype in the Jews, HLA-B38(35), SC21(SC31), DR4, DQw8, and spread to other populations largely as D-region segments. The other arose in or near Italy on the haplotype HLA-Bw55, SB45, DRw14, DQw5 amd has also partially fragmented so that many patients carry only DRw14, DQw5. The available data do not permit the specific localization of either the DR4, DQw8-or the DRw14, DQw5-linked susceptibility genes.

  3. Haplotypes for 13 Y-chromosomal STR loci in South Tunisian population (Sfax region).

    Science.gov (United States)

    Ayadi, Imen; Ammar-Keskes, Leila; Rebai, Ahmed

    2006-12-20

    Nine Y-STR loci from the "minimal haplotype" (DYS19, DYS385a/b, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393) included in Y-STR Haplotype Reference Databases (YHRD) with 4 additional Y-STRs (DYS436, DYS437, DYS438, DYS439) were analyzed by PCR using duplex and Y-PLEX 12 kit, followed by automatic genotyping in a sample of 105 Tunisian males originating from Sfax region (south Tunisia). Allelic frequencies and gene diversities for each Y-STR locus were determined. The high haplotype diversity (0.9932) and discrimination capacity (0.7714) show the usefulness of these loci for human identification in forensic studies and paternity tests in Tunisia. The most common haplotype was shared by 4.7% (5 individuals) of the sample was only found in samples from the Tunisian population reported in YHRD. One private allele for DYS392 (allele 17) was discovered and duplications were observed for five loci (DYS19, DYS389I, DYS393, DYS437 and DYS439).

  4. HLA class II linkage disequilibrium and haplotype evolution in the Cayapa Indians of Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Trachtenberg, E.A.; Erlich, H.A. [Roche Molecular Systems, Alameda, CA (United States); Klitz, W. [Univ. of California, Berkeley, CA (United States)] [and others

    1995-08-01

    DNA-based typing of the HLA class II loci in a sample of the Cayapa Indians of Ecuador reveals several lines of evidence that selection has operated to maintain and to diversify the existing level of polymorphism in the class II region. As has been noticed for other Native American groups, the overall level of polymorphism at the DRB1, DQA1, DQB1, and DPB1 loci is reduced relative to that found in other human populations. Nonetheless, the relative eveness in the distribution of allele frequencies at each of the four loci points to the role of balancing selection in the maintenance of the polymorphism. The DQA1 and DQB1 loci, in particular, have near-maximum departures from the neutrality model, which suggests that balancing selection has been especially strong in these cases. Several novel DQA1-DQB1 haplotypes and the discovery of a new DRB1 allele demonstrate an evolutionary tendency favoring the diversification of class II alleles and haplotypes. The recombination interval between the centromeric DPB1 locus and the other class II loci will, in the absence of other forces such as selection, reduce disequilibrium across this region. However, nearly all common alleles were found to be part of DR-DP haplotypes in strong disequilibrium, consistent with the recent action of selection acting on these haplotypes in the Cayapa. 50 refs., 3 figs., 3 tabs.

  5. Haplotype frequencies at the DRD2 locus in populations of the East European Plain

    Directory of Open Access Journals (Sweden)

    Mikulich Alexey I

    2009-09-01

    Full Text Available Abstract Background It was demonstrated previously that the three-locus RFLP haplotype, TaqI B-TaqI D-TaqI A (B-D-A, at the DRD2 locus constitutes a powerful genetic marker and probably reflects the most ancient dispersal of anatomically modern humans. Results We investigated TaqI B, BclI, MboI, TaqI D, and TaqI A RFLPs in 17 contemporary populations of the East European Plain and Siberia. Most of these populations belong to the Indo-European or Uralic language families. We identified three common haplotypes, which occurred in more than 90% of chromosomes investigated. The frequencies of the haplotypes differed according to linguistic and geographical affiliation. Conclusion Populations in the northwestern (Byelorussians from Mjadel', northern (Russians from Mezen' and Oshevensk, and eastern (Russians from Puchezh parts of the East European Plain had relatively high frequencies of haplotype B2-D2-A2, which may reflect admixture with Uralic-speaking populations that inhabited all of these regions in the Early Middle Ages.

  6. Differentiation analysis for estimating individual ancestry from the Tibetan Plateau by an archaic altitude adaptation EPAS1 haplotype among East Asian populations.

    Science.gov (United States)

    Jiang, Li; Peng, Jianxiong; Huang, Meisha; Liu, Jing; Wang, Ling; Ma, Quan; Zhao, Hui; Yang, Xin; Ji, Anquan; Li, Caixia

    2018-02-10

    Tibetans have adapted to the extreme environment of high altitude for hundreds of generations. A highly differentiated 5-SNP (Single Nucleotide Polymorphism) haplotype motif (AGGAA) on a hypoxic pathway gene, EPAS1, is observed in Tibetans and lowlanders. To evaluate the potential usage of the 5-SNP haplotype in ancestry inference for Tibetan or Tibetan-related populations, we analyzed this haplotype in 1053 individuals of 12 Chinese populations residing on the Tibetan Plateau, peripheral regions of Tibet, and plain regions. These data were integrated with the genotypes from the 1000 Genome populations and populations in a previously reported paper for population structure analyses. We found that populations representing highland and lowland groups have different dominant ancestry components. The core Denisovan haplotype (AGGAA) was observed at a frequency of 72.32% in the Tibetan Plateau, with a frequency range from 9.48 to 21.05% in the peripheral regions and Tibetan Plateau carried the archaic haplotype, while < 5% of the Chinese Han people carried the haplotype. Our findings indicate that the 5-SNP haplotype has a special distribution pattern in populations of Tibet and peripheral regions and could be integrated into AISNP (Ancestry Informative Single Nucleotide Polymorphism) panels to enhance ancestry resolution.

  7. Identification of Tribolium castaneum (Herbst) haplotypes, the pest of ...

    African Journals Online (AJOL)

    SARAH

    2016-07-31

    Jul 31, 2016 ... J. Appl. Biosci. 2016 Identification of Tribolium castaneum (Herbst) haplotypes, the pest of stocked millet in Senegal ... Keywords: Tribolium castaneum, Cytochrome b, haplotype, Senegal, identification, distribution. Journal of Applied Biosciences ... species or plant varieties. In Africa, especially in the Sahel ...

  8. Polymorphism in the upstream regulatory region of DQA1 genes and DRB1, QAP, DQA1, and DQB1 haplotypes in the German population.

    Science.gov (United States)

    Haas, J P; Kimura, A; Andreas, A; Hochberger, M; Keller, E; Brünnler, G; Bettinotti, M P; Nevinny-Stickel, C; Hildebrandt, B; Sierp, G

    1994-01-01

    Polymorphism in the URR of the MHC class II DQA1 gene defines ten different alleles named QAP. Oligotyping for the alleles of DRB1, QAP, DQA1, and DQB1 have been performed in 210 unrelated healthy controls from Germany. Moreover, 83 HTCs from the Tenth IHWS have been tested. Four point loci haplotypes (DRB1, QAP, DQA1, and DQB1) have been analyzed in the unrelated healthy population sample. Computer analysis of the linkage disequilibria leads to the conclusion that QAP alleles are in strong linkage disequilibrium with alleles either the DQA1 or the DRB1 locus. One typical ("common") haplotype was found to be associated with each DRB1 allele in the majority (86%) of the tested persons. Apart from that, 25 other less frequent ("unusual") haplotypes, with an overall frequency of 14% have been defined. Some of these "unusual" MHC class II haplotypes were found to differ only in the regulatory alleles of DQA1 (QAP alleles) while they are identical for the alleles coding for structural elements (DRB1, DQA1, and DQB1). Most of the "unusual" haplotypes were found to carry HLA-DQ6. Assuming that "unusual" (= rare) haplotypes have arisen from "common" (= frequent) haplotypes by point mutation and recombination, we propose the existence of three recombination sites in the MHC DR-DQ region: one between DRB1 and QAP, the second between QAP and DQA1, and the third between DQA1 and DQB1.

  9. Distribution of QPY and RAH haplotypes of granzyme B gene in distinct Brazilian populations

    Directory of Open Access Journals (Sweden)

    Fernanda Bernadelli Garcia

    2012-08-01

    Full Text Available INTRODUCTION: The cytolysis mediated by granules is one of the most important effector functions of cytotoxic T lymphocytes and natural killer cells. Recently, three single nucleotide polymorphisms (SNPs were identified at exons 2, 3, and 5 of the granzyme B gene, resulting in a haplotype in which three amino acids of mature protein Q48P88Y245 are changed to R48A88H245, which leads to loss of cytotoxic activity of the protein. In this study, we evaluated the frequency of these polymorphisms in Brazilian populations. METHODS: We evaluated the frequency of these polymorphisms in Brazilian ethnic groups (white, Afro-Brazilian, and Asian by sequencing these regions. RESULTS: The allelic and genotypic frequencies of SNP 2364A/G at exon 2 in Afro-Brazilian individuals (42.3% and 17.3% were significantly higher when compared with those in whites and Asians (p < 0.0001 and p = 0.0007, respectively. The polymorphisms 2933C/G and 4243C/T also were more frequent in Afro-Brazilians but without any significant difference regarding the other groups. The Afro-Brazilian group presented greater diversity of haplotypes, and the RAH haplotype seemed to be more frequent in this group (25%, followed by the whites (20.7% and by the Asians (11.9%, similar to the frequency presented in the literature. CONCLUSIONS: There is a higher frequency of polymorphisms in Afro-Brazilians, and the RAH haplotype was more frequent in these individuals. We believe that further studies should aim to investigate the correlation of this haplotype with diseases related to immunity mediated by cytotoxic lymphocytes, and if this correlation is confirmed, novel treatment strategies might be elaborated.

  10. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.

    Science.gov (United States)

    Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K

    2010-02-24

    A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.

  11. PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

    Science.gov (United States)

    Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

    2011-01-01

    Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

  12. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves

    Directory of Open Access Journals (Sweden)

    Ostrander Elaine A

    2010-02-01

    Full Text Available Abstract Background A selective sweep containing the insulin-like growth factor 1 (IGF1 gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. Results We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. Conclusions The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East. See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10

  13. Single-stage surgical repair in a complex case of aberrant right subclavian artery aneurysm and common carotid trunk.

    Science.gov (United States)

    Kokotsakis, Ioannis; Harling, Leanne; Anagnostakou, Vania; Tassopoulos, Dimitris; Charitos, Christos; Ashrafian, Hutan; Athanasiou, Thanos

    2013-04-25

    Aberrant right subclavian artery with coexisting common carotid trunk is an extremely rare congenital anomaly affecting <0.1% of the population. We report the case of a 77-year-old Caucasian man presenting with dysphagia and dyspnea secondary to an aberrant right subclavian artery aneurysm and describe our technique for open surgical repair.

  14. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  15. Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

    Directory of Open Access Journals (Sweden)

    Dallol Ashraf

    2012-09-01

    Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

  16. Comparison of the clinical significance of single cuff-based arterial stiffness parameters with that of the commonly used parameters.

    Science.gov (United States)

    Komatsu, Shunsuke; Tomiyama, Hirofumi; Kimura, Kazutaka; Matsumoto, Chisa; Shiina, Kazuki; Yamashina, Akira

    2017-04-01

    We examined the following: (1) whether the new simple markers related to the arterial stiffness/central hemodynamics [i.e. arterial pressure-volume index (API) and arterial velocity pulse index (AVI)] are clinically interchangeable with the commonly used markers [brachial-ankle pulse wave velocity (baPWV) and radial augmentation index (rAI)]; (2) whether the new simple markers reflect vascular damage as reliably as the commonly used markers; (3) which cardiovascular risk factors are reflected by these new simple markers. API, AVI, baPWV, and rAI were measured simultaneously in consecutive patients admitted for the management of cardiovascular disease and/or cardiovascular risk factors (n=322). The API was correlated with the baPWV (R=0.492, pAPI, AVI, baPWV, and rAI were higher in the patients admitted for coronary angiography (CAG group: n=152) than in those admitted for reasons other than coronary angiography (nonCAG group: n=170). After adjustments for confounding factors, only the AVI was found to be higher in the CAG group than in the nonCAG group. Multivariate linear regression analysis revealed that age and the systolic blood pressure were independently associated with the API and AVI after adjustments. In patients with cardiovascular diseases or cardiovascular risk factors, the new simple markers and the commonly used markers are not interchangeable for assessing vascular damage and/or cardiovascular risk. Further study is proposed to examine whether AVI is higher in subjects with cardiovascular disease than in those without a history of cardiovascular disease. Similar to the case for the commonly used markers, age and the blood pressure significantly influenced both the new markers; therefore, age and the blood pressure need to be taken into account while interpreting the changes in these new simple markers. Copyright © 2016 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  17. The influence of interleukin-7 receptor α-chain haplotypes on outcome after allogeneic hematopoietic cell transplantation

    DEFF Research Database (Denmark)

    Broux, B; Shamim, Z; Wang, T

    2014-01-01

    We investigated the influence of IL-7 receptor α-chain (IL-7Rα) gene haplotypes in donors on the outcome of haematopoietic cell transplantation (HCT). Unlike the association between single donor SNPs and HCT outcome found previously, only trends towards association were found here, due to 'dilution...

  18. Are molecular haplotypes worth the time and expense? A cost-effective method for applying molecular haplotypes.

    Directory of Open Access Journals (Sweden)

    Mark A Levenstien

    2006-08-01

    Full Text Available Because current molecular haplotyping methods are expensive and not amenable to automation, many researchers rely on statistical methods to infer haplotype pairs from multilocus genotypes, and subsequently treat these inferred haplotype pairs as observations. These procedures are prone to haplotype misclassification. We examine the effect of these misclassification errors on the false-positive rate and power for two association tests. These tests include the standard likelihood ratio test (LRTstd and a likelihood ratio test that employs a double-sampling approach to allow for the misclassification inherent in the haplotype inference procedure (LRTae. We aim to determine the cost-benefit relationship of increasing the proportion of individuals with molecular haplotype measurements in addition to genotypes to raise the power gain of the LRTae over the LRTstd. This analysis should provide a guideline for determining the minimum number of molecular haplotypes required for desired power. Our simulations under the null hypothesis of equal haplotype frequencies in cases and controls indicate that (1 for each statistic, permutation methods maintain the correct type I error; (2 specific multilocus genotypes that are misclassified as the incorrect haplotype pair are consistently misclassified throughout each entire dataset; and (3 our simulations under the alternative hypothesis showed a significant power gain for the LRTae over the LRTstd for a subset of the parameter settings. Permutation methods should be used exclusively to determine significance for each statistic. For fixed cost, the power gain of the LRTae over the LRTstd varied depending on the relative costs of genotyping, molecular haplotyping, and phenotyping. The LRTae showed the greatest benefit over the LRTstd when the cost of phenotyping was very high relative to the cost of genotyping. This situation is likely to occur in a replication study as opposed to a whole-genome association study.

  19. Single-cell sequencing analysis characterizes common and cell-lineage-specific mutations in a muscle-invasive bladder cancer

    DEFF Research Database (Denmark)

    Li, Yingrui; Xu, Xun; Song, Luting

    2012-01-01

    sequencing of 66 individual tumor cells from a muscle-invasive bladder transitional cell carcinoma (TCC). Analyses of the somatic mutant allele frequency spectrum and clonal structure revealed that the tumor cells were derived from a single ancestral cell, but that subsequent evolution occurred, leading...... to two distinct tumor cell subpopulations. By analyzing recurrently mutant genes in an additional cohort of 99 TCC tumors, we identified genes that might play roles in the maintenance of the ancestral clone and in the muscle-invasive capability of subclones of this bladder cancer, respectively...

  20. Novel Nucleotide Variations, Haplotypes Structure and Associations with Growth Related Traits of Goat AT Motif-Binding Factor ( Gene

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    2015-10-01

    Full Text Available The AT motif-binding factor (ATBF1 not only interacts with protein inhibitor of activated signal transducer and activator of transcription 3 (STAT3 (PIAS3 to suppress STAT3 signaling regulating embryo early development and cell differentiation, but is required for early activation of the pituitary specific transcription factor 1 (Pit1 gene (also known as POU1F1 critically affecting mammalian growth and development. The goal of this study was to detect novel nucleotide variations and haplotypes structure of the ATBF1 gene, as well as to test their associations with growth-related traits in goats. Herein, a total of seven novel single nucleotide polymorphisms (SNPs (SNP 1-7 within this gene were found in two well-known Chinese native goat breeds. Haplotypes structure analysis demonstrated that there were four haplotypes in Hainan black goat while seventeen haplotypes in Xinong Saanen dairy goat, and both breeds only shared one haplotype (hap1. Association testing revealed that the SNP2, SNP5, SNP6, and SNP7 loci were also found to significantly associate with growth-related traits in goats, respectively. Moreover, one diplotype in Xinong Saanen dairy goats significantly linked to growth related traits. These preliminary findings not only would extend the spectrum of genetic variations of the goat ATBF1 gene, but also would contribute to implementing marker-assisted selection in genetics and breeding in goats.

  1. Minimal sharing of Y-chromosome STR haplotypes among five endogamous population groups from western and southwestern India.

    Science.gov (United States)

    Das, Birajalaxmi; Chauhan, P S; Seshadri, M

    2004-10-01

    We attempt to address the issue of genetic variation and the pattern of male gene flow among and between five Indian population groups of two different geographic and linguistic affiliations using Y-chromosome markers. We studied 221 males at three Y-chromosome biallelic loci and 184 males for the five Y-chromosome STRs. We observed 111 Y-chromosome STR haplotypes. An analysis of molecular variance (AMOVA) based on Y-chromosome STRs showed that the variation observed between the population groups belonging to two major regions (western and southwestern India) was 0.17%, which was significantly lower than the level of genetic variance among the five populations (0.59%) considered as a single group. Combined haplotype analysis of the five STRs and the biallelic locus 92R7 revealed minimal sharing of haplotypes among these five ethnic groups, irrespective of the similar origin of the linguistic and geographic affiliations; this minimal sharing indicates restricted male gene flow. As a consequence, most of the haplotypes were population specific. Network analysis showed that the haplotypes, which were shared between the populations, seem to have originated from different mutational pathways at different loci. Biallelic markers showed that all five ethnic groups have a similar ancestral origin despite their geographic and linguistic diversity.

  2. Polymorphisms and their Haplotype Combinations in the Lysozyme Gene Associated with the Production Traits of a Chinese Native Chicken Breed

    Directory of Open Access Journals (Sweden)

    LJ Yan

    Full Text Available ABSTRACT Animal lysozymes, which have been studied in many of invertebrate and vertebrate species, have been characterized and demonstrated to be immune-associated molecules, digestive enzymes and multifunctional molecules. The purpose of this study was to detect the connection between lysozyme-gene polymorphism and the production traits of a Chinese native chicken breed (Langshan chicken. Four single nucleotide mutation sites were identified: G345A, C1726T, G1836A, A1838G. By the linkage disequilibrium analysis, six haplotypes and 15haplotype combinations were depicted in the studied population. The statistical analysis demonstrated that the SNPs and the haplotype combinations are related to body weight at sixteen weeks of age in Langshan chickens (p<0.05, and those with combined haplotype Hap3-Hap6 (GA-TT-GG-AA presented higher body weight. Our study demonstrated that the SNPs and their haplotype combinations in the lysozyme gene were associated with the chicken production traits, and that SNPs can be used as a molecular marker for chicken marker-assisted selection.

  3. Associations between RET tagSNPs and their haplotypes and susceptibility, clinical severity, and thyroid function in patients with differentiated thyroid cancer.

    Directory of Open Access Journals (Sweden)

    Caiyun He

    Full Text Available It is unclear whether common genetic variants of the RET proto-oncogene contribute to disease susceptibility, clinical severity, and thyroid function in differentiated thyroid cancer (DTC.A total of 300 DTC patients and 252 healthy controls were enrolled in this study. Seven RET tagging single nucleotide polymorphisms were genotyped using the KASPar platform.Subgroup analysis showed that concomitant thyroid benign diseases were less likely to occur in DTC subjects with the rs1799939 AG or AG plus AA genotypes (odds ratio (OR = 1.93 and 1.88, P = 0.009 and 0.011, respectively. A rare haplotype, CGGATAA, was associated statistically with a reduced risk of DTC (OR = 0.18, P = 0.001. Concerning the aggressive features of DTC, higher level of N stage was more likely to occur in subjects carrying the wild-type genotypes at rs1800860 site (for dominant model: OR = 0.48, P = 0.008. Another rare haplotype, CAAGCGT, conferred increased risk for the occurrence of distant metastasis (OR = 7.57, P = 0.009. Notably, higher thyroid stimulating hormone levels and lower parathyroid hormone levels were found in patients with rs2075912, rs2565200, and rs2742240 heterozygotes and rare homozygotes; similar results were observed between PTH levels and rs1800858.This study provided useful information on RET variants that should be subjected to further study.

  4. Associations between RET tagSNPs and their haplotypes and susceptibility, clinical severity, and thyroid function in patients with differentiated thyroid cancer.

    Science.gov (United States)

    He, Caiyun; Ma, Jiangjun; Jiang, Yongle; Su, Xuan; Zhang, Xiao; Chen, Weichao; Ye, Zulu; Deng, Tiancheng; Deng, Wenze; Yang, Ankui

    2017-01-01

    It is unclear whether common genetic variants of the RET proto-oncogene contribute to disease susceptibility, clinical severity, and thyroid function in differentiated thyroid cancer (DTC). A total of 300 DTC patients and 252 healthy controls were enrolled in this study. Seven RET tagging single nucleotide polymorphisms were genotyped using the KASPar platform. Subgroup analysis showed that concomitant thyroid benign diseases were less likely to occur in DTC subjects with the rs1799939 AG or AG plus AA genotypes (odds ratio (OR) = 1.93 and 1.88, P = 0.009 and 0.011, respectively). A rare haplotype, CGGATAA, was associated statistically with a reduced risk of DTC (OR = 0.18, P = 0.001). Concerning the aggressive features of DTC, higher level of N stage was more likely to occur in subjects carrying the wild-type genotypes at rs1800860 site (for dominant model: OR = 0.48, P = 0.008). Another rare haplotype, CAAGCGT, conferred increased risk for the occurrence of distant metastasis (OR = 7.57, P = 0.009). Notably, higher thyroid stimulating hormone levels and lower parathyroid hormone levels were found in patients with rs2075912, rs2565200, and rs2742240 heterozygotes and rare homozygotes; similar results were observed between PTH levels and rs1800858. This study provided useful information on RET variants that should be subjected to further study.

  5. Simultaneous inference of haplotypes and alleles at a causal gene

    Directory of Open Access Journals (Sweden)

    Fabrice eLarribe

    2015-10-01

    Full Text Available We present a new methodology which jointly infers haplotypes and the causal alleles at a gene influencing a given trait. Often in human genetic studies, the available data consists of genotypes (series of genetic markers along the chromosomes and a phenotype. However, for many genetic analyses, one needs haplotypes instead of genotypes. Our methodology is not only able to estimate haplotypes conditionally on the disease status, but is also able to infer the alleles at the unknown disease locus. Some applications of our methodology are in genetic mapping and in genetic counselling.

  6. Fitchi: haplotype genealogy graphs based on the Fitch algorithm.

    Science.gov (United States)

    Matschiner, Michael

    2016-04-15

    : In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Fast single run of vanilla fingerprint markers on microfluidic-electrochemistry chip for confirmation of common frauds.

    Science.gov (United States)

    Avila, Mónica; Zougagh, Mohammed; Escarpa, Alberto; Ríos, Angel

    2009-10-01

    A new strategy based on the fast separation of the fingerprint markers of Vanilla planifolia extracts and vanilla-related samples on microfluidic-electrochemistry chip is proposed. This methodology allowed the detection of all required markers for confirmation of common frauds in this field. The elution order was strategically connected with sequential sample screening and analyte confirmation steps, where first ethyl vanillin was detected to distinguish natural from adultered samples; second, vanillin as prominent marker in V. planifolia, but frequently added in its synthetic form; and third, the final detection of the fingerprint markers (p-hydroxybenzaldehyde, vanillic acid, and p-hydroxybenzoic acid) of V. planifolia with confirmation purposes. The reliability of the proposed methodology was demonstrated in the confirmation the natural or non-natural origin of vanilla in samples using V. planifolia extracts and other selected food samples containing this flavor.

  8. Diagnostics of common microdeletion syndromes using fluorescence in situ hybridization: single center experience in a developing country

    Directory of Open Access Journals (Sweden)

    Amina Kurtovic-Kozaric

    2016-03-01

    Full Text Available Microdeletion syndromes are caused by chromosomal deletions of less than 5 megabases which can be detected by fluorescence in situ hybridization (FISH. We evaluated the most commonly detected microdeletions for the period from June 01, 2008 to June 01, 2015 in the Federation of Bosnia and Herzegovina, including DiGeorge, Prader-Willi/Angelman, Wolf-Hirschhorn, and Williams syndromes. We report 4 patients with DiGeorge syndromes, 4 patients with Prader-Willi/Angelman, 4 patients with Wolf-Hirschhorn syndrome, and 3 patients with Williams syndrome in the analyzed 7 year period. Based on the positive FISH results for each syndrome, the incidence was calculated for the Federation of Bosnia and Herzegovina. These are the first reported frequencies of the microdeletion syndromes in the Federation of Bosnia and Herzegovina.

  9. Association of ATG16L1 gene haplotype with inflammatory bowel disease in Indians.

    Directory of Open Access Journals (Sweden)

    Srinivasan Pugazhendhi

    Full Text Available Inflammatory bowel disease (IBD is characterized by multigenic inheritance. Defects in autophagy related genes are considered to show genetic heterogeneity between populations. We evaluated the association of several single nucleotide polymorphisms (SNPs in the autophagy related 16 like 1 (ATG16L1 gene with IBD in Indians. The ATG16L1 gene was genotyped for ten different SNPs using DNA extracted from peripheral blood of 234 patients with Crohn's disease (CD, 249 patients with ulcerative colitis (UC and 393 healthy controls The SNPs rs2241880, rs4663396, rs3792106, rs10210302, rs3792109, rs2241877, rs6737398, rs11682898, rs4663402 and rs4663421 were genotyped using the Sequenom MassArray platform. PLINK was used for the association analysis and pairwise linkage disequilibrium (LD values. Haplotype analysis was done using Haploview. All SNPs were in Hardy Weinberg equilibrium in cases and controls. The G allele at rs6737398 exhibited a protective association with both CD and UC. The T allele at rs4663402 and C allele at rs4663421 were positively associated with CD and UC. The T allele at rs2241877 exhibited protective association with UC only. The AA genotype at rs4663402 and the GG genotype at rs4663421 were protectively associated with both CD and UC. Haplotype analysis revealed that all the SNPs in tight LD (D' = 0.76-1.0 and organized in a single haplotype block. Haplotype D was positively associated with IBD (P = 5.8 x 10-6 for CD and 0.002 for UC. SNPs in ATG16L1 were associated with IBD in Indian patients. The relevance to management of individual patients requires further study.

  10. Lack of association between common single nucleotide polymorphisms in the TERT-CLPTM1L locus and breast cancer in women of African ancestry.

    Science.gov (United States)

    Zheng, Yonglan; Ogundiran, Temidayo O; Adebamowo, Clement; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Simon, Michael S; John, Esther M; Hennis, Anselm; Nemesure, Barbara; Wu, Suh-Yuh; Leske, Maria Cristina; Ambs, Stefan; Niu, Qun; Zhang, Jing; Cox, Nancy J; Olopade, Olufunmilayo I; Huo, Dezheng

    2012-02-01

    As one of the most common cancers worldwide, breast cancer places an extraordinary burden on the populations of African ancestry. Common SNPs in the TERT-CLPTM1L locus have been reported to be associated with several types of cancer, including breast cancer. We sought to investigate whether the previously reported common single nucleotide polymorphisms (SNPs) in the TERT-CLPTM1L locus could also contribute to the breast cancer risk in women of African ancestry. We genotyped eleven SNPs in 2,892 women of African descent but were unable to detect any significant association between TERT-CLPTM1L SNPs and their predispositions for breast cancer risk. Given the differences in linkage disequilibrium patterns across populations, our findings suggest that larger independent studies from diverse populations are expected to evaluate the importance of the TERT-CLPTM1L locus in breast cancer.

  11. Effect of common single-nucleotide polymorphisms in acetylsalicylic acid metabolic pathway genes on platelet reactivity in patients with diabetes

    Science.gov (United States)

    Postula, Marek; Janicki, Piotr K.; Rosiak, Marek; Kaplon-Cieslicka, Agnieszka; Kondracka, Agnieszka; Trzepla, Ewa; Filipiak, Krzysztof J.; Kosior, Dariusz A.; Czlonkowski, Andrzej; Opolski, Grzegorz

    2013-01-01

    Background Platelet reactivity in patients on acetylsalicylic acid (ASA) therapy can be influenced by physiological or pathological conditions affecting ASA pharmacokinetics or pharmacodynamics. The mechanism of such variability in the therapeutic response to ASA, particularly in diabetic patients, is poorly understood. The rate of elimination of ASA and its metabolite, salicylic acid (SA), is likely a major factor determining drug efficacy. The objective of this study was to investigate the effect of genetic polymorphisms in the selected candidate genes within the ASA metabolic pathway on the platelet reactivity and concentration of ASA and thromboxane A2 (TxA2) metabolites in a population of patients with type 2 diabetes mellitus (T2DM). Material/Methods The study cohort consisted of 287 Caucasians with T2DM who had been taking ASA tablets at the dose of 75 mg per day for at least 3 months. Platelet reactivity analyses were performed using VerifyNow Aspirin and PFA-100 assays. The measured ASA metabolite included salicylic acid (ASA), and TxA2 metabolites included serum TxB2 and urinary 11-dh-TxB2. Genotyping for the selected 18 single-nucleotide polymorphisms (SNPs) within 5 genes of the ASA metabolic pathway was performed using a Sequenom iPLEX platform. Results No statistically significant association was observed between the investigated SNPs genotypes, platelet reactivity, and measured metabolites in the investigated cohort of patients. Conclusions The results of our study failed to confirm that the selected variants in the genes within the ASA metabolic pathway might contribute to platelet reactivity in a diabetic population treated with ASA. PMID:23715170

  12. De novo assembly of a haplotype-resolved human genome.

    Science.gov (United States)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  13. De novo assembly of a haplotype-resolved human genome

    DEFF Research Database (Denmark)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang

    2015-01-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome...... of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should...... shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb...

  14. Common ERBB2 polymorphisms and risk of breast cancer in a white British population: a case–control study

    International Nuclear Information System (INIS)

    Benusiglio, Patrick R; Ponder, Bruce AJ; Lesueur, Fabienne; Luccarini, Craig; Conroy, Donald M; Shah, Mitul; Easton, Douglas F; Day, Nick E; Dunning, Alison M; Pharoah, Paul D

    2005-01-01

    About two-thirds of the excess familial risk associated with breast cancer is still unaccounted for and may be explained by multiple weakly predisposing alleles. A gene thought to be involved in low-level predisposition to the disease is ERBB2 (HER2). This gene is involved in cell division, differentiation, and apoptosis and is frequently amplified in breast tumours. Its amplification correlates with poor prognosis. Moreover, the coding polymorphism I655V has previously been associated with an increased risk of breast cancer. We aimed to determine if common polymorphisms (frequency ≥ 5%) in ERBB2 were associated with breast cancer risk in a white British population. Five single-nucleotide polymorphisms (SNPs) were selected for study: SNP 1 near the promoter, SNP 2 in intron 1, SNP 3 in intron 4, SNP 4 in exon 17 (I655V), and SNP 5 in exon 27 (A1170P). We tested their association with breast cancer in a large case–control study (n = 2192 cases and 2257 controls). There were no differences in genotype frequencies between cases and controls for any of the SNPs examined. To investigate the possibility that a common polymorphism not included in our study might be involved in breast cancer predisposition, we also constructed multilocus haplotypes. Our set of SNPs generated all existing (n = 6) common haplotypes and no differences were seen in haplotype frequencies between cases and controls (P = 0.44). In our population, common ERBB2 polymorphisms are not involved in predisposition to breast cancer

  15. Y-chromosome STR haplotypes in males from Greenland

    DEFF Research Database (Denmark)

    Hallenberg, Charlotte; Tomas Mas, Carmen; Simonsen, Bo

    2009-01-01

    A total of 272 males from Greenland were typed for 11 Y-chromosome STRs DYS19, DYS385a/b, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438 and DYS439 with the PowerPlex Y System (Promega). A total of 146 different haplotypes were observed and the haplotype diversity was 0...

  16. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  17. Haplotype allelic classes for detecting ongoing positive selection

    Directory of Open Access Journals (Sweden)

    Lefebvre Jean-François

    2010-01-01

    Full Text Available Abstract Background Natural selection eliminates detrimental and favors advantageous phenotypes. This process leaves characteristic signatures in underlying genomic segments that can be recognized through deviations in allelic or haplotypic frequency spectra. To provide an identifiable signature of recent positive selection that can be detected by comparison with the background distribution, we introduced a new way of looking at genomic polymorphisms: haplotype allelic classes. Results The model combines segregating sites and haplotypic information in order to reveal useful data characteristics. We developed a summary statistic, Svd, to compare the distribution of the haplotypes carrying the selected allele with the distribution of the remaining ones. Coalescence simulations are used to study the distributions under standard population models assuming neutrality, demographic scenarios and selection models. To test, in practice, haplotype allelic class performance and the derived statistic in capturing deviation from neutrality due to positive selection, we analyzed haplotypic variation in detail in the locus of lactase persistence in the three HapMap Phase II populations. Conclusions We showed that the Svd statistic is less sensitive than other tests to confounding factors such as demography or recombination. Our approach succeeds in identifying candidate loci, such as the lactase-persistence locus, as targets of strong positive selection and provides a new tool complementary to other tests to study natural selection in genomic data.

  18. Assessment of association between variants and haplotypes of the IGF2 gene in beef cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Jing; Zhan, Zhao-Yang; Cao, Xiu-Kai; Sun, Yu-Jia; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-10-10

    Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation. The aim of this study was to examine the association of the IGF2 polymorphism with growth traits in beef cattle breed. Four single nucleotide polymorphisms (SNPs: 1-4) were identified in the bovine IGF2 by sequencing pooled DNA samples (Pool-Seq) and forced polymerase chain reaction-restriction fragment length polymorphism (Forced PCR-RFLP) methods. The result of haplotype analysis of four SNPs showed that eight haplotypes and eighteen combined genotypes were revealed, and the linkage disequilibrium and evolutionary relationship were assessed in 1522 individuals representing four purebred cattle breeds from China. The statistical analyses indicated that the 4 SNPs and 18 combined genotypes or haplotypes are associated with the body weight at 18 and 24 months in Jiaxian cattle population (Pgrowth traits, and may be used for marker-assisted selection in beef cattle breeding program. © 2013.

  19. Analysis of Case-Control Association Studies: SNPs, Imputation and Haplotypes

    KAUST Repository

    Chatterjee, Nilanjan

    2009-11-01

    Although prospective logistic regression is the standard method of analysis for case-control data, it has been recently noted that in genetic epidemiologic studies one can use the "retrospective" likelihood to gain major power by incorporating various population genetics model assumptions such as Hardy-Weinberg-Equilibrium (HWE), gene-gene and gene-environment independence. In this article we review these modern methods and contrast them with the more classical approaches through two types of applications (i) association tests for typed and untyped single nucleotide polymorphisms (SNPs) and (ii) estimation of haplotype effects and haplotype-environment interactions in the presence of haplotype-phase ambiguity. We provide novel insights to existing methods by construction of various score-tests and pseudo-likelihoods. In addition, we describe a novel two-stage method for analysis of untyped SNPs that can use any flexible external algorithm for genotype imputation followed by a powerful association test based on the retrospective likelihood. We illustrate applications of the methods using simulated and real data. © Institute of Mathematical Statistics, 2009.

  20. Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes.

    Directory of Open Access Journals (Sweden)

    Tiffany Langewisch

    Full Text Available In this Genomics Era, vast amounts of next-generation sequencing data have become publicly available for multiple genomes across hundreds of species. Analyses of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset and among different datasets or organisms. To facilitate the exploration of allelic variation and diversity, we have developed and deployed an in-house computer software to categorize and visualize these haplotypes. The SNPViz software enables users to analyze region-specific haplotypes from single nucleotide polymorphism (SNP datasets for different sequenced genomes. The examination of allelic variation and diversity of important soybean [Glycine max (L. Merr.] flowering time and maturity genes may provide additional insight into flowering time regulation and enhance researchers' ability to target soybean breeding for particular environments. For this study, we utilized two available soybean genomic datasets for a total of 72 soybean genotypes encompassing cultivars, landraces, and the wild species Glycine soja. The major soybean maturity genes E1, E2, E3, and E4 along with the Dt1 gene for plant growth architecture were analyzed in an effort to determine the number of major haplotypes for each gene, to evaluate the consistency of the haplotypes with characterized variant alleles, and to identify evidence of artificial selection. The results indicated classification of a small number of predominant haplogroups for each gene and important insights into possible allelic diversity for each gene within the context of known causative mutations. The software has both a stand-alone and web-based version and can be used to analyze other genes, examine additional soybean datasets, and view similar genome sequence and SNP datasets from other species.

  1. BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.

    Science.gov (United States)

    Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira

    2015-03-01

    To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  2. Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes.

    Science.gov (United States)

    Langewisch, Tiffany; Zhang, Hongxin; Vincent, Ryan; Joshi, Trupti; Xu, Dong; Bilyeu, Kristin

    2014-01-01

    In this Genomics Era, vast amounts of next-generation sequencing data have become publicly available for multiple genomes across hundreds of species. Analyses of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset and among different datasets or organisms. To facilitate the exploration of allelic variation and diversity, we have developed and deployed an in-house computer software to categorize and visualize these haplotypes. The SNPViz software enables users to analyze region-specific haplotypes from single nucleotide polymorphism (SNP) datasets for different sequenced genomes. The examination of allelic variation and diversity of important soybean [Glycine max (L.) Merr.] flowering time and maturity genes may provide additional insight into flowering time regulation and enhance researchers' ability to target soybean breeding for particular environments. For this study, we utilized two available soybean genomic datasets for a total of 72 soybean genotypes encompassing cultivars, landraces, and the wild species Glycine soja. The major soybean maturity genes E1, E2, E3, and E4 along with the Dt1 gene for plant growth architecture were analyzed in an effort to determine the number of major haplotypes for each gene, to evaluate the consistency of the haplotypes with characterized variant alleles, and to identify evidence of artificial selection. The results indicated classification of a small number of predominant haplogroups for each gene and important insights into possible allelic diversity for each gene within the context of known causative mutations. The software has both a stand-alone and web-based version and can be used to analyze other genes, examine additional soybean datasets, and view similar genome sequence and SNP datasets from other species.

  3. Novel full-length major histocompatibility complex class I allele discovery and haplotype definition in pig-tailed macaques.

    Science.gov (United States)

    Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H

    2017-11-13

    Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

  4. Application of the Linux cluster for exhaustive window haplotype analysis using the FBAT and Unphased programs.

    Science.gov (United States)

    Mishima, Hiroyuki; Lidral, Andrew C; Ni, Jun

    2008-05-28

    Genetic association studies have been used to map disease-causing genes. A newly introduced statistical method, called exhaustive haplotype association study, analyzes genetic information consisting of different numbers and combinations of DNA sequence variations along a chromosome. Such studies involve a large number of statistical calculations and subsequently high computing power. It is possible to develop parallel algorithms and codes to perform the calculations on a high performance computing (HPC) system. However, most existing commonly-used statistic packages for genetic studies are non-parallel versions. Alternatively, one may use the cutting-edge technology of grid computing and its packages to conduct non-parallel genetic statistical packages on a centralized HPC system or distributed computing systems. In this paper, we report the utilization of a queuing scheduler built on the Grid Engine and run on a Rocks Linux cluster for our genetic statistical studies. Analysis of both consecutive and combinational window haplotypes was conducted by the FBAT (Laird et al., 2000) and Unphased (Dudbridge, 2003) programs. The dataset consisted of 26 loci from 277 extended families (1484 persons). Using the Rocks Linux cluster with 22 compute-nodes, FBAT jobs performed about 14.4-15.9 times faster, while Unphased jobs performed 1.1-18.6 times faster compared to the accumulated computation duration. Execution of exhaustive haplotype analysis using non-parallel software packages on a Linux-based system is an effective and efficient approach in terms of cost and performance.

  5. Y chromosomal haplotype characteristics of domestic sheep (Ovis aries) in China.

    Science.gov (United States)

    Wang, Yutao; Xu, Lei; Yan, Wei; Li, Shaobin; Wang, Jiqing; Liu, Xiu; Hu, Jiang; Luo, Yuzhu

    2015-07-10

    Investigations on the variation present at the male-specific Y chromosome region provide strong information to understand the origin and evolution of domestic sheep. One SNP OY1 (g.88A>G) in the upstream region of SRY gene, and the microsatellite SRYM18 locus within ovine Y chromosome were analyzed in one hundred and forty five samples collected from eleven breeds in China. SNP OY1 was analyzed using PCR-SSCP method and sequencing. Two different PCR-SSCP patterns represented two specific sequences with sequence analysis revealing SNP-OY1 (g.88A>G) were observed, while SNP A-OY1 showed the most common frequency (82.8%). Sequencing of the SRYM18 region revealed one novel size fragment (A2) with different repetitive units. Seven haplotypes (H4, H5, H6, H7, H8, H9 and H12) and two novel haplotypes (Ha and Hb) were established using combined genotype analysis. H6 showed the highest frequency (43.4%) across all breeds, and H8 showed the second frequency (24.1%). Ha was only found in one breed (Tan), while Hb was present in three breeds (Gansu alpine, White Suffolk and Duolang). Our findings reveal one novel allele in SRYM18 region and two novel male haplotypes of domestic sheep in China. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  7. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  8. Caucasian origin of disease associated HLA haplotypes in chinese blood donors with IgA deficiency.

    Science.gov (United States)

    Wang, Ning; Lu, Ping; Ling, Bing; Zhu, Ziyan; Hammarström, Lennart

    2014-02-01

    Selective immunoglobulin A deficiency (IgAD) is the most common primary immunodeficiency in Caucasians with a prevalence of 1:600. However, the prevalence of IgAD is markedly lower in East Asian countries but no genetic studies have been performed on IgAD individuals in the Mongoloid population. We investigated the prevalence of IgAD in a large number of Chinese blood donors (n = 39,015) in Shanghai, China. We measured immunoglobulin class, IgG subclass and anti-IgA serum levels among the IgAD donors. These donors were subsequently tissue typed and the allele frequency was compared with the Shanghai bone marrow donor HLA registry. Seventeen IgAD Chinese blood donors were identified, giving a prevalence of 1: 2,295. Two previously identified IgAD blood donor samples were added in the subsequent tests. Most IgAD donors had serum IgG levels above the normal range with no major IgG subclass deficiency and one donor was weakly positive for anti-IgA. Two-thirds of the Chinese IgAD donors carried Caucasian IgAD associated risk haplotypes, including DRB1*0301-DQB1*0201, DRB1*0701-DQB1*0202 and DRB1*0102-DQB1*0501, giving a significantly higher frequency of these haplotypes as compared to the Shanghai bone marrow donor HLA registry. The prevalence of IgAD in Chinese in this study is markedly lower than in Caucasians. This is the first study to investigate the genetics of IgAD in the Mongoloid population and two-thirds of the Chinese IgAD donors showed a mixture of Caucasian IgAD risk haplotypes. The low prevalence of IgAD could potentially be due to the low frequency of the disease associated risk haplotypes in China.

  9. MICA-HLA-B haplotype diversity and linkage disequilibrium in a population of Jewish descent from Majorca (the Balearic Islands).

    Science.gov (United States)

    Cambra, Ana; Muñoz-Saá, Iván; Crespí, Catalina; Serra, Antònia; Etxagibel, Aitziber; Matamoros, Núria; Milà, Joan; Julià, Maria Rosa

    2009-07-01

    The major histocompatibility complex class I chain-related A (MICA) gene is located 46 kb centromeric of human leukocyte antigen (HLA)-B and is highly polymorphic, similar to HLA genes. This allelic variation may influence the affinity of MICA molecules to their receptor on natural killer, gammadelta T and CD8+ T cells, NKG2D, and the immune response to organ transplantation and disease susceptibility. In the present study, we typed MICA and HLA-B polymorphisms in 95 individuals from a population of Jewish descent (Chuetas) and 195 individuals of Caucasian origin from Majorca (the Balearic Islands). MICA*008, -*004, and -*002 were the most common alleles and accounted for 53 and 60% in Chuetas and Majorcans, respectively. Other common alleles (frequency >5%) were MICA*016, -*009, -*012, -*007, and -*017 in Chuetas and -*009, -*001, and -*018 in Majorcans. We also studied two-locus haplotype diversity and linkage disequilibrium (LD). Both populations presented haplotypes with significant LD that were shared by other Caucasians populations, but we reported particular haplotypes in the Chueta group: MICA*002-HLA-B*38, MICA*016-HLA-B*35, MICA*012-HLA-B*55, and MICA*017-HLA-B*57. These haplotypes were not reported in other studies at high frequencies. In conclusion, the Chueta population presents a particular genetic pool but has affinities with the host population.

  10. Single Common Powertrain Lubricant Development

    Science.gov (United States)

    2012-01-01

    Carbon, % 0.00 0.00 0.38 0.13 Exahust 9.0 9.0 9.1 9.04 Intake 7.2 8.5 6.7 7.46 3 Run Average Cylinder AverageRatings Valve Tulip Deposits, Merits Piston...0.13 0.00 Exahust 9.2 9.3 9.0 Intake 8.3 6.7 7.2 Cylinder AverageRatings Ring Sticking Scuffing % Area Piston Deposits Valve Tulip Deposits, Merits...Fill, % 0.00 0.75 3.75 2.13 Top Land Heavy Carbon, % 18.38 16.25 18.63 16.38 Top Lan Flaked Carbon, % 0.00 0.13 0.00 0.00 Valve Tulip Deposits, Merits

  11. Association of SNPs/haplotypes in promoter of TNF A and IL-10 gene together with life style factors in prostate cancer progression in Indian population.

    Science.gov (United States)

    Bandil, Kapil; Singhal, Pallavi; Dogra, Atika; Rawal, Sudhir K; Doval, D C; Varshney, Anil K; Bharadwaj, Mausumi

    2017-12-01

    Levels of proinflammatory (TNF A) and anti-inflammatory (IL-10) cytokines play a key role in the progression of inflammation as well as cancer disease. We were investigating the potential association of single-nucleotide polymorphisms (SNPs)/haplotypes in proinflammatory (TNF A) and anti-inflammatory (IL-10) cytokines locus with the development of PCa in Indian population. We had genotyped 235 BPH/PCa samples (130 BPH and 105 cancer) along with 115 control samples for proinflammatory (TNF A -238G/A and -308G/A) and anti-inflammatory (IL-10 -1082A/G, -819C/T and -592C/A) cytokines SNPs in the gene promoter region using ARMS-PCR method. Allelic frequencies of TNF A and IL-10 SNPs were found to be significantly associated with the risk of prostate cancer and BPH when compared to controls (p = 0.05). Further haplotypic analysis showed that two haplotypes of TNF A (AG and AA) and IL-10 gene (CCG and CTG) were serving as risk haplotypes for prostate cancer development. IL-10 risk haplotypes were found to be positively associated with aggressiveness of prostate cancer. We also noticed successively increasing percentage of TNF A and IL-10 risk haplotypes with life style habits like smoking (10 and 26%) and alcohol consuming (9 and 27%). According to our data, TNF A -238G>A and IL-10 -1082A>G, -819C>T and -592C>A may be associated with the development of prostate cancer and BPH. We could also notice higher frequency of TNF A and IL-10 risk haplotypes in smoker and alcohol user. Interestingly, IL-10 risk haplotype was positively associated with aggressiveness of tumor. This information can be used for the early diagnosis of disease and to improve tissue-specific treatment's efficacy which will be moving ultimately towards the discovery of personalized therapy.

  12. Common spatio-temporal pattern for single-trial detection of event-related potential in rapid serial visual presentation triage.

    Science.gov (United States)

    Yu, Ke; Shen, Kaiquan; Shao, Shiyun; Ng, Wu Chun; Kwok, Kenneth; Li, Xiaoping

    2011-09-01

    Searching for target images in large volume imagery is a challenging problem and the rapid serial visual presentation (RSVP) triage is potentially a promising solution to the problem. RSVP triage is essentially a cortically-coupled computer vision technique that relies on single-trial detection of event-related potentials (ERP). In RSVP triage, images are shown to a subject in a rapid serial sequence. When a target image is seen by the subject, unique ERP characterized by P300 are elicited. Thus, in RSVP triage, accurate detection of such distinct ERP allows for fast searching of target images in large volume imagery. The accuracy of the distinct ERP detection in RSVP triage depends on the feature extraction method, for which the common spatial pattern analysis (CSP) was used with limited success. This paper presents a novel feature extraction method, termed common spatio-temporal pattern (CSTP), which is critical for robust single-trial detection of ERP. Unlike the conventional CSP, whereby only spatial patterns of ERP are considered, the present proposed method exploits spatial and temporal patterns of ERP separately, providing complementary spatial and temporal features for high accurate single-trial ERP detection. Numerical study using data collected from 20 subjects in RSVP triage experiments demonstrates that the proposed method offers significant performance improvement over the conventional CSP method (corrected p-value < 0.05, Pearson r = 0.64) and other competing methods in the literature. This paper further shows that the main idea of CSTP can be easily applied to other methods.

  13. HLA Haplotypes and Genotypes Frequencies in Brazilian Chronic Periodontitis Patients

    Science.gov (United States)

    Sippert, Emília Ângela; Silva, Cléverson de Oliveira e; Ayo, Christiane Maria; Marques, Silvia Barbosa Dutra; Visentainer, Jeane Eliete Laguila; Sell, Ana Maria

    2015-01-01

    Human leukocyte antigens (HLA) have a pivotal role in immune response and may be involved in antigen recognition of periodontal pathogens. However, the associations of HLA with chronic periodontitis (CP) have not been previously studied in the Brazilian population. In an attempt to clarify the issue of genetic predisposition to CP, we examined the distribution of HLA alleles, genotypes, and haplotypes in patients from Southern Brazil. One hundred and eight CP patients and 151 healthy and unrelated controls with age-, gender-, and ethnicity-matched were HLA investigated by polymerase chain reaction with sequence specific oligonucleotides. To exclude smoking as a predisposing factor, statistical analyses were performed in the total sample and in nonsmoking individuals. The significant results showed a positive association of the A∗02/HLA-B∗40 haplotype with CP (total samples: 4.2% versus 0%, P c = 0.03; nonsmokers: 4.3% versus 0%, P c = 0.23) and a lower frequency of HLA-B∗15/HLA-DRB1∗11 haplotype in CP compared to controls (total samples: 0.0% versus 4.3%, P c = 0.04; nonsmokers: 0 versus 5.1%, P c = 1.0). In conclusion, the HLA-A∗02/B∗40 haplotype may contribute to the development of CP, while HLA-B∗15/DRB1∗11 haplotype might indicate resistance to disease among Brazilians. PMID:26339134

  14. HLA Haplotypes and Genotypes Frequencies in Brazilian Chronic Periodontitis Patients

    Directory of Open Access Journals (Sweden)

    Emília Ângela Sippert

    2015-01-01

    Full Text Available Human leukocyte antigens (HLA have a pivotal role in immune response and may be involved in antigen recognition of periodontal pathogens. However, the associations of HLA with chronic periodontitis (CP have not been previously studied in the Brazilian population. In an attempt to clarify the issue of genetic predisposition to CP, we examined the distribution of HLA alleles, genotypes, and haplotypes in patients from Southern Brazil. One hundred and eight CP patients and 151 healthy and unrelated controls with age-, gender-, and ethnicity-matched were HLA investigated by polymerase chain reaction with sequence specific oligonucleotides. To exclude smoking as a predisposing factor, statistical analyses were performed in the total sample and in nonsmoking individuals. The significant results showed a positive association of the A∗02/HLA-B∗40 haplotype with CP (total samples: 4.2% versus 0%, Pc = 0.03; nonsmokers: 4.3% versus 0%, Pc = 0.23 and a lower frequency of HLA-B∗15/HLA-DRB1∗11 haplotype in CP compared to controls (total samples: 0.0% versus 4.3%, Pc = 0.04; nonsmokers: 0 versus 5.1%, Pc = 1.0. In conclusion, the HLA-A∗02/B∗40 haplotype may contribute to the development of CP, while HLA-B∗15/DRB1∗11 haplotype might indicate resistance to disease among Brazilians.

  15. Associations of Haplotypes Upstream of IRS1 with Insulin Resistance, Type 2 Diabetes, Dyslipidemia, Preclinical Atherosclerosis, and Skeletal Muscle LOC646736 mRNA Levels

    Directory of Open Access Journals (Sweden)

    Selma M. Soyal

    2015-01-01

    Full Text Available The genomic region ~500 kb upstream of IRS1 has been implicated in insulin resistance, type 2 diabetes, adverse lipid profile, and cardiovascular risk. To gain further insight into this chromosomal region, we typed four SNPs in a cross-sectional cohort and subjects with type 2 diabetes recruited from the same geographic region. From 16 possible haplotypes, 6 haplotypes with frequencies >0.01 were observed. We identified one haplotype that was protective against insulin resistance (determined by HOMA-IR and fasting plasma insulin levels, type 2 diabetes, an adverse lipid profile, increased C-reactive protein, and asymptomatic atherosclerotic disease (assessed by intima media thickness of the common carotid arteries. BMI and total adipose tissue mass as well as visceral and subcutaneous adipose tissue mass did not differ between the reference and protective haplotypes. In 92 subjects, we observed an association of the protective haplotype with higher skeletal muscle mRNA levels of LOC646736, which is located in the same haplotype block as the informative SNPs and is mainly expressed in skeletal muscle, but only at very low levels in liver or adipose tissues. These data suggest a role for LOC646736 in human insulin resistance and warrant further studies on the functional effects of this locus.

  16. Inducible Nitric Oxide Synthase Promoter Haplotypes and Residential Traffic-Related Air Pollution Jointly Influence Exhaled Nitric Oxide Level in Children.

    Directory of Open Access Journals (Sweden)

    Muhammad T Salam

    Full Text Available Exhaled nitric oxide (FeNO, a biomarker of airway inflammation, predicts asthma risk in children. We previously found that the promoter haplotypes in inducible nitric oxide synthase (NOS2 and exposure to residential traffic independently influence FeNO level. Because NOS2 is inducible by environmental exposures such as traffic-related exposure, we tested the hypothesis that common NOS2 promoter haplotypes modulate the relationship between residential traffic-related exposure and FeNO level in children.In a cross-sectional population-based study, subjects (N = 2,457; 7-11 year-old were Hispanic and non-Hispanic white children who participated in the Southern California Children's Health Study and had FeNO measurements. For residential traffic, lengths of local roads within circular buffers (50m, 100m and 200m radii around homes around the subjects' homes were estimated using geographic information system (GIS methods. We interrogated the two most common NOS2 promoter haplotypes that were found to affect FeNO level.The relationship between local road lengths within 100m and 200m circular buffers and FeNO level varied significantly by one of the NOS2 promoter haplotypes (P-values for interaction between road length and NOS2 promoter haplotype = 0.02 and 0.03, respectively. In children who had ≤250m of local road lengths within 100m buffer around their homes, those with two copies of the haplotype had significantly lower FeNO (adjusted geometric mean = 11.74ppb; 95% confidence intervals (CI: 9.99 to 13.80 than those with no copies (adjusted geometric mean = 15.28ppb; 95% CI: 14.04 to 16.63 with statistically significant trend of lower FeNO level with increasing number of haplotype copy (P-value for trend = 0.002. In contrast, among children who had >250m of local road lengths within 100m buffer, FeNO level did not significantly differ by the haplotype copy-number (P-value for trend = 0.34. Similar interactive effects of this haplotype and local

  17. Interaction between a novel TGFB1 haplotype and CFTR genotype is associated with improved lung function in cystic fibrosis.

    Science.gov (United States)

    Bremer, Lindsay A; Blackman, Scott M; Vanscoy, Lori L; McDougal, Kathryn E; Bowers, Amanda; Naughton, Kathleen M; Cutler, David J; Cutting, Garry R

    2008-07-15

    Cystic fibrosis (CF), the most common lethal single gene disorder in Caucasians, is due to mutations in the CFTR gene. Twin and sibling analysis indicates that modifier genes, rather than allelic variation in CFTR, are responsible for most of the variability in severity of lung disease, the major cause of mortality in CF patients. We used a family-based approach to test for association between lung function and two functional SNPs (rs1800469, '-509' and rs1982073, 'codon 10') in the 5' region of transforming growth factor-beta1 (TGFB1), a putative CF modifier gene. Quantitative transmission disequilibrium testing of 472 CF patient-parent-parent trios revealed that both TGFB1 SNPs showed significant transmission distortion when patients were stratified by CFTR genotype. Although lung function and nutritional status are correlated in CF patients, there was no evidence of association between the TGFB1 SNPs and variation in nutritional status. Additional tagging SNPs (rs8179181, rs2278422, rs8110090, rs4803455 and rs1982072) that capture most of the diversity in TGFB1 were also typed but none showed association with variation in lung function. However, a haplotype composed of the -509 C and codon 10 T alleles along with the C allele of the 3' SNP rs8179181 was highly associated with increased lung function in patients grouped by CFTR genotype. These results demonstrate that TGFB1 is a modifier of CF lung disease and reveal a previously unrecognized beneficial effect of TGFB1 variants upon the pulmonary phenotype.

  18. Haplotype identification and detection of mitochondrial DNA heteroplasmy in Varroa destructor mites using ARMS and PCR-RFLP methods.

    Science.gov (United States)

    Gajić, Bojan; Stevanović, Jevrosima; Radulović, Željko; Kulišić, Zoran; Vejnović, Branislav; Glavinić, Uroš; Stanimirović, Zoran

    2016-11-01

    In the present study, amplification refractory mutation system (ARMS) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were used for identification of recently described Serbia 1 (S1) and Peshter 1 (P1) mitochondrial haplotypes of Varroa destructor. Based on single nucleotide polymorphisms (SNPs) within cytochrome oxidase 1 (cox1) and cytochrome b (cytb) gene sequences, a total of 64 adult V. destructor females were analyzed from locations where the S1 and P1 haplotypes had been detected previously. Results of haplotype identification obtained by ARMS and PCR-RFLP methods were completely consistent with the sequencing data. Furthermore, in some analyzed samples the occurrence of site heteroplasmy at haplotype-defining sites was detected, as it was confirmed by double peaks in the sequence chromatograms. Neither mites with simultaneous nucleotide variability, nor those with combined SNP and heteroplasmy in cox1 and cytb were found. Given that this is the first occurrence of site heteroplasmy in V. destructor, the origin of this phenomenon and possible specific traits of heteroplasmic mites have yet to be determined.

  19. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  20. Two Orangutan Species Have Evolved DifferentKIRAlleles and Haplotypes.

    Science.gov (United States)

    Guethlein, Lisbeth A; Norman, Paul J; Heijmans, Corinne M C; de Groot, Natasja G; Hilton, Hugo G; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E; Parham, Peter

    2017-04-15

    The immune and reproductive functions of human NK cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell Ig-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping, and data mining from the Great Ape Genome Project, we characterized the KIR alleles and haplotypes for panels of 10 Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between 5 and 10 KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean specific, one is Sumatran specific, and five are shared. Of 12 KIR gene-content haplotypes, 5 are Bornean specific, 5 are Sumatran specific, and 2 are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean specific, 65 are Sumatran specific, and 10 are shared. Copyright © 2017 by The American Association of Immunologists, Inc.

  1. PP130. ENOS tagging SNP haplotypes in hypertensive disorders of pregnancy.

    Science.gov (United States)

    Sandrim, V; Muniz, L; Luizon, M; Palei, A C; Lacchini, R; Duarte, G; Cavalli, R; Tanus-Santos, J E

    2012-07-01

    Haplotypes formed by polymorphisms (T-786C, rs2070744; a variable number of tandem repeats in intron 4, and Glu298Asp, rs1799983) of eNOS gene were associated previously with gestational hypertension (GH) and preeclampsia (PE). However, no study has explored the tagging SNPs rs743506 and rs7830 in these disorders. The aim of the current study was to compare the distribution of the genotypes and haplotypes formed by the two tagging SNPs or by the five eNOS polymorphisms mentioned among healthy pregnant GH and PE. We recruited 122 HP, 138 GH and 157 PE. Genotypes for the T-786C, the Glu298Asp and rs743506 polymorphisms were determined by Taqmanâ Allele Discrimination assays and fluorescence signals were measured on Chromo 4 Detector (Bio-Rad Laboratories, USA). Genotypes for the VNTR polymorphism in intron 4 and rs7830, however, were determined by PCR and fragment separation by electrophoresis in 8% polyacrylamide gels. Plasma aliquots were analyzed in triplicate for their nitrite content using an ozone-based chemiluminescence assay. The haplotype formed by the most common variants in each polymorphism "T b G A C" was more frequent in PE group compared to HP (P=0.00004), which may be explained by the higher linkage disequilibrium found in PE compared to GH and HP. Conversely, the haplotype "C b G G C" was more frequent in HP compared to PE (P=0.00113), which is supported by previous findings that demonstrated the association of the combination "C b G" with higher level of nitrite (NO marker). Our results suggest a protective effect of the haplotype "C b G G C" against the development of PE. This study was funded by the Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG-Brazil), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP-Brazil). Copyright © 2012. Published by Elsevier B.V.

  2. HLA-G 3' UTR haplotypes and HIV vertical transmission.

    Science.gov (United States)

    Segat, Ludovica; Catamo, Eulalia; Fabris, Annalisa; Padovan, Lara; Morgutti, Marcello; Crovella, Sergio

    2009-09-10

    We evaluated the possible association of human leukocyte antigen-G (HLA-G) 3777G>C and 14-bp deletion/insertion (D/I) polymorphisms haplotypes and combined genotypes with perinatal HIV transmission in Brazilian children. The 3777G>C polymorphism alone has no effect on HIV vertical transmission but, when linked with the D allele, exerts a positive role in the protection. Indeed, we identified the DC HLA-G haplotype as significantly associated with a protective effect towards HIV vertical transmission.

  3. R&D for a single-layer $Nb_{3}Sn$ common coil dipole using the react-and-wind fabrication technique

    CERN Document Server

    Ambrosio, G; Barzi, E; Bauer, P; Chichili, D R; Ewald, K D; Fehér, S; Imbasciati, L; Kashikhin, V V; Limon, P J; Litvinenko, L; Novitski, I; Rey, J M; Scanlan, R M; Yadav, S; Yamada, R; Zlobin, A V

    2002-01-01

    A dipole magnet based on the common coil design, using prereacted Nb /sub 3/Sn superconductor, is under development at Fermilab, for a future Very Large Hadron Collider. This magnet has some innovative design and technological features such as single layer coils, a 22 mm wide 60-strand Rutherford type cable and stainless steel collars reinforced by horizontal bridges inserted between coil blocks. Both left and right coils are wound simultaneously into the collar structure and then impregnated with epoxy. In order to optimize the design and fabrication techniques an R&D program is underway. The production of cables with the required characteristics was shown possible. Collar laminations were produced, assembled and tested in order to check the effectiveness of the bridges and the validity of the mechanical design. A mechanical model consisting in a 165 mm long section of the magnet straight section was assembled and tested. This paper summarizes the status of the program, and reports the results of fabrica...

  4. Common crystalline and magnetic structure of superconducting A2Fe4Se5 (A=K,Rb,Cs,Tl) single crystals measured using neutron diffraction.

    Science.gov (United States)

    Ye, F; Chi, S; Bao, Wei; Wang, X F; Ying, J J; Chen, X H; Wang, H D; Dong, C H; Fang, Minghu

    2011-09-23

    Single-crystal neutron diffraction studies on superconductors A(2)Fe(4)Se(5), where A=Rb, Cs, (Tl, Rb), and (Tl, K) (T(c) ∼ 30 K), uncover the same Fe vacancy ordered crystal structure and the same block antiferromagnetic order as in K(2)Fe(4)Se(5). The Fe order-disorder transition occurs at T(S)=500-578 K, and the antiferromagnetic transition at T(N) = 471-559 K with an ordered magnetic moment ∼3.3μ(B)/Fe at 10 K. Thus, all recently discovered A intercalated iron selenide superconductors share the common crystalline and magnetic structure, which are very different from previous families of Fe-based superconductors, and constitute a distinct new 245 family.

  5. Molecular characterization of a long range haplotype affecting protein yield and mastitis susceptibility in Norwegian Red cattle

    Directory of Open Access Journals (Sweden)

    Hayes Ben J

    2011-08-01

    Full Text Available Abstract Background Previous fine mapping studies in Norwegian Red cattle (NRC in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6 has revealed a quantitative trait locus (QTL for protein yield (PY around 88 Mb and a QTL for clinical mastitis (CM around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Results Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and αS2-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of

  6. Comparison of Single-Layer and Double-Layer Anti-Reflection Coatings Using Laser-Induced Damage Threshold and Photothermal Common-Path Interferometry

    Directory of Open Access Journals (Sweden)

    Caspar Clark

    2016-05-01

    Full Text Available The dielectric thin-film coating on high-power optical components is often the weakest region and will fail at elevated optical fluences. A comparison of single-layer coatings of ZrO2, LiF, Ta2O5, SiN, and SiO2 along with anti-reflection (AR coatings optimized at 1064 nm comprised of ZrO2 and Ta2O5 was made, and the results of photothermal common-path interferometry (PCI and a laser-induced damage threshold (LIDT are presented here. The coatings were grown by radio frequency (RF sputtering, pulsed direct-current (DC sputtering, ion-assisted electron beam evaporation (IAD, and thermal evaporation. Test regimes for LIDT used pulse durations of 9.6 ns at 100 Hz for 1000-on-1 and 1-on-1 regimes at 1064 nm for single-layer and AR coatings, and 20 ns at 20 Hz for a 200-on-1 regime to compare the //ZrO2/SiO2 AR coating.

  7. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees

    Science.gov (United States)

    Schöning, Caspar

    2017-01-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163

  8. Genome patterns of selection and introgression of haplotypes in natural populations of the house mouse (Mus musculus.

    Directory of Open Access Journals (Sweden)

    Fabian Staubach

    Full Text Available General parameters of selection, such as the frequency and strength of positive selection in natural populations or the role of introgression, are still insufficiently understood. The house mouse (Mus musculus is a particularly well-suited model system to approach such questions, since it has a defined history of splits into subspecies and populations and since extensive genome information is available. We have used high-density single-nucleotide polymorphism (SNP typing arrays to assess genomic patterns of positive selection and introgression of alleles in two natural populations of each of the subspecies M. m. domesticus and M. m. musculus. Applying different statistical procedures, we find a large number of regions subject to apparent selective sweeps, indicating frequent positive selection on rare alleles or novel mutations. Genes in the regions include well-studied imprinted loci (e.g. Plagl1/Zac1, homologues of human genes involved in adaptations (e.g. alpha-amylase genes or in genetic diseases (e.g. Huntingtin and Parkin. Haplotype matching between the two subspecies reveals a large number of haplotypes that show patterns of introgression from specific populations of the respective other subspecies, with at least 10% of the genome being affected by partial or full introgression. Using neutral simulations for comparison, we find that the size and the fraction of introgressed haplotypes are not compatible with a pure migration or incomplete lineage sorting model. Hence, it appears that introgressed haplotypes can rise in frequency due to positive selection and thus can contribute to the adaptive genomic landscape of natural populations. Our data support the notion that natural genomes are subject to complex adaptive processes, including the introgression of haplotypes from other differentiated populations or species at a larger scale than previously assumed for animals. This implies that some of the admixture found in inbred strains of mice

  9. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees.

    Science.gov (United States)

    Wallberg, Andreas; Schöning, Caspar; Webster, Matthew T; Hasselmann, Martin

    2017-05-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies.

  10. Linkage Disequilibrium Decay and Haplotype Block Structure in the Pig

    NARCIS (Netherlands)

    Amaral, A.J.; Megens, H.J.W.C.; Crooijmans, R.P.M.A.; Heuven, H.C.M.; Groenen, M.A.M.

    2008-01-01

    Linkage disequilibrium (LD) may reveal much about domestication and breed history. Ail investigation was conducted, to analyze the extent of LD, haploblock partitioning, and haplotype diversity within haploblocks across several pig breeds from China and Europe and in European wild boar. In total,

  11. Geographical distribution of a specific mitochondrial haplotype of Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Sameh BOUKEF

    2014-01-01

    Full Text Available Severity of disease caused by the fungus Zymoseptoria tritici throughout world cereal growing regions has elicited much debate on the potential evolutionary mechanism conferring high adaptability of the pathogen to diverse climate conditions and different wheat hosts (Triticum durum and T. aestivum. Specific mitochondrial DNA sequence was used to investigate geographic distribution of the type 4 haplotype (mtRFLP4 within 1363 isolates of Z. tritici originating from 21 countries. The mtRFLP4 haplotype was detected from both durum and bread wheat hosts with greater frequency on durum wheat. The distribution of mtRFLP4 was limited to populations sampled from the Mediterranean and the Red Sea region. Greater frequencies of mtRFLP4 were found in Tunisia (87% and Algeria (60%. The haplotype was absent within European, Australian, North and South American populations except Argentina. While alternative hypotheses such as climatic adaptation could not be ruled out, it is postulated that mtRFLP4 originated in North Africa (e.g. Tunisia or Algeria as an adaptation to durum wheat as the prevailing cereal crop. The specialized haplotype has subsequently spread as indicated by lower frequency of occurrence in the surrounding Mediterranean countries and on bread wheat hosts.

  12. Association of specific haplotype of TNFα with Helicobacter pylori ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 87; Issue 3. Association of specific haplotype of TNF with Helicobacter pylori-mediated duodenal ulcer in eastern Indian population. Meenakshi Chakravorty Dipanjana Datta De Abhijit Choudhury Amal Santra Susanta Roychoudhury. Research Note Volume 87 Issue 3 ...

  13. Genetics of chloroquine-resistant malaria: a haplotypic view

    Directory of Open Access Journals (Sweden)

    Gauri Awasthi

    2013-12-01

    Full Text Available The development and rapid spread of chloroquine resistance (CQR in Plasmodium falciparum have triggered the identification of several genetic target(s in the P. falciparum genome. In particular, mutations in the Pfcrt gene, specifically, K76T and mutations in three other amino acids in the region adjoining K76 (residues 72, 74, 75 and 76, are considered to be highly related to CQR. These various mutations form several different haplotypes and Pfcrt gene polymorphisms and the global distribution of the different CQR- Pfcrt haplotypes in endemic and non-endemic regions of P. falciparum malaria have been the subject of extensive study. Despite the fact that the Pfcrt gene is considered to be the primary CQR gene in P. falciparum , several studies have suggested that this may not be the case. Furthermore, there is a poor correlation between the evolutionary implications of the Pfcrt haplotypes and the inferred migration of CQR P. falciparum based on CQR epidemiological surveillance data. The present paper aims to clarify the existing knowledge on the genetic basis of the different CQR- Pfcrt haplotypes that are prevalent in worldwide populations based on the published literature and to analyse the data to generate hypotheses on the genetics and evolution of CQR malaria.

  14. Haplotype combination of the bovine PCSK1 gene sequence ...

    Indian Academy of Sciences (India)

    Haplotype combination of the bovine PCSK1 gene sequence variants and association with growth traits in Jiaxian cattle. JIAJIE SUN1,2, LIMIN SHAN2, CHUNLEI ZHANG2 and HONG CHEN1∗. 1College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology.

  15. Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.

    Science.gov (United States)

    Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem

    2017-02-01

    Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (pinformation processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (pinformation processing. This moderating effect may depend on the novelty of the situation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. IL6 and CRP haplotypes are associated with COPD risk and systemic inflammation: a case-control study

    Directory of Open Access Journals (Sweden)

    Passos Valéria

    2009-03-01

    Full Text Available Abstract Background Elevated circulating levels of C-reactive protein (CRP, interleukin (IL-6 and fibrinogen (FG have been repeatedly associated with many adverse outcomes in patients with chronic obstructive pulmonary disease (COPD. To date, it remains unclear whether and to what extent systemic inflammation is primary or secondary in the pathogenesis of COPD. The aim of this study was to examine the association between haplotypes of CRP, IL6 and FGB genes, systemic inflammation, COPD risk and COPD-related phenotypes (respiratory impairment, exercise capacity and body composition. Methods Eighteen SNPs in three genes, representing optimal haplotype-tagging sets, were genotyped in 355 COPD patients and 195 healthy smokers. Plasma levels of CRP, IL-6 and FG were measured in the total study group. Differences in haplotype distributions were tested using the global and haplotype-specific statistics. Results Raised plasma levels of CRP, IL-6 and fibrinogen were demonstrated in COPD patients. However, COPD population was very heterogeneous: about 40% of patients had no evidence of systemic inflammation (CRP CRP gene and CRP plasma levels (P = 0.0004 and IL6 gene and COPD (P = 0.003. Subsequent analysis has shown that IL6 haplotype H2, associated with an increased COPD risk (p = 0.004, OR = 4.82; 1.64 to 4.18, was also associated with very low CRP levels (p = 0.0005. None of the genes were associated with COPD-related phenotypes. Conclusion Our findings suggest that common genetic variation in CRP and IL6 genes may contribute to heterogeneity of COPD population associated with systemic inflammation.

  17. HLA-B14 subtyping by semi-nested PCR-SSP and haplotype distribution in a Spanish population.

    Science.gov (United States)

    Santos, S; Balas, A; Lillo, R; Garcia-Sanchez, F; Merino, J L; Vicario, J L

    1997-12-01

    HLA-B14 serological subtyping is very limited probably due to the internal position of the unique amino acid residue that differentiates B64 and B65 molecules. In order to carry out an accurate B14 subtyping we have designed a semi-nested PCR-SSP procedure that can differentiate B*1401 and B*1402 in any HLA-A, -B or -C antigen combination. A panel of 133 B14-positive and 31 B14-negative healthy and unrelated Spanish individuals were studied. Additionally, 45 B14-bearing haplotypes (-A,-B,-C,-DRB1,-DRB3/DRB4/DRB5,-DQA1,- DQB1) were available through family studies. The relative frequencies of HLA-B14 subtypes were 74% for B*1402 and 26% for B*1401, in agreement with those found in other Central European populations, but differing from those in Wales, where the relative presence of B64 goes to 41%. A total of 11/17 and 18/28 different haplotypes for B*1401 and B*1402, respectively, were identified. Both alleles showed the strongest association to Cw8 (43/45), indicating a primary ancestral B14-Cw8 association. However, B14 subtypes evidenced very distinguishable haplotype distributions. B*1401 is strongly associated with the common HLA class II haplotype DRB1*0701-DQA1*0201-DQB1*02 (13/17), while B*1402 is mainly associated to DRB1*0102 (16/28). Three major haplotypes were identified: A32-Cw8-B*1401-DR7-DQ2 (5/17), A33-Cw8-B*1402-DRB1*0102-DQ5 (5/28) and A2-Cw8-B*1402-DRB1*0102-DQ5 (5/28).

  18. RET variants and haplotype analysis in a cohort of Czech patients with Hirschsprung disease.

    Directory of Open Access Journals (Sweden)

    Eliska Vaclavikova

    Full Text Available Hirschsprung disease (HSCR is a congenital aganglionosis of myenteric and submucosal plexuses in variable length of the intestine. This study investigated the influence and a possible modifying function of RET proto-oncogene's single nucleotide polymorphisms (SNPs and haplotypes in the development and phenotype of the disease in Czech patients. Genotyping of 14 SNPs was performed using TaqMan Genotyping Assays and direct sequencing. The frequencies of SNPs and generated haplotypes were statistically evaluated using chi-square test and the association with the risk of HSCR was estimated by odds ratio. SNP analysis revealed significant differences in frequencies of 11 polymorphic RET variants between 162 HSCR patients and 205 unaffected controls. Particularly variant alleles of rs1864410, rs2435357, rs2506004 (intron 1, rs1800858 (exon 2, rs1800861 (exon 13, and rs2565200 (intron 19 were strongly associated with increased risk of HSCR (p<0.00000 and were over-represented in males vs. females. Conversely, variant alleles of rs1800860, rs1799939 and rs1800863 (exons 7, 11, 15 had a protective role. The haploblock comprising variants in intron 1 and exon 2 was constructed. It represented a high risk of HSCR, however, the influence of other variants was also found after pruning from effect of this haploblock. Clustering patients according to genotype status in haploblock revealed a strong co-segregation with several SNPs and pointed out the differences between long and short form of HSCR. This study involved a large number of SNPs along the entire RET proto-oncogene with demonstration of their risk/protective role also in haplotype and diplotype analysis in the Czech population. The influence of some variant alleles on the aggressiveness of the disease and their role in gender manifestation differences was found. These data contribute to worldwide knowledge of the genetics of HSCR.

  19. Worldwide genealogy of Entamoeba histolytica: an overview to understand haplotype distribution and infection outcome.

    Science.gov (United States)

    Zermeño, Valeria; Ximénez, Cecilia; Morán, Patricia; Valadez, Alicia; Valenzuela, Olivia; Rascón, Edgar; Diaz, Daniel; Cerritos, René

    2013-07-01

    Although Entamoeba histolytica is one of the most prevalent intestinal parasites, how the different strains of this species are distributed all over the world and how different genotypes are associated with the infection outcome are yet to be fully understood. Recently, the use of a number of molecular markers has made the characterization of several genotypes in those regions with high incidence of amoebiasis possible. This work proposes the first genealogy of E. histolytica, with an haplotype network based on two tRNA gene-linked array of Short Tandem Repeats (STRs) reported until today, and 47 sequences from 39 new isolates of Mexican Amoebic Liver Abscesses (ALA) samples. One hundred and three sequences were obtained from D-A locus, their information about the geographic region of isolation as well as clinical diagnosis were also collected. One hundred and five sequences from N-K2 locus were also obtained as well as the region of isolation, but the information about clinical diagnosis was not available in all cases. The most abundant and widely distributed haplotype in the world is the one of E. histolytica HM1:IMSS strain. This was found in Mexico, Bangladesh, Japan, China and USA and is associated to symptomatic patients as well as asymptomatic cyst passers. Many other haplotypes were found only in a single country. Both genealogies suggest that there are no lineages within the networks that may be related to a particular geographic region or infection outcome. A concatenated analysis of the two molecular markers revealed 12 different combinations, which suggests the possibility of genetic recombination events. The present study is the first to propose a global genealogy of this species and suggests that there are still many genotypes to be discovered. The genotyping of new isolates will help to understand the great diversity and genetic structure of this parasite. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops

    Directory of Open Access Journals (Sweden)

    Lunwen Qian

    2017-09-01

    Full Text Available In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP–trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately

  1. The 8.1 ancestral MHC haplotype is strongly associated with colorectal cancer risk.

    Science.gov (United States)

    Tóth, Eva Katalin; Kocsis, Judit; Madaras, Balázs; Bíró, Adrienn; Pocsai, Zsuzsa; Fust, George; Blaskó, Bernadett; Karádi, István; Adány, Róza; Laki, Judit

    2007-10-15

    Many recent data indicate that some alleles encoded in the central major histocompatibility complex (MHC) region (Class III) of short arm of chromosome 6 may modify the risk of cancer development. Therefore we determined 4 single nucleotide polymorphisms (SNPs) of this region (TNF-alpha -308 G > A, RAGE -429 T > C, HSP70-2 -1267 A > G, LTA 252 A > G) in genomic DNA samples from 183 Hungarian patients with colorectal cancer and 141 age matched control subjects representing the Hungarian population of the same age and gender. No significant differences were found in either SNP tested. When, however, three- or four-locus haplotypes consisting of known constituents of the so-called 8.1 ancestral haplotype (8.1AH) were considered, marked differences were observed. Frequency of TNF-alpha -308A, RAGE -429C, HSP70-2 -1267G, LTA 252G (8.1AH) haplotype was significantly (p = 0.006) more frequent (19.1%) among patients than in the controls (7.7%). Age- and gender-adjusted ratio of the 8.1AH carriers vs. non-carriers to have colorectal cancer was 2.514 (1.130-5.594). This risk was higher in cancer-indicate that carriers of the 8.1AH, encoding for an altered immune response and known to be associated with alterations of several immune functions and autoimmune diseases have an increased risk for some cancer types. These findings may contribute to better understanding how the defense mechanisms against tumors could be enhanced/strengthened. (c) 2007 Wiley-Liss, Inc.

  2. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    Science.gov (United States)

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A

  3. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana

    Directory of Open Access Journals (Sweden)

    Miller Robert NG

    2010-07-01

    Full Text Available Abstract Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp., two diploid wild species Musa acuminata (A genome and Musa balbisiana (B genome contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW. Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year

  4. Long term outcome of cavotricuspid isthmus cryoablation for the treatment of common atrial flutter in 180 patients: a single center experience.

    Science.gov (United States)

    Moreira, Wendel; Timmermans, Carl; Wellens, Hein J J; Mizusawa, Yuka; Perez, David; Philippens, Suzanne; Rodriguez, Luz-Maria

    2008-04-01

    Recent literature has shown that common type atrial flutter (AFL) can recur late after cavotricuspid isthmus (CTI) catheter ablation using radiofrequency energy (RF). We report the long term outcome of a large group of patients undergoing CTI ablation using cryothermy for AFL in a single center. Patients with AFL referred for CTI ablation were recruited prospectively from July 2001 to July 2006. Cryoablation was performed using a deflectable, 10.5 F, 6.5 mm tip catheter. CTI block was reassessed 30 min after the last application during isoproterenol infusion. Recurrences were evaluated by 12-lead ECG and 24 h Holter recording every clinic visit (1/3/6/9 and 12 months after the procedure and yearly thereafter) or if symptoms developed. The 180 enrolled patients had the following characteristics: 39 women (22%), mean age 58 years, no structural heart disease in 86 patients (48%), mean left atrium diameter 44+/-7 mm and mean left ventricular ejection fraction 57+/-7%. The average number of applications per patient was 7 (3 to 20) with a mean temperature and duration of -88 degrees C and 3 min, respectively. Acute success was achieved in 95% (171) of the patients. There were no complications. After a mean follow-up of 27+/-17 (from 12 to 60) months, the chronic success rate was 91%. The majority of the recurrences occurred within the first year post ablation. One hundred and twenty three patients had a history of atrial fibrillation (AF) prior to CTI ablation and 85 (69%) of those remained having AF after cryoablation. In 20 of 57 (35%) patients without a history of AF prior to CTI ablation, AF occurred during follow-up. This prospective study showed a 91% chronic success rate (range 12 to 60 months) for cryoablation of the CTI in patients with common type AFL and ratified the frequent association of AF with AFL.

  5. Novel Single Nucleotide Polymorphisms of the Insulin-Like Growth Factor-I Gene and Their Associations with Growth Traits in Common Carp (Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Xiu Feng

    2014-12-01

    Full Text Available Insulin-like growth factor-I (IGF-I plays an important role in the growth and development of vertebrates. To study polymorphisms of IGF-I, we screened a total of 4555 bp of genomic sequences in four exons and partial introns for the discovery of single nucleotide polymorphism (SNP in common carp (Cyprinus carpio. Three SNPs (g.3759T>G, g.7627T>A and g.7722T>C in intron 2 and a nonsynonymous SNP (g.7892C>T in exon 3 were identified in a pilot population including random parents and their progenies. 289 progenies were further genotyped for studying possible associations between genotypes or combined genotypes and growth traits. The results showed that the locus g.7627T>A was significantly associated with body weight and body length, and fish with genotype AA had a mean body weight 5.9% higher than those with genotype TT. No significant associations were observed between genotypes of other loci and growth traits. However, when both g.7627T>A and g.7722T>C were considered, the combined genotype TT/TT was extremely associated with the lowest values of body length and body weight and the highest K value in comparison with other diplotypes (p < 0.01. These results suggest that genotype AA at g.7627T>A and its combined genotypes with alleles from another locus have positive effects on growth traits, which would be a candidate molecular marker for further studies in marker-assisted selection in common carp.

  6. MHC haplotype diversity in Persian Arabian horses determined using polymorphic microsatellites.

    Science.gov (United States)

    Sadeghi, R; Moradi-Shahrbabak, Mohammad; Miraei Ashtiani, S R; Miller, D C; Antczak, Douglas F

    2017-11-23

    Previous research on the equine major histocompatibility complex (MHC) demonstrated strong correlations between haplotypes defined by polymorphic intra-MHC microsatellites and haplotypes defined using classical serology. Here, we estimated MHC diversity in a sample of 124 Arabian horses from an endangered strain native to Iran (Persian Asil Arabians), using a validated 10-marker microsatellite panel. In a group of 66 horses related as parent-offspring pairs or half-sibling groups, we defined 51 MHC haplotypes, 49 of which were new. In 47 of the remaining 58 unrelated horses, we could assign one previously identified MHC haplotype, and by default, we gave provisional haplotype status to the remaining constellation of microsatellite alleles. In these horses, we found 21 haplotypes that we had previously defined and 31 provisional haplotypes, two of which had been identified in an earlier study. This gave a total of 78 new MHC haplotypes. The final 11 horses were MHC heterozygotes that we could not phase using information from any of the previously validated or provisional haplotypes. However, we could determine that these horses carried a total of 22 different undefined haplotypes. In the overall population sample, we detected three homozygous horses and one maternally inherited recombinant from 21 informative segregations. Virtually all of the horses tested were MHC heterozygotes, and most unrelated horses (98%) were heterozygous for rare microsatellite-defined haplotypes found less than three times in the sampled horses. This is evidence for a very high level of MHC haplotype variation in the Persian Asil Arabian horse.

  7. Development of a Y-STR 12-plex PCR system and haplotype ...

    Indian Academy of Sciences (India)

    A Y-chromosomal short tandem repeat (Y-STR) dodecaplex. PCR system for 12 loci has been developed, and using this system allele frequencies and haplotypes were determined in a Korean male population. From a study of 320 unre- lated Korean males, 254 different haplotypes were identi- fied. The haplotype diversity ...

  8. snp.plotter: an R-based SNP/haplotype association and linkage disequilibrium plotting package.

    Science.gov (United States)

    Luna, Augustin; Nicodemus, Kristin K

    2007-03-15

    snp.plotter is a newly developed R package which produces high-quality plots of results from genetic association studies. The main features of the package include options to display a linkage disequilibrium (LD) plot below the P-value plot using either the r2 or D' LD metric, to set the X-axis to equal spacing or to use the physical map of markers, and to specify plot labels, colors, symbols and LD heatmap color scheme. snp.plotter can plot single SNP and/or haplotype data and simultaneously plot multiple sets of results. R is a free software environment for statistical computing and graphics available for most platforms. The proposed package provides a simple way to convey both association and LD information in a single appealing graphic for genetic association studies. Downloadable R package and example datasets are available at http://cbdb.nimh.nih.gov/~kristin/snp.plotter.html and http://www.r-project.org.

  9. R and D for a single-layer Nb3Sn common coil dipole using the react-and-wind fabrication technique

    International Nuclear Information System (INIS)

    Ambrosio, Giorgio

    2002-01-01

    A dipole magnet based on the common coil design, using prereacted Nb 3 Sn superconductor, is under development at Fermilab, for a future Very Large Hadron Collider. This magnet has some innovative design and technological features such as single layer coils, a 22 mm wide 60-strand Rutherford type cable and stainless steel collars reinforced by horizontal bridges inserted between coil blocks. Both left and right coils are wound simultaneously into the collar structure and then impregnated with epoxy. In order to optimize the design and fabrication techniques an R and D program is underway. The production of cables with the required characteristics was shown possible. Collar laminations were produced, assembled and tested in order to check the effectiveness of the bridges and the validity of the mechanical design. A mechanical model consisting of a 165 mm long section of the magnet straight section was assembled and tested. This paper summarizes the status of the program, and reports the results of fabrication and test of cable, collars and the mechanical model

  10. ParaHaplo 3.0: A program package for imputation and a haplotype-based whole-genome association study using hybrid parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2011-05-01

    Full Text Available Abstract Background Use of missing genotype imputations and haplotype reconstructions are valuable in genome-wide association studies (GWASs. By modeling the patterns of linkage disequilibrium in a reference panel, genotypes not directly measured in the study samples can be imputed and used for GWASs. Since millions of single nucleotide polymorphisms need to be imputed in a GWAS, faster methods for genotype imputation and haplotype reconstruction are required. Results We developed a program package for parallel computation of genotype imputation and haplotype reconstruction. Our program package, ParaHaplo 3.0, is intended for use in workstation clusters using the Intel Message Passing Interface. We compared the performance of ParaHaplo 3.0 on the Japanese in Tokyo, Japan and Han Chinese in Beijing, and Chinese in the HapMap dataset. A parallel version of ParaHaplo 3.0 can conduct genotype imputation 20 times faster than a non-parallel version of ParaHaplo. Conclusions ParaHaplo 3.0 is an invaluable tool for conducting haplotype-based GWASs. The need for faster genotype imputation and haplotype reconstruction using parallel computing will become increasingly important as the data sizes of such projects continue to increase. ParaHaplo executable binaries and program sources are available at http://en.sourceforge.jp/projects/parallelgwas/releases/.

  11. Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qian-fei; Liu, Xin; O' Connell, Jeff; Peng, Ze; Krauss, Ronald M.; Rainwater, David L.; VandeBerg, John L.; Rubin, Edward M.; Cheng, Jan-Fang; Pennacchio, Len A.

    2003-09-15

    Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent with haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.

  12. Haplotype-based case-control study between human apurinic/apyrimidinic endonuclease 1/redox effector factor-1 gene and cerebral infarction.

    Science.gov (United States)

    Naganuma, Takahiro; Nakayama, Tomohiro; Sato, Naoyuki; Fu, Zhenyan; Yamaguchi, Mai; Soma, Masayoshi; Aoi, Noriko; Usami, Ron; Doba, Nobutaka; Hinohara, Shigeaki

    2009-10-01

    The aim of this study was to investigate the relationship between cerebral infarction (CI) and the human apurinic/apyrimidinic endonuclease 1/redox effector factor-1 (APE1/REF-1) gene using single-nucleotide polymorphisms (SNPs) and a haplotype-based case-control study. We selected 5 SNPs in the human APE1/REF1 gene (rs1760944, rs3136814, rs17111967, rs3136817 and rs1130409), and performed case-control studies in 177 CI patients and 309 control subjects. rs17111967 was found to have no heterogeneity in Japanese. The overall distribution of the haplotype-based case-control study constructed by rs1760944, rs3136814 and rs1130409 showed a significant difference. The frequency of the G-C-T haplotype was significantly higher in the CI group than in the control group (2.5% vs. 0.0%, p>0.001). Based on the results of the haplotype-based case-control-study, the G-C-T haplotype may be a genetic marker of CI, and the APE1/REF-1 gene may be a CI susceptibility gene.

  13. Risk of Pediatric Celiac Disease According to HLA Haplotype and Country

    Science.gov (United States)

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A.; Hagopian, William A.; Koletzko, Sibylle; Rewers, Marian J.; Eisenbarth, George S.; Bingley, Polly J.; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-01-01

    BACKGROUND The presence of HLA haplotype DR3–DQ2 or DR4–DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). METHODS We studied 6403 children with HLA haplotype DR3–DQ2 or DR4–DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. RESULTS The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3–DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3–DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4–DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). CONCLUSIONS Children with the HLA haplotype DR3–DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries

  14. The systemic lupus erythematosus IRF5 risk haplotype is associated with systemic sclerosis.

    Directory of Open Access Journals (Sweden)

    F David Carmona

    Full Text Available Systemic sclerosis (SSc is a fibrotic autoimmune disease in which the genetic component plays an important role. One of the strongest SSc association signals outside the human leukocyte antigen (HLA region corresponds to interferon (IFN regulatory factor 5 (IRF5, a major regulator of the type I IFN pathway. In this study we aimed to evaluate whether three different haplotypic blocks within this locus, which have been shown to alter the protein function influencing systemic lupus erythematosus (SLE susceptibility, are involved in SSc susceptibility and clinical phenotypes. For that purpose, we genotyped one representative single-nucleotide polymorphism (SNP of each block (rs10488631, rs2004640, and rs4728142 in a total of 3,361 SSc patients and 4,012 unaffected controls of Caucasian origin from Spain, Germany, The Netherlands, Italy and United Kingdom. A meta-analysis of the allele frequencies was performed to analyse the overall effect of these IRF5 genetic variants on SSc. Allelic combination and dependency tests were also carried out. The three SNPs showed strong associations with the global disease (rs4728142: P  = 1.34×10(-8, OR  = 1.22, CI 95%  = 1.14-1.30; rs2004640: P  = 4.60×10(-7, OR  = 0.84, CI 95%  = 0.78-0.90; rs10488631: P  = 7.53×10(-20, OR  = 1.63, CI 95%  = 1.47-1.81. However, the association of rs2004640 with SSc was not independent of rs4728142 (conditioned P  = 0.598. The haplotype containing the risk alleles (rs4728142*A-rs2004640*T-rs10488631*C: P  = 9.04×10(-22, OR  = 1.75, CI 95%  = 1.56-1.97 better explained the observed association (likelihood P-value  = 1.48×10(-4, suggesting an additive effect of the three haplotypic blocks. No statistical significance was observed in the comparisons amongst SSc patients with and without the main clinical characteristics. Our data clearly indicate that the SLE risk haplotype also influences SSc predisposition, and that this

  15. The Systemic Lupus Erythematosus IRF5 Risk Haplotype Is Associated with Systemic Sclerosis

    Science.gov (United States)

    Beretta, Lorenzo; Simeón, Carmen P.; Carreira, Patricia E.; Callejas, José Luis; Fernández-Castro, Mónica; Sáez-Comet, Luis; Beltrán, Emma; Camps, María Teresa; Egurbide, María Victoria; Airó, Paolo; Scorza, Raffaella; Lunardi, Claudio; Hunzelmann, Nicolas; Riemekasten, Gabriela; Witte, Torsten; Kreuter, Alexander; Distler, Jörg H. W.; Madhok, Rajan; Shiels, Paul; van Laar, Jacob M.; Fonseca, Carmen; Denton, Christopher; Herrick, Ariane; Worthington, Jane; Schuerwegh, Annemie J.; Vonk, Madelon C.; Voskuyl, Alexandre E.; Radstake, Timothy R. D. J.; Martín, Javier

    2013-01-01

    Systemic sclerosis (SSc) is a fibrotic autoimmune disease in which the genetic component plays an important role. One of the strongest SSc association signals outside the human leukocyte antigen (HLA) region corresponds to interferon (IFN) regulatory factor 5 (IRF5), a major regulator of the type I IFN pathway. In this study we aimed to evaluate whether three different haplotypic blocks within this locus, which have been shown to alter the protein function influencing systemic lupus erythematosus (SLE) susceptibility, are involved in SSc susceptibility and clinical phenotypes. For that purpose, we genotyped one representative single-nucleotide polymorphism (SNP) of each block (rs10488631, rs2004640, and rs4728142) in a total of 3,361 SSc patients and 4,012 unaffected controls of Caucasian origin from Spain, Germany, The Netherlands, Italy and United Kingdom. A meta-analysis of the allele frequencies was performed to analyse the overall effect of these IRF5 genetic variants on SSc. Allelic combination and dependency tests were also carried out. The three SNPs showed strong associations with the global disease (rs4728142: P  = 1.34×10−8, OR  = 1.22, CI 95%  = 1.14–1.30; rs2004640: P  = 4.60×10−7, OR  = 0.84, CI 95%  = 0.78–0.90; rs10488631: P  = 7.53×10−20, OR  = 1.63, CI 95%  = 1.47–1.81). However, the association of rs2004640 with SSc was not independent of rs4728142 (conditioned P  = 0.598). The haplotype containing the risk alleles (rs4728142*A-rs2004640*T-rs10488631*C: P  = 9.04×10−22, OR  = 1.75, CI 95%  = 1.56–1.97) better explained the observed association (likelihood P-value  = 1.48×10−4), suggesting an additive effect of the three haplotypic blocks. No statistical significance was observed in the comparisons amongst SSc patients with and without the main clinical characteristics. Our data clearly indicate that the SLE risk haplotype also influences SSc predisposition, and that

  16. Risk of pediatric celiac disease according to HLA haplotype and country.

    Science.gov (United States)

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A; Hagopian, William A; Koletzko, Sibylle; Rewers, Marian J; Eisenbarth, George S; Bingley, Polly J; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-07-03

    The presence of HLA haplotype DR3-DQ2 or DR4-DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). We studied 6403 children with HLA haplotype DR3-DQ2 or DR4-DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3-DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3-DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4-DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). Children with the HLA haplotype DR3-DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries highlights the importance of studying environmental

  17. High-resolution HLA-A, HLA-B, and HLA-DRB1 haplotype frequencies from the French Bone Marrow Donor Registry

    OpenAIRE

    Gourraud, PA; Pappas, DJ; Baouz, A; Balère, ML; Garnier, F; Marry, E

    2015-01-01

    © 2015 American Society for Histocompatibility and Immunogenetics. We have estimated human leukocyte antigen (HLA) haplotype frequencies using the maximum likelihood mode, which accommodates typing ambiguities. The results of the frequency distribution of the 7015 haplotypes obtained are presented here. These include a total of 114 HLA-A, 185 HLA-B, and 76 HLA-DRB1 unique alleles at each locus. Across all populations, although the most common individual HLA alleles were HLA-A * 02:01 (29.0%),...

  18. Maternal KIR haplotype influences live birth rate after double embryo transfer in IVF cycles in patients with recurrent miscarriages and implantation failure.

    Science.gov (United States)

    Alecsandru, D; Garrido, N; Vicario, J L; Barrio, A; Aparicio, P; Requena, A; García-Velasco, J A

    2014-12-01

    In patients with recurrent miscarriages (RM) or recurrent implantation failure (RIF), does the maternal killer immunoglobulin-like receptor (KIR) haplotype have an impact on live birth rates per cycle after embryo transfer with the patient's own or donated oocytes? After double embryo transfer (DET) in patients with the maternal KIR AA haplotype, a significantly increased early miscarriage rate was observed when the patient's own oocytes were used, and a significantly decreased live birth rate per cycle after embryo transfer was observed when donated oocytes were used. Interactions between fetal HLA-C and maternal KIR influence placentation during human pregnancy. There is an increased risk of RM, pre-eclampsia or fetal growth restriction in mothers with the KIR AA haplotype when the fetus has more HLA-C2 genes than the mother. Between 2010 and 2014, we performed a retrospective study that included 291 women, with RM or RIF, who had a total of 1304 assisted reproductive cycles. Pregnancy, miscarriage and live birth rates per cycle after single or DET, categorized by the origin of the oocytes and the presence of maternal KIR haplotypes, were studied. KIR haplotype regions were defined by the presence of the following KIR genes: Cen-A/2DL3; Tel-A/3DL1 and 2DS4; Cen-B/2DL2 and 2DS2; as well as Tel-B/2DS1 and 3DS1. Higher rates of early miscarriage per cycle after DET with the patient's own oocytes in mothers with the KIR AA haplotype (22.8%) followed by those with the KIR AB haplotype (16.7%) compared with mothers with the KIR BB haplotype (11.1%) were observed (P = 0.03). Significantly decreased live birth rates per cycle were observed after DET of donated oocytes in mothers with the KIR AA haplotype (7.5%) compared with those with the KIR AB (26.4%) and KIR BB (21.5%) haplotypes (P = 0.006). No statistically significant differences were observed for pregnancy, miscarriage and live birth rates per cycle among those with maternal KIR AA, AB and BB haplotypes after

  19. A population association study of vitamin D receptor gene polymorphisms and haplotypes with the risk of systemic lupus erythematosus in a Chinese population.

    Science.gov (United States)

    Chen, Xu-E; Chen, Pu; Chen, Shan-Shan; Lu, Jin; Ma, Ting; Shi, Guang; Zhou, Ya; Li, Ji; Sheng, Liang

    2017-06-01

    The aim of the study is to investigate the association of vitamin D receptor (VDR) gene polymorphism, additional gene-gene interaction, and haplotype combination with systemic lupus erythematosus (SLE) risk. Pairwise linkage disequilibrium (LD) analysis was conducted using SNPstats. The association between four SNPs within VDR gene and SLE risk was investigated by logistic regression. Generalized multifactor dimensionality reduction (GMDR) was used to analyze the interaction among four SNPs. Four SNPs within VDR gene were selected for genotyping in this study, including rs2228570, rs1544410, rs7975232, and rs731236. The T allele of rs2228570 and the G allele of the rs1544410 were associated with increased MM risk, adjusted ORs (95%CI) were 1.61(1.25-2.11) and 1.78 (1.34-2.23), respectively. GMDR analysis suggested a significant two-locus model (P = 0.0010) involving rs1544410 and rs2228570, and in this model, the cross-validation consistency was 10/10, and the testing accuracy was 62.70%. The haplotype analysis indicated that the most common haplotype was rs1544410-A and rs7975232-G haplotype, the frequencies of which were 0.4701 and 0.5467 in case and control group. Haplotype containing the rs1544410-G and rs7975232-T alleles were associated with increased SLE risk, OR (95%CI) = 2.08 (1.47-2.72), P risk.

  20. Analysis of high-resolution HapMap of DTNBP1 (Dysbindin) suggests no consistency between reported common variant associations and schizophrenia.

    Science.gov (United States)

    Mutsuddi, Mousumi; Morris, Derek W; Waggoner, Skye G; Daly, Mark J; Scolnick, Edward M; Sklar, Pamela

    2006-11-01

    DTNBP1 was first identified as a putative schizophrenia-susceptibility gene in Irish pedigrees, with a report of association to common genetic variation. Several replication studies have reported confirmation of an association to DTNBP1 in independent European samples; however, reported risk alleles and haplotypes appear to differ between studies, and comparison among studies has been confounded because different marker sets were employed by each group. To facilitate evaluation of existing evidence of association and further work, we supplemented the extensive genotype data, available through the International HapMap Project (HapMap), about DTNBP1 by specifically typing all associated single-nucleotide polymorphisms reported in each of the studies of the Centre d'Etude du Polymorphisme Humain (CEPH)-derived HapMap sample (CEU). Using this high-density reference map, we compared the putative disease-associated haplotype from each study and found that the association studies are inconsistent with regard to the identity of the disease-associated haplotype at DTNBP1. Specifically, all five "replication" studies define a positively associated haplotype that is different from the association originally reported. We further demonstrate that, in all six studies, the European-derived populations studied have haplotype patterns and frequencies that are consistent with HapMap CEU samples (and each other). Thus, it is unlikely that population differences are creating the inconsistency of the association studies. Evidence of association is, at present, equivocal and unsatisfactory. The new dense map of the region may be valuable in more-comprehensive follow-up studies.

  1. Inflammation, insulin resistance, and diabetes--Mendelian randomization using CRP haplotypes points upstream.

    Directory of Open Access Journals (Sweden)

    Eric J Brunner

    2008-08-01

    Full Text Available Raised C-reactive protein (CRP is a risk factor for type 2 diabetes. According to the Mendelian randomization method, the association is likely to be causal if genetic variants that affect CRP level are associated with markers of diabetes development and diabetes. Our objective was to examine the nature of the association between CRP phenotype and diabetes development using CRP haplotypes as instrumental variables.We genotyped three tagging SNPs (CRP + 2302G > A; CRP + 1444T > C; CRP + 4899T > G in the CRP gene and measured serum CRP in 5,274 men and women at mean ages 49 and 61 y (Whitehall II Study. Homeostasis model assessment-insulin resistance (HOMA-IR and hemoglobin A1c (HbA1c were measured at age 61 y. Diabetes was ascertained by glucose tolerance test and self-report. Common major haplotypes were strongly associated with serum CRP levels, but unrelated to obesity, blood pressure, and socioeconomic position, which may confound the association between CRP and diabetes risk. Serum CRP was associated with these potential confounding factors. After adjustment for age and sex, baseline serum CRP was associated with incident diabetes (hazard ratio = 1.39 [95% confidence interval 1.29-1.51], HOMA-IR, and HbA1c, but the associations were considerably attenuated on adjustment for potential confounding factors. In contrast, CRP haplotypes were not associated with HOMA-IR or HbA1c (p = 0.52-0.92. The associations of CRP with HOMA-IR and HbA1c were all null when examined using instrumental variables analysis, with genetic variants as the instrument for serum CRP. Instrumental variables estimates differed from the directly observed associations (p = 0.007-0.11. Pooled analysis of CRP haplotypes and diabetes in Whitehall II and Northwick Park Heart Study II produced null findings (p = 0.25-0.88. Analyses based on the Wellcome Trust Case Control Consortium (1,923 diabetes cases, 2,932 controls using three SNPs in tight linkage disequilibrium with our

  2. Molecular mapping of soybean rust resistance in soybean accession PI 561356 and SNP haplotype analysis of the Rpp1 region in diverse germplasm.

    Science.gov (United States)

    Kim, Ki-Seung; Unfried, Jair R; Hyten, David L; Frederick, Reid D; Hartman, Glen L; Nelson, Randall L; Song, Qijian; Diers, Brian W

    2012-10-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi Sydow, is one of the most economically important and destructive diseases of soybean [Glycine max (L.) Merr.] and the discovery of novel SBR resistance genes is needed because of virulence diversity in the pathogen. The objectives of this research were to map SBR resistance in plant introduction (PI) 561356 and to identify single nucleotide polymorphism (SNP) haplotypes within the region on soybean chromosome 18 where the SBR resistance gene Rpp1 maps. One-hundred F(2:3) lines derived from a cross between PI 561356 and the susceptible experimental line LD02-4485 were genotyped with genetic markers and phenotyped for resistance to P. pachyrhizi isolate ZM01-1. The segregation ratio of reddish brown versus tan lesion type in the population supported that resistance was controlled by a single dominant gene. The gene was mapped to a 1-cM region on soybean chromosome 18 corresponding to the same interval as Rpp1. A haplotype analysis of diverse germplasm across a 213-kb interval that included Rpp1 revealed 21 distinct haplotypes of which 4 were present among 5 SBR resistance sources that have a resistance gene in the Rpp1 region. Four major North American soybean ancestors belong to the same SNP haplotype as PI 561356 and seven belong to the same haplotype as PI 594538A, the Rpp1-b source. There were no North American soybean ancestors belonging to the SNP haplotypes found in PI 200492, the source of Rpp1, or PI 587886 and PI 587880A, additional sources with SBR resistance mapping to the Rpp1 region.

  3. Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    Nicholas A. Tinker

    2016-04-01

    Full Text Available Genotyping-by-sequencing (GBS, and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1 operates without a reference genome; (2 can be used in a polyploid species; (3 provides a discovery mode, and a production mode; (4 discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5 reports SNPs as well as haplotype-based genotypes; and (6 provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species.

  4. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement.

    Science.gov (United States)

    Zhang, Chihong; Gao, Lifeng; Sun, Jiaqiang; Jia, Jizeng; Ren, Zhenglong

    2014-08-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschii, 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the well-known Green Revolution allele Rht-D1b, Hapl VII (an allele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently. © 2014 Institute of Botany, Chinese Academy of Sciences.

  5. Haplotype Diversity at Sub1 Locus and Allelic Distribution Among Rice Varieties of Tide and Flood Prone Areas of South-East Asia

    Directory of Open Access Journals (Sweden)

    A.S.M. Masuduzzaman

    2017-07-01

    Full Text Available Single nucleotide polymorphisms and restriction digestion-based haplotype variations among 160 flood prone rice varieties were analyzed with enzymes Alu I and Cac8 I to generate polymorphisms at Sub1A and Sub1C loci (conferring submergence tolerance, respectively. Haplotype associated with phenotype was used to study the haplotype variations at Sub1A and Sub1C loci and to determine their functional influence on submergence tolerance and stem elongation. Three patterns at Sub1A locus, Sub1A0 (null allele, Sub1A1 (does not cut and Sub1A2 (one SNP, and four patterns at Sub1C locus, Sub1C1, Sub1C2, Sub1C3 and Sub1C4, were generated. Both tolerant Sub1A1 and intolerant Sub1A2 had the same length, but the difference was presence of a restriction site in the Sub1A2, but absent at the Sub1A1. Further, two types of polymorphism were detected at the Sub1C, one included major length polymorphisms (165, 170 and 175 bp and the other was a single restriction site at different position. Eight haplotypes (different combinations of the two loci, A1C1, A1C2, A1C4, A2C2, A2C4, A0C2, A0C3 and A0C4, were detected among 160 varieties. Haplotype A1C1 was comparatively more related to haplotypes A1C2 and A1C4, having the same Sub1A allele, and these haplotypes were found only in Bangladeshi, Sri Lankan and Indian varieties. Most tolerant varieties in A1C1 haplotype showed slow elongation, having tolerant specific Sub1A1 and Sub1C1 alleles. Further, the varieties Madabaru and Kottamali (A2C2 also showed moderate level of tolerance without Sub1A1 allele. These varieties were different with FR13A and also suspected to carry different novel tolerant genes at other loci. These materials could be used for hybridization with Sub1 varieties for pyramiding additional tolerant specific alleles into a single genotype for improving submergence tolerance in rice.

  6. Bayesian genomic selection: the effect of haplotype lenghts and priors

    DEFF Research Database (Denmark)

    Villumsen, Trine Michelle; Janss, Luc

    2009-01-01

    Breeding values for animals with marker data are estimated using a genomic selection approach where data is analyzed using Bayesian multi-marker association models. Fourteen model scenarios with varying haplotype lengths, hyper parameter and prior distributions were compared to find the scenario...... expected to give the most correct genomic estimated breeding values for animals with marker information only. Five-fold cross validation was performed to assess the ability of models to estimate breeding values for animals in generation 3. In each of the five subsets, 20% of phenotypic records...... well. Correlations were 0.77-0.89 and predicted breeding values were biased. In addition the models seemed to over fit the genomic part of the variation. Highest correlations and most unbiased results were obtained when SNP markers were joined into haplotypes. Especially the scenarios with 5-SNP...

  7. Common Mechanism of Pathogenesis in Gastrointestinal Diseases Implied by Consistent Efficacy of Single Chinese Medicine Formula: A PRISMA-Compliant Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Ling, Wei; Li, Yang; Jiang, Wei; Sui, Yi; Zhao, Hai-Lu

    2015-07-01

    = 2989; OR = 3.94, 95% CI = 3.17-4.90). The relapse rate was 12.9% for SNS, significantly <46.5% for conventional therapies (OR = 0.16, 95% CI = 0.11-0.25).The consistent efficacy of the single TCM formula implicates common mechanisms of pathogenesis in GI disorders.

  8. Extended HLA-D region haplotype associated with celiac disease

    Energy Technology Data Exchange (ETDEWEB)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II ..beta..-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this ..beta..-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP ..beta..-chain. This celiac disease-associated HLA-DP ..beta..-chain gene was flanked by HLA-DP ..cap alpha..-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DP..cap alpha..-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP ..cap alpha..- and ..beta..-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion.

  9. Extended HLA-D region haplotype associated with celiac disease

    International Nuclear Information System (INIS)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II β-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this β-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP β-chain. This celiac disease-associated HLA-DP β-chain gene was flanked by HLA-DP α-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DPα-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP α- and β-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion

  10. Combinatorial aspects of genome rearrangements and haplotype networks

    OpenAIRE

    Labarre , Anthony

    2008-01-01

    The dissertation covers two problems motivated by computational biology: genome rearrangements, and haplotype networks. Genome rearrangement problems are a particular case of edit distance problems, where one seeks to transform two given objects into one another using as few operations as possible, with the additional constraint that the set of allowed operations is fixed beforehand; we are also interested in computing the corresponding distances between those objects, i.e. merely computing t...

  11. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  12. Haplotype study in Dutch SCA3 and SCA6 families : evidence for common founder mutations

    NARCIS (Netherlands)

    Verbeek, Dineke S; Piersma, Sytse J; Hennekam, Eric F A M; Ippel, Elly F; Pearson, Peter L; Sinke, Richard J

    This pilot study was initiated to show the existence of founder effects in the Dutch autosomal dominant cerebellar ataxia (ADCA) population. The ADCAs comprise a clinically heterogeneous group of neurodegenerative disorders and the estimated prevalence in the Netherlands is approximately 3:100 000

  13. The effect of using genealogy-based haplotypes for genomic prediction.

    Science.gov (United States)

    Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt

    2013-03-06

    Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.

  14. Minimum Conflict Individual Haplotyping from SNP Fragments and Related Genotype

    Directory of Open Access Journals (Sweden)

    Ling-Yun Wu

    2006-01-01

    Full Text Available The Minimum Error Correction (MEC is an important model for haplotype reconstruction from SNP fragments. However, this model is effective only when the error rate of SNP fragments is low. In this paper, we propose a new computational model called Minimum Conflict Individual Haplotyping (MCIH as an extension to MEC. In contrast to the conventional approaches, the new model employs SNP fragment information and also related genotype information, thereby a high accurate inference can be expected. We first prove the MCIH problem to be NP-hard. To evaluate the practicality of the new model we design an exact algorithm (a dynamic programming procedure to implement MCIH on a special data structure. The numerical experience indicates that it is fairly effective to use MCIH at the cost of related genotype information, especially in the case of SNP fragments with a high error rate. Moreover, we present a feed-forward neural network algorithm to solve MCIH for general data structure and large size instances. Numerical results on real biological data and simulation data show that the algorithm works well and MCIH is a potential alternative in individual haplotyping.

  15. Spray and atomization of diesel fuel and its alternatives from a single-hole injector using a common rail fuel injection system

    KAUST Repository

    Chen, PinChia

    2013-01-01

    Fuel spray and atomization characteristics play an important role in the performance of internal combustion engines. As the reserves of petroleum fuel are expected to be depleted within a few decades, finding alternative fuels that are economically viable and sustainable to replace the petroleum fuel has attracted much research attention. In this work, the spray and atomization characteristics were investigated for commercial No. 2 diesel fuel, biodiesel (FAME) derived from waste cooking oil (B100), 20% biodiesel blended diesel fuel (B20), renewable diesel fuel produced in house, and civil aircraft jet fuel (Jet-A). Droplet diameters and particle size distributions were measured by a laser diffraction particle analyzing system and the spray tip penetrations and cone angles were acquired using a high speed imaging technique. All experiments were conducted by employing a common-rail high-pressure fuel injection system with a single-hole nozzle under room temperature and pressure. The experimental results showed that biodiesel and jet fuel had different features compared with diesel. Longer spray tip penetration and larger droplet diameters were observed for B100. The smaller droplet size of the Jet-A were believed to be caused by its relatively lower viscosity and surface tension. B20 showed similar characteristics to diesel but with slightly larger droplet sizes and shorter tip penetration. Renewable diesel fuel showed closer droplet size and spray penetration to Jet-A with both smaller than diesel. As a result, optimizing the trade-off between spray volume and droplet size for different fuels remains a great challenge. However, high-pressure injection helps to optimize the trade-off of spray volume and droplet sizes. Furthermore, it was observed that the smallest droplets were within a region near the injector nozzle tip and grew larger along the axial and radial direction. The variation of droplet diameters became smaller with increasing injection pressure.

  16. High-Resolution Analyses of Human Leukocyte Antigens Allele and Haplotype Frequencies Based on 169,995 Volunteers from the China Bone Marrow Donor Registry Program.

    Science.gov (United States)

    Zhou, Xiao-Yang; Zhu, Fa-Ming; Li, Jian-Ping; Mao, Wei; Zhang, De-Mei; Liu, Meng-Li; Hei, Ai-Lian; Dai, Da-Peng; Jiang, Ping; Shan, Xiao-Yan; Zhang, Bo-Wei; Zhu, Chuan-Fu; Shen, Jie; Deng, Zhi-Hui; Wang, Zheng-Lei; Yu, Wei-Jian; Chen, Qiang; Qiao, Yan-Hui; Zhu, Xiang-Ming; Lv, Rong; Li, Guo-Ying; Li, Guo-Liang; Li, Heng-Cong; Zhang, Xu; Pei, Bin; Jiao, Li-Xin; Shen, Gang; Liu, Ying; Feng, Zhi-Hui; Su, Yu-Ping; Xu, Zhao-Xia; Di, Wen-Ying; Jiang, Yao-Qin; Fu, Hong-Lei; Liu, Xiang-Jun; Liu, Xiang; Zhou, Mei-Zhen; Du, Dan; Liu, Qi; Han, Ying; Zhang, Zhi-Xin; Cai, Jian-Ping

    2015-01-01

    Allogeneic hematopoietic stem cell transplantation is a widely used and effective therapy for hematopoietic malignant diseases and numerous other disorders. High-resolution human leukocyte antigen (HLA) haplotype frequency distributions not only facilitate individual donor searches but also determine the probability with which a particular patient can find HLA-matched donors in a registry. The frequencies of the HLA-A, -B, -C, -DRB1, and -DQB1 alleles and haplotypes were estimated among 169,995 Chinese volunteers using the sequencing-based typing (SBT) method. Totals of 191 HLA-A, 244 HLA-B, 146 HLA-C, 143 HLA-DRB1 and 47 HLA-DQB1 alleles were observed, which accounted for 6.98%, 7.06%, 6.46%, 9.11% and 7.91%, respectively, of the alleles in each locus in the world (IMGT 3.16 Release, Apr. 2014). Among the 100 most common haplotypes from the 169,995 individuals, nine distinct haplotypes displayed significant regionally specific distributions. Among these, three were predominant in the South China region (i.e., the 20th, 31st, and 81sthaplotypes), another three were predominant in the Southwest China region (i.e., the 68th, 79th, and 95th haplotypes), one was predominant in the South and Southwest China regions (the 18th haplotype), one was relatively common in the Northeast and North China regions (the 94th haplotype), and one was common in the Northeast, North and Northwest China (the 40th haplotype). In conclusion, this is the first to analyze high-resolution HLA diversities across the entire country of China, based on a detailed and complete data set that covered 31 provinces, autonomous regions, and municipalities. Specifically, we also evaluated the HLA matching probabilities within and between geographic regions and analyzed the regional differences in the HLA diversities in China. We believe that the data presented in this study might be useful for unrelated HLA-matched donor searches, donor registry planning, population genetic studies, and anthropogenesis

  17. Influence of HLA class I haplotypes on HIV-1 seroconversion and disease progression in Pumwani sex worker cohort.

    Directory of Open Access Journals (Sweden)

    Raghavan Sampathkumar

    02-C*08∶02 and B*58∶01-C*03∶02 with differential seroconversion or disease progression are due to the dominant effect of a single allele within the haplotypes. The true haplotype effect was observed with A*30∶02-B*45∶01, A*30∶02-C*16∶02, B*53∶01-C*04∶01 B*15∶10-C*03∶04, and B*42∶01-C*17∶01. In these cases, the presence of both alleles accelerated the disease progression or seroconversion than any of the single allele within the haplotypes. Our study showed that the true effects of HLA class I haplotypes on HIV seroconversion and disease progression exist and the associations of HLA class I haplotype can also be due to the dominant effect of a single allele within the haplotype.

  18. Influence of HLA class I haplotypes on HIV-1 seroconversion and disease progression in Pumwani sex worker cohort.

    Science.gov (United States)

    Sampathkumar, Raghavan; Peters, Harold O; Mendoza, Lillian; Bielawny, Thomas; Ngugi, Elizabeth; Kimani, Joshua; Wachihi, Charles; Plummer, Francis A; Luo, Ma

    2014-01-01

    *08∶02 and B*58∶01-C*03∶02 with differential seroconversion or disease progression are due to the dominant effect of a single allele within the haplotypes. The true haplotype effect was observed with A*30∶02-B*45∶01, A*30∶02-C*16∶02, B*53∶01-C*04∶01 B*15∶10-C*03∶04, and B*42∶01-C*17∶01. In these cases, the presence of both alleles accelerated the disease progression or seroconversion than any of the single allele within the haplotypes. Our study showed that the true effects of HLA class I haplotypes on HIV seroconversion and disease progression exist and the associations of HLA class I haplotype can also be due to the dominant effect of a single allele within the haplotype.

  19. Hemoglobin Constant Spring among Southeast Asian Populations: Haplotypic Heterogeneities and Phylogenetic Analysis.

    Directory of Open Access Journals (Sweden)

    Wittaya Jomoui

    Full Text Available Hemoglobin Constant Spring (Hb CS is an abnormal Hb caused by a mutation at the termination codon of α2-globin gene found commonly among Southeast Asian and Chinese people. Association of Hb CS with α°-thalassemia leads to a thalassemia intermedia syndrome commonly encountered in the region. We report chromosome background and addressed genetic origins of Hb CS observed in a large cohort of Hb CS among Southeast Asian populations.A study was done on 102 Vietnamese (aged 15-49 year-old and 40 Laotian (aged 18-39 year-old subjects with Hb CS and results compared with 120 Hb CS genes in Thailand. Hematological parameters were recorded and Hb analysis was performed using capillary electrophoresis. Hb CS mutation and thalassemia genotypes were defined by DNA analysis. Six DNA polymorphisms within α-globin gene cluster including 5'Xba I, Bgl I, Inter-zeta HVR, AccI, RsaI and αPstI 3', were determined using PCR-RFLP assay.Nine different genotypes of Hb CS were observed. In contrast to the Thai Hb CS alleles which are mostly linked to haplotype (+-S + + -, most of the Vietnamese and the Laotian Hb CS genes were associated with haplotype (+-M + + -, both of which are different from that of the European Hb CS.Hb CS is commonly found in combination with other thalassemias among Southeast Asian populations. Accurate genotyping of the cases requires both hematologic and DNA analyses. At least two independent origins are associated with the Hb CS gene which could indirectly explain the high prevalence of this Hb variant in the region.

  20. ABCB1 genotypes and haplotypes in patients with dementia and age-matched non-demented control patients

    Directory of Open Access Journals (Sweden)

    Frankfort Suzanne V

    2006-09-01

    Full Text Available Abstract Amyloid β is an in vitro substrate for P-glycoprotein (P-gp, an efflux pump at the blood brain barrier (BBB. The Multi Drug Resistance (ABCB1 gene, encoding for P-gp, is highly polymorphic and this may result in a changed function of P-gp and may possibly interfere with the pathogenesis of Alzheimer's disease. This study investigates to what extent ABCB1 Single Nucleotide Polymorphisms (SNPs; C1236T in exon 12, G2677T/A in exon 21 and C3435T in exon 26 and inferred haplotypes exist in an elderly population and if these SNPs and haplotypes differ between patients with dementia and age-matched non-demented control patients. ABCB1 genotype, allele and haplotype frequencies were neither significantly different between patients with dementia and age-matched controls, nor between subgroups of different types of dementia nor age-matched controls. This study shows ABCB1 genotype frequencies to be comparable with described younger populations. To our knowledge this is the first study on ABCB1 genotypes in dementia. ABCB1 genotypes are presently not useful as a biomarker for dementia, as they were not significantly different between demented patients and age-matched control subjects.

  1. The haplotype of two FSHR polymorphisms in ovarian cancer--a potential role of ethnology in risk modification.

    Science.gov (United States)

    Heubner, Martin; Riemann, Kathrin; Otterbach, Friedrich; Kimmig, Rainer; Kasimir-Bauer, Sabine; Siffert, Winfried; Wimberger, Pauline

    2009-03-01

    The precise role of gonadotropins in the carcinogenesis of epithelial ovarian cancer remains uncertain. Recently, the haplotype of two single nucleotide polymorphisms, Thr307Ala (rs6165) and Asn680Ser (rs6166), has been described as a risk factor for ovarian cancer in Chinese women. In this study we investigated the impact of this haplotype regarding the risk to develop ovarian cancer as well as possible effects upon the clinical course in a Caucasian patient sample. Determination of genotypes in 115 patients with primary epithelial ovarian cancer and 115 age-matched controls was performed by Pyrosequencing for Thr307Ala and by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique for Asn680Ser. Analysis of the genotypes revealed almost complete linkage disequilibrium of both SNPs. The distribution of genotypes was not statistically significant different between ovarian cancer patients and age-matched controls. Clinical parameters such as overall survival, CA12-5 elevation at primary diagnosis, age at diagnosis, FIGO stage, grading, and platinum resistance were not statistically significantly different regarding genotypes. We could not confirm the FSHR Ala307-Ser680 haplotype as a risk factor for epithelial ovarian cancer in Caucasian women. Hence, the modification of tumor risk may be affected by the ethnology of the patient collective. We could not find any associations of clinical parameters or course of the disease with the different genotypes.

  2. Estimating KIR Haplotype Frequencies on a Cohort of 10,000 Individuals: A Comprehensive Study on Population Variations, Typing Resolutions, and Reference Haplotypes.

    Directory of Open Access Journals (Sweden)

    Cynthia Vierra-Green

    Full Text Available The killer cell immunoglobulin-like receptors (KIR mediate human natural killer (NK cell cytotoxicity via activating or inhibiting signals. Although informative and functional haplotype patterns have been reported, most genotyping has been performed at resolutions that are structurally ambiguous. In order to leverage structural information given low-resolution genotypes, we performed experiments to quantify the effects of population variations, reference haplotypes, and genotyping resolutions on population-level haplotype frequency estimations as well as predictions of individual haplotypes. We genotyped 10,157 unrelated individuals in 5 populations (518 African American[AFA], 258 Asian or Pacific Islander[API], 8,245 European[EUR], 1,073 Hispanic[HIS], and 63 Native American[NAM] for KIR gene presence/absence (PA, and additionally half of the AFA samples for KIR gene copy number variation (CNV. A custom EM algorithm was used to estimate haplotype frequencies for each population by interpretation in the context of three sets of reference haplotypes. The algorithm also assigns each individual the haplotype pairs of maximum likelihood. Generally, our haplotype frequency estimates agree with similar previous publications to within <5% difference for all haplotypes. The exception is that estimates for NAM from the U.S. showed higher frequency association of cB02 with tA01 (+14% instead of tB01 (-8.5% compared to a previous study of NAM from south of the U.S. The higher-resolution CNV genotyping on the AFA samples allowed unambiguous haplotype-pair assignments for the majority of individuals, resulting in a 22% higher median typing resolution score (TRS, which measures likelihood of self-match in the context of population-specific haplo- and geno-types. The use of TRS to quantify reduced ambiguity with CNV data clearly revealed the few individuals with ambiguous genotypes as outliers. It is observed that typing resolution and reference haplotype set

  3. Estimating KIR Haplotype Frequencies on a Cohort of 10,000 Individuals: A Comprehensive Study on Population Variations, Typing Resolutions, and Reference Haplotypes.

    Science.gov (United States)

    Vierra-Green, Cynthia; Roe, David; Jayaraman, Jyothi; Trowsdale, John; Traherne, James; Kuang, Rui; Spellman, Stephen; Maiers, Martin

    2016-01-01

    The killer cell immunoglobulin-like receptors (KIR) mediate human natural killer (NK) cell cytotoxicity via activating or inhibiting signals. Although informative and functional haplotype patterns have been reported, most genotyping has been performed at resolutions that are structurally ambiguous. In order to leverage structural information given low-resolution genotypes, we performed experiments to quantify the effects of population variations, reference haplotypes, and genotyping resolutions on population-level haplotype frequency estimations as well as predictions of individual haplotypes. We genotyped 10,157 unrelated individuals in 5 populations (518 African American[AFA], 258 Asian or Pacific Islander[API], 8,245 European[EUR], 1,073 Hispanic[HIS], and 63 Native American[NAM]) for KIR gene presence/absence (PA), and additionally half of the AFA samples for KIR gene copy number variation (CNV). A custom EM algorithm was used to estimate haplotype frequencies for each population by interpretation in the context of three sets of reference haplotypes. The algorithm also assigns each individual the haplotype pairs of maximum likelihood. Generally, our haplotype frequency estimates agree with similar previous publications to within <5% difference for all haplotypes. The exception is that estimates for NAM from the U.S. showed higher frequency association of cB02 with tA01 (+14%) instead of tB01 (-8.5%) compared to a previous study of NAM from south of the U.S. The higher-resolution CNV genotyping on the AFA samples allowed unambiguous haplotype-pair assignments for the majority of individuals, resulting in a 22% higher median typing resolution score (TRS), which measures likelihood of self-match in the context of population-specific haplo- and geno-types. The use of TRS to quantify reduced ambiguity with CNV data clearly revealed the few individuals with ambiguous genotypes as outliers. It is observed that typing resolution and reference haplotype set influence

  4. Identification of haplotypes at the Rsv4 genomic region in soybean associated with durable resistance to soybean mosaic virus.

    Science.gov (United States)

    Ilut, Daniel C; Lipka, Alexander E; Jeong, Namhee; Bae, Dong Nyuk; Kim, Dong Hyun; Kim, Ji Hong; Redekar, Neelam; Yang, Kiwoung; Park, Won; Kang, Sung-Taeg; Kim, Namshin; Moon, Jung-Kyung; Saghai Maroof, M A; Gore, Michael A; Jeong, Soon-Chun

    2016-03-01

    Discovery of new germplasm sources and identification of haplotypes for the durable Soybean mosaic virus resistance gene, Rsv 4, provide novel resources for map-based cloning and genetic improvement efforts in soybean. The Soybean mosaic virus (SMV) resistance locus Rsv4 is of interest because it provides a durable type of resistance in soybean [Glycine max (L.) Merr.]. To better understand its molecular basis, we used a population of 309 BC3F2 individuals to fine-map Rsv4 to a ~120 kb interval and leveraged this genetic information in a second study to identify accessions 'Haman' and 'Ilpumgeomjeong' as new sources of Rsv4. These two accessions along with three other Rsv4 and 14 rsv4 accessions were used to examine the patterns of nucleotide diversity at the Rsv4 region based on high-depth resequencing data. Through a targeted association analysis of these 19 accessions within the ~120 kb interval, a cluster of four intergenic single-nucleotide polymorphisms (SNPs) was found to perfectly associate with SMV resistance. Interestingly, this ~120 kb interval did not contain any genes similar to previously characterized dominant disease resistance genes. Therefore, a haplotype analysis was used to further resolve the association signal to a ~94 kb region, which also resulted in the identification of at least two Rsv4 haplotypes. A haplotype phylogenetic analysis of this region suggests that the Rsv4 locus in G. max is recently introgressed from G. soja. This integrated study provides a strong foundation for efforts focused on the cloning of this durable virus resistance gene and marker-assisted selection of Rsv4-mediated SMV resistance in soybean breeding programs.

  5. Haplotype and genotype effects of the F7 gene on circulating factor VII, coagulation activation markers and incident coronary heart disease in UK men.

    Science.gov (United States)

    Ken-Dror, G; Drenos, F; Humphries, S E; Talmud, P J; Hingorani, A D; Kivimäki, M; Kumari, M; Bauer, K A; Morrissey, J H; Ireland, H A

    2010-11-01

    Evidence for the associations of single nucleotide polymorphisms (SNPs) in the F7 gene and factor (F)VII levels and with risk of coronary heart disease (CHD) is inconsistent. We examined whether F7 tagging SNPs (tSNPs) and haplotypes were associated with FVII levels, coagulation activation markers (CAMs) and CHD risk in two cohorts of UK men. Genotypes for eight SNPs and baseline levels of FVIIc, FVIIag and CAMs (including FVIIa) were determined in 2773 healthy men from the Second Northwick Park Heart Study (NPHS-II). A second cohort, Whitehall II study (WH-II, n = 4055), was used for replication analysis of FVIIc levels and CHD risk. In NPHS-II the minor alleles of three SNPs (rs555212, rs762635 and rs510317; haplotype H2) were associated with higher levels of FVIIag, FVIIc and FVIIa, whereas the minor allele for two SNPs (I/D323 and rs6046; haplotype H5) was associated with lower levels. Adjusted for classic risk factors, H2 carriers had a CHD hazard ratio of 1.34 [95% confidence interval (CI): 1.12-1.59; independent of FVIIc], whereas H5 carriers had a CHD risk of 1.29 (95% CI: 1.01-1.56; not independent of FVIIc) and significantly lower CAMs. Effects of haplotypes on FVIIc levels were replicated in WH-II, as was the association of H5 with higher CHD risk [pooled-estimate odds ratio (OR) 1.16 (1.00-1.36), P = 0.05], but surprisingly, H2 exhibited a reduced risk for CHD.  tSNPs in the F7 gene strongly influence FVII levels. The haplotype associated with low FVIIc level, with particularly reduced functional activity, was consistently associated with increased risk for CHD, whereas the haplotype associated with high FVIIc level was not. © 2010 International Society on Thrombosis and Haemostasis.

  6. The discrete Laplace exponential family and estimation of Y-STR haplotype frequencies

    DEFF Research Database (Denmark)

    Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels

    2013-01-01

    of the Fisher-Wright model of evolution for haploid lineage DNA markers. An exponential family (a class of probability distributions that is well understood in probability theory such that inference is easily made by using existing software) called the 'discrete Laplace distribution' is described. We illustrate...... how well the discrete Laplace distribution approximates a more complicated distribution that arises by investigating the well-known population genetic Fisher-Wright model of evolution by a single-step mutation process. It was shown how the discrete Laplace distribution can be used to estimate...... haplotype frequencies for haploid lineage DNA markers (such as Y-chromosomal short tandem repeats), which in turn can be used to assess the evidential weight of a DNA profile found at a crime scene. This was done by making inference in a mixture of multivariate, marginally independent, discrete Laplace...

  7. Haplotypes on pig chromosome 3 distinguish metabolically healthy from unhealthy obese individuals

    DEFF Research Database (Denmark)

    Frederiksen, Simona Denise; Karlskov-Mortensen, Peter; Pant, Sameer D.

    2017-01-01

    We have established a pig resource population specifically designed to elucidate the genetics involved in development of obesity and obesity related co-morbidities by crossing the obesity prone Gottingen Minipig breed with two lean production pig breeds. In this study we have performed genome wid...... shown to impose a positive effect on blood lipid levels. Thus, the genetic profile of the Gottingen Minipig breed seems to support a phenotype comparable to the metabolic healthy obese (MHO) phenotype in humans....... association (GWA) to identify loci with effect on blood lipid levels. The most significantly associated single nucleotide polymorphisms (SNPs) were used for linkage disequilibrium (LD) and haplotype analyses. Three separate haploblocks which influence the ratio between high density lipoprotein cholesterol...

  8. Haplotype analysis and a novel allele-sharing method refines a chromosome 4p locus linked to bipolar affective disorder.

    Science.gov (United States)

    Le Hellard, Stephanie; Lee, Andrew J; Underwood, Sarah; Thomson, Pippa A; Morris, Stewart W; Torrance, Helen S; Anderson, Susan M; Adams, Richard R; Navarro, Pau; Christoforou, Andrea; Houlihan, Lorna M; Detera-Wadleigh, Sevilla; Owen, Michael J; Asherson, Philip; Muir, Walter J; Blackwood, Douglas H R; Wray, Naomi R; Porteous, David J; Evans, Kathryn L

    2007-03-15

    Bipolar affective disorder (BPAD) and schizophrenia (SCZ) are common conditions. Their causes are unknown, but they include a substantial genetic component. Previously, we described significant linkage of BPAD to a chromosome 4p locus within a large pedigree (F22). Others subsequently have found evidence for linkage of BPAD and SCZ to this region. We constructed high-resolution haplotypes for four linked families, calculated logarithm of the odds (LOD) scores, and developed a novel method to assess the extent of allele sharing within genes between the families. We describe an increase in the F22 LOD score for this region. Definition and comparison of the linked haplotypes allowed us to prioritize two subregions of 3.8 and 4.4 Mb. Analysis of the extent of allele sharing within these subregions identified 200 kb that shows increased allele sharing between families. Linkage of BPAD to chromosome 4p has been strengthened. Haplotype analysis in the additional linked families refined the 20-Mb linkage region. Development of a novel allele-sharing method allowed us to bridge the gap between conventional linkage and association studies. Description of a 200-kb region of increased allele sharing prioritizes this region, which contains two functional candidate genes for BPAD, SLC2A9, and WDR1, for subsequent studies.

  9. Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

    Science.gov (United States)

    Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

    2018-05-01

    Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

  10. Integrated genetic and epigenetic analysis identifies haplotype-specific methylation in the FTO type 2 diabetes and obesity susceptibility locus.

    Directory of Open Access Journals (Sweden)

    Christopher G Bell

    Full Text Available Recent multi-dimensional approaches to the study of complex disease have revealed powerful insights into how genetic and epigenetic factors may underlie their aetiopathogenesis. We examined genotype-epigenotype interactions in the context of Type 2 Diabetes (T2D, focussing on known regions of genomic susceptibility. We assayed DNA methylation in 60 females, stratified according to disease susceptibility haplotype using previously identified association loci. CpG methylation was assessed using methylated DNA immunoprecipitation on a targeted array (MeDIP-chip and absolute methylation values were estimated using a Bayesian algorithm (BATMAN. Absolute methylation levels were quantified across LD blocks, and we identified increased DNA methylation on the FTO obesity susceptibility haplotype, tagged by the rs8050136 risk allele A (p = 9.40×10(-4, permutation p = 1.0×10(-3. Further analysis across the 46 kb LD block using sliding windows localised the most significant difference to be within a 7.7 kb region (p = 1.13×10(-7. Sequence level analysis, followed by pyrosequencing validation, revealed that the methylation difference was driven by the co-ordinated phase of CpG-creating SNPs across the risk haplotype. This 7.7 kb region of haplotype-specific methylation (HSM, encapsulates a Highly Conserved Non-Coding Element (HCNE that has previously been validated as a long-range enhancer, supported by the histone H3K4me1 enhancer signature. This study demonstrates that integration of Genome-Wide Association (GWA SNP and epigenomic DNA methylation data can identify potential novel genotype-epigenotype interactions within disease-associated loci, thus providing a novel route to aid unravelling common complex diseases.

  11. HLA-DQ2 and -DQ8 haplotypes frequency and diagnostic utility in celiac disease patients of Gaza strip, Palestine.

    Science.gov (United States)

    Ayesh, Basim M; Zaqout, Eman Kh; Yassin, Maged M

    2017-11-15

    Celiac disease (CD) diagnosis can be established by serological and small bowel biopsy (SBB), while absence of HLA-DQ2 and -DQ8 haplotypes excludes the disease. The present study aims at evaluating the diagnosis of a representative sample of pediatric and adult CD patients of Gaza strip in light of DQ2 and DQ8 haplotypes expression. Unrelated CD patients (n = 101) and matched healthy controls (n = 97) were genotyped for DQA1*05, DQB1*02 and DQB1*03:02 alleles by allele-specific real-time PCR. The diagnosis was re-evaluated according to the patient laboratory tests and HLA-DQ genotype. The diagnosis of 35 patients who have been managed for CD could not be confirmed. Twenty-five of them were diagnosed upon their clinical presentation only. The remaining were either negative for serological and SBB tests or negative for HLA-DQ haplotypes. The HLA-DQ alleles were negative in 4 SBB and one Anti-EMA positive patients. The frequency of DQ2 and DQ8 haplotypes among the remaining 65 confirmed cases was 70.8 and 15.4%, respectively, compared to 17.5 and 27.8% in the controls. The DQB1*02 allele was the most common in the cases (84.6%) followed by DQA1*05 allele (80%) and DQB1*03:02 allele (20%). The DQA1*05 allele was commonest in the control group (54.6%) followed by DQB1*02 allele (42.3%) and DQB1*03:02 allele (28.9%). Absence of HLA-DQ2 and HLA-DQ8 genotyping in the workup of patients may result in CD misdiagnosis, particularly in a setting with poor histopathological diagnostic capacity.

  12. Genomic history of the origin and domestication of common bean unveils its closest sister species.

    Science.gov (United States)

    Rendón-Anaya, Martha; Montero-Vargas, Josaphat M; Saburido-Álvarez, Soledad; Vlasova, Anna; Capella-Gutierrez, Salvador; Ordaz-Ortiz, José Juan; Aguilar, O Mario; Vianello-Brondani, Rosana P; Santalla, Marta; Delaye, Luis; Gabaldón, Toni; Gepts, Paul; Winkler, Robert; Guigó, Roderic; Delgado-Salinas, Alfonso; Herrera-Estrella, Alfredo

    2017-03-29

    Modern civilization depends on only a few plant species for its nourishment. These crops were derived via several thousands of years of human selection that transformed wild ancestors into high-yielding domesticated descendants. Among cultivated plants, common bean (Phaseolus vulgaris L.) is the most important grain legume. Yet, our understanding of the origins and concurrent shaping of the genome of this crop plant is limited. We sequenced the genomes of 29 accessions representing 12 Phaseolus species. Single nucleotide polymorphism-based phylogenomic analyses, using both the nuclear and chloroplast genomes, allowed us to detect a speciation event, a finding further supported by metabolite profiling. In addition, we identified ~1200 protein coding genes (PCGs) and ~100 long non-coding RNAs with domestication-associated haplotypes. Finally, we describe asymmetric introgression events occurring among common bean subpopulations in Mesoamerica and across hemispheres. We uncover an unpredicted speciation event in the tropical Andes that gave rise to a sibling species, formerly considered the "wild ancestor" of P. vulgaris, which diverged before the split of the Mesoamerican and Andean P. vulgaris gene pools. Further, we identify haplotypes strongly associated with genes underlying the emergence of domestication traits. Our findings also reveal the capacity of a predominantly autogamous plant to outcross and fix loci from different populations, even from distant species, which led to the acquisition by domesticated beans of adaptive traits from wild relatives. The occurrence of such adaptive introgressions should be exploited to accelerate breeding programs in the near future.

  13. Two haplotype clusters of Echinococcus granulosus sensu stricto in northern Iraq (Kurdistan region) support the hypothesis of a parasite cradle in the Middle East.

    Science.gov (United States)

    Hassan, Zuber Ismael; Meerkhan, Azad Abdullah; Boufana, Belgees; Hama, Abdullah A; Ahmed, Bayram Dawod; Mero, Wijdan Mohammed Salih; Orsten, Serra; Interisano, Maria; Pozio, Edoardo; Casulli, Adriano

    2017-08-01

    Human cystic echinococcosis (CE) caused by Echinococcus granulosus s.s. is a major public health problem in Iraqi Kurdistan with a reported surgical incidence of 6.3 per 100,000 Arbil inhabitants. A total of 125 Echinococcus isolates retrieved from sheep, goats and cattle were used in this study. Our aim was to determine species/genotypes infecting livestock in Iraqi Kurdistan and examine intraspecific variation and population structure of Echinococcus granulosus s.s. in this region and relate it to that of other regions worldwide. Using nucleotide sequences of the mitochondrial cytochrome c oxidase subunit 1 (cox 1) we identified E. granulosus s.s. as the cause of hydatidosis in all examined animals. The haplotype network displayed a double-clustered topology with two main E. granulosus s.s. haplotypes, (KU05) and (KU33). The 'founder' haplotype (KU05) confirmed the presence of a common lineage of non-genetically differentiated populations as inferred by the low non-significant fixation index values. Overall diversity and neutrality indices indicated demographic expansion. We used E. granulosus s.s. nucleotide sequences from GenBank to draw haplotype networks for the Middle East (Iran, Jordan and Turkey), Europe (Albania, Greece, Italy, Romania and Spain), China, Mongolia, Russia, South America (Argentina, Brazil, Chile and Mexico) and Tunisia. Networks with two haplotype clusters like that reported here for Iraqi Kurdistan were seen for the Middle East, Europe, Mongolia, Russia and Tunisia using both 827bp and 1609bp cox1 nucleotide sequences, whereas a star-like network was observed for China and South America. We hypothesize that the double clustering seen at what is generally assumed to be the cradle of domestication may have emerged independently and dispersed from the Middle East to other regions and that haplotype (KU33) may be the main haplotype within a second cluster in the Middle East from where it has spread into Europe, Mongolia, Russia and North

  14. A High-risk Haplotype for Premature Menopause in Childhood Cancer Survivors Exposed to Gonadotoxic Therapy.

    Science.gov (United States)

    Brooke, Russell J; Im, Cindy; Wilson, Carmen L; Krasin, Matthew J; Liu, Qi; Li, Zhenghong; Sapkota, Yadav; Moon, WonJong; Morton, Lindsay M; Wu, Gang; Wang, Zhaoming; Chen, Wenan; Howell, Rebecca M; Armstrong, Gregory T; Bhatia, Smita; Mostoufi-Moab, Sogol; Seidel, Kristy; Chanock, Stephen J; Zhang, Jinghui; Green, Daniel M; Sklar, Charles A; Hudson, Melissa M; Robison, Leslie L; Chemaitilly, Wassim; Yasui, Yutaka

    2018-02-08

    Childhood cancer survivors are at increased risk of therapy-related premature menopause (PM), with a cumulative incidence of 8.0%, but the contribution of genetic factors is unknown. Genome-wide association analyses were conducted to identify single nucleotide polymorphisms (SNPs) associated with clinically diagnosed PM (menopause < 40 years) among 799 female survivors of childhood cancer participating in the St. Jude Lifetime Cohort Study (SJLIFE). Analyses were adjusted for cyclophosphamide equivalent dose of alkylating agents and ovarian radiotherapy (RT) dose (all P values two-sided). Replication was performed using self-reported PM in 1624 survivors participating in the Childhood Cancer Survivor Study (CCSS). PM was clinically diagnosed in 30 (3.8%) SJLIFE participants. Thirteen SNPs (70 kb region of chromosome 4q32.1) upstream of the Neuropeptide Receptor 2 gene (NPY2R) were associated with PM prevalence (minimum P = 3.3 × 10-7 for rs9999820, all P < 10-5). Being a homozygous carrier of a haplotype formed by four of the 13 SNPs (seen in one in seven in the general population but more than 50% of SJLIFE clinically diagnosed PM) was associated with markedly elevated PM prevalence among survivors exposed to ovarian RT (odds ratio [OR] = 25.89, 95% confidence interval [CI] = 6.18 to 138.31, P = 8.2 × 10-6); this finding was replicated in an independent second cohort of CCSS in spite of its use of self-reported PM (OR = 3.97, 95% CI = 1.67 to 9.41, P = .002). Evidence from bioinformatics data suggests that the haplotype alters the regulation of NPY2R transcription, possibly affecting PM risk through neuroendocrine pathways. The haplotype captures the majority of clinically diagnosed PM cases and, with further validation, may have clinical application in identifying the highest-risk survivors for PM for possible intervention by cryopreservation. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions

  15. Strategies for haplotype-based association mapping in complex pedigreed populations

    DEFF Research Database (Denmark)

    Boleckova, J; Christensen, Ole Fredslund; Sørensen, Peter

    2012-01-01

    increases the number of parameters in the model, resulting in low accuracy of the estimates especially for the low-frequency haplotypes. Modeling of haplotype effects can be improved if they are assumed to be random effects, as only one parameter i.e. haplotype variance needs to be estimated compared......, 4, 6, 10 and 20. The simulated data resembled the Danish Holstein cattle pedigree representing a complex relationship structure and QTL effects of different sizes were simulated. We observed that the random haplotype models had high power and very low type I error rates (after Bonferroni correction...

  16. IL23R and IL12B SNPs and Haplotypes Strongly Associate with Crohn's Disease Risk in a New Zealand Population

    Directory of Open Access Journals (Sweden)

    Lynnette R. Ferguson

    2010-01-01

    Full Text Available DNA samples from 339 Crohn's disease (CD and 407 randomly selected controls from the Auckland (New Zealand IBD project, were genotyped for five common single nucleotide polymorphisms in IL-23R (rs11805303, rs7517847, rs1343151, rs11209026, and rs10889677 and two in IL-12B (rs1363670 and rs6887695. While the IL-12B variants did not show an overall association and other IL23R variants led to minor changes in the risk of CD, rs1343151 and/or rs7517847 variants in the IL-23R gene strongly reduced the risk of developing CD at both allelic and genotype levels. A significantly decreased risk of first diagnosis of childhood CD was observed in individuals carrying the A allele of rs1343151, or between 17–40 y in individuals carrying the G allele in rs7517847 of IL-23R. A significantly decreased risk of ileocolonic or structuring disease was observed in individuals carrying the A allele in either rs11209026 or rs1343151, or the G allele in rs7517847 of IL-23R, and when such individuals did develop the disease, they were unlikely to require a bowel resection. Certain haplotypes very strongly modified risk. There was evidence for interactions of IL-23R variants with the NOD2 wild-type (d/d genotype. Down-regulating the function of the IL-23R gene may decrease CD risk in the normal population.

  17. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

    Directory of Open Access Journals (Sweden)

    Luciana Takada

    Full Text Available Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth as fixed effect and parent of the animal (sire effect as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05 on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2, two in the Estrogen-related receptor gamma gene (ESRRG, and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A, Kell blood group complex subunit-related family (XKR4 and mannose-binding lectin genes (MBL-1 genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

  18. Maternal Age-Specific Rates for Trisomy 21 and Common Autosomal Trisomies in Fetuses from a Single Diagnostic Center in Thailand.

    Directory of Open Access Journals (Sweden)

    Kanoot Jaruthamsophon

    Full Text Available To provide maternal age-specific rates for trisomy 21 (T21 and common autosomal trisomies (including trisomies 21, 18 and 13 in fetuses. We retrospectively reviewed prenatal cytogenetic results obtained between 1990 and 2009 in Songklanagarind Hospital, a university teaching hospital, in southern Thailand. Maternal age-specific rates of T21 and common autosomal trisomies were established using different regression models, from which only the fittest models were used for the study. A total of 17,819 records were included in the statistical analysis. The fittest models for predicting rates of T21 and common autosomal trisomies were regression models with 2 parameters (Age and Age2. The rate of T21 ranged between 2.67 per 1,000 fetuses at the age of 34 and 71.06 per 1,000 at the age of 48. The rate of common autosomal trisomies ranged between 4.54 per 1,000 and 99.65 per 1,000 at the same ages. This report provides the first maternal age-specific rates for T21 and common autosomal trisomies fetuses in a Southeast Asian population and the largest case number of fetuses have ever been reported in Asians.

  19. A haplotype spanning P2X7R, P2X4R and CAMKK2 may mark susceptibility to pulmonary non-tuberculous mycobacterial disease.

    Science.gov (United States)

    Halstrom, Samuel; Cherry, Catherine L; Black, Michael; Thomson, Rachel; Goullee, Hayley; Baltic, Svetlana; Allcock, Richard; Temple, Suzanna E L; Price, Patricia

    2017-05-01

    Despite widespread exposure to potentially pathogenic mycobacteria present in the soil and in domestic water supplies, it is not clear why only a small proportion of individuals contract pulmonary nontuberculous mycobacterial (NTM) infections. Here, we explore the impact of polymorphisms within three genes: P2X ligand gated ion channel 7 (P2X7R), P2X ligand gated ion channel 4 (P2X4R) and calcium/calmodulin-dependent protein kinase kinase 2 beta (CAMKK2) on susceptibility. Thirty single nucleotide polymorphisms (SNPs) were genotyped in NTM patients (n = 124) and healthy controls (n = 229). Weak associations were found between individual alleles in P2X7R and disease but were not significant in multivariate analyses adjusted to account for gender. Haplotypes spanning the three genes were derived using the fastPHASE algorithm. This yielded 27 haplotypes with frequencies >1% and accounting for 63.3% of the combined cohort. In univariate analyses, seven of these haplotypes displayed associations with NTM disease above our preliminary cut-off (p ≤ 0.20). When these were carried forward in a logistic regression model, gender and one haplotype (SH95) were independently associated with the disease (model p P2X7R and CAMKK2 in pathways affecting pulmonary NTM disease.

  20. Tumor necrosis factor haplotype diversity in Mestizo and native populations of Mexico.

    Science.gov (United States)

    Castro-Martínez, X H; Leal-Cortés, C; Flores-Martínez, S E; García-Zapién, A G; Sánchez-Corona, J; Portilla-de Buen, E; Gómez-Espinel, I; Zamora-Ginez, I; Pérez-Fuentes, R; Islas-Andrade, S; Revilla-Monsalve, C; Guerrero-Romero, F; Rodríguez-Morán, M; Mendoza-Carrera, F

    2014-04-01

    The so-called tumor necrosis factor (TNF) block includes the TNFA, lymphotoxin alpha and beta (LTA and LTB) genes with single-nucleotide polymorphisms (SNP) and microsatellites with an allele frequency that exhibits interpopulation variability. To date, no reports have included both SNPs and microsatellites at the TNF block to study Mestizo or Amerindian populations from Mexico. In this study, samples of five Mexican Mestizo populations (Durango, Guadalajara, Monterrey, Puebla, and Tierra Blanca) and four native-Mexican populations (North Lacandonians, South Lacandonians, Tepehuanos, and Yaquis) were genotyped for two SNPs (LTA+252A>G and TNFA-308G>A) and four microsatellites (TNFa, d, e, and f), to analyze the genetic substructure of the Mexican population. Allele and haplotype frequencies, linkage disequilibrium (LD), and interpopulation genetic relationships were calculated. There was significant LD along almost all of the TNF block but the lowest D' values were observed for the TNFf-TNFd pair. Mestizos showed higher allele and haplotype diversity than did natives. The genetic differentiation level was reduced among Mestizos; however, a slightly, but significant genetic substructure was observed between northern and southern Mexican Mestizos. Among the Amerindian populations, the genetic differentiation level was significantly elevated, particularly in both North and South Lacandonians. Furthermore, among Southern Lacandonians, inhabitants of Lacanja town were the most differentiated from all the Mexicans analyzed. The data presented here will serve as a reference for further population and epidemiological studies including these TNF polymorphisms in the Mexican population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Program death 1 (PD1) haplotyping in patients with breast carcinoma.

    Science.gov (United States)

    Haghshenas, Mohammad Reza; Naeimi, Sirous; Talei, Abdolrasoul; Ghaderi, Abbas; Erfani, Nasrollah

    2011-08-01

    Located on chromosome 2q37.3, the programmed death 1 (PD1) gene encodes for PD-1 (also known as CD279), a negative co-stimulator in the immune system. PD-1 renders potent inhibitory effects on T and B lymphocytes as well as monocyte responses. Expression of PD-1 ligands by tumor cells has been reported to contribute in immune system evasion. We aimed, in current study, to investigate the association of two single nucleotide polymorphisms in PD1 gene, +7146 G to A (PD-1.3) and +7785 C to T (PD-1.5 or +872), with susceptibility and/or progression of breast carcinoma. Four hundred forty-three women with breast cancer and 328 age-sex match healthy donors were recruited in present study. Genotyping was performed using Nested polymerase chain reaction-restriction fragment length polymorphisms. Arlequin software package was used to check for the Hardy-Weinberg equilibration and to determine the haplotypes. Results revealed no significant differences in the frequencies of genotypes and alleles at PD-1.3 (P=0.252 and 0.279 for genotypes and alleles, respectively) and PD-1.5 positions (P=0.522 and 0.278 for genotypes and alleles, respectively). Four haplotypes were observed among populations with no differences in the frequency between patients and controls. Our results also revealed no association between PD1 genotypes and tumor stage, tumor size, tumor grade, lymph node involvement, vascular invasion, distant metastasis, and Nottingham prognostic index. Present data do not confirm association of PD-1.3 (+7146) G/A and PD-1.5 (+7785 or +872) C/T genetic markers with susceptibility of Iranians to breast cancer.

  2. Common electronic origin of superconductivity in (Li,Fe)OHFeSe bulk superconductor and single-layer FeSe/SrTiO3 films.

    Science.gov (United States)

    Zhao, Lin; Liang, Aiji; Yuan, Dongna; Hu, Yong; Liu, Defa; Huang, Jianwei; He, Shaolong; Shen, Bing; Xu, Yu; Liu, Xu; Yu, Li; Liu, Guodong; Zhou, Huaxue; Huang, Yulong; Dong, Xiaoli; Zhou, Fang; Liu, Kai; Lu, Zhongyi; Zhao, Zhongxian; Chen, Chuangtian; Xu, Zuyan; Zhou, X J

    2016-02-08

    The mechanism of high-temperature superconductivity in the iron-based superconductors remains an outstanding issue in condensed matter physics. The electronic structure plays an essential role in dictating superconductivity. Recent revelation of distinct electronic structure and high-temperature superconductivity in the single-layer FeSe/SrTiO3 films provides key information on the role of Fermi surface topology and interface in inducing or enhancing superconductivity. Here we report high-resolution angle-resolved photoemission measurements on the electronic structure and superconducting gap of an FeSe-based superconductor, (Li0.84Fe0.16)OHFe0.98Se, with a Tc at 41 K. We find that this single-phase bulk superconductor shows remarkably similar electronic behaviours to that of the superconducting single-layer FeSe/SrTiO3 films in terms of Fermi surface topology, band structure and the gap symmetry. These observations provide new insights in understanding high-temperature superconductivity in the single-layer FeSe/SrTiO3 films and the mechanism of superconductivity in the bulk iron-based superconductors.

  3. A method for allocating low-coverage sequencing resources by targeting haplotypes rather than individuals.

    Science.gov (United States)

    Ros-Freixedes, Roger; Gonen, Serap; Gorjanc, Gregor; Hickey, John M

    2017-10-25

    This paper describes a heuristic method for allocating low-coverage sequencing resources by targeting haplotypes rather than individuals. Low-coverage sequencing assembles high-coverage sequence information for every individual by accumulating data from the genome segments that they share with many other individuals into consensus haplotypes. Deriving the consensus haplotypes accurately is critical for achieving a high phasing and imputation accuracy. In order to enable accurate phasing and imputation of sequence information for the whole population, we allocate the available sequencing resources among individuals with existing phased genomic data by targeting the sequencing coverage of their haplotypes. Our method, called AlphaSeqOpt, prioritizes haplotypes using a score function that is based on the frequency of the haplotypes in the sequencing set relative to the target coverage. AlphaSeqOpt has two steps: (1) selection of an initial set of individuals by iteratively choosing the individuals that have the maximum score conditional on the current set, and (2) refinement of the set through several rounds of exchanges of individuals. AlphaSeqOpt is very effective for distributing a fixed amount of sequencing resources evenly across haplotypes, which results in a reduction of the proportion of haplotypes that are sequenced below the target coverage. AlphaSeqOpt can provide a greater proportion of haplotypes sequenced at the target coverage by sequencing less individuals, as compared with other methods that use a score function based on haplotype frequencies in the population. A refinement of the initially selected set can provide a larger more diverse set with more unique individuals, which is beneficial in the context of low-coverage sequencing. We extend the method with an approach for filtering rare haplotypes based on their flanking haplotypes, so that only those that are likely to derive from a recombination event are targeted. We present a method for

  4. Chronic inflammatory state in sickle cell anemia patients is associated with HBB(*)S haplotype.

    Science.gov (United States)

    Bandeira, Izabel C J; Rocha, Lillianne B S; Barbosa, Maritza C; Elias, Darcielle B D; Querioz, José A N; Freitas, Max Vitor Carioca; Gonçalves, Romélia P

    2014-02-01

    The chronic inflammatory state in sickle cell anemia (SCA) is associated with several factors such as the following: endothelial damage; increased production of reactive oxygen species; hemolysis; increased expression of adhesion molecules by leukocytes, erythrocytes, and platelets; and increased production of proinflammatory cytokines. Genetic characteristics affecting the clinical severity of SCA include variations in the hemoglobin F (HbF) level, coexistence of alpha-thalassemia, and the haplotype associated with the HbS gene. The different haplotypes of SCA are Bantu, Benin, Senegal, Cameroon, and Arab-Indian. These haplotypes are associated with ethnic groups and also based on the geographical origin. Studies have shown that the Bantu haplotype is associated with higher incidence of clinical complications than the other haplotypes and is therefore considered to have the worst prognosis. This study aimed to evaluate the profile of the proinflammatory cytokines interleukin-6, tumor necrosis factor-α, and interleukin-17 in patients with SCA and also to assess the haplotypes associated with beta globin cluster S (HBB(*)S). We analyzed a total of 62 patients who had SCA and had been treated with hydroxyurea; they had received a dose ranging between 15 and 25 (20.0±0.6)mg/kg/day for 6-60 (18±3.4)months; their data were compared with those for 30 normal individuals. The presence of HbS was detected and the haplotypes of the beta S gene cluster were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Our study demonstrated that SCA patients have increased inflammatory profile when compared to the healthy individuals. Further, analysis of the association between the haplotypes and inflammatory profile showed that the levels of IL-6 and TNF-α were greater in subjects with the Bantu/Bantu haplotype than in subjects with the Benin/Benin haplotype. The Bantu/Benin haplotype individuals had lower levels of cytokines than those with

  5. HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.

    Science.gov (United States)

    Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia

    2017-12-15

    Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  6. Common Elements of Risk

    National Research Council Canada - National Science Library

    Alberts, Christopher J

    2006-01-01

    .... It is now common for multiple organizations to work collaboratively in pursuit of a single mission, which creates a degree of programmatic and process complexity that can be difficult to manage effectively...

  7. Musical aptitude is associated with AVPR1A-haplotypes.

    Directory of Open Access Journals (Sweden)

    Liisa T Ukkola

    Full Text Available Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A, serotonin transporter (SLC6A4, catecol-O-methyltranferase (COMT, dopamin receptor D2 (DRD2 and tyrosine hydroxylase 1 (TPH1, genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT and Carl Seashores tests for pitch (SP and for time (ST. Data on creativity in music (composing, improvising and/or arranging music was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2 = .84; composing h(2 = .40; arranging h(2 = .46; improvising h(2 = .62 in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001. We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3 and KMT (p = 0.0008; corrected p = 0.00002, SP (p = 0.0261; corrected p = 0.0072 and combined music test scores (COMB (p = 0.0056; corrected p = 0.0006. AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184 and COMB (p = 0.0083; corrected p = 0.0040 using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment

  8. Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values

    Directory of Open Access Journals (Sweden)

    Schrooten Chris

    2009-01-01

    Full Text Available Abstract The aim of this paper was to compare the effect of haplotype definition on the precision of QTL-mapping and on the accuracy of predicted genomic breeding values. In a multiple QTL model using identity-by-descent (IBD probabilities between haplotypes, various haplotype definitions were tested i.e. including 2, 6, 12 or 20 marker alleles and clustering base haplotypes related with an IBD probability of > 0.55, 0.75 or 0.95. Simulated data contained 1100 animals with known genotypes and phenotypes and 1000 animals with known genotypes and unknown phenotypes. Genomes comprising 3 Morgan were simulated and contained 74 polymorphic QTL and 383 polymorphic SNP markers with an average r2 value of 0.14 between adjacent markers. The total number of haplotypes decreased up to 50% when the window size was increased from two to 20 markers and decreased by at least 50% when haplotypes related with an IBD probability of > 0.55 instead of > 0.95 were clustered. An intermediate window size led to more precise QTL mapping. Window size and clustering had a limited effect on the accuracy of predicted total breeding values, ranging from 0.79 to 0.81. Our conclusion is that different optimal window sizes should be used in QTL-mapping versus genome-wide breeding value prediction.

  9. Inheritance of the 8.1 ancestral haplotype in recurrent pregnancy loss

    DEFF Research Database (Denmark)

    Kolte, Astrid M; Nielsen, Henriette S; Steffensen, Rudi

    2015-01-01

    BACKGROUND AND OBJECTIVES: The 8.1 ancestral haplotype (AH) (HLA-A1, C7, B8, C4AQ0, C4B1, DR3, DQ2) is a remarkably long and conserved haplotype in the human major histocompatibility complex. It has been associated with both beneficial and detrimental effects, consistent with antagonistic...

  10. The JAK2 46/1 haplotype in Budd-Chiari syndrome and portal vein thrombosis

    NARCIS (Netherlands)

    J.H. Smalberg (Jasper); S. Darwish Murad (Sarwa); E.M. Koehler (Edith); A. Plessier (Aurelie); S. Seijo (Susana); J. Trebicka (Jonel); M. Primignani (Massimo); M.P.M. de Maat (Moniek); J.C. García-Pagán (Juan Carlos); D.C. Valla (Dominique Charle); H.L.A. Janssen (Harry); F.W.G. Leebeek (Frank)

    2011-01-01

    textabstractThe germline JAK2 46/1 haplotype has been associated with the development of JAK2V617F-positive as well as JAK2V617F-negative myeloproliferative neoplasms (MPNs). In this study we examined the role of the 46/1 haplotype in the etiology and clinical presentation of patients with

  11. Genotype and Haplotype Analysis of ABCB1 at 1236, 2677 and ...

    African Journals Online (AJOL)

    Genotype and Haplotype Analysis of ABCB1 at 1236, 2677 and 3435 among Jordanian Population. ... Tropical Journal of Pharmaceutical Research ... Purpose: To determine the frequencies of important allelic variants and their haplotype frequencies of the gene among Jordanian population and to compare findings with ...

  12. Haplotype structure in Ashkenazi Jewish BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Im, Kate M; Kirchhoff, Tomas; Wang, Xianshu

    2011-01-01

    indicate that long-range haplotypes are expected in the context of a genome-wide survey. Our results are consistent with the hypothesis that a local bottleneck effect from population size constriction events could by chance have resulted in the large haplotype blocks observed at high frequency in the BRCA1...

  13. Brazilian Angiostrongylus cantonensis haplotypes, ac8 and ac9, have two different biological and morphological profiles

    Directory of Open Access Journals (Sweden)

    Tainá CC Monte

    2014-12-01

    Full Text Available Angiostrongylus cantonensis is the etiologic agent of eosinophilic meningoencephalitis in humans. Cases have been recorded in many parts of the world, including Brazil. The aim of this study was to compare the differences in the biology and morphology of two different Brazilian haplotypes of A. : ac8 and ac9. A significantly larger number of L1 larvae eliminated in the faeces of rodents at the beginning of the patent period was observed for ac9 haplotype and compared to the total of L1 larvae eliminated, there was a significant difference between the two haplotypes. The ac9 haplotype showed a significant difference in the proportion of female and male specimens (0.6:1, but the same was not observed for ac8 (1.2:1. The morphometric analysis showed that male and female specimens isolated from ac8 haplotype were significantly larger with respect to body length, oesophagus length, spicule length (male and distance from the anus to the rear end (female compared to specimens from ac9. The morphological analysis by light microscopy showed little variation in the level of bifurcations at the lateral rays in the right lobe of the copulatory bursa between the two haplotypes. The biological, morphological and morphometric variations observed between the two haplotypes agree with the observed variation at the molecular level using the cytochrome oxidase subunit I marker and reinforce the possible influence of geographical isolation on the development of these haplotypes.

  14. Brazilian Angiostrongylus cantonensis haplotypes, ac8 and ac9, have two different biological and morphological profiles.

    Science.gov (United States)

    Monte, Tainá C C; Gentile, Rosana; Garcia, Juberlan; Mota, Ester; Santos, Jeannie N; Maldonado Júnior, Arnaldo

    2014-12-01

    Angiostrongylus cantonensis is the etiologic agent of eosinophilic meningoencephalitis in humans. Cases have been recorded in many parts of the world, including Brazil. The aim of this study was to compare the differences in the biology and morphology of two different Brazilian haplotypes of A. cantonensis: ac8 and ac9. A significantly larger number of L1 larvae eliminated in the faeces of rodents at the beginning of the patent period was observed for ac9 haplotype and compared to the total of L1 larvae eliminated, there was a significant difference between the two haplotypes. The ac9 haplotype showed a significant difference in the proportion of female and male specimens (0.6:1), but the same was not observed for ac8 (1.2:1). The morphometric analysis showed that male and female specimens isolated from ac8 haplotype were significantly larger with respect to body length, oesophagus length, spicule length (male) and distance from the anus to the rear end (female) compared to specimens from ac9. The morphological analysis by light microscopy showed little variation in the level of bifurcations at the lateral rays in the right lobe of the copulatory bursa between the two haplotypes. The biological, morphological and morphometric variations observed between the two haplotypes agree with the observed variation at the molecular level using the cytochrome oxidase subunit I marker and reinforce the possible influence of geographical isolation on the development of these haplotypes.

  15. Musical aptitude is associated with AVPR1A-haplotypes.

    Science.gov (United States)

    Ukkola, Liisa T; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-05-20

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2) = .84; composing h(2) = .40; arranging h(2) = .46; improvising h(2) = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior.

  16. Musical Aptitude Is Associated with AVPR1A-Haplotypes

    Science.gov (United States)

    Ukkola, Liisa T.; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-01-01

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h2 = .84; composing h2 = .40; arranging h2 = .46; improvising h2 = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior. PMID:19461995

  17. IL10 GGC haplotype is positively and HLA-DQA1*05-DQB1*02 is negatively associated with radiographic progression in undifferentiated arthritis.

    Science.gov (United States)

    Ursum, Jennie; van der Weijden, Mignon A C; van Schaardenburg, Dirkjan; Prins, Arend P A; Dijkmans, Ben A C; Twisk, Jos W R; Crusius, Jakob B A; van der Horst-Bruinsma, Irene E

    2010-07-01

    In rheumatoid arthritis (RA), many genetic markers, such as the shared-epitope (SE) alleles, are described in association with radiographic progression, but limited data are available on undifferentiated arthritis (UA). We investigated whether single-nucleotide polymorphisms (SNP) and haplotypes in immune response genes and HLA class II alleles are associated with radiographic progression in patients with early UA. Progression of radiographic damage was determined in white Dutch patients with early UA after 2 years of followup. Severe progression was defined as an increase in Sharp/van der Heijde Score > or = 5 points after 2 years of followup. The remainder was classified as mild. These SNP were genotyped by Taqman technology: tumor necrosis factor (TNF) -1031, -863, -857, -308, -238; lymphotoxin-alpha (LTA) +368, +252; interleukin 10 (IL10) -2849, -1082, -819; IL1A -889, IL1B -31, +3953; and IL1RN +2018. Carriage of SE alleles and HLA-DQA1*05-DQB1*02 haplotype was established. These markers were analyzed in relation to radiographic progression. Forty-eight out of 151 patients with early UA had severe radiographic progression. Severe radiographic progression was associated with an increased carrier frequency of SE alleles (OR 5.12, 95% CI 2.0-13.1, p HLA-DQA1*05-DQB1*02 haplotype (OR 0.3, 95% CI, 0.1-0.8, p = 0.013) and with allele TNF -308A (OR 0.4, 95% CI, 0.2-0.9, p = 0.02). The SE and the IL10 GGC haplotype are associated with severe progression of radiographic damage, in contrast to the DQA1*05-DQB1*02 haplotype and the TNF -308A allele, which are associated with mild radiographic progression in early UA.

  18. Haplotype-based case-control study on human apurinic/apyrimidinic endonuclease 1/redox effector factor-1 gene and essential hypertension.

    Science.gov (United States)

    Naganuma, Takahiro; Nakayama, Tomohiro; Sato, Naoyuki; Fu, Zhenyan; Soma, Masayoshi; Yamaguchi, Mai; Shimodaira, Masanori; Aoi, Noriko; Usami, Ron

    2010-02-01

    Oxidative DNA damage is involved in the pathophysiology of essential hypertension (EH), which is a multifactorial disorder. Apurinic/apyrimidinic endonuclease 1/redox effector factor-1 (APE1/REF-1) is an essential endonuclease in the base excision repair pathway of oxidatively damaged DNA, in addition to having reducing properties that promote the binding of redox-sensitive transcription factors. Blood pressure in APE1/REF-1-knockout mice is reported to be significantly higher than in wild-type mice. The aim of this study was to investigate the relationship between EH and the human APE1/REF-1 gene through a haplotype-based case-control study using single-nucleotide polymorphisms (SNPs). We selected five SNPs in the human APE1/REF-1 gene (rs1760944, rs3136814, rs17111967, rs3136817, and rs1130409), and performed case-control studies in 265 EH patients and 266 age-matched normotensive (NT) subjects. rs17111967 was found to show nonheterogeneity among Japanese subjects. There were no significant differences in the overall distribution of genotypes or alleles for each SNP between EH and NT groups. In the overall distribution of the haplotype-based case-control study constructed based on rs1760944, rs3136817, and rs1130409, the frequency of the G-T-T haplotype was significantly higher in the EH group than in the NT group (2.1% vs. 0.0%, P = 0.001). Multiple logistic regression analysis also revealed significant differences for the G-T-T haplotype, even after adjustment for confounding factors (OR = 8.600, 95% CI: 1.073-68.951, P = 0.043). Based on the present results, the G-T-T haplotype appears to be a genetic marker of EH, and the APE1/REF-1 gene appears to be a susceptibility gene for EH.

  19. Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method

    DEFF Research Database (Denmark)

    Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels

    2014-01-01

    method can be used for cluster analysis to further validate the discrete Laplace method. A very important practical fact is that the calculations can be performed on a normal computer. We identified two sub-clusters of the Eastern and Western European Y-STR haplotypes similar to results of previous......The European Y-chromosomal short tandem repeat (STR) haplotype distribution has previously been analysed in various ways. Here, we introduce a new way of analysing population substructure using a new method based on clustering within the discrete Laplace exponential family that models...... the probability distribution of the Y-STR haplotypes. Creating a consistent statistical model of the haplotypes enables us to perform a wide range of analyses. Previously, haplotype frequency estimation using the discrete Laplace method has been validated. In this paper we investigate how the discrete Laplace...

  20. Peptide-binding motifs of two common equine class I MHC molecules in Thoroughbred horses.

    Science.gov (United States)

    Bergmann, Tobias; Lindvall, Mikaela; Moore, Erin; Moore, Eugene; Sidney, John; Miller, Donald; Tallmadge, Rebecca L; Myers, Paisley T; Malaker, Stacy A; Shabanowitz, Jeffrey; Osterrieder, Nikolaus; Peters, Bjoern; Hunt, Donald F; Antczak, Douglas F; Sette, Alessandro

    2017-05-01

    Quantitative peptide-binding motifs of MHC class I alleles provide a valuable tool to efficiently identify putative T cell epitopes. Detailed information on equine MHC class I alleles is still very limited, and to date, only a single equine MHC class I allele, Eqca-1*00101 (ELA-A3 haplotype), has been characterized. The present study extends the number of characterized ELA class I specificities in two additional haplotypes found commonly in the Thoroughbred breed. Accordingly, we here report quantitative binding motifs for the ELA-A2 allele Eqca-16*00101 and the ELA-A9 allele Eqca-1*00201. Utilizing analyses of endogenously bound and eluted ligands and the screening of positional scanning combinatorial libraries, detailed and quantitative peptide-binding motifs were derived for both alleles. Eqca-16*00101 preferentially binds peptides with aliphatic/hydrophobic residues in position 2 and at the C-terminus, and Eqca-1*00201 has a preference for peptides with arginine in position 2 and hydrophobic/aliphatic residues at the C-terminus. Interestingly, the Eqca-16*00101 motif resembles that of the human HLA A02-supertype, while the Eqca-1*00201 motif resembles that of the HLA B27-supertype and two macaque class I alleles. It is expected that the identified motifs will facilitate the selection of candidate epitopes for the study of immune responses in horses.

  1. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms: A cross-sectional descriptive study of 13,473 Chinese adult women.

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-11-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited.We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms.In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D' and r values were 0.883 and 0.143, respectively.In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs.

  2. Differential effect of disease-associated ST8SIA2 haplotype on cerebral white matter diffusion properties in schizophrenia and healthy controls.

    Science.gov (United States)

    Fullerton, Janice M; Klauser, Paul; Lenroot, Rhoshel K; Shaw, Alex D; Overs, Bronwyn; Heath, Anna; Cairns, Murray J; Atkins, Joshua; Scott, Rodney; Schofield, Peter R; Weickert, Cyndi Shannon; Pantelis, Christos; Fornito, Alex; Whitford, Thomas J; Weickert, Thomas W; Zalesky, Andrew

    2018-01-22

    Brain white matter abnormalities are evident in individuals with schizophrenia, and also their first-degree relatives, suggesting that some alterations may relate to underlying genetic risk. The ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 (ST8SIA2) gene, which encodes the alpha-2,8-sialyltransferase 8B enzyme that aids neuronal migration and synaptic plasticity, was previously implicated as a schizophrenia susceptibility gene. This study examined the extent to which specific haplotypes in ST8SIA2 influence white matter microstructure using diffusion-weighted imaging of individuals with schizophrenia (n = 281) and healthy controls (n = 172), recruited across five Australian sites. Interactions between diagnostic status and the number of haplotype copies (0 or ≥1) were tested across all white matter voxels with cluster-based statistics. Fractional anisotropy (FA) in the right parietal lobe was found to show a significant interaction between diagnosis and ST8SIA2 protective haplotype (p matter fiber tracking revealed that the region-of-interest was traversed by portions of the superior longitudinal fasciculus, corona radiata, and posterior limb of internal capsule. Post hoc analysis revealed that reduced FA in this regional juncture correlated with reduced IQ in people with schizophrenia. The ST8SIA2 risk haplotype copy number did not show any differential effects on white matter. This study provides a link between a common disease-associated haplotype and specific changes in white matter microstructure, which may relate to resilience or risk for mental illness, providing further compelling evidence for involvement of ST8SIA2 in the pathophysiology of schizophrenia.

  3. Analysis of HLA class II haplotypes in the Cayapa indians of ecuador: A novel DRBI allele reveals evidence for convergent evolution and balancing selection at position 86

    Energy Technology Data Exchange (ETDEWEB)

    Titus-Trachtenberg, E.A.; Erlich, H. (Roche Molecular Systems, Alameda, CA (United States)); Rickards, O.; De Stefano, G.F. (Universita di Roma, Rome (Italy))

    1994-07-01

    PCR amplification, oligonucleotide probe typing, and sequencing were used to analyze the HLA class II loci (DRB1, DQA1, DAB1, and DPB1) of an isolated South Amerindian tribe. Here the authors report HLA class II variation, including the identification of a new DRB1 allele, several novel DR/DQ haplotypes, and an unusual distribution of DPB1 alleles, among the Cayapa Indians (N=100) of Ecuador. A general reduction of HLA class II allelic variation in the Cayapa is consistent with a population bottleneck during the colonization of the Americas. The new Cayapa DRB1 allele, DRB1[sup *]08042, which arose by a G[yields]T point mutation in the parental DRB1[sup *]0802, contains a novel Val codon (GTT) at position 86. The generation of DRB1[sup *]08042 (Val-86) from DRB1[sup *]0802 (Gly-86) in the Cayapa, by a different mechanism than the (GT[yields]TG) change in the creation of DRB1[sub *]08041 (Val-86) from DRB1[sup *]0802 in Africa, implicates selection in the convergent evolution of position 86 DR[beta] variants. The DRB1[sup *]08042 allele has not been found in >1,800 Amerindian haplotypes and thus presumably arose after the Cayapa separated from other South American Amerindians. Selection pressure for increased haplotype diversity can be inferred in the generation and maintenance of three new DRB1[sup *]08042 haplotypes and several novel DR/DQ haplotypes in this population. The DPB1 allelic distribution in the Cayapa is also extraordinary, with two alleles, DPB1[sup *]1401, a very rare allele in North American Amerindian populations, and DPB1[sup *]0402, the most common Amerindian DPB1 allele, constituting 89% of the Cayapa DPB1. These data are consistent with the postulated rapid rate of evolution as noted for the class I HLA-B locus of other South American Indians. 34 refs., 2 figs., 2 tabs.

  4. Type 2 Active Galactic Nuclei with Double-peaked [O III] Lines. II. Single AGNs with Complex Narrow-line Region Kinematics are More Common than Binary AGNs

    Science.gov (United States)

    Shen, Yue; Liu, Xin; Greene, Jenny E.; Strauss, Michael A.

    2011-07-01

    Approximately 1% of low-redshift (z interpreted as either due to kinematics, such as biconical outflows and/or disk rotation of the narrow line region (NLR) around single black holes, or due to the relative motion of two distinct NLRs in a merging pair of AGNs. Here, we report follow-up near-infrared (NIR) imaging and optical slit spectroscopy of 31 double-peaked [O III] type 2 AGNs drawn from the Sloan Digital Sky Survey (SDSS) parent sample presented in Liu et al. The NIR imaging traces the old stellar population in each galaxy, while the optical slit spectroscopy traces the NLR gas. These data reveal a mixture of origins for the double-peaked feature. Roughly 10% of our objects are best explained by binary AGNs at (projected) kpc-scale separations, where two stellar components with spatially coincident NLRs are seen. ~50% of our objects have [O III] emission offset by a few kpc, corresponding to the two velocity components seen in the SDSS spectra, but there are no spatially coincident double stellar components seen in the NIR imaging. For those objects with sufficiently high-quality slit spectra, we see velocity and/or velocity dispersion gradients in [O III] emission, suggestive of the kinematic signatures of a single NLR. The remaining ~40% of our objects are ambiguous and will need higher spatial resolution observations to distinguish between the two scenarios. Our observations therefore favor the kinematics scenario with a single AGN for the majority of these double-peaked [O III] type 2 AGNs. We emphasize the importance of combining imaging and slit spectroscopy in identifying kpc-scale binary AGNs, i.e., in no cases does one of these alone allow an unambiguous identification. We estimate that ~0.5%-2.5% of the z ~ 150 km s-1. Based in part on observations obtained with the 6.5 m Magellan telescopes located at Las Campanas Observatory, Chile, and with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research

  5. ParaHaplo: A program package for haplotype-based whole-genome association study using parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2009-10-01

    Full Text Available Abstract Background Since more than a million single-nucleotide polymorphisms (SNPs are analyzed in any given genome-wide association study (GWAS, performing multiple comparisons can be problematic. To cope with multiple-comparison problems in GWAS, haplotype-based algorithms were developed to correct for multiple comparisons at multiple SNP loci in linkage disequilibrium. A permutation test can also control problems inherent in multiple testing; however, both the calculation of exact probability and the execution of permutation tests are time-consuming. Faster methods for calculating exact probabilities and executing permutation tests are required. Methods We developed a set of computer programs for the parallel computation of accurate P-values in haplotype-based GWAS. Our program, ParaHaplo, is intended for workstation clusters using the Intel Message Passing Interface (MPI. We compared the performance of our algorithm to that of the regular permutation test on JPT and CHB of HapMap. Results ParaHaplo can detect smaller differences between 2 populations than SNP-based GWAS. We also found that parallel-computing techniques made ParaHaplo 100-fold faster than a non-parallel version of the program. Conclusion ParaHaplo is a useful tool in conducting haplotype-based GWAS. Since the data sizes of such projects continue to increase, the use of fast computations with parallel computing--such as that used in ParaHaplo--will become increasingly important. The executable binaries and program sources of ParaHaplo are available at the following address: http://sourceforge.jp/projects/parallelgwas/?_sl=1

  6. Characterization of N-acetyltransferase 1 and 2 polymorphisms and haplotype analysis for inflammatory bowel disease and sporadic colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Cobbs Gary A

    2007-05-01

    Full Text Available Abstract Background N-acetyltransferase 1 (NAT1 and 2 (NAT2 are polymorphic isoenzymes responsible for the metabolism of numerous drugs and carcinogens. Acetylation catalyzed by NAT1 and NAT2 are important in metabolic activation of arylamines to electrophilic intermediates that initiate carcinogenesis. Inflammatory bowel diseases (IBD consist of Crohn's disease (CD and ulcerative colitis (UC, both are associated with increased colorectal cancer (CRC risk. We hypothesized that NAT1 and/or NAT2 polymorphisms contribute to the increased cancer evident in IBD. Methods A case control study was performed with 729 Caucasian participants, 123 CRC, 201 CD, 167 UC, 15 IBD dysplasia/cancer and 223 controls. NAT1 and NAT2 genotyping were performed using Taqman based techniques. Eight single nucleotide polymorphisms (SNPs were characterized for NAT1 and 7 SNPs for NAT2. Haplotype frequencies were estimated using an Expectation-Maximization (EM method. Disease groups were compared to a control group for the frequencies at each individual SNP separately. The same groups were compared for the frequencies of NAT1 and NAT2 haplotypes and deduced NAT2 phenotypes. Results No statistically significant differences were found for any comparison. Strong linkage disequilibrium was present among both the NAT1 SNPs and the NAT2 SNPs. Conclusion This study did not demonstrate an association between NAT1 and NAT2 polymorphisms and IBD or sporadic CRC, although power calculations indicate this study had sufficient sample size to detect differences in frequency as small as 0.05 to 0.15 depending on SNP or haplotype.

  7. Vascular endothelial growth factor genetic polymorphisms and haplotypes in female patients with bisphosphonate-related osteonecrosis of the jaws.

    Science.gov (United States)

    Arduino, P G; Menegatti, E; Scoletta, M; Battaglio, C; Mozzati, M; Chiecchio, A; Berardi, D; Vandone, A M; Donadio, M; Gandolfo, S; Scully, C; Broccoletti, R

    2011-07-01

    To investigate the polymorphisms of the vascular endothelial growth factor (VEGF) gene in relation to female patients who developed bisphosphonate-related osteonecrosis of the jaws (BRONJ). Test subjects were 30 Italian female patients with BRONJ (Group A). Control subjects were 30 female patients with a history of intravenous bisphosphonate use without any evidence of osteonecrosis (Group B) and 125 unrelated healthy volunteers (Group C). Three single-nucleotide polymorphisms were investigated: -634 G>C, occurring in 5' untranslated region (UTR); +936 C>T, occurring in 3' UTR; and -2578 C>A of the promoter region. The frequency of the VEGF CAC (+936/-2578/-634) haplotype was increased in patients with BRONJ, compared with female disease-negative controls [odds ratio (OR) = 2.76, 95% CI = 1.09-4.94, P = 0.039; corrected P value: P(c) = 0.117], and was also increased compared with female healthy controls (OR = 2.11, 95% CI = 1.14-3.89, P = 0.024; corrected P value: P(c) = 0.072). The CC homozygotes of -634G>C of VEGF gene and AA homozygotes of -2578C>A have also been significantly correlated in female patients who developed BRONJ compared with healthy controls (OR = 2.04, 95% CI = 1.12-3.70, P = 0.008; corrected P value: P(c) = 0.024). These results suggest a possible haplotype effect of VEGF polymorphisms expression in BRONJ Italian female patients. Studies with different and larger populations possibly using TagSNP to represent all haplotypes within the VEGF gene are needed to further delineate the genetic contribution of this gene to BRONJ. © 2011 John Wiley & Sons A/S.

  8. The HLA-B*39 allele increases type 1 diabetes risk conferred by HLA-DRB1*04:04-DQB1*03:02 and HLA-DRB1*08-DQB1*04 class II haplotypes.

    Science.gov (United States)

    Mikk, M-L; Kiviniemi, M; Laine, A-P; Härkönen, T; Veijola, R; Simell, O; Knip, M; Ilonen, J

    2014-01-01

    To further characterise the effect of the HLA-B*39 allele on type 1 diabetes risk we assessed its role in different HLA-DR/DQ haplotypes and genotypes using 1764 nuclear families with a diabetic child collected in the framework of the Finnish Paediatric Diabetes Register. HLA assays were based on sequence specific hybridization using lanthanide labelled oligonucleotide probes. Transmissions of major HLA-DR/DQ haplotypes with and without the HLA-B*39 allele to diabetic index cases were analysed by direct haplotype and allele counting. The HLA-B*39 allele significantly increased the disease risk conferred by DRB1*04:04-DQA1*03-DQB1*03:02 and (DR8)-DQB1*04 haplotypes. The same effect was observed on genotype level as disease association for the HLA-B*39 allele was observed in multiple genotypes containing DRB1*04:04-DQA1*03-DQB1*03:02 or (DR8)-DQB1*04 haplotypes. Finally we considered the two common subtypes of the HLA-B*39 allele, B*39:01 and B*39:06 and observed their unequal distribution when stratified for specific DR-DQ haplotypes. The risk for type 1 diabetes conferred by certain DR/DQ haplotypes is modified by the presence of the HLA-B*39 and this confirms the independent disease predisposing effect of the HLA-B*39 allele. The results can be applied in enhancing the sensitivity and specificity of DR/DQ based screening programs for subjects at disease risk. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  9. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice

    Directory of Open Access Journals (Sweden)

    Nisha Singh

    2017-06-01

    Full Text Available The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color (Rc, grain size (GS3 and eight different starch synthase genes (GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa, and SSIVb. Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  10. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice.

    Science.gov (United States)

    Singh, Nisha; Singh, Balwant; Rai, Vandna; Sidhu, Sukhjeet; Singh, Ashok K; Singh, Nagendra K

    2017-01-01

    The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color ( Rc ), grain size ( GS3 ) and eight different starch synthase genes ( GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa , and SSIVb ). Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  11. Analysis of 24 Y chromosomal STR haplotypes in a Chinese Han population sample from Henan Province, Central China.

    Science.gov (United States)

    Shi, Meisen; Liu, Yaju; Zhang, Juntao; Bai, Rufeng; Lv, Xiaojiao; Ma, Shuhua

    2015-07-01

    We analyzed haplotypes for 24 Y chromosomal STRs (Y-STRs), including 17 Yfiler loci (DYS19, DYS385a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS437, DY438, DYS439, DYS448, DYS456, DYS458, DYS635 and Y-GATA-H4) and 7 additional STRs (DYS388, DYS444, DYS447, DYS449, DYS522 and DYS527a/b) in 1100 unrelated Chinese Han individuals from Henan Province using AGCU Y24 STR kit systems. The calculated average gene diversity (GD) values ranged from 0.4105 to 0.9647 for the DYS388 and DYS385a/b loci, respectively. The discriminatory capacity (DC) was 72.91% with 802 observed haplotypes using 17 Yfiler loci, by the addition of 7 Y-STRs to the Yfiler system, the DC was increased to 79.09% while showing 870 observed haplotypes. Among the additional 7 Y-STRs, DYS449, DYS527a/b, DYS444 and DYS522 were major contributors to enhancing discrimination. In the analysis of molecular variance, the Henan Han population clustered with Han origin populations and showed significant differences from other Non-Han populations. In the present study, we report 24 Y-STR population data in Henan Han population, and we emphasize the need for adding additional markers to the commonly used 17 Yfiler loci to achieve more improved discriminatory capacity in a population with low genetic diversity. Copyright © 2015. Published by Elsevier Ireland Ltd.

  12. A deep look at KIR-HLA in Amerindians: comprehensive meta-analysis reveals limited diversity of KIR haplotypes.

    Science.gov (United States)

    Augusto, Danillo G; Hollenbach, Jill A; Petzl-Erler, Maria Luiza

    2015-04-01

    Killer-cell immunoglobulin-like receptors (KIR) are highly polymorphic and have been associated to several diseases. Their ligands are specific human leukocyte antigens (HLA) molecules, expressed on the majority of cells. Only few genetically isolated populations have been characterized for the frequency of KIR-HLA combinations. The aim of this work was summarize and reanalyze the data described in recent publications regarding KIR and HLA in Amerindians. In total, 1258 individuals from 23 Amerindian populations were analyzed. All population samples were previously genotyped for KIR presence/absence polymorphism; KIR allelic content was poorly described. Only 9 of the 23 populations were genotyped for HLA class I. Based on the KIR gene-content profiles, we estimated the most common Amerindian KIR gene-content haplotypes, information never reported before for many of these populations. When the HLA genes started to be analyzed in many of these groups, KIR genes were still not well characterized. Therefore, they have never been analyzed in a joint context. We thoroughly examined the HLA haplotypes of these populations; for the first time, we are showing the frequencies of the known HLA ligands of most of these populations, which had been separately studied for both KIR and HLA. Amerindians exhibits a low diversity of KIR gene-content haplotypes when compared to most worldwide population. We compared the KIR-HLA diversity within and between Amerindian groups trying to understand the natural causes of variation. This study corroborates the hypothesis that demographic factors such as founder effect played a major role in shaping KIR diversity in Amerindians and may contribute to understand the importance of KIR-HLA for human health and disease. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. All rights reserved.

  13. Sequence of a complete chicken BG haplotype shows dynamic expansion and contraction of two gene lineages with particular expression patterns

    DEFF Research Database (Denmark)

    Salomonsen, Jan; Chattaway, John A.; Chan, Andrew C. Y.

    2014-01-01

    complex (MHC), and show striking association with particular autoimmune diseases. In chickens, BG genes encode homologues with somewhat different domain organisation. Only a few BG genes have been characterised, one involved in actin-myosin interaction in the intestinal brush border, and another...... implicated in resistance to viral diseases. We characterise all BG genes in B12 chickens, finding a multigene family organised as tandem repeats in the BG region outside the MHC, a single gene in the MHC (the BF-BL region), and another single gene on a different chromosome. There is a precise cell and tissue...... many hybrid genes, suggesting recombination and/or deletion as major evolutionary forces. We identify BG genes in the chicken whole genome shotgun sequence, as well as by comparison to other haplotypes by fibre fluorescence in situ hybridisation, confirming dynamic expansion and contraction within...

  14. HLA-G regulatory haplotypes and implantation outcome in couples who underwent assisted reproduction treatment.

    Science.gov (United States)

    Costa, Cynthia Hernandes; Gelmini, Georgia Fernanda; Wowk, Pryscilla Fanini; Mattar, Sibelle Botogosque; Vargas, Rafael Gustavo; Roxo, Valéria Maria Munhoz Sperandio; Schuffner, Alessandro; Bicalho, Maria da Graça

    2012-09-01

    The role of HLA-G in several clinical conditions related to reproduction has been investigated. Important polymorphisms have been found within the 5'URR and 3'UTR regions of the HLA-G promoter. The aim of the present study was to investigate 16 SNPs in the 5'URR and 14-bp insertion/deletion (ins/del) polymorphism located in the 3'UTR region of the HLA-G gene and its possible association with the implantation outcome in couples who underwent assisted reproduction treatments (ART). The case group was composed of 25 ART couples. Ninety-four couples with two or more term pregnancies composed the control group. Polymorphism haplotype frequencies of the HLA-G were determined for both groups. The Haplotype 5, Haplotype 8 and Haplotype 11 were absolute absence in ART couples. The HLA-G*01:01:02a, HLA-G*01:01:02b alleles and the 14-bp ins polymorphism, Haplotype 2, showed an increased frequency in case women and similar distribution between case and control men. However, this susceptibility haplotype is significantly presented in case women and in couple with failure implantation after treatment, which led us to suggest a maternal effect, associated with this haplotype, once their presence in women is related to a higher number of couples who underwent ART. Copyright © 2012. Published by Elsevier Inc.

  15. Analysis of HLA-DRB1,DQA1,DQB1 haplotypes in Sardinian centenarians

    Science.gov (United States)

    Scola, Letizia; Lio, Domenico; Candore, Giuseppina; Forte, Giusi I.; Crivello, Antonio; Colonna-Romano, Giuseppina; Pes, Mario G.; Carru, Ciriaco; Ferrucci, Luigi; Deiana, Luca; Baggio, Giovannella; Franceschi, Claudio; Caruso, Calogero

    2009-01-01

    Some genetic determinants of longevity might reside in those polymorphisms for the immune system genes that regulate immune responses. Many longevity association studies focused their attention on HLA (the human MHC) polymorphisms, but discordant results have been obtained. Sardinians are a relatively isolate population and represent a suitable population for association studies. Some HLA-DR and DQ alleles form very stable haplotypes with a strong linkage disequilibrium. In a previous study on Sardinian centenarians we have suggested that HLA-DRB1∗15 allele might be marginally associated to longevity. HLA-DR,DQ haplotypes are in strong linkage disequilibrium and well conserved playing a role in the association to diseases. Hence, we have evaluated, by amplification refractory mutation system/polymerase chain reaction (ARMS-PCR) the HLADQA1 and HLA-DQB1 allele frequencies in 123 centenarians and 92 controls from Sardinia to assess whether the association to HLA-DRB1∗15 allele may be due to the other genes involved in the HLA-DR,DQ haplotypes. The frequencies of HLA-DQA1,DQB1 haplotypes were not significantly modified in centenarians. Nevertheless by evaluating the frequency of DRB1∗15 linked haplotypes, we observed a not significant increase in centenarians of HLA-DQA1∗01,DQB1∗05 and HLA-DQA1∗01,DQB1∗06 haplotypes. These data suggest that these haplotypes might have a role in determining life span expectancy and longevity. PMID:17714903

  16. Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

    Science.gov (United States)

    Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

    2017-02-01

    Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

  17. KIR haplotypes are associated with late-onset type 1 diabetes in European-American families.

    Science.gov (United States)

    Traherne, J A; Jiang, W; Valdes, A M; Hollenbach, J A; Jayaraman, J; Lane, J A; Johnson, C; Trowsdale, J; Noble, J A

    2016-01-01

    Classical human leukocyte antigens (HLA) genes confer the strongest, but not the only, genetic susceptibility to type 1 diabetes. Killer cell immunoglobulin-like receptors (KIR), on natural killer (NK) cells, bind ligands including class I HLA. We examined presence or absence, with copy number, of KIR loci in 1698 individuals, from 339 multiplex type 1 diabetes families, from the Human Biological Data Interchange, previously genotyped for HLA. Combining family data with KIR copy number information allowed assignment of haplotypes using identity by descent. This is the first disease study to use KIR copy number typing and unambiguously define haplotypes by gene transmission. KIR A1 haplotypes were positively associated with T1D in the subset of patients without the high T1D risk HLA genotype, DR3/DR4 (odds ratio=1.29, P=0.0096). The data point to a role for KIR in type 1 diabetes risk in late-onset patients. In the top quartile (age of onset>14), KIR A2 haplotype was overtransmitted (63.4%, odds ratio=1.73, P=0.024) and KIR B haplotypes were undertransmitted (41.1%, odds ratio=0.70, P=0.0052) to patients. The data suggest that inhibitory 'A' haplotypes are predisposing and stimulatory 'B' haplotypes confer protection in both DR3/DR4-negative and late-onset patient groups.

  18. Estimating effects of rare haplotypes on failure time using a penalized Cox proportional hazards regression model

    Directory of Open Access Journals (Sweden)

    Tanck Michael WT

    2008-01-01

    Full Text Available Abstract Background This paper describes a likelihood approach to model the relation between failure time and haplotypes in studies with unrelated individuals where haplotype phase is unknown, while dealing with the problem of unstable estimates due to rare haplotypes by considering a penalized log-likelihood. Results The Cox model presented here incorporates the uncertainty related to the unknown phase of multiple heterozygous individuals as weights. Estimation is performed with an EM algorithm. In the E-step the weights are estimated, and in the M-step the parameter estimates are estimated by maximizing the expectation of the joint log-likelihood, and the baseline hazard function and haplotype frequencies are calculated. These steps are iterated until the parameter estimates converge. Two penalty functions are considered, namely the ridge penalty and a difference penalty, which is based on the assumption that similar haplotypes show similar effects. Simulations were conducted to investigate properties of the method, and the association between IL10 haplotypes and risk of target vessel revascularization was investigated in 2653 patients from the GENDER study. Conclusion Results from simulations and real data show that the penalized log-likelihood approach produces valid results, indicating that this method is of interest when studying the association between rare haplotypes and failure time in studies of unrelated individuals.

  19. Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.

    Science.gov (United States)

    Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H

    2017-11-01

    Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.

  20. Long read nanopore sequencing for detection of HLA and CYP2D6 variants and haplotypes [v2; ref status: indexed, http://f1000r.es/5ev

    Directory of Open Access Journals (Sweden)

    Ron Ammar

    2015-05-01

    Full Text Available Haplotypes are often critical for the interpretation of genetic laboratory observations into medically actionable findings. Current massively parallel DNA sequencing technologies produce short sequence reads that are often unable to resolve haplotype information. Phasing short read data typically requires supplemental statistical phasing based on known haplotype structure in the population or parental genotypic data. Here we demonstrate that the MinION nanopore sequencer is capable of producing very long reads to resolve both variants and haplotypes of HLA-A, HLA-B and CYP2D6 genes important in determining patient drug response in sample NA12878 of CEPH/UTAH pedigree 1463, without the need for statistical phasing. Long read data from a single 24-hour nanopore sequencing run was used to reconstruct haplotypes, which were confirmed by HapMap data and statistically phased Complete Genomics and Sequenom genotypes. Our results demonstrate that nanopore sequencing is an emerging standalone technology with potential utility in a clinical environment to aid in medical decision-making.

  1. Long read nanopore sequencing for detection of HLA and CYP2D6 variants and haplotypes [v1; ref status: indexed, http://f1000r.es/4zj

    Directory of Open Access Journals (Sweden)

    Ron Ammar

    2015-01-01

    Full Text Available Haplotypes are often critical for the interpretation of genetic laboratory observations into medically actionable findings. Current massively parallel DNA sequencing technologies produce short sequence reads that are often unable to resolve haplotype information. Phasing short read data typically requires supplemental statistical phasing based on known haplotype structure in the population or parental genotypic data. Here we demonstrate that the MinION nanopore sequencer is capable of producing very long reads to resolve both variants and haplotypes of HLA-A, HLA-B and CYP2D6 genes important in determining patient drug response in sample NA12878 of CEPH/UTAH pedigree 1463, without the need for statistical phasing. Long read data from a single 24-hour nanopore sequencing run was used to reconstruct haplotypes, which were confirmed by HapMap data and statistically phased Complete Genomics and Sequenom genotypes. Our results demonstrate that nanopore sequencing is an emerging standalone technology with potential utility in a clinical environment to aid in medical decision-making.

  2. Lack of evidence for selection favouring MHC haplotypes that combine high functional diversity.

    Science.gov (United States)

    Gaigher, Arnaud; Roulin, Alexandre; Gharib, Walid H; Taberlet, Pierre; Burri, Reto; Fumagalli, Luca

    2018-01-24

    High rates of gene duplication and the highest levels of functional allelic diversity in vertebrate genomes are the main hallmarks of the major histocompatibility complex (MHC), a multigene family with a primordial role in pathogen recognition. The usual tight linkage among MHC gene duplicates may provide an opportunity for the evolution of haplotypes that associate functionally divergent alleles and thus grant the transmission of optimal levels of diversity to coming generations. Even though such associations may be a crucial component of disease resistance, this hypothesis has been given little attention in wild populations. Here, we leveraged pedigree data from a barn owl (Tyto alba) population to characterize MHC haplotype structure across two MHC class I (MHC-I) and two MHC class IIB (MHC-IIB) duplicates, in order to test the hypothesis that haplotypes' genetic diversity is higher than expected from randomly associated alleles. After showing that MHC loci are tightly linked within classes, we found limited evidence for shifts towards MHC haplotypes combining high diversity. Neither amino acid nor functional within-haplotype diversity were significantly higher than in random sets of haplotypes, regardless of MHC class. Our results therefore provide no evidence for selection towards high-diversity MHC haplotypes in barn owls. Rather, high rates of concerted evolution may constrain the evolution of high-diversity haplotypes at MHC-I, while, in contrast, for MHC-IIB, fixed differences among loci may provide barn owls with already optimized functional diversity. This suggests that at the MHC-I and MHC-IIB respectively, different evolutionary dynamics may govern the evolution of within-haplotype diversity.

  3. Genetic and molecular characterization of three novel S-haplotypes in sour cherry (Prunus cerasus L.).

    Science.gov (United States)

    Tsukamoto, Tatsuya; Potter, Daniel; Tao, Ryutaro; Vieira, Cristina P; Vieira, Jorge; Iezzoni, Amy F

    2008-01-01

    Tetraploid sour cherry (Prunus cerasus L.) exhibits gametophytic self-incompatibility (GSI) whereby the specificity of self-pollen rejection is controlled by alleles of the stylar and pollen specificity genes, S-RNase and SFB (S haplotype-specific F-box protein gene), respectively. As sour cherry selections can be either self-compatible (SC) or self-incompatible (SI), polyploidy per se does not result in SC. Instead the genotype-dependent loss of SI in sour cherry is due to the accumulation of non-functional S-haplotypes. The presence of two or more non-functional S-haplotypes within sour cherry 2x pollen renders that pollen SC. Two new S-haplotypes from sour cherry, S(33) and S(34), that are presumed to be contributed by the P. fruticosa species parent, the complete S-RNase and SFB sequences of a third S-haplotype, S(35), plus the presence of two previously identified sweet cherry S-haplotypes, S(14) and S(16) are described here. Genetic segregation data demonstrated that the S(16)-, S(33)-, S(34)-, and S(35)-haplotypes present in sour cherry are fully functional. This result is consistent with our previous finding that 'hetero-allelic' pollen is incompatible in sour cherry. Phylogenetic analyses of the SFB and S-RNase sequences from available Prunus species reveal that the relationships among S-haplotypes show no correspondence to known organismal relationships at any taxonomic level within Prunus, indicating that polymorphisms at the S-locus have been maintained throughout the evolution of the genus. Furthermore, the phylogenetic relationships among SFB sequences are generally incongruent with those among S-RNase sequences for the same S-haplotypes. Hypotheses compatible with these results are discussed.

  4. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  5. Common Warts

    Science.gov (United States)

    ... from spreading Common warts Symptoms & causes Diagnosis & treatment Advertisement Mayo Clinic does not endorse companies or products. ... a Job Site Map About This Site Twitter Facebook Google YouTube Pinterest Mayo Clinic is a not- ...

  6. Common Warts

    Science.gov (United States)

    ... with HIV/AIDS or people who've had organ transplants Prevention To reduce your risk of common warts: Avoid direct contact with warts. This includes your own warts. Don't pick at warts. Picking may spread the ...

  7. Common Courses for Common Purposes:

    DEFF Research Database (Denmark)

    Schaub Jr, Gary John

    2014-01-01

    (PME)? I suggest three alternative paths that increased cooperation in PME at the level of the command and staff course could take: a Nordic Defence College, standardized national command and staff courses, and a core curriculum of common courses for common purposes. I conclude with a discussion of how...

  8. Genomic-assisted haplotype analysis and the development of high-throughput SNP markers for salinity tolerance in soybean

    Science.gov (United States)

    Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.

    2016-01-01

    Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337

  9. Genetic mapping and haplotype analysis of a locus for quantitative resistance to Fusarium graminearum in soybean accession PI 567516C.

    Science.gov (United States)

    Cheng, Peng; Gedling, Cassidy R; Patil, Gunvant; Vuong, Tri D; Shannon, J Grover; Dorrance, Anne E; Nguyen, Henry T

    2017-05-01

    A major novel quantitative disease resistance locus, qRfg_Gm06, for Fusarium graminearum was genetically mapped to chromosome 6. Genomic-assisted haplotype analysis within this region identified three putative candidate genes. Fusarium graminearum causes seed, root rot, and seedling damping-off in soybean which contributes to reduced stands and yield. A cultivar Magellan and PI 567516C were identified with low and high levels of partial resistance to F. graminearum, respectively. Quantitative disease resistance loci (QDRL) were mapped with 241 F 7:8 recombinant inbred lines (RILs) derived from a cross of Magellan × PI 567516C. Phenotypic evaluation for resistance to F. graminearum used the rolled towel assay in a randomized incomplete block design. The genetic map was constructed from 927 polymorphic single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers. One major QDRL qRfg_Gm06 was detected and mapped to chromosome 6 with a LOD score of 20.3 explaining 40.2% of the total phenotypic variation. This QDRL was mapped to a ~400 kb genomic region of the Williams 82 reference genome. Genome mining of this region identified 14 putative candidate disease resistance genes. Haplotype analysis of this locus using whole genome re-sequencing (WGRS) of 106 diverse soybean lines narrowed the list to three genes. A SNP genotyping Kompetitive allele-specific PCR (KASP) assay was designed for one of the genes and was validated in a subset of the RILs and all 106 diverse lines.

  10. The Commons

    OpenAIRE

    Moore, D.

    2004-01-01

    Over a three-year period, David Moore made repeated early morning visits to the chamber of the House of Commons, making photographs of unseen and overlooked areas and submitting this political environment to the scrutiny of the document. The Commons pursues archaeology of our most important debating chamber, exploring how an environment can act as a metaphor for wider societal issues. In doing so Moore creates an incisive survey of the epicentre of British politics.

  11. Distribution of von Willebrand factor levels in young women with and without bleeding symptoms: influence of ABO blood group and promoter haplotypes

    DEFF Research Database (Denmark)

    Lethagen, S.; Hillarp, A.; Ekholm, C.

    2008-01-01

    . It was the objective of the present study to evaluate the distribution of VWF levels in young females with or without bleeding symptoms in this population, and the influence of ABO blood group and promoter haplotypes on VWF levels and to identify a possible increased prevalence of VWD in females with bleeding symptoms.......4%) (p = 0.017). Blood group O was found in 14/18 girls with low VWF:RCo. There was a highly significant correlation between VWF:RCo and blood group O and non-O genotypes. Two common VWF promoter haplotypes did not contribute to the VWF:RCo variation. VWF levels did not correlate with time during...... menstrual cycle, or the use of oral contraceptives. No case fulfilled the diagnostic criteria for VWD. In conclusion, low VWF:RCo was significantly more frequent in females with bleeding symptoms. However, we found no case fulfilling strict diagnostic criteria for VWD. The ABO blood group was a strong...

  12. Singapore Genome Variation Project: a haplotype map of three Southeast Asian populations.

    Science.gov (United States)

    Teo, Yik-Ying; Sim, Xueling; Ong, Rick T H; Tan, Adrian K S; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S; Ku, Chee-Seng; Lee, Edmund J D; Seielstad, Mark; Chia, Kee-Seng

    2009-11-01

    The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser.

  13. A global analysis of Y-chromosomal haplotype diversity for 23 STR loci

    Science.gov (United States)

    Purps, Josephine; Siegert, Sabine; Willuweit, Sascha; Nagy, Marion; Alves, Cíntia; Salazar, Renato; Angustia, Sheila M.T.; Santos, Lorna H.; Anslinger, Katja; Bayer, Birgit; Ayub, Qasim; Wei, Wei; Xue, Yali; Tyler-Smith, Chris; Bafalluy, Miriam Baeta; Martínez-Jarreta, Begoña; Egyed, Balazs; Balitzki, Beate; Tschumi, Sibylle; Ballard, David; Court, Denise Syndercombe; Barrantes, Xinia; Bäßler, Gerhard; Wiest, Tina; Berger, Burkhard; Niederstätter, Harald; Parson, Walther; Davis, Carey; Budowle, Bruce; Burri, Helen; Borer, Urs; Koller, Christoph; Carvalho, Elizeu F.; Domingues, Patricia M.; Chamoun, Wafaa Takash; Coble, Michael D.; Hill, Carolyn R.; Corach, Daniel; Caputo, Mariela; D’Amato, Maria E.; Davison, Sean; Decorte, Ronny; Larmuseau, Maarten H.D.; Ottoni, Claudio; Rickards, Olga; Lu, Di; Jiang, Chengtao; Dobosz, Tadeusz; Jonkisz, Anna; Frank, William E.; Furac, Ivana; Gehrig, Christian; Castella, Vincent; Grskovic, Branka; Haas, Cordula; Wobst, Jana; Hadzic, Gavrilo; Drobnic, Katja; Honda, Katsuya; Hou, Yiping; Zhou, Di; Li, Yan; Hu, Shengping; Chen, Shenglan; Immel, Uta-Dorothee; Lessig, Rüdiger; Jakovski, Zlatko; Ilievska, Tanja; Klann, Anja E.; García, Cristina Cano; de Knijff, Peter; Kraaijenbrink, Thirsa; Kondili, Aikaterini; Miniati, Penelope; Vouropoulou, Maria; Kovacevic, Lejla; Marjanovic, Damir; Lindner, Iris; Mansour, Issam; Al-Azem, Mouayyad; Andari, Ansar El; Marino, Miguel; Furfuro, Sandra; Locarno, Laura; Martín, Pablo; Luque, Gracia M.; Alonso, Antonio; Miranda, Luís Souto; Moreira, Helena; Mizuno, Natsuko; Iwashima, Yasuki; Neto, Rodrigo S. Moura; Nogueira, Tatiana L.S.; Silva, Rosane; Nastainczyk-Wulf, Marina; Edelmann, Jeanett; Kohl, Michael; Nie, Shengjie; Wang, Xianping; Cheng, Baowen; Núñez, Carolina; Pancorbo, Marian Martínez de; Olofsson, Jill K.; Morling, Niels; Onofri, Valerio; Tagliabracci, Adriano; Pamjav, Horolma; Volgyi, Antonia; Barany, Gusztav; Pawlowski, Ryszard; Maciejewska, Agnieszka; Pelotti, Susi; Pepinski, Witold; Abreu-Glowacka, Monica; Phillips, Christopher; Cárdenas, Jorge; Rey-Gonzalez, Danel; Salas, Antonio; Brisighelli, Francesca; Capelli, Cristian; Toscanini, Ulises; Piccinini, Andrea; Piglionica, Marilidia; Baldassarra, Stefania L.; Ploski, Rafal; Konarzewska, Magdalena; Jastrzebska, Emila; Robino, Carlo; Sajantila, Antti; Palo, Jukka U.; Guevara, Evelyn; Salvador, Jazelyn; Ungria, Maria Corazon De; Rodriguez, Jae Joseph Russell; Schmidt, Ulrike; Schlauderer, Nicola; Saukko, Pekka; Schneider, Peter M.; Sirker, Miriam; Shin, Kyoung-Jin; Oh, Yu Na; Skitsa, Iulia; Ampati, Alexandra; Smith, Tobi-Gail; Calvit, Lina Solis de; Stenzl, Vlastimil; Capal, Thomas; Tillmar, Andreas; Nilsson, Helena; Turrina, Stefania; De Leo, Domenico; Verzeletti, Andrea; Cortellini, Venusia; Wetton, Jon H.; Gwynne, Gareth M.; Jobling, Mark A.; Whittle, Martin R.; Sumita, Denilce R.; Wolańska-Nowak, Paulina; Yong, Rita Y.Y.; Krawczak, Michael; Nothnagel, Michael; Roewer, Lutz

    2014-01-01

    In a worldwide collaborative effort, 19,630 Y-chromosomes were sampled from 129 different populations in 51 countries. These chromosomes were typed for 23 short-tandem repeat (STR) loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, GATAH4, DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643) and using the PowerPlex Y23 System (PPY23, Promega Corporation, Madison, WI). Locus-specific allelic spectra of these markers were determined and a consistently high level of allelic diversity was observed. A considerable number of null, duplicate and off-ladder alleles were revealed. Standard single-locus and haplotype-based parameters were calculated and compared between subsets of Y-STR markers established for forensic casework. The PPY23 marker set provides substantially stronger discriminatory power than other available kits but at the same time reveals the same general patterns of population structure as other marker sets. A strong correlation was observed between the number of Y-STRs included in a marker set and some of the forensic parameters under study. Interestingly a weak but consistent trend toward smaller genetic distances resulting from larger numbers of markers became apparent. PMID:24854874

  14. Lrrk2 R1441G-related Parkinson's disease: evidence of a common founding event in the seventh century in Northern Spain.

    Science.gov (United States)

    Mata, Ignacio F; Hutter, Carolyn M; González-Fernández, María C; de Pancorbo, Marian M; Lezcano, Elena; Huerta, Cecilia; Blazquez, Marta; Ribacoba, Renee; Guisasola, Luis M; Salvador, Carlos; Gómez-Esteban, Juan C; Zarranz, Juan J; Infante, Jon; Jankovic, Joseph; Deng, Hao; Edwards, Karen L; Alvarez, Victoria; Zabetian, Cyrus P

    2009-10-01

    Mutations in the leucine-rich repeat kinase 2 (LRRK2) gene together represent the most common genetic determinant of Parkinson's disease (PD) identified to date. The vast majority of patients with LRRK2-related PD reported in the literature carry one of three pathogenic substitutions: G2019S, R1441C, or R1441G. While G2019S and R1441C are geographically widespread, R1441G is most prevalent in the Basque Country and is rare outside of Northern Spain. We sought to better understand the processes that have shaped the current distribution of R1441G. We performed a haplotype analysis of 29 unrelated PD patients heterozygous for R1441G and 85 wild-type controls using 20 markers that spanned 15.1 Mb across the LRRK2 region. Nine of the patients were of Basque origin and 20 were non-Basques. We inferred haplotypes using a Bayesian approach and utilized a maximum-likelihood method to estimate the age of the most recent common ancestor. Significant but incomplete allele sharing was observed over a distance of 6.0 Mb and a single, rare ten-marker haplotype 5.8 Mb in length was seen in all mutation carriers. We estimate that the most recent common ancestor lived 1,350 (95% CI, 1,020-1,740) years ago in approximately the seventh century. We hypothesize that R1441G originated in the Basque population and that dispersion of the mutation then occurred through short-range gene flow that was largely limited to nearby regions in Spain.

  15. Regression-based approach for testing the association between multi-region haplotype configuration and complex trait

    Directory of Open Access Journals (Sweden)

    Zhao Hongbo

    2009-09-01

    Full Text Available Abstract Background It is quite common that the genetic architecture of complex traits involves many genes and their interactions. Therefore, dealing with multiple unlinked genomic regions simultaneously is desirable. Results In this paper we develop a regression-based approach to assess the interactions of haplotypes that belong to different unlinked regions, and we use score statistics to test the null hypothesis of non-genetic association. Additionally, multiple marker combinations at each unlinked region are considered. The multiple tests are settled via the minP approach. The P value of the "best" multi-region multi-marker configuration is corrected via Monte-Carlo simulations. Through simulation studies, we assess the performance of the proposed approach and demonstrate its validity and power in testing for haplotype interaction association. Conclusion Our simulations showed that, for binary trait without covariates, our proposed methods prove to be equal and even more powerful than htr and hapcc which are part of the FAMHAP program. Additionally, our model can be applied to a wider variety of traits and allow adjustment for other covariates. To test the validity, our methods are applied to analyze the association between four unlinked candidate genes and pig meat quality.

  16. Tyrosinase-positive oculocutaneous albinism in Southern African blacks: P gene-associated haplotypes suggest a major mutation in the 5{prime} region of the gene

    Energy Technology Data Exchange (ETDEWEB)

    Ramsay, M.; Stevens, G.; Beukering, J. van [Univ. of the Witwatersrand, Johannesburg (South Africa)] [and others

    1994-09-01

    Tyrosinase-positive oculocutaneous albinism (ty-pos OCA) occurs with a prevalence of 1 in 3900 among Southern African (SA) blacks. The major contributors to morbidity and mortality are skin cancer and decreased visual acuity. Two distinct phenotypes occur, namely individuals with ephelides (darkly pigmented patches) and those without. There is complete concordance with regard to ephelus status among siblings. The disorder is linked to markers on chromosome 15q11.2-q12, and no obligatory cross-overs were observed with polymophic markers at the human homolog, P, of the mouse pink eyed dilute gene, p. Contrary to what has been shown for Caucasoid ty-pos OCA, this condition shows locus homogeneity among SA blacks. The P gene is an excellent candidate for ty-pos OCA and mutations in this gene will confirm its role in causing the common form of albinism in SA. Numerous P gene mutations have been described in other populations. In an attempt to detect mutations, the P gene cDNA was used to search for structural rearrangements or polymorphisms. Six polymorphisms (plR10/Scal, 912/Xbal, 912/HincII, 912/TaqI, 1412/TaqI [two systems] and 1412/HindIII) were detected with subclones of the P cDNA and haplotypes were determined in each family. None were clearly associated with an albinism-related rearrangement. However, strong linkage disequilibrium was observed with alleles at loci toward the 5{prime} region of the gene ({triangle}=0.65, 0.57 and 0.80 for the three polymorphisms detected with the 912 subclone), suggesting a major ty-pos OCA mutation in this region. Haplotype analysis provides evidence for a major mutation associated with the same haplotype in individuals with ephelides (8/12 OCA chromosomes) and those without ephelides (24:30). The presence of other ty-pos OCA associated haplotypes indicates several other less common mutations.

  17. A reduced number of mtSNPs saturates mitochondrial DNA haplotype diversity of worldwide population groups.

    Directory of Open Access Journals (Sweden)

    Antonio Salas

    Full Text Available BACKGROUND: The high levels of variation characterising the mitochondrial DNA (mtDNA molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. METHODOLOGY/PRINCIPAL FINDINGS: This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia and two admixed populations ("African-Americans" and "Hispanics" were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of "universal" mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. CONCLUSIONS/SIGNIFICANCE: The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given

  18. Relationship between protein complotypes and DNA variant haplotypes: complotype-RFLP constellations (CRC).

    Science.gov (United States)

    Simon, S; Truedsson, L; Marcus-Bagley, D; Awdeh, Z; Eisenbarth, G S; Brink, S J; Yunis, E J; Alper, C A

    1997-09-15

    From the study of 52 families and 15 homozygous typing cells, 234 MHC complement haplotypes were characterized for features in the DNA of the complotype region: C2/Sst I (2.75, 2.70, 2.65, and 2.40 kb), BF/Taq I (6.6 and 4.5 kb), C4 5'/Bgl II (15 and 4.5 kb), C4 5'/Taq I (7.0, 6.4, 6.0 and 5.4 kb) and C4 3'/Xba I/BamH I (11 and 4 + 7 kb) restriction fragment length polymorphisms (RFLP's), by the presence or absence of C4A, C4B, CYP21A and CYP21B genes and by duplications. Nineteen (of over 1000 theoretically possible) complotype-RFLP constellations (CRC's) were found. The 9 CRC's with two C4 and CYP21 genes were designated A through I. CRC's Bdup and Ddup were like B and D but had duplicated C4B-CYP21B genes. The remaining CRC's had deletions of C4 and/or CYP21 genes and were designated Bdel, Cdel and the like. Individual complement alleles and complotypes were nor randomly distributed among the CRC's. Some complotypes, such as SC01, SC02 and FIC30, were restricted to only 1 CRC; others, such as SC31, FC31, and SC30, were found in several CRC's. Some of the CRC's contained a single complotype, others contained several. Remarkably, there are about 30 CRC-specified complotypes with frequencies of .01 or higher and 14 of .02 or higher. A number of evolutionary origins of complement alleles and complotypes are suggested by the relationships among CRC's. Approximate normal frequencies of the undeleted CRC's were A = .27, B = .19, Bdup = .02, C = .17, D = .07, Ddup = .02, E = .06, F = .05, and G = .02. Thus, CRC's without deletions accounted for 88% of normal complotypes. Since the frequency of Bdel, with a deletion of C4A, was .12, 10 CRC's accounted for all observed normal caucasian MHC haplotypes.

  19. A reduced number of mtSNPs saturates mitochondrial DNA haplotype diversity of worldwide population groups.

    Science.gov (United States)

    Salas, Antonio; Amigo, Jorge

    2010-05-03

    The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations ("African-Americans" and "Hispanics") were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of "universal" mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of mtSNPs is more efficient than previous empirical approaches. In contrast to

  20. Morphometric characteristics and COI haplotype diversity of Arctodiaptomus spinosus (Copedoda) populations in soda pans in Hungary.

    Science.gov (United States)

    Forró, László; Nédli, Judit; Csata, Enikő; Krízsik, Virág; Balogh, Csilla; G-Tóth, László

    2017-09-01

    Arctodiaptomus spinosus (Daday, 1891) is a characteristic species of the soda pan zooplankton in the Great Hungarian Plain. The biogeographical distribution of the species is interesting, since its range expands from the Pannonian Biogeographic region to the other side of the Carpathians, occurring in saline lakes in Eastern Anatolia, Armenia, Iran and in temporary waters in Ukraine. Our investigations focused on the morphometric characteristics and the COI haplotype diversity of four Hungarian populations in the Kiskunság area. We detected substantial morphological differences between the Böddi-szék population and the rest of the sampling sites, however considerable differences were not observable in the COI haplotypes in the populations. The 20 animals investigated for COI haplotypes belonged to the same haplotype network. Tajima's D indicated departures from the neutral Wright - Fisher population model and suggested population expansion. The genetic composition of Arctodiaptomus spinosus populations in the Kiskunság area is rather uniform.

  1. An algorithm for inferring complex haplotypes in a region of copy-number variation.

    Science.gov (United States)

    Kato, Mamoru; Nakamura, Yusuke; Tsunoda, Tatsuhiko

    2008-08-01

    Recent studies have extensively examined the large-scale genetic variants in the human genome known as copy-number variations (CNVs), and the universality of CNVs in normal individuals, along with their functional importance, has been increasingly recognized. However, the absence of a method to accurately infer alleles or haplotypes within a CNV region from high-throughput experimental data hampers the finer analyses of CNV properties and applications to disease-association studies. Here we developed an algorithm to infer complex haplotypes within a CNV region by using data obtained from high-throughput experimental platforms. We applied this algorithm to experimental data and estimated the population frequencies of haplotypes that can yield information on both sequences and numbers of DNA copies. These results suggested that the analysis of such complex haplotypes is essential for accurately detecting genetic differences within a CNV region between population groups.

  2. Science commons

    CERN Multimedia

    CERN. Geneva

    2007-01-01

    SCP: Creative Commons licensing for open access publishing, Open Access Law journal-author agreements for converting journals to open access, and the Scholar's Copyright Addendum Engine for retaining rights to self-archive in meaningful formats and locations for future re-use. More than 250 science and technology journals already publish under Creative Commons licensing while 35 law journals utilize the Open Access Law agreements. The Addendum Engine is a new tool created in partnership with SPARC and U.S. universities. View John Wilbanks's biography

  3. Creative Commons

    DEFF Research Database (Denmark)

    Jensen, Lone

    2006-01-01

    En Creative Commons licens giver en forfatter mulighed for at udbyde sit værk i en alternativ licensløsning, som befinder sig på forskellige trin på en skala mellem yderpunkterne "All rights reserved" og "No rights reserved". Derved opnås licensen "Some rights reserved"......En Creative Commons licens giver en forfatter mulighed for at udbyde sit værk i en alternativ licensløsning, som befinder sig på forskellige trin på en skala mellem yderpunkterne "All rights reserved" og "No rights reserved". Derved opnås licensen "Some rights reserved"...

  4. Haplotypes in the Dystrophin DNA Segment Point to a Mosaic Origin of Modern Human Diversity

    OpenAIRE

    Ziętkiewicz, Ewa; Yotova, Vania; Gehl, Dominik; Wambach, Tina; Arrieta, Isabel; Batzer, Mark; Cole, David E.C.; Hechtman, Peter; Kaplan, Feige; Modiano, David; Moisan, Jean-Paul; Michalski, Roman; Labuda, Damian

    2003-01-01

    Although Africa has played a central role in human evolutionary history, certain studies have suggested that not all contemporary human genetic diversity is of recent African origin. We investigated 35 simple polymorphic sites and one Tn microsatellite in an 8-kb segment of the dystrophin gene. We found 86 haplotypes in 1,343 chromosomes from around the world. Although a classical out-of-Africa topology was observed in trees based on the variant frequencies, the tree of haplotype sequences re...

  5. Haplotypes of the porcine peroxisome proliferator-activated receptor delta gene are associated with backfat thickness

    Directory of Open Access Journals (Sweden)

    Blöcker Helmut

    2009-11-01

    Full Text Available Abstract Background Peroxisome proliferator-activated receptor delta belongs to the nuclear receptor superfamily of ligand-inducible transcription factors. It is a key regulator of lipid metabolism. The peroxisome proliferator-activated receptor delta gene (PPARD has been assigned to a region on porcine chromosome 7, which harbours a quantitative trait locus for backfat. Thus, PPARD is considered a functional and positional candidate gene for backfat thickness. The purpose of this study was to test this candidate gene hypothesis in a cross of breeds that were highly divergent in lipid deposition characteristics. Results Screening for genetic variation in porcine PPARD revealed only silent mutations. Nevertheless, significant associations between PPARD haplotypes and backfat thickness were observed in the F2 generation of the Mangalitsa × Piétrain cross as well as a commercial German Landrace population. Haplotype 5 is associated with increased backfat in F2 Mangalitsa × Piétrain pigs, whereas haplotype 4 is associated with lower backfat thickness in the German Landrace population. Haplotype 4 and 5 carry the same alleles at all but one SNP. Interestingly, the opposite effects of PPARD haplotypes 4 and 5 on backfat thickness are reflected by opposite effects of these two haplotypes on PPAR-δ mRNA levels. Haplotype 4 significantly increases PPAR-δ mRNA levels, whereas haplotype 5 decreases mRNA levels of PPAR-δ. Conclusion This study provides evidence for an association between PPARD and backfat thickness. The association is substantiated by mRNA quantification. Further studies are required to clarify, whether the observed associations are caused by PPARD or are the result of linkage disequilibrium with a causal variant in a neighbouring gene.

  6. Prognostic importance of VEGF-A haplotype combinations in a stage II colon cancer population

    DEFF Research Database (Denmark)

    Kjaer-Frifeldt, Sanne; Fredslund, Rikke; Lindebjerg, Jan

    2012-01-01

    To investigate the prognostic effect of three VEGF-A SNPs, -2578, -460 and 405, as well as the corresponding haplotype combinations, in a unique population of stage II colon cancer patients.......To investigate the prognostic effect of three VEGF-A SNPs, -2578, -460 and 405, as well as the corresponding haplotype combinations, in a unique population of stage II colon cancer patients....

  7. CYP19 Genetic Polymorphism Haplotype AASA Is Associated with a Poor Prognosis in Premenopausal Women with Lymph Node-Negative, Hormone Receptor-Positive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Sung-Hsin Kuo

    2013-01-01

    Full Text Available Given the critical role of CYP19 in estrogen synthesis, we investigated the influence of CYP19 gene polymorphisms on the clinical outcome of lymph node- (LN- negative, hormone receptor- (HR- positive early breast cancers. Genotyping for the CYP19 polymorphisms rs4646 (A/C, rs1065779 (A/C, CYP19 (TTTAn (short allele/long (S/L allele using the 7 TTTA repeat polymorphism as the cut-off, and rs1870050 (A/C was performed on 296 patients with LN-negative, HR-positive breast cancers. All patients received adjuvant hormonal therapy. Associations were examined between these 4 genotypes and 6 common haplotypes of CYP19 and distant disease-free survival (DDFS, disease-free survival (DFS, and overall survival (OS. Patients were divided into the 6 subhaplotypes of CCLA (41.1%, AASA (17.1%, CASA (11.9%, CCLC (8.9%, CCSA (7.5%, AASC (8.9%, and others (4.6%. In premenopausal patients, haplotype AASA was significantly associated with a poor DDFS (adjusted hazard ratio (aHR, 3.3; P=0.001, DFS (aHR, 2.5; P=0.0008, and OS (aHR, 2.9; P=0.0004 after adjusting for age, tumor size, tumor grade, estrogen receptor status, progesterone receptor status, chemotherapy, pathology, adjuvant hormone therapy, menopausal status, and radiotherapy. Furthermore, haplotype AASA remained a negative prognostic factor for premenopausal patients receiving adjuvant chemotherapy in terms of DDFS (aHR, 4.5; P=0.0005, DFS (HR, 3.2; P=0.003, and OS (HR, 6.4; P=0.0009. However, in postmenopausal patients, haplotype AASA was not associated with a poor prognosis, whereas the AASC haplotype was significantly associated with a poor DFS (aHR, 3.1; P=0.03 and OS (aHR, 4.4; P=0.01. Our results indicate that, in patients with LN-negative, HR-positive breast cancers, genetic polymorphism haplotype AASA is associated with poor survival of premenopausal women but does not affect survival of postmenopausal women.

  8. Methylenetetrahydrofolate reductase genotypes and haplotypes associated with susceptibility to colorectal cancer in an eastern Chinese Han population.

    Science.gov (United States)

    Li, H; Xu, W L; Shen, H L; Chen, Q Y; Hui, L L; Long, L L; Zhu, X L

    2011-12-14

    Methylenetetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. The two common functional polymorphisms of MTHFR, C677T and A1298C have been associated with several diseases, including cancer. We made a case-control study to analyze a possible association of MTHFR gene polymorphisms C677T and A1298C with risk for colorectal cancer in an eastern Chinese Han population of 137 patients with a confirmed histopathological diagnosis of CRC and 145 age- and gender-matched controls with no history of cancer. DNA was isolated from peripheral blood samples and the genotypes were determined by PCR-RFLP. The concentrations of folate in plasma were measured by chemiluminescence immunoassay. The MTHFR 677TT genotype had a protective effect against colorectal cancer, with an odds ratio (OR) = 0.467 (95% confidence interval (CI) = 0.225-0.966). The 1298CC genotype was significantly correlated with a reduced risk of colorectal cancer (OR = 0.192; 95%CI = 0.040-0.916). Compared with the MTHFR 677CC and MTHFR 1298 AA genotypes, for individuals who carried both MTHFR 677CC and 1298CC genotypes, the OR of colorectal cancer was 0.103 (95%CI = 0.012-0.900); among individuals who carried both MTHFR 677TT and 1298AC genotypes, the OR for risk of colorectal cancer was 0.169 (95%CI = 0.044-0.654). MTHFR 677TT+CT genotypes had a significantly lower plasma folate concentration than those with the MTHFR 677CC genotype. MTHFR 1298AC+CC genotypes had a lower plasma folate concentration than those with the MTHFR 1298AA genotype (P < 0.05). In conclusion, subjects with the MTHFR 677TT and MTHFR 1298CC genotypes appeared to have a significantly lower risk for colorectal cancer. MTHFR haplotypes 677CC/1298CC and 677TT/1298AC were less common in cases than in controls. These haplotypes, when compared to the most common haplotype 677CC/1298AA, were associated with a decreased risk for colorectal cancer. We

  9. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    Energy Technology Data Exchange (ETDEWEB)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

  10. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Directory of Open Access Journals (Sweden)

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  11. A Monomorphic Haplotype of Chromosome Ia Is Associated with Widespread Success in Clonal and Nonclonal Populations of Toxoplasma gondii

    Science.gov (United States)

    Khan, Asis; Miller, Natalie; Roos, David S.; Dubey, J. P.; Ajzenberg, Daniel; Dardé, Marie Laure; Ajioka, James W.; Rosenthal, Benjamin; Sibley, L. David

    2011-01-01

    ABSTRACT Toxoplasma gondii is a common parasite of animals that also causes a zoonotic infection in humans. Previous studies have revealed a strongly clonal population structure that is shared between North America and Europe, while South American strains show greater genetic diversity and evidence of sexual recombination. The common inheritance of a monomorphic version of chromosome Ia (referred to as ChrIa*) among three clonal lineages from North America and Europe suggests that inheritance of this chromosome might underlie their recent clonal expansion. To further examine the diversity and distribution of ChrIa, we have analyzed additional strains with greater geographic diversity. Our findings reveal that the same haplotype of ChrIa* is found in the clonal lineages from North America and Europe and in older lineages in South America, where sexual recombination is more common. Although lineages from all three continents harbor the same conserved ChrIa* haplotype, strains from North America and Europe are genetically separate from those in South America, and these respective geographic regions show limited evidence of recent mixing. Genome-wide, array-based profiling of polymorphisms provided evidence for an ancestral flow from particular older southern lineages that gave rise to the clonal lineages now dominant in the north. Collectively, these data indicate that ChrIa* is widespread among nonclonal strains in South America and has more recently been associated with clonal expansion of specific lineages in North America and Europe. These findings have significant implications for the spread of genetic loci influencing transmission and virulence in pathogen populations. PMID:22068979

  12. Common approach to common interests

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-06-01

    In referring to issues confronting the energy field in this region and options to be exercised in the future, I would like to mention the fundamental condition of the utmost importance. That can be summed up as follows: any subject in energy area can never be solved by one country alone, given the geographical and geopolitical characteristics intrinsically possessed by energy. So, a regional approach is needed and it is especially necessary for the main players in the region to jointly address problems common to them. Though it may be a matter to be pursued in the distant future, I am personally dreaming a 'Common Energy Market for Northeast Asia,' in which member countries' interests are adjusted so that the market can be integrated and the region can become a most economically efficient market, thus formulating an effective power to encounter the outside. It should be noted that Europe needed forty years to integrate its market as the unified common market. It is necessary for us to follow a number of steps over the period to eventually materialize our common market concept, too. Now is the time for us to take a first step to lay the foundation for our descendants to enjoy prosperity from such a common market.

  13. Haplotypes in CCR5-CCR2, CCL3 and CCL5 are associated with natural resistance to HIV-1 infection in a Colombian cohort.

    Science.gov (United States)

    Vega, Jorge A; Villegas-Ospina, Simón; Aguilar-Jiménez, Wbeimar; Rugeles, María T; Bedoya, Gabriel; Zapata, Wildeman

    2017-06-01

    Variants in genes encoding for HIV-1 co-receptors and their natural ligands have been individually associated to natural resistance to HIV-1 infection. However, the simultaneous presence of these variants has been poorly studied. To evaluate the association of single and multilocus haplotypes in genes coding for the viral co-receptors CCR5 and CCR2, and their ligands CCL3 and CCL5, with resistance or susceptibility to HIV-1 infection. Nine variants in CCR5-CCR2, two SNPs in CCL3 and two in CCL5 were genotyped by PCR-RFLP in 35 seropositive (cases) and 49 HIV-1-exposed seronegative Colombian individuals (controls). Haplotypes were inferred using the Arlequin software, and their frequency in individual or combined loci was compared between cases and controls by the chi-square test. A p' value ;0.05 after Bonferroni correction was considered significant. Homozygosis of the human haplogroup (HH) E was absent in controls and frequent in cases, showing a tendency to susceptibility. The haplotypes C-C and T-T in CCL3 were associated with susceptibility (p'=0.016) and resistance (p';0.0001) to HIV-1 infection, respectively. Finally, in multilocus analysis, the haplotype combinations formed by HHC in CCR5-CCR2, T-T in CCL3 and G-C in CCL5 were associated with resistance (p'=0.006). Our results suggest that specific combinations of variants in genes from the same signaling pathway can define an HIV-1 resistant phenotype. Despite our small sample size, our statistically significant associations suggest strong effects; however, these results should be further validated in larger cohorts.

  14. Genetic diversity of Echinococcus multilocularis in red foxes in Poland: the first report of a haplotype of probable Asian origin.

    Science.gov (United States)

    Karamon, Jacek; Stojecki, Krzysztof; Samorek-Pierog, Malgorzata; Bilska-Zajac, Ewa; Rozycki, Miroslaw; Chmurzynska, Ewa; Sroka, Jacek; Zdybel, Jolanta; Cencek, Tomasz

    2017-03-09

    The aim of the present study was to estimate the genetic diversity of the cestode Echinococcus multilocularis Leuckart, 1863 in Poland based on sequence analysis of the mitochondrial genes of worms isolated from red foxes, Vulpes vulpes (Linnaeus). Overall, 83 adults of E. multilocularis from the same number of foxes in different parts of Poland were used for analysis. Sequences of the three mitochondrial genes, cytochrome b (cob), NADH dehydrogenase subunit 2 (nad2) and cytochrome c oxidase subunit 1 (cox1), were analysed. Seventy-four individual biological samples were successfully sequenced. Combined sequence analysis of these three genes exhibited fifteen Polish haplotypes (EmPL1-EmPL15). Most isolates (n = 29; 39%) were classified to the EmPL1 haplotype, which occurred mainly in the east, north and centre of Poland. Haplotype EmPL4 (n = 14; 19%) and other haplotypes appeared predominantly in the south and west area. Fourteen haplotypes were grouped in the European clade. One Polish haplotype (EmPL9) (n = 7, 10%) was assigned to the Asian clade with haplotypes from Japan and Kazakhstan. This haplotype was found only in northeast Poland and this is the westernmost report of haplotype of E. multilocularis belonging to the Asian clade in Europe. The investigation demonstrated that populations of E. multilocularis in Poland (and probably also in eastern Europe) included not only different European haplotypes but also those of the Asian origin.

  15. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns.

    Science.gov (United States)

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α -ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns.

  16. Genetic variations and haplotype diversity of the UGT1 gene cluster in the Chinese population.

    Directory of Open Access Journals (Sweden)

    Jing Yang

    Full Text Available Vertebrates require tremendous molecular diversity to defend against numerous small hydrophobic chemicals. UDP-glucuronosyltransferases (UGTs are a large family of detoxification enzymes that glucuronidate xenobiotics and endobiotics, facilitating their excretion from the body. The UGT1 gene cluster contains a tandem array of variable first exons, each preceded by a specific promoter, and a common set of downstream constant exons, similar to the genomic organization of the protocadherin (Pcdh, immunoglobulin, and T-cell receptor gene clusters. To assist pharmacogenomics studies in Chinese, we sequenced nine first exons, promoter and intronic regions, and five common exons of the UGT1 gene cluster in a population sample of 253 unrelated Chinese individuals. We identified 101 polymorphisms and found 15 novel SNPs. We then computed allele frequencies for each polymorphism and reconstructed their linkage disequilibrium (LD map. The UGT1 cluster can be divided into five linkage blocks: Block 9 (UGT1A9, Block 9/7/6 (UGT1A9, UGT1A7, and UGT1A6, Block 5 (UGT1A5, Block 4/3 (UGT1A4 and UGT1A3, and Block 3' UTR. Furthermore, we inferred haplotypes and selected their tagSNPs. Finally, comparing our data with those of three other populations of the HapMap project revealed ethnic specificity of the UGT1 genetic diversity in Chinese. These findings have important implications for future molecular genetic studies of the UGT1 gene cluster as well as for personalized medical therapies in Chinese.

  17. Differential fine-tuning of gene expression regulation in coffee leaves by CcDREB1D promoter haplotypes under water deficit.

    Science.gov (United States)

    Alves, Gabriel Sergio Costa; Torres, Luana Ferreira; Déchamp, Eveline; Breitler, Jean-Christophe; Joët, Thierry; Gatineau, Frédéric; Andrade, Alan Carvalho; Bertrand, Benoît; Marraccini, Pierre; Etienne, Hervé

    2017-05-17

    Despite the importance of the DREB1D gene (also known as CBF4) in plant responses to water deficit and cold stress, studies analysing its regulation by transgenic approaches are lacking. In the current work, a functional study of three CcDREB1D promoter haplotypes (named HP15, HP16 and HP17) isolated from drought-tolerant and drought-sensitive clones of Coffea canephora was carried out in plants of C. arabica stably transformed by Agrobacterium tumefaciens by analysing their ability to regulate the expression of the uidA reporter gene in response to water deficit mimicked by polyethylene glycol (-2.0 MPa) and low relative humidity treatments. A deletion analysis of their corresponding 5'-upstream regions revealed increased specificity of β-glucuronidase activity in the polyethylene glycol and low relative humidity treatments, with high expression in leaf mesophyll and guard cells in full-length constructs. RT-qPCR assays also revealed that the HP16 haplotype (specific to clone tolerant to water deficit) had stronger and earlier activity compared with the HP15 and HP17 haplotypes. As most of the cis-regulatory elements involved in ABA-dependent and -independent networks, tissue specificity and light regulation are common to these haplotypes, we propose that their organization, as well as the nucleic acid polymorphisms present outside these boxes, may play a role in modulating activities of DREB1D promoters in guard cells. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Sequence analysis of mtDNA COI barcode region revealed three haplotypes within Culex pipiens assemblage.

    Science.gov (United States)

    Koosha, Mona; Oshaghi, Mohammad Ali; Sedaghat, Mohammad Mehdi; Vatandoost, Hassan; Azari-Hamidian, Shahyad; Abai, Mohammad Reza; Hanafi-Bojd, Ahmad Ali; Mohtarami, Fatemeh

    2017-10-01

    Members of the Culex (Culex) pipiens assemblage are known vectors of deadly encephalitides, periodic filariasis, and West Nile virus throughout the world. However, members of this assemblage are morphologically indistinguishable or hard to distinguish and play distinct roles in transmission of the diseases. The current study aimed to provide further evidence on utility of the two most popular nuclear (ITS2-rDNA) and mitochondrial (COI barcode region) genetic markers to identify members of the assemblage. Culex pipiens assemblage specimens from different climate zones of Iran were collected and identified to species level based on morphological characteristics. Nucleotide sequences of the loci for the specimens plus available data in the GenBank were analyzed to find species specific genetic structures useful for diagnosis purposes. ITS2 region was highly divergent within species or populations suggesting lack of consistency as a reliable molecular marker. In contrast, sequence analysis of 710 bp of COI gene revealed three fixed haplotypes named here "C, T, H" within the assemblage which can be distinguished by HaeIII and AluI enzymes. There were a correlation between the haplotypes and the world climate regions, where the haplotypes H/T and C are present mainly in temperate and tropical regions of the world, respectively. In the New world, Australia, and Japan only haplotype H is found. In conjunction between tropical and temperate regions such Iran, China, and Turkey, a mix of C/H or C/H/T are present. Although, the haplotypes are not strictly species-specific, however, Cx. quinquefasciatus was mainly of haplotype C. Due to the lack of mating barrier and questionable taxonomic situation of the complex members, the mentioned haplotypes in combination with other morphological and molecular characters might be used to address the genetic structure of the studied populations. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. F8 haplotype and inhibitor risk: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort

    Science.gov (United States)

    Schwarz, John; Astermark, Jan; Menius, Erika D.; Carrington, Mary; Donfield, Sharyne M.; Gomperts, Edward D.; Nelson, George W.; Oldenburg, Johannes; Pavlova, Anna; Shapiro, Amy D.; Winkler, Cheryl A.; Berntorp, Erik

    2012-01-01

    Background Ancestral background, specifically African descent, confers higher risk for development of inhibitory antibodies to factor VIII (FVIII) in hemophilia A. It has been suggested that differences in the distribution of factor VIII gene (F8) haplotypes, and mismatch between endogenous F8 haplotypes and those comprising products used for treatment could contribute to risk. Design and Methods Data from the HIGS Combined Cohort were used to determine the association between F8 haplotype 3 (H3) vs. haplotypes 1 and 2 (H1+H2) and inhibitor risk among individuals of genetically-determined African descent. Other variables known to affect inhibitor risk including type of F8 mutation and HLA were included in the analysis. A second research question regarding risk related to mismatch in endogenous F8 haplotype and recombinant FVIII products used for treatment was addressed. Results H3 was associated with higher inhibitor risk among those genetically-identified (N=49) as of African ancestry, but the association did not remain significant after adjustment for F8 mutation type and the HLA variables. Among subjects of all racial ancestries enrolled in HIGS who reported early use of recombinant products (N=223), mismatch in endogenous haplotype and the FVIII proteins constituting the products used did not confer greater risk for inhibitor development. Conclusion H3 was not an independent predictor of inhibitor risk. Further, our findings did not support a higher risk of inhibitors in the presence of a haplotype mismatch between the FVIII molecule infused and that of the individual. PMID:22958194

  1. Three Novel Haplotypes of Theileria bicornis in Black and White Rhinoceros in Kenya.

    Science.gov (United States)

    Otiende, M Y; Kivata, M W; Jowers, M J; Makumi, J N; Runo, S; Obanda, V; Gakuya, F; Mutinda, M; Kariuki, L; Alasaad, S

    2016-02-01

    Piroplasms, especially those in the genera Babesia and Theileria, have been found to naturally infect rhinoceros. Due to natural or human-induced stress factors such as capture and translocations, animals often develop fatal clinical piroplasmosis, which causes death if not treated. This study examines the genetic diversity and occurrence of novel Theileria species infecting both black and white rhinoceros in Kenya. Samples collected opportunistically during routine translocations and clinical interventions from 15 rhinoceros were analysed by polymerase chain reaction (PCR) using a nested amplification of the small subunit ribosomal RNA (18S rRNA) gene fragments of Babesia and Theileria. Our study revealed for the first time in Kenya the presence of Theileria bicornis in white (Ceratotherium simum simum) and black (Diceros bicornis michaeli) rhinoceros and the existence of three new haplotypes: haplotypes H1 and H3 were present in white rhinoceros, while H2 was present in black rhinoceros. No specific haplotype was correlated to any specific geographical location. The Bayesian inference 50% consensus phylogram recovered the three haplotypes monophyleticly, and Theileria bicornis had very high support (BPP: 0.98). Furthermore, the genetic p-uncorrected distances and substitutions between T. bicornis and the three haplotypes were the same in all three haplotypes, indicating a very close genetic affinity. This is the first report of the occurrence of Theileria species in white and black rhinoceros from Kenya. The three new haplotypes reported here for the first time have important ecological and conservational implications, especially for population management and translocation programs and as a means of avoiding the transport of infected animals into non-affected areas. © 2014 Blackwell Verlag GmbH.

  2. Association between HIV-1 tropism and CCR5 human haplotype E in a Caucasian population.

    Science.gov (United States)

    Huik, Kristi; Avi, Radko; Uibopuu, Helen; Pauskar, Merit; Margus, Tõnu; Karki, Tõnis; Krispin, Tõnu; Kool, Piret; Rüütel, Kristi; Talu, Ave; Abel-Ollo, Katri; Uusküla, Anneli; Carrillo, Andrew; He, Weijing; Ahuja, Sunil K; Lutsar, Irja

    2014-07-01

    The influence of the diversity of CCR5 on HIV susceptibility and disease progression has been clearly demonstrated but how the variability of this gene influences the HIV tropism is poorly understood. We investigated whether CCR5 haplotypes are associated with HIV tropism in a Caucasian population. We evaluated 161 HIV-positive subjects in a cross-sectional study. CCR5 haplotypes were derived after genotyping 9 CCR2-CCR5 polymorphisms. The HIV subtype was determined by phylogenetic analysis using the maximum likelihood method and viral tropism by the genotypic tropism assay (geno2pheno). Associations between CCR5 haplotypes and viral tropism were determined using logistic regression analyses. Samples from 500 blood donors were used to evaluate the representativeness of HIV-positives in terms of CCR5 haplotype distribution. The distribution of CCR5 haplotypes was similar in HIV-positive subjects and blood donors. The majority of viruses (93.8%) belonged to HIV-1 CRF06_cpx; 7.5% were X4, and the remaining were R5 tropic. X4 tropic viruses were over represented among people with CCR5 human haplotype E (HHE) compared with those without this haplotype (13.0% vs 1.4%; P = 0.006). People possessing CCR5 HHE had 11 times increased odds (odds ratio = 11.00; 95% confidence interval: 1.38 to 87.38) of having X4 tropic viruses than those with non-HHE. After adjusting for antiretroviral (ARV) therapy, neither the presence of HHE nor the use of ARV was associated with X4 tropic viruses. Our results suggest that CCR5 HHE and ARV treatment might be associated with the presence of HIV-1 X4 tropic viruses.

  3. A haplotype of polymorphisms in ASE-1, RAI and ERCC1 and the effects of tobacco smoking and alcohol consumption on risk of colorectal cancer: a danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Hansen, Rikke D; Sørensen, Mette; Tjønneland, Anne; Overvad, Kim; Wallin, Håkan; Raaschou-Nielsen, Ole; Vogel, Ulla

    2008-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent type of genetic variation in the human genome, and are of interest for the study of susceptibility to and protection from diseases. The haplotype at chromosome 19q13.2-3 encompassing the three SNPs ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn have been associated with risk of breast cancer and lung cancer. Haplotype carriers are defined as the homozygous carriers of RAI IVS1 A4364G A , ERCC1 Asn118Asn T and ASE-1 G-21A G . We aimed to evaluate whether the three polymorphisms and the haplotype are associated to risk of colorectal cancer, and investigated gene-environment associations between the polymorphisms and the haplotype and smoking status at enrolment, smoking duration, average smoking intensity and alcohol consumption, respectively, in relation to risk of colorectal cancer. Associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were examined, as well as gene-environment interaction, in a Danish case-cohort study including 405 cases and a comparison group of 810 persons. Incidence rate ratio (IRR) were estimated by the Cox proportional hazards model stratified according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. No consistent associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were found. No statistically significant interactions between the genotypes and the lifestyle exposures smoking or alcohol consumption were observed. Our results suggest that the ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn polymorphisms and the previously identified haplotype are not associated with risk of colorectal cancer. We found no evidence of gene-environment interaction between the three polymorphisms and the haplotype and smoking intensity and alcohol consumption

  4. Comparison of linkage disequilibrium and haplotype diversity on macro- and microchromosomes in chicken

    Directory of Open Access Journals (Sweden)

    Muir William M

    2009-12-01

    Full Text Available Abstract Background The chicken (Gallus gallus, like most avian species, has a very distinct karyotype consisting of many micro- and a few macrochromosomes. While it is known that recombination frequencies are much higher for micro- as compared to macrochromosomes, there is limited information on differences in linkage disequilibrium (LD and haplotype diversity between these two classes of chromosomes. In this study, LD and haplotype diversity were systematically characterized in 371 birds from eight chicken populations (commercial lines, fancy breeds, and red jungle fowl across macro- and microchromosomes. To this end we sampled four regions of ~1 cM each on macrochromosomes (GGA1 and GGA2, and four 1.5 -2 cM regions on microchromosomes (GGA26 and GGA27 at a high density of 1 SNP every 2 kb (total of 889 SNPs. Results At a similar physical distance, LD, haplotype homozygosity, haploblock structure, and haplotype sharing were all lower for the micro- as compared to the macrochromosomes. These differences were consistent across populations. Heterozygosity, genetic differentiation, and derived allele frequencies were also higher for the microchromosomes. Differences in LD, haplotype variation, and haplotype sharing between populations were largely in line with known demographic history of the commercial chicken. Despite very low levels of LD, as measured by r2 for most populations, some haploblock structure was observed, particularly in the macrochromosomes, but the haploblock sizes were typically less than 10 kb. Conclusion Differences in LD between micro- and macrochromosomes were almost completely explained by differences in recombination rate. Differences in haplotype diversity and haplotype sharing between micro- and macrochromosomes were explained by differences in recombination rate and genotype variation. Haploblock structure was consistent with demography of the chicken populations, and differences in recombination rates between micro

  5. HLA haplotypes in primary sclerosing cholangitis patients of admixed and non-European ancestry.

    Science.gov (United States)

    Henriksen, E K K; Viken, M K; Wittig, M; Holm, K; Folseraas, T; Mucha, S; Melum, E; Hov, J R; Lazaridis, K N; Juran, B D; Chazouillères, O; Färkkilä, M; Gotthardt, D N; Invernizzi, P; Carbone, M; Hirschfield, G M; Rushbrook, S M; Goode, E; Ponsioen, C Y; Weersma, R K; Eksteen, B; Yimam, K K; Gordon, S C; Goldberg, D; Yu, L; Bowlus, C L; Franke, A; Lie, B A; Karlsen, T H

    2017-10-01

    Primary sclerosing cholangitis (PSC) is strongly associated with several human leukocyte antigen (HLA) haplotypes. Due to extensive linkage disequilibrium and multiple polymorphic candidate genes in the HLA complex, identifying the alleles responsible for these associations has proven difficult. We aimed to evaluate whether studying populations of admixed or non-European descent could help in defining the causative HLA alleles. When assessing haplotypes carrying HLA-DRB1*13:01 (hypothesized to specifically increase the susceptibility to chronic cholangitis), we observed that every haplotype in the Scandinavian PSC population carried HLA-DQB1*06:03. In contrast, only 65% of HLA-DRB1*13:01 haplotypes in an admixed/non-European PSC population carried this allele, suggesting that further assessments of the PSC-associated haplotype HLA-DRB1*13:01-DQA1*01:03-DQB1*06:03 in admixed or multi-ethnic populations could aid in identifying the causative allele. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Class I gene regulation of haplotype preference may influence antiviral immunity in vivo

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Marker, O

    1989-01-01

    targets. In regard to the in vivo significance of haplotype preference it was found that (C X C3) F1 mice expressed an earlier and stronger virus-specific delayed type hypersensitivity response and exerted a more efficient virus control than did (C-H-2dm2 X C3) F1. Taken together these findings suggest......The lymphocytic choriomeningitis virus (LCMV)-specific Tc response in (C3 X D2) F1 hybrids (k X d) is markedly biased in favor of the H-2d haplotype. Adoptive transfer experiments established that this haplotype preference also applied to T cell function in vivo. Using different mouse strain...... combinations we were unable to detect an influence of sex, non-H-2 background, maternal genotype, or route of priming on the preference pattern. In other haplotype combinations tested (k and b, b and d) no distinct haplotype preference was observed. A comparison of the LCMV-specific Tc response of (C X C3) F1...

  7. Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800).

    Science.gov (United States)

    Artico, L O; Bianchini, A; Grubel, K S; Monteiro, D S; Estima, S C; Oliveira, L R de; Bonatto, S L; Marins, L F

    2010-09-01

    The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande), both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop) was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7), with OFA1 being the most frequent (47.54%). Nucleotide diversity was moderate (π = 0.62%) and haplotype diversity was relatively low (67%). Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

  8. Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800

    Directory of Open Access Journals (Sweden)

    L.O. Artico

    2010-09-01

    Full Text Available The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande, both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7, with OFA1 being the most frequent (47.54%. Nucleotide diversity was moderate (π = 0.62% and haplotype diversity was relatively low (67%. Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

  9. Haplotypes in the dystrophin DNA segment point to a mosaic origin of modern human diversity.

    Science.gov (United States)

    Zietkiewicz, Ewa; Yotova, Vania; Gehl, Dominik; Wambach, Tina; Arrieta, Isabel; Batzer, Mark; Cole, David E C; Hechtman, Peter; Kaplan, Feige; Modiano, David; Moisan, Jean-Paul; Michalski, Roman; Labuda, Damian

    2003-11-01

    Although Africa has played a central role in human evolutionary history, certain studies have suggested that not all contemporary human genetic diversity is of recent African origin. We investigated 35 simple polymorphic sites and one T(n) microsatellite in an 8-kb segment of the dystrophin gene. We found 86 haplotypes in 1,343 chromosomes from around the world. Although a classical out-of-Africa topology was observed in trees based on the variant frequencies, the tree of haplotype sequences reveals three lineages accounting for present-day diversity. The proportion of new recombinants and the diversity of the T(n) microsatellite were used to estimate the age of haplotype lineages and the time of colonization events. The lineage that underwent the great expansion originated in Africa prior to the Upper Paleolithic (27,000-56,000 years ago). A second group, of structurally distinct haplotypes that occupy a central position on the tree, has never left Africa. The third lineage is represented by the haplotype that lies closest to the root, is virtually absent in Africa, and appears older than the recent out-of-Africa expansion. We propose that this lineage could have left Africa before the expansion (as early as 160,000 years ago) and admixed, outside of Africa, with the expanding lineage. Contemporary human diversity, although dominated by the recently expanded African lineage, thus represents a mosaic of different contributions.

  10. The performance of phylogenetic algorithms in estimating haplotype genealogies with migration.

    Science.gov (United States)

    Salzburger, Walter; Ewing, Greg B; Von Haeseler, Arndt

    2011-05-01

    Genealogies estimated from haplotypic genetic data play a prominent role in various biological disciplines in general and in phylogenetics, population genetics and phylogeography in particular. Several software packages have specifically been developed for the purpose of reconstructing genealogies from closely related, and hence, highly similar haplotype sequence data. Here, we use simulated data sets to test the performance of traditional phylogenetic algorithms, neighbour-joining, maximum parsimony and maximum likelihood in estimating genealogies from nonrecombining haplotypic genetic data. We demonstrate that these methods are suitable for constructing genealogies from sets of closely related DNA sequences with or without migration. As genealogies based on phylogenetic reconstructions are fully resolved, but not necessarily bifurcating, and without reticulations, these approaches outperform widespread 'network' constructing methods. In our simulations of coalescent scenarios involving panmictic, symmetric and asymmetric migration, we found that phylogenetic reconstruction methods performed well, while the statistical parsimony approach as implemented in TCS performed poorly. Overall, parsimony as implemented in the PHYLIP package performed slightly better than other methods. We further point out that we are not making the case that widespread 'network' constructing methods are bad, but that traditional phylogenetic tree finding methods are applicable to haplotypic data and exhibit reasonable performance with respect to accuracy and robustness. We also discuss some of the problems of converting a tree to a haplotype genealogy, in particular that it is nonunique. © 2011 Blackwell Publishing Ltd.

  11. Class I gene regulation of haplotype preference may influence antiviral immunity in vivo

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Marker, O

    1989-01-01

    combinations we were unable to detect an influence of sex, non-H-2 background, maternal genotype, or route of priming on the preference pattern. In other haplotype combinations tested (k and b, b and d) no distinct haplotype preference was observed. A comparison of the LCMV-specific Tc response of (C X C3) F1......The lymphocytic choriomeningitis virus (LCMV)-specific Tc response in (C3 X D2) F1 hybrids (k X d) is markedly biased in favor of the H-2d haplotype. Adoptive transfer experiments established that this haplotype preference also applied to T cell function in vivo. Using different mouse strain...... and (C-H-2dm2 X C3) F1 hybrids revealed that the dominance of the H-2d haplotype was controlled by H-2Ld. The ability of this gene to down-regulate the generation of an H-2k-restricted response did not seem to reflect antigenic mimicry since H-2k-restricted LCMV-specific Tc did not lyse H-2d expressing...

  12. CRP genotype and haplotype associations with serum C-reactive protein level and DAS28 in untreated early rheumatoid arthritis patients

    DEFF Research Database (Denmark)

    Ammitzbøll, Christian Gytz; Steffensen, Rudi; Bøgsted, Martin

    2014-01-01

    investigated: rs11265257, rs1130864, rs1205, rs1800947, rs2808632, rs3093077 and rs876538. The genotype and haplotype associations with CRP and DAS28 levels were evaluated using linear regression analysis adjusted for age, sex and treatment. RESULTS: The minor allele of rs1205 C > T was associated......INTRODUCTION: Single-nucleotide polymorphisms (SNPs) in the CRP gene are implicated in the regulation of the constitutional C-reactive protein (CRP) expression and its response to proinflammatory stimuli. Previous reports suggest that these effects may have an impact on clinical decision...

  13. Human leucocyte antigens class II allele and haplotype association with Type 1 Diabetes in Madeira Island (Portugal).

    Science.gov (United States)

    Spínola, H; Lemos, A; Couto, A R; Parreira, B; Soares, M; Dutra, I; Bruges-Armas, J; Brehm, A; Abreu, S

    2017-12-01

    This study confirms for Madeira Island (Portugal) population the Type 1 Diabetes (T1D) susceptible and protective Human leucocyte antigens (HLA) markers previously reported in other populations and adds some local specificities. Among the strongest T1D HLA associations, stands out, as susceptible, the alleles DRB1*04:05 (OR = 7.3), DQB1*03:02 (OR = 6.1) and DQA1*03:03 (OR = 4.5), as well as the haplotypes DRB1*04:05-DQA1*03:03-DQB1*03:02 (OR = 100.9) and DRB1*04:04-DQA1*03:01-DQB1*03:02 (OR = 22.1), and DQB1*06:02 (OR = 0.07) and DRB1*15:01-DQA1*01:02-DQB1*06:02 (OR = 0.04) as protective. HLA-DQA1 positive for Arginine at position 52 (Arg52) (OR = 15.2) and HLA-DQB1 negative for Aspartic acid at the position 57 (Asp57) (OR = 9.0) alleles appear to be important genetic markers for T1D susceptibility, with higher odds ratio values than any single allele and than most of the haplotypes. Genotypes generated by the association of markers Arg52 DQA1 positive and Asp57 DQB1 negative increase T1D susceptibility much more than one would expected by a simple additive effect of those markers separately (OR = 26.9). This study also confirms an increased risk for DRB1*04/DRB1*03 heterozygote genotypes (OR = 16.8) and also a DRB1*04-DQA1*03:01-DQB1*03:02 haplotype susceptibility dependent on the DRB1*04 allele (DRB1*04:01, OR = 7.9; DRB1*04:02, OR = 3.2; DRB1*04:04, OR = 22.1). © 2017 John Wiley & Sons Ltd.

  14. Comprehensive linkage and association analyses identify haplotype, near to the TNFSF15 gene, significantly associated with spondyloarthritis.

    Directory of Open Access Journals (Sweden)

    Elena Zinovieva

    2009-06-01

    Full Text Available Spondyloarthritis (SpA is a chronic inflammatory disorder with a strong genetic predisposition dominated by the role of HLA-B27. However, the contribution of other genes to the disease susceptibility has been clearly demonstrated. We previously reported significant evidence of linkage of SpA to chromosome 9q31-34. The current study aimed to characterize this locus, named SPA2. First, we performed a fine linkage mapping of SPA2 (24 cM with 28 microsatellite markers in 149 multiplex families, which allowed us to reduce the area of investigation to an 18 cM (13 Mb locus delimited by the markers D9S279 and D9S112. Second, we constructed a linkage disequilibrium (LD map of this region with 1,536 tag single-nucleotide polymorphisms (SNPs in 136 families (263 patients. The association was assessed using a transmission disequilibrium test. One tag SNP, rs4979459, yielded a significant P-value (4.9 x 10(-5. Third, we performed an extension association study with rs4979459 and 30 surrounding SNPs in LD with it, in 287 families (668 patients, and in a sample of 139 cases and 163 controls. Strong association was observed in both familial and case/control datasets for several SNPs. In the replication study, carried with 8 SNPs in an independent sample of 232 cases and 149 controls, one SNP, rs6478105, yielded a nominal P-value<3 x 10(-2. Pooled case/control study (371 cases and 312 controls as well as combined analysis of extension and replication data showed very significant association (P<5 x 10(-4 for 6 of the 8 latter markers (rs7849556, rs10817669, rs10759734, rs6478105, rs10982396, and rs10733612. Finally, haplotype association investigations identified a strongly associated haplotype (P<8.8 x 10(-5 consisting of these 6 SNPs and located in the direct vicinity of the TNFSF15 gene. In conclusion, we have identified within the SPA2 locus a haplotype strongly associated with predisposition to SpA which is located near to TNFSF15, one of the major

  15. Evidence for the molecular heterogeneity of sickle cell anemia chromosomes bearing the betaS/Benin haplotype.

    Science.gov (United States)

    Patrinos, George P; Samperi, Piera; Lo Nigro, Luca; Kollia, Panagoula; Schiliro, Gino; Papadakis, Manoussos N

    2005-09-01

    There are at least four distinct African and one Asian chromosomal backgrounds (haplotypes) on which the sickle cell mutation has arisen. Additionally, previous data suggest that the beta(S)/Bantu haplotype is heterogeneous at the molecular level. Here, we report the presence of the (A)gamma -499 T-->A variation in sickle cell anemia chromosomes of Sicilian and North African origin bearing the beta(S)/Benin haplotype. Being absent from North American beta(S)/Benin chromosomes, which were studied previously, this variation is indicative for the molecular heterogeneity of the beta(S)/Benin haplotype. Copyright 2005 Wiley-Liss, Inc.

  16. Reaction of sources of resistance to white mold to microsatellite haplotypes of Sclerotinia sclerotiorum

    Directory of Open Access Journals (Sweden)

    Miller da Silva Lehner

    2016-04-01

    Full Text Available ABSTRACT White mold caused by the fungus Sclerotinia sclerotiorum is the most yield-limiting disease of common bean in Brazil. To date, there has been no commercial cultivar resistant to this disease. In a greenhouse we evaluated white mold resistance sources (Cornell 605, A195 and G122 against eight isolates of S. sclerotiorum from five Brazilian states. A Brazilian cultivar (BRSMG Madrepérola and a susceptible check (Beryl were used as control. Treatments were arranged in factorial combinations (5 × 8 in a completely random design with four replicates. Disease severity was assessed on a rating scale of 1-to-9 together with lesion length, which was used to determine an area under the disease progress curve (AUDPC. Polymorphisms detected in ten microsatellite loci were used to assess variability between the isolates. Each isolate was a distinct haplotype; they formed a genetic tree with two clusters. One cluster was formed by three isolates collected from the states of Minas Gerais and São Paulo (southeastern; the others, by isolates from Paraná, Santa Catarina (southern, Goiás (Mid-western, and again, Minas Gerais. Genotype × isolate interaction was significant. In general, Beryl was more susceptible than BRSMG Madrepérola. Considering the AUDPC and/or the white mold reaction score, Cornell 605 exhibited more physiological resistance than BRSMG Madrepérola to seven isolates, A195 to five isolates, and G122 to two isolates. Our results suggest that Cornell 605 is the best source of resistance to white mold for the southern region, whereas Cornell 605 and A195 are somewhat superior to G122 for the southeastern and mid-western regions.

  17. Haplotype Variation of Flowering Time Genes of Sugar Beet and Its Wild Relatives and the Impact on Life Cycle Regimes

    Directory of Open Access Journals (Sweden)

    Nadine Höft

    2018-01-01

    Full Text Available The species Beta vulgaris encompasses wild and cultivated members with a broad range of phenological development. The annual life cycle is commonly found in sea beets (ssp. maritima from Mediterranean environments which germinate, bolt, and flower within one season under long day conditions. Biennials such as the cultivated sugar beet (B. vulgaris ssp. vulgaris as well as sea beets from northern latitudes require prolonged exposure to cold temperature over winter to acquire floral competence. Sugar beet is mainly cultivated for sugar production in Europe and is likely to have originated from sea beet. Flowering time strongly affects seed yield and yield potential and is thus a trait of high agronomic relevance. Besides environmental cues, there are complex genetic networks known to impact life cycle switch in flowering plants. In sugar beet, BTC1, BvBBX19, BvFT1, and BvFT2 are major flowering time regulators. In this study, we phenotyped plants from a diversity Beta panel encompassing cultivated and wild species from different geographical origin. Plants were grown under different day length regimes with and without vernalization. Haplotype analysis of BTC1, BvBBX19, BvFT1, and BvFT2 was performed to identify natural diversity of these genes and their impact on flowering. We found that accessions from northern latitudes flowered significantly later than those from southern latitudes. Some plants did not flower at all, indicating a strong impact of latitude of origin on life cycle. Haplotype analysis revealed a high conservation of the CCT-, REC-, BBX-, and PEBP-domains with regard to SNP occurrence. We identified sequence variation which may impact life cycle adaptation in beet. Our data endorse the importance of BTC1 in the domestication process of cultivated beets and contribute to the understanding of distribution and adaption of Beta species to different life cycle regimes in response to different environments. Moreover, our data provide a

  18. Haplotype Variation of Flowering Time Genes of Sugar Beet and Its Wild Relatives and the Impact on Life Cycle Regimes

    Science.gov (United States)

    Höft, Nadine; Dally, Nadine; Hasler, Mario; Jung, Christian

    2018-01-01

    The species Beta vulgaris encompasses wild and cultivated members with a broad range of phenological development. The annual life cycle is commonly found in sea beets (ssp. maritima) from Mediterranean environments which germinate, bolt, and flower within one season under long day conditions. Biennials such as the cultivated sugar beet (B. vulgaris ssp. vulgaris) as well as sea beets from northern latitudes require prolonged exposure to cold temperature over winter to acquire floral competence. Sugar beet is mainly cultivated for sugar production in Europe and is likely to have originated from sea beet. Flowering time strongly affects seed yield and yield potential and is thus a trait of high agronomic relevance. Besides environmental cues, there are complex genetic networks known to impact life cycle switch in flowering plants. In sugar beet, BTC1, BvBBX19, BvFT1, and BvFT2 are major flowering time regulators. In this study, we phenotyped plants from a diversity Beta panel encompassing cultivated and wild species from different geographical origin. Plants were grown under different day length regimes with and without vernalization. Haplotype analysis of BTC1, BvBBX19, BvFT1, and BvFT2 was performed to identify natural diversity of these genes and their impact on flowering. We found that accessions from northern latitudes flowered significantly later than those from southern latitudes. Some plants did not flower at all, indicating a strong impact of latitude of origin on life cycle. Haplotype analysis revealed a high conservation of the CCT-, REC-, BBX-, and PEBP-domains with regard to SNP occurrence. We identified sequence variation which may impact life cycle adaptation in beet. Our data endorse the importance of BTC1 in the domestication process of cultivated beets and contribute to the understanding of distribution and adaption of Beta species to different life cycle regimes in response to different environments. Moreover, our data provide a resource for

  19. Haplotype CGC from XPD, hOGG1 and ITGA2 polymorphisms increases the risk of nasopharyngeal carcinoma in Malaysia.

    Directory of Open Access Journals (Sweden)

    Eng-Zhuan Ban

    Full Text Available 8-oxoG, a common DNA lesion resulting from reactive oxygen species (ROS, has been shown to be associated with cancer initiation. hOGG1 DNA glycosylase is the primary enzyme responsible for excision of 8-oxoG through base excision repair (BER. Integrins are members of a family of cell surface receptors that mediate the cell-cell and extracellular matrix (ECM interactions. Integrins are involved in almost every aspect of carcinogenesis, from cell differentiation, cell proliferation, metastasis to angiogenesis. Loss of ITGA2 expression was associated with enhanced tumor intravasation and metastasis of breast and colon cancer. XPD gene encodes DNA helicase enzyme that is involved in nucleotide excision repair (NER. It is shown in previous research that XPD homozygous wildtype Lys/Lys genotype was associated with higher odds of NPC.We conducted a 1 to N case-control study involving 300 nasopharyngeal carcinoma (NPC cases and 533 controls matched by age, gender and ethnicity to investigate the effect of hOGG1 Ser326Cys, ITGA2 C807T and XPD Lys751Gln polymorphisms on NPC risk. Linkage disequilibrium and haplotype analysis were conducted to explore the association of allele combinations with NPC risk. Restriction fragment length polymorphism (RFLP-PCR was used for DNA genotyping.No significant association was observed between hOGG1 Ser326Cys and ITGA2 C807T polymorphisms with NPC risk after adjustment for age, gender, ethnicity, cigarette smoking, alcohol and salted fish consumption. Lys/Lys genotype of XPD Lys751Gln polymorphism was associated with increased NPC risk (OR = 1.60, 95% CI = 1.06-2.43. Subjects with history of smoking (OR = 1.81, 95% CI = 1.26-2.60, and salted fish consumption before age of 10 (OR = 1.77, 95% CI = 1.30-2.42 were observed to have increased odds of NPC. The odds of developing NPC of CGC haplotype was significantly higher compared to reference AGC haplotype (OR = 2.20, 95% CI = 1.06-4.58.The allele combination of CGC from h

  20. Haplotype CGC from XPD, hOGG1 and ITGA2 polymorphisms increases the risk of nasopharyngeal carcinoma in Malaysia.

    Science.gov (United States)

    Ban, Eng-Zhuan; Lye, Munn-Sann; Chong, Pei Pei; Yap, Yoke-Yeow; Lim, Siew Ying Crystale; Abdul Rahman, Hejar

    2017-01-01

    8-oxoG, a common DNA lesion resulting from reactive oxygen species (ROS), has been shown to be associated with cancer initiation. hOGG1 DNA glycosylase is the primary enzyme responsible for excision of 8-oxoG through base excision repair (BER). Integrins are members of a family of cell surface receptors that mediate the cell-cell and extracellular matrix (ECM) interactions. Integrins are involved in almost every aspect of carcinogenesis, from cell differentiation, cell proliferation, metastasis to angiogenesis. Loss of ITGA2 expression was associated with enhanced tumor intravasation and metastasis of breast and colon cancer. XPD gene encodes DNA helicase enzyme that is involved in nucleotide excision repair (NER). It is shown in previous research that XPD homozygous wildtype Lys/Lys genotype was associated with higher odds of NPC. We conducted a 1 to N case-control study involving 300 nasopharyngeal carcinoma (NPC) cases and 533 controls matched by age, gender and ethnicity to investigate the effect of hOGG1 Ser326Cys, ITGA2 C807T and XPD Lys751Gln polymorphisms on NPC risk. Linkage disequilibrium and haplotype analysis were conducted to explore the association of allele combinations with NPC risk. Restriction fragment length polymorphism (RFLP-PCR) was used for DNA genotyping. No significant association was observed between hOGG1 Ser326Cys and ITGA2 C807T polymorphisms with NPC risk after adjustment for age, gender, ethnicity, cigarette smoking, alcohol and salted fish consumption. Lys/Lys genotype of XPD Lys751Gln polymorphism was associated with increased NPC risk (OR = 1.60, 95% CI = 1.06-2.43). Subjects with history of smoking (OR = 1.81, 95% CI = 1.26-2.60), and salted fish consumption before age of 10 (OR = 1.77, 95% CI = 1.30-2.42) were observed to have increased odds of NPC. The odds of developing NPC of CGC haplotype was significantly higher compared to reference AGC haplotype (OR = 2.20, 95% CI = 1.06-4.58). The allele combination of CGC from hOGG1

  1. Evidence for Directional Selection at a Novel Major Histocompatibility Class I Marker in Wild Common Frogs (Rana temporaria) Exposed to a Viral Pathogen (Ranavirus)

    Science.gov (United States)

    Teacher, Amber G. F.; Garner, Trenton W. J.; Nichols, Richard A.

    2009-01-01

    Whilst the Major Histocompatibility Complex (MHC) is well characterized in the anuran Xenopus, this region has not previously been studied in another popular model species, the common frog (Rana temporaria). Nor, to date, have there been any studies of MHC in wild amphibian host-pathogen systems. We characterise an MHC class I locus in the common frog, and present primers to amplify both the whole region, and specifically the antigen binding region. As no more than two expressed haplotypes were found in over 400 clones from 66 individuals, it is likely that there is a single class I locus in this species. This finding is consistent with the single class I locus in Xenopus, but contrasts with the multiple loci identified in axolotls, providing evidence that the diversification of MHC class I into multiple loci likely occurred after the Caudata/Anura divergence (approximately 350 million years ago) but before the Ranidae/Pipidae divergence (approximately 230 mya). We use this locus to compare wild populations of common frogs that have been infected with a viral pathogen (Ranavirus) with those that have no history of infection. We demonstrate that certain MHC supertypes are associated with infection status (even after accounting for shared ancestry), and that the diseased populations have more similar supertype frequencies (lower FST) than the uninfected. These patterns were not seen in a suite of putatively neutral microsatellite loci. We interpret this pattern at the MHC locus to indicate that the disease has imposed selection for particular haplotypes, and hence that common frogs may be adapting to the presence of Ranavirus, which currently kills tens of thousands of amphibians in the UK each year. PMID:19240796

  2. High-accuracy haplotype imputation using unphased genotype data as the references.

    Science.gov (United States)

    Li, Wenzhi; Xu, Wei; Fu, Guoxing; Ma, Li; Richards, Jendai; Rao, Weinian; Bythwood, Tameka; Guo, Shiwen; Song, Qing

    2015-11-10

    Enormously growing genomic datasets present a new challenge on missing data imputation, a notoriously resource-demanding task. Haplotype imputation requires ethnicity-matched references. However, to date, haplotype references are not available for the majority of populations in the world. We explored to use existing unphased genotype datasets as references; if it succeeds, it will cover almost all of the populations in the world. The results showed that our HiFi software successfully yields 99.43% accuracy with unphased genotype references. Our method provides a cost-effective solution to breakthrough the bottleneck of limited reference availability for haplotype imputation in the big data era. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Haplotype-resolved sweet potato genome traces back its hexaploidization history.

    Science.gov (United States)

    Yang, Jun; Moeinzadeh, M-Hossein; Kuhl, Heiner; Helmuth, Johannes; Xiao, Peng; Haas, Stefan; Liu, Guiling; Zheng, Jianli; Sun, Zhe; Fan, Weijuan; Deng, Gaifang; Wang, Hongxia; Hu, Fenhong; Zhao, Shanshan; Fernie, Alisdair R; Boerno, Stefan; Timmermann, Bernd; Zhang, Peng; Vingron, Martin

    2017-09-01

    Here we present the 15 pseudochromosomes of sweet potato, Ipomoea batatas, the seventh most important crop in the world and the fourth most significant in China. By using a novel haplotyping method based on genome assembly, we have produced a half haplotype-resolved genome from ~296 Gb of paired-end sequence reads amounting to roughly 67-fold coverage. By phylogenetic tree analysis of homologous chromosomes, it was possible to estimate the time of two recent whole-genome duplication events as occurring about 0.8 and 0.5 million years ago. This half haplotype-resolved hexaploid genome represents the first successful attempt to investigate the complexity of chromosome sequence composition directly in a polyploid genome, using sequencing of the polyploid organism itself rather than any of its simplified proxy relatives. Adaptation and application of our approach should provide higher resolution in future genomic structure investigations, especially for similarly complex genomes.

  4. HLA-DRB1-DQB1 haplotypes confer susceptibility and resistance to multiple sclerosis in Sardinia.

    Directory of Open Access Journals (Sweden)

    Eleonora Cocco

    Full Text Available INTRODUCTION: Genetic predisposition to multiple sclerosis (MS in Sardinia (Italy has been associated with five DRB1*-DQB1* haplotypes of the human leukocyte antigen (HLA. Given the complexity of these associations, an in-depth re-analysis was performed with the specific aims of confirming the haplotype associations; establishing the independence of the associated haplotypes; and assessing patients' genotypic risk of developing MS. METHODS AND RESULTS: A transmission disequilibrium test (TDT of the DRB1*-DQB1* haplotypes in 943 trio families, confirmed a higher than expected transmission rate (over-transmission of the *13:03-*03:01 (OR = 2.9, P = 7.6×10(-3, *04:05-*03:01 (OR = 2.4, P = 4.4×10(-6 and *03:01-*02:01 (OR = 2.1, P = 1.0×10(-15 haplotype. In contrast, the *16:01-*05:02 (OR = 0.5, P = 5.4×10(-11 and the *15:02-*06:01 (OR = 0.3, P = 1.5×10(-3 haplotypes exhibited a lower than expected transmission rate (under-transmission. The independence of the transmission of each positively and negatively associated haplotype was confirmed relative to all positively associated haplotypes, and to the negatively associated *16:01-*05:02 haplotype. In patients, carriage of two predisposing haplotypes, or of protective haplotypes, respectively increased or decreased the patient's risk of developing MS. The risk of MS followed a multiplicative model of genotypes, which was, in order of decreasing ORs: *04:05-*0301/*03:01-*02:01 (OR = 4.5; *03:01-*02:01/*03:01-*02:01 (OR = 4.1; and the *16:01-*05:02/*16:01-*0502 (OR = 0.2 genotypes. Analysis of DRB1 and DQB1 protein chain residues showed that the Val/Gly residue at position 86 of the DRB1 chain was the only difference between the protective *16:01- *15:02 alleles and the predisposing *15:01 one. Similarly, the Ala/Val residue at position 38 of the DQB1 chain differentiated the positively associated *06:02 allele and the negatively associated *05

  5. Characteristic beta-globin gene cluster haplotypes of Evenkis and Oroqens in north China.

    Science.gov (United States)

    Shimizu, Koji; Marubayashi, Azusa; Tokimasa, Kozue; Harihara, Shinji; Omoto, Keiichi; Imanishi, Tadashi; Hao, Luping; Jin, Feng

    2004-10-01

    Haplotype frequencies of the beta-globin gene cluster were estimated for 114 Evenkis and 81 Oroqens from northeast China, and their characteristics were compared with those in Japanese, Koreans, and three Colombian Amerindian groups of South America (Wayuu, Kamsa, and Inga tribes). A major 5' subhaplotype (5' to the delta-globin gene) was + - - - - in Evenkis, whereas + - - - -, - + + - +, and - + - + + were the major subhaplotypes in Oroqens. One possible candidate for an ancestral 5' subhaplotype, - - - - -, was found in one Evenki (0.5%) and three Oroqen chromosomes (2.0%). They were observed as heterozygous forms for + ---- and -----. Major haplotypes were +-----+, + -----+-, and + - - - - + + in Evenkis, whereas they were +-----+,-++-+-+, +----+-, and -+-++-+ in Oroqens. The lowest Nei's genetic distance values of Evenkis or Oroqens based on the 5' subhaplotype frequency distributions were observed in relation to the Wayuu or Koreans, respectively, but those of Evenkis and Oroqens based on the haplotype frequency distributions were found in relation to Koreans.

  6. Climate Clever Clovers: New Paradigm to Reduce the Environmental Footprint of Ruminants by Breeding Low Methanogenic Forages Utilizing Haplotype Variation

    Directory of Open Access Journals (Sweden)

    Parwinder Kaur

    2017-09-01

    Full Text Available Mitigating methane production by ruminants is a significant challenge to global livestock production. This research offers a new paradigm to reduce methane emissions from ruminants by breeding climate-clever clovers. We demonstrate wide genetic diversity for the trait methanogenic potential in Australia’s key pasture legume, subterranean clover (Trifolium subterraneum L.. In a bi-parental population the broadsense heritability in methanogenic potential was moderate (H2 = 0.4 and allelic variation in a region of Chr 8 accounted for 7.8% of phenotypic variation. In a genome-wide association study we identified four loci controlling methanogenic potential assessed by an in vitro fermentation system. Significantly, the discovery of a single nucleotide polymorphism (SNP on Chr 5 in a defined haplotype block with an upstream putative candidate gene from a plant peroxidase-like superfamily (TSub_g18548 and a downstream lectin receptor protein kinase (TSub_g18549 provides valuable candidates for an assay for this complex trait. In this way haplotype variation can be tracked to breed pastures with reduced methanogenic potential. Of the quantitative trait loci candidates, the DNA-damage-repair/toleration DRT100-like protein (TSub_g26967, linked to avoid the severity of DNA damage induced by secondary metabolites, is considered central to enteric methane production, as are disease resistance (TSub_g26971, TSub_g26972, and TSub_g18549 and ribonuclease proteins (TSub_g26974, TSub_g26975. These proteins are good pointers to elucidate the genetic basis of in vitro microbial fermentability and enteric methanogenic potential in subterranean clover. The genes identified allow the design of a suite of markers for marker-assisted selection to reduce rumen methane emission in selected pasture legumes. We demonstrate the feasibility of a plant breeding approach without compromising animal productivity to mitigate enteric methane emissions, which is one of the most

  7. Trypanosoma cruzi IV causing outbreaks of acute Chagas disease and infections by different haplotypes in the Western Brazilian Amazonia.

    Directory of Open Access Journals (Sweden)

    Wuelton Marcelo Monteiro

    Full Text Available BACKGROUND: Chagas disease is an emergent tropical disease in the Brazilian Amazon Region, with an increasing number of cases in recent decades. In this region, the sylvatic cycle of Trypanosoma cruzi transmission, which constitutes a reservoir of parasites that might be associated with specific molecular, epidemiological and clinical traits, has been little explored. The objective of this work is to genetically characterize stocks of T. cruzi from human cases, triatomines and reservoir mammals in the State of Amazonas, in the Western Brazilian Amazon. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed 96 T. cruzi samples from four municipalities in distant locations of the State of Amazonas. Molecular characterization of isolated parasites from cultures in LIT medium or directly from vectors or whole human blood was performed by PCR of the non-transcribed spacer of the mini-exon and of the 24 S alfa ribosomal RNA gene, RFLP and sequencing of the mitochondrial cytochrome c oxidase subunit II (COII gene, and by sequencing of the glucose-phosphate isomerase gene. The T. cruzi parasites from two outbreaks of acute disease were all typed as TcIV. One of the outbreaks was triggered by several haplotypes of the same DTU. TcIV also occurred in isolated cases and in Rhodnius robustus. Incongruence between mitochondrial and nuclear phylogenies is likely to be indicative of historical genetic exchange events resulting in mitochondrial introgression between TcIII and TcIV DTUs from Western Brazilian Amazon. TcI predominated among triatomines and was the unique DTU infecting marsupials. CONCLUSION/SIGNIFICANCE: DTU TcIV, rarely associated with human Chagas disease in other areas of the Amazon basin, is the major strain responsible for the human infections in the Western Brazilian Amazon, occurring in outbreaks as single or mixed infections by different haplotypes.

  8. Association of RET genetic polymorphisms and haplotypes with papillary thyroid carcinoma in the Portuguese population: a case-control study.

    Directory of Open Access Journals (Sweden)

    Marina Santos

    Full Text Available Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A, L769L (exon 13, rs1800861 T/G, S836S (exon 14, rs1800862 C/T, and S904S (exon 15, rs1800863 C/G. The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC when compared to controls (OR 1.57; 95% CI 1.05-2.35; p = 0.026. The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07-5.91; p = 0.029. No associations were found in follicular thyroid carcinoma (FTC. Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour.

  9. Association of RET Genetic Polymorphisms and Haplotypes with Papillary Thyroid Carcinoma in the Portuguese Population: A Case-Control Study

    Science.gov (United States)

    Santos, Marina; Azevedo, Teresa; Martins, Teresa; Rodrigues, Fernando J.; Lemos, Manuel C.

    2014-01-01

    Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET) proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs) on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A), L769L (exon 13, rs1800861 T/G), S836S (exon 14, rs1800862 C/T), and S904S (exon 15, rs1800863 C/G). The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC) when compared to controls (OR 1.57; 95% CI 1.05–2.35; p = 0.026). The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07–5.91; p = 0.029). No associations were found in follicular thyroid carcinoma (FTC). Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour. PMID:25330015

  10. Climate Clever Clovers: New Paradigm to Reduce the Environmental Footprint of Ruminants by Breeding Low Methanogenic Forages Utilizing Haplotype Variation.

    Science.gov (United States)

    Kaur, Parwinder; Appels, Rudi; Bayer, Philipp E; Keeble-Gagnere, Gabriel; Wang, Jiankang; Hirakawa, Hideki; Shirasawa, Kenta; Vercoe, Philip; Stefanova, Katia; Durmic, Zoey; Nichols, Phillip; Revell, Clinton; Isobe, Sachiko N; Edwards, David; Erskine, William

    2017-01-01

    Mitigating methane production by ruminants is a significant challenge to global livestock production. This research offers a new paradigm to reduce methane emissions from ruminants by breeding climate-clever clovers. We demonstrate wide genetic diversity for the trait methanogenic potential in Australia's key pasture legume, subterranean clover ( Trifolium subterraneum L.). In a bi-parental population the broadsense heritability in methanogenic potential was moderate ( H 2 = 0.4) and allelic variation in a region of Chr 8 accounted for 7.8% of phenotypic variation. In a genome-wide association study we identified four loci controlling methanogenic potential assessed by an in vitro fermentation system. Significantly, the discovery of a single nucleotide polymorphism (SNP) on Chr 5 in a defined haplotype block with an upstream putative candidate gene from a plant peroxidase-like superfamily (TSub_g18548) and a downstream lectin receptor protein kinase (TSub_g18549) provides valuable candidates for an assay for this complex trait. In this way haplotype variation can be tracked to breed pastures with reduced methanogenic potential. Of the quantitative trait loci candidates, the DNA-damage-repair/toleration DRT100-like protein (TSub_g26967), linked to avoid the severity of DNA damage induced by secondary metabolites, is considered central to enteric methane production, as are disease resistance (TSub_g26971, TSub_g26972, and TSub_g18549) and ribonuclease proteins (TSub_g26974, TSub_g26975). These proteins are good pointers to elucidate the genetic basis of in vitro microbial fermentability and enteric methanogenic potential in subterranean clover. The genes identified allow the design of a suite of markers for marker-assisted selection to reduce rumen methane emission in selected pasture legumes. We demonstrate the feasibility of a plant breeding approach without compromising animal productivity to mitigate enteric methane emissions, which is one of the most significant

  11. Genome-Wide Pharmacogenomic Study on Methadone Maintenance Treatment Identifies SNP rs17180299 and Multiple Haplotypes on CYP2B6, SPON1, and GSG1L Associated with Plasma Concentrations of Methadone R- and S-enantiomers in Heroin-Dependent Patients

    Science.gov (United States)

    Yang, Hsin-Chou; Chu, Shih-Kai; Huang, Chieh-Liang; Kuo, Hsiang-Wei; Wang, Sheng-Chang; Liu, Sheng-Wen; Ho, Ing-Kang; Liu, Yu-Li

    2016-01-01

    Methadone maintenance treatment (MMT) is commonly used for controlling opioid dependence, preventing withdrawal symptoms, and improving the quality of life of heroin-dependent patients. A steady-state plasma concentration of methadone enantiomers, a measure of methadone metabolism, is an index of treatment response and efficacy of MMT. Although the methadone metabolism pathway has been partially revealed, no genome-wide pharmacogenomic study has been performed to identify genetic determinants and characterize genetic mechanisms for the plasma concentrations of methadone R- and S-enantiomers. This study was the first genome-wide pharmacogenomic study to identify genes associated with the plasma concentrations of methadone R- and S-enantiomers and their respective metabolites in a methadone maintenance cohort. After data quality control was ensured, a dataset of 344 heroin-dependent patients in the Han Chinese population of Taiwan who underwent MMT was analyzed. Genome-wide single-locus and haplotype-based association tests were performed to analyze four quantitative traits: the plasma concentrations of methadone R- and S-enantiomers and their respective metabolites. A significant single nucleotide polymorphism (SNP), rs17180299 (raw p = 2.24 × 10−8), was identified, accounting for 9.541% of the variation in the plasma concentration of the methadone R-enantiomer. In addition, 17 haplotypes were identified on SPON1, GSG1L, and CYP450 genes associated with the plasma concentration of methadone S-enantiomer. These haplotypes accounted for approximately one-fourth of the variation of the overall S