WorldWideScience

Sample records for single base pair

  1. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  2. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  3. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  4. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  5. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

    2015-12-15

    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  6. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  7. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang

    2018-01-04

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  8. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    KAUST Repository

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  9. Single-flavour and two-flavour pairing in three-flavour quark matter

    International Nuclear Information System (INIS)

    Alford, Mark G; Cowan, Greig A

    2006-01-01

    We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities

  10. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  11. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  12. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    Science.gov (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  13. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  14. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  15. Using Single Colors and Color Pairs to Communicate Basic Tastes

    Directory of Open Access Journals (Sweden)

    Andy T. Woods

    2016-07-01

    Full Text Available Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty with specific colors (e.g., red, green, black, and white. In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  16. Using Single Colors and Color Pairs to Communicate Basic Tastes.

    Science.gov (United States)

    Woods, Andy T; Spence, Charles

    2016-01-01

    Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty) with specific colors (e.g., red, green, black, and white). In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word) would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.

  17. Einstein-Podolsky-Rosen paradox in single pairs of images.

    Science.gov (United States)

    Lantz, Eric; Denis, Séverine; Moreau, Paul-Antoine; Devaux, Fabrice

    2015-10-05

    Spatially entangled twin photons provide a test of the Einstein-Podolsky-Rosen (EPR) paradox in its original form of position (image plane) versus impulsion (Fourier plane). We show that recording a single pair of images in each plane is sufficient to safely demonstrate an EPR paradox. On each pair of images, we have retrieved the fluctuations by subtracting the fitted deterministic intensity shape and then have obtained an intercorrelation peak with a sufficient signal to noise ratio to safely distinguish this peak from random fluctuations. A 95% confidence interval has been determined, confirming a high degree of paradox whatever the considered single pairs. Last, we have verified that the value of the variance of the difference between twin images is always below the quantum (poissonian) limit, in order to ensure the particle character of the demonstration. Our demonstration shows that a single image pattern can reveal the quantum and non-local behavior of light.

  18. DNA deformability changes of single base pair mutants within CDE binding sites in S. Cerevisiae centromere DNA correlate with measured chromosomal loss rates and CDE binding site symmetries

    Directory of Open Access Journals (Sweden)

    Marx Kenneth A

    2006-03-01

    Full Text Available Abstract Background The centromeres in yeast (S. cerevisiae are organized by short DNA sequences (125 bp on each chromosome consisting of 2 conserved elements: CDEI and CDEIII spaced by a CDEII region. CDEI and CDEIII are critical sequence specific protein binding sites necessary for correct centromere formation and following assembly with proteins, are positioned near each other on a specialized nucleosome. Hegemann et al. BioEssays 1993, 15: 451–460 reported single base DNA mutants within the critical CDEI and CDEIII binding sites on the centromere of chromosome 6 and quantitated centromere loss of function, which they measured as loss rates for the different chromosome 6 mutants during cell division. Olson et al. Proc Natl Acad Sci USA 1998, 95: 11163–11168 reported the use of protein-DNA crystallography data to produce a DNA dinucleotide protein deformability energetic scale (PD-scale that describes local DNA deformability by sequence specific binding proteins. We have used the PD-scale to investigate the DNA sequence dependence of the yeast chromosome 6 mutants' loss rate data. Each single base mutant changes 2 PD-scale values at that changed base position relative to the wild type. In this study, we have utilized these mutants to demonstrate a correlation between the change in DNA deformability of the CDEI and CDEIII core sites and the overall experimentally measured chromosome loss rates of the chromosome 6 mutants. Results In the CDE I and CDEIII core binding regions an increase in the magnitude of change in deformability of chromosome 6 single base mutants with respect to the wild type correlates to an increase in the measured chromosome loss rate. These correlations were found to be significant relative to 105 Monte Carlo randomizations of the dinucleotide PD-scale applied to the same calculation. A net loss of deformability also tends to increase the loss rate. Binding site position specific, 4 data-point correlations were also

  19. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  20. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  1. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  2. Homozygosity for a single base-pair mutation in the oocyte-specific GDF9 gene results in sterility in Thoka sheep

    DEFF Research Database (Denmark)

    Nicel, Linda; Bishop, Stephen; Pong-Wong, Richardo

    2009-01-01

    and infertility in homozygotes. Analysis of homozygote ovarian morphology and a number of genes normally activated in growing follicles showed that GDF9 was not involved in oocyte activation, but in subsequent development of the follicle. This study highlights the importance of oocyte factors in regulating...... ovulation rate, although in some cases homozygous ewes are infertile. In the present study we present a detailed characterisation of a novel mutation in growth differentiation factor 9 (GDF9), found in Icelandic Thoka sheep. This mutation is a single base change (A1279C) resulting in a non-conservative...... fertility and provides new information for structural analysis and investigation of the potentially important sites of dimerization or translational modifications required to produce biologically active GDF9. It also provides the basis for the utilisation of these animals to enhance sheep production...

  3. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  4. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  5. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  6. Competing bosonic condensates in optical lattice with a mixture of single and pair hoppings

    Energy Technology Data Exchange (ETDEWEB)

    Travin, V.M., E-mail: v.travin@int.pan.wroc.pl; Kopeć, T.K., E-mail: t.kopec@int.pan.wroc.pl

    2017-01-15

    A system of ultra-cold atoms with single boson and pair tunneling of bosonic atoms is considered in an optical lattice at arbitrary temperature. A mean-field theory was applied to the extended Bose-Hubbard Hamiltonian describing the system in order to investigate the competition between superfluid and pair superfluid as a function of the chemical potential and the temperature. To this end we have applied a method based on the Laplace transform method for the efficient calculation of the statistical sum for the quantum Hamiltonian. These results may be of interest for experiments on cold atom systems in optical lattices.

  7. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  8. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  9. Single-diffractive Drell-Yan pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Ceccopieri, Federico Alberto [Universita degli Studi di Perugia, Dipartimento di Fisica e Geologia, Perugia (Italy); Universite de Liege, IFPA, Liege (Belgium); INFN, Sezione di Perugia (Italy)

    2017-01-15

    We present predictions for single-diffractive low-mass Drell-Yan pair production in pp collisions at the LHC at √(s) = 13 TeV. Predictions are obtained adopting a factorised form for the relevant cross sections and are based on a new set of diffractive parton distributions resulting from the QCD analysis of combined HERA leading proton data. We discuss a number of observables useful to characterise the expected factorisation breaking effects. (orig.)

  10. The evolution of a single-paired immigration death process

    Energy Technology Data Exchange (ETDEWEB)

    Gillespie, Colin S [School of Mathematics and Statistics, University of Newcastle, Newcastle upon Tyne NE1 7RU (United Kingdom); Renshaw, Eric [Department of Statistics and Modelling Science, Livingstone Tower, University of Strathclyde, 26 Richmond Street, Glasgow G1 1XH (United Kingdom)

    2008-09-05

    The general question of whether it is possible to determine the fundamental structure of a hidden stochastic process purely from counts of escaping individuals is of immense importance in fields such as quantum optics, where externally based radiation elucidates the nature of the electromagnetic radiation process. Although the general probability structure has been derived in an earlier paper in terms of the joint probability generating function of the (hidden) population size and (known) counts, its complex nature hides some particularly intriguing features of the underlying process. Our current objective is therefore to examine specific immigration regimes in order to highlight the underlying saw-tooth behaviour of the underlying probability and moment structures. The paper first explores paired- and triple-immigration schemes, and then introduces birth in order to show that the technique is equally successful in exposing hidden multiplicative effects. These analyses uncover novel and highly illuminating features, and emphasize the potential of this population-counting construct for expanding into more complex multi-type situations.

  11. The evolution of a single-paired immigration death process

    International Nuclear Information System (INIS)

    Gillespie, Colin S; Renshaw, Eric

    2008-01-01

    The general question of whether it is possible to determine the fundamental structure of a hidden stochastic process purely from counts of escaping individuals is of immense importance in fields such as quantum optics, where externally based radiation elucidates the nature of the electromagnetic radiation process. Although the general probability structure has been derived in an earlier paper in terms of the joint probability generating function of the (hidden) population size and (known) counts, its complex nature hides some particularly intriguing features of the underlying process. Our current objective is therefore to examine specific immigration regimes in order to highlight the underlying saw-tooth behaviour of the underlying probability and moment structures. The paper first explores paired- and triple-immigration schemes, and then introduces birth in order to show that the technique is equally successful in exposing hidden multiplicative effects. These analyses uncover novel and highly illuminating features, and emphasize the potential of this population-counting construct for expanding into more complex multi-type situations

  12. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  13. Multi-photon creation and single-photon annihilation of electron-positron pairs

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Huayu

    2011-04-27

    In this thesis we study multi-photon e{sup +}e{sup -} pair production in a trident process, and singlephoton e{sup +}e{sup -} pair annihilation in a triple interaction. The pair production is considered in the collision of a relativistic electron with a strong laser beam, and calculated within the theory of laser-dressed quantum electrodynamics. A regularization method is developed systematically for the resonance problem arising in the multi-photon process. Total production rates, positron spectra, and relative contributions of different reaction channels are obtained in various interaction regimes. Our calculation shows good agreement with existing experimental data from SLAC, and adds further insights into the experimental findings. Besides, we study the process in a manifestly nonperturbative domain, whose accessibility to future all-optical experiments based on laser acceleration is shown. In the single-photon e{sup +}e{sup -} pair annihilation, the recoil momentum is absorbed by a spectator particle. Various kinematic configurations of the three incoming particles are examined. Under certain conditions, the emitted photon exhibits distinct angular and polarization distributions which could facilitate the detection of the process. Considering an equilibrium relativistic e{sup +}e{sup -} plasma, it is found that the single-photon process becomes the dominant annihilation channel for plasma temperatures above 3 MeV. Multi-particle correlation effects are therefore essential for the e{sup +}e{sup -} dynamics at very high density. (orig.)

  14. Multi-photon creation and single-photon annihilation of electron-positron pairs

    International Nuclear Information System (INIS)

    Hu, Huayu

    2011-01-01

    In this thesis we study multi-photon e + e - pair production in a trident process, and singlephoton e + e - pair annihilation in a triple interaction. The pair production is considered in the collision of a relativistic electron with a strong laser beam, and calculated within the theory of laser-dressed quantum electrodynamics. A regularization method is developed systematically for the resonance problem arising in the multi-photon process. Total production rates, positron spectra, and relative contributions of different reaction channels are obtained in various interaction regimes. Our calculation shows good agreement with existing experimental data from SLAC, and adds further insights into the experimental findings. Besides, we study the process in a manifestly nonperturbative domain, whose accessibility to future all-optical experiments based on laser acceleration is shown. In the single-photon e + e - pair annihilation, the recoil momentum is absorbed by a spectator particle. Various kinematic configurations of the three incoming particles are examined. Under certain conditions, the emitted photon exhibits distinct angular and polarization distributions which could facilitate the detection of the process. Considering an equilibrium relativistic e + e - plasma, it is found that the single-photon process becomes the dominant annihilation channel for plasma temperatures above 3 MeV. Multi-particle correlation effects are therefore essential for the e + e - dynamics at very high density. (orig.)

  15. Skew Information for a Single Cooper Pair Box Interacting with a Single Cavity Field

    International Nuclear Information System (INIS)

    Metwally, N.; Al-Mannai, A.; Abdel-Aty, M.

    2013-01-01

    The dynamics of the skew information (SI) is investigated for a single Cooper Pair Box (CPB) interacting with a single cavity field. By suitably choosing the system parameters and precisely controlling the dynamics, novel connection is found between the SI and entanglement generation. It is shown that SI can be increased and reach its maximum value either by increasing the number of photons inside the cavity or considering the far off-resonant case. The number of oscillations of SI is increased by decreasing this ratio between the Josephson junction capacity and the gate capacity. This leads to significant improvement of the travelling time between the maximum and minimum values. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  16. Experimental study of single-vertex $(e^{-}-e^{+})$ pair creation in a crystal

    CERN Multimedia

    2002-01-01

    This experiment will study the newly predicted process of $e^{-}-e^{+}$ pair production by high energy photons incident along major axial direction of a single crystal. This process is based upon the well-known channeling properties of negatively charged particles along atomic rows of a crystal. The $e^{-}-e^{+}$ pair creation may proceed in a one-step process, without violating energy and momentum conversation laws, due to the lowering of the total energy of the channeled electron (Fig. 1). \\\\ \\\\ The pair creation rate should increase with increasing photon energies (above a threshold of a few GeV) and largely exceed the Bethe-Heitler process rate for photon energies of a few tens of GeV. It is also expected that the created particles share the photon energy nearly equally, in contrast with the rather flat energy distribution associated with the Bethe-Heitler process. \\\\ \\\\ The experimental set-up (Fig. 2) is designed for the study of those two features: photon energy dependence of the pair creation rate, an...

  17. Pair and single neutron transfer with Borromean 8He

    International Nuclear Information System (INIS)

    Lemasson, A.; Navin, A.; Rejmund, M.; Keeley, N.; Zelevinsky, V.; Bhattacharyya, S.; Shrivastava, A.; Bazin, D.; Beaumel, D.; Blumenfeld, Y.; Chatterjee, A.; Gupta, D.; France, G. de; Jacquot, B.; Labiche, M.; Lemmon, R.; Nanal, V.; Nyberg, J.; Pillay, R.G.; Raabe, R.

    2011-01-01

    Direct observation of the survival of 199 Au residues after 2n transfer in the 8 He+ 197 Au system and the absence of the corresponding 67 Cu in the 8 He+ 65 Cu system at various energies are reported. The measurements of the surprisingly large cross sections for 199 Au, coupled with the integral cross sections for the various Au residues, is used to obtain the first model-independent lower limits on the ratio of 2n to 1n transfer cross sections from 8 He to a heavy target. A comparison of the transfer cross sections for 6,8 He on these targets highlights the differences in the interactions of these Borromean nuclei. These measurements for the most neutron-rich nuclei on different targets highlight the need to probe the reaction mechanism with various targets and represent an experimental advance towards understanding specific features of pairing in the dynamics of dilute nuclear systems.

  18. Study of KS0 pair production in single-tag two-photon collisions

    Science.gov (United States)

    Masuda, M.; Uehara, S.; Watanabe, Y.; Adachi, I.; Ahn, J. K.; Aihara, H.; Al Said, S.; Asner, D. M.; Atmacan, H.; Aulchenko, V.; Aushev, T.; Ayad, R.; Babu, V.; Badhrees, I.; Bansal, V.; Behera, P.; Berger, M.; Bhardwaj, V.; Bhuyan, B.; Biswal, J.; Bondar, A.; Bonvicini, G.; Bozek, A.; Bračko, M.; Červenkov, D.; Chen, A.; Cheon, B. G.; Chilikin, K.; Cho, K.; Choi, Y.; Choudhury, S.; Cinabro, D.; Czank, T.; Dash, N.; Di Carlo, S.; Doležal, Z.; Drásal, Z.; Dutta, D.; Eidelman, S.; Epifanov, D.; Fast, J. E.; Ferber, T.; Fulsom, B. G.; Garg, R.; Gaur, V.; Gabyshev, N.; Garmash, A.; Gelb, M.; Giri, A.; Goldenzweig, P.; Guido, E.; Haba, J.; Hayasaka, K.; Hayashii, H.; Hedges, M. T.; Hou, W.-S.; Iijima, T.; Inami, K.; Inguglia, G.; Ishikawa, A.; Itoh, R.; Iwasaki, M.; Iwasaki, Y.; Jacobs, W. W.; Jaegle, I.; Jin, Y.; Joo, K. K.; Julius, T.; Kang, K. H.; Karyan, G.; Kawasaki, T.; Kichimi, H.; Kiesling, C.; Kim, D. Y.; Kim, H. J.; Kim, J. B.; Kim, K. T.; Kim, S. H.; Kodyš, P.; Kotchetkov, D.; Križan, P.; Kroeger, R.; Krokovny, P.; Kulasiri, R.; Kuzmin, A.; Kwon, Y.-J.; Lee, I. S.; Lee, S. C.; Li, L. K.; Li, Y.; Li Gioi, L.; Libby, J.; Liventsev, D.; Lubej, M.; Luo, T.; Matsuda, T.; Matvienko, D.; Merola, M.; Miyabayashi, K.; Miyata, H.; Mizuk, R.; Mohanty, G. B.; Moon, H. K.; Mori, T.; Mussa, R.; Nakao, M.; Nakazawa, H.; Nanut, T.; Nath, K. J.; Natkaniec, Z.; Nayak, M.; Niiyama, M.; Nisar, N. K.; Nishida, S.; Ogawa, S.; Okuno, S.; Ono, H.; Onuki, Y.; Pakhlov, P.; Pakhlova, G.; Pal, B.; Park, H.; Paul, S.; Pedlar, T. K.; Pestotnik, R.; Piilonen, L. E.; Ritter, M.; Rostomyan, A.; Russo, G.; Sakai, Y.; Salehi, M.; Sandilya, S.; Santelj, L.; Sanuki, T.; Savinov, V.; Schneider, O.; Schnell, G.; Schwanda, C.; Seidl, R.; Seino, Y.; Senyo, K.; Seon, O.; Sevior, M. E.; Shebalin, V.; Shen, C. P.; Shibata, T.-A.; Shimizu, N.; Shiu, J.-G.; Shwartz, B.; Sokolov, A.; Solovieva, E.; Starič, M.; Strube, J. F.; Sumihama, M.; Sumiyoshi, T.; Takizawa, M.; Tamponi, U.; Tanida, K.; Tenchini, F.; Teramoto, Y.; Uchida, M.; Uglov, T.; Unno, Y.; Uno, S.; Urquijo, P.; Van Hulse, C.; Varner, G.; Vinokurova, A.; Vorobyev, V.; Vossen, A.; Wang, B.; Wang, C. H.; Wang, M.-Z.; Wang, P.; Wang, X. L.; Watanabe, M.; Widmann, E.; Won, E.; Ye, H.; Yuan, C. Z.; Yusa, Y.; Zakharov, S.; Zhang, Z. P.; Zhilich, V.; Zhukova, V.; Zhulanov, V.; Zupanc, A.; Belle Collaboration

    2018-03-01

    We report a measurement of the cross section for KS0 pair production in single-tag two-photon collisions, γ*γ →KS0KS0, for Q2 up to 30 GeV2 , where Q2 is the negative of the invariant mass squared of the tagged photon. The measurement covers the kinematic range 1.0 GeV partial decay widths of the χc 0 and χc 2 mesons are measured as a function of Q2 based on 10 candidate events in total.

  19. Bell's experiment with intra- and inter-pair entanglement: Single-particle mode entanglement as a case study

    International Nuclear Information System (INIS)

    Ashhab, S.; Nori, Franco; Maruyama, Koji; Brukner, Caslav

    2009-01-01

    Theoretical considerations of Bell-inequality experiments usually assume identically prepared and independent pairs of particles. Here we consider pairs that exhibit both intrapair and interpair entanglement. The pairs are taken from a large many-body system where all the pairs are generally entangled with each other. Using an explicit example based on single mode entanglement and an ancillary Bose-Einstein condensate, we show that the Bell-inequality violation in such systems can display statistical properties that are remarkably different from those obtained using identically prepared independent pairs. In particular, one can have probabilistic violation of Bell's inequalities in which a finite fraction of all the runs result in violation even though there could be no violation when averaging over all the runs. Whether or not a particular run of results will end up being local realistically explainable is 'decided' by a sequence of quantum (random) outcomes.

  20. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  1. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  2. High-throughput deterministic single-cell encapsulation and droplet pairing, fusion, and shrinkage in a single microfluidic device

    NARCIS (Netherlands)

    Schoeman, R.M.; Kemna, Evelien; Wolbers, F.; van den Berg, Albert

    In this article, we present a microfluidic device capable of successive high-yield single-cell encapsulation in droplets, with additional droplet pairing, fusion, and shrinkage. Deterministic single-cell encapsulation is realized using Dean-coupled inertial ordering of cells in a Yin-Yang-shaped

  3. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  4. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  5. Effect of single-particle splitting in the exact wave function of the isovectorial pairing Hamiltonian

    International Nuclear Information System (INIS)

    Lerma H, S.

    2010-01-01

    The structure of the exact wave function of the isovectorial pairing Hamiltonian with nondegenerate single-particle levels is discussed. The way that the single-particle splittings break the quartet condensate solution found for N=Z nuclei in a single degenerate level is established. After a brief review of the exact solution, the structure of the wave function is analyzed and some particular cases are considered where a clear interpretation of the wave function emerges. An expression for the exact wave function in terms of the isospin triplet of pair creators is given. The ground-state wave function is analyzed as a function of pairing strength, for a system of four protons and four neutrons. For small and large values of the pairing strength a dominance of two-pair (quartets) scalar couplings is found, whereas for intermediate values enhancements of the nonscalar couplings are obtained. A correlation of these enhancements with the creation of Cooper-like pairs is observed.

  6. A Novel Deterministic Secure Quantum Communication Scheme with Einstein—Podolsky—Rosen Pairs and Single Photons

    International Nuclear Information System (INIS)

    Wang Chao; Liu Jian-Wei; Liu Xiao; Shang Tao

    2013-01-01

    A novel deterministic secure quantum communication (DSQC) scheme is presented based on Einstein-Podolsky-Rosen (EPR) pairs and single photons in this study. In this scheme, the secret message can be encoded directly on the first particles of the prepared Bell states by simple unitary operations and decoded by performing the Bell-basis measurement after the additional classic information is exchanged. In addition, the strategy with two-step transmission of quantum data blocks and the technique of decoy-particle checking both are exploited to guarantee the security of the communication. Compared with some previous DSQC schemes, this scheme not only has a higher resource capacity, intrinsic efficiency and total efficiency, but also is more realizable in practical applications. Security analysis shows that the proposed scheme is unconditionally secure against various attacks over an ideal quantum channel and still conditionally robust over a noisy and lossy quantum channel. (general)

  7. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  8. High-throughput deterministic single-cell encapsulation and droplet pairing, fusion, and shrinkage in a single microfluidic device.

    Science.gov (United States)

    Schoeman, Rogier M; Kemna, Evelien W M; Wolbers, Floor; van den Berg, Albert

    2014-02-01

    In this article, we present a microfluidic device capable of successive high-yield single-cell encapsulation in droplets, with additional droplet pairing, fusion, and shrinkage. Deterministic single-cell encapsulation is realized using Dean-coupled inertial ordering of cells in a Yin-Yang-shaped curved microchannel using a double T-junction, with a frequency over 2000 Hz, followed by controlled droplet pairing with a 100% success rate. Subsequently, droplet fusion is realized using electrical actuation resulting in electro-coalescence of two droplets, each containing a single HL60 cell, with 95% efficiency. Finally, volume reduction of the fused droplet up to 75% is achieved by a triple pitchfork structure. This droplet volume reduction is necessary to obtain close cell-cell membrane contact necessary for final cell electrofusion, leading to hybridoma formation, which is the ultimate aim of this research. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Analysis of the paired TCR α- and β-chains of single human T cells.

    Directory of Open Access Journals (Sweden)

    Song-Min Kim

    Full Text Available Analysis of the paired i.e. matching TCR α- and β-chain rearrangements of single human T cells is required for a precise investigation of clonal diversity, tissue distribution and specificity of protective and pathologic T-cell mediated immune responses. Here we describe a multiplex RT-PCR based technology, which for the first time allows for an unbiased analysis of the complete sequences of both α- and β-chains of TCR from single T cells. We validated our technology by the analysis of the pathologic T-cell infiltrates from tissue lesions of two T-cell mediated autoimmune diseases, psoriasis vulgaris (PV and multiple sclerosis (MS. In both disorders we could detect various T cell clones as defined by multiple T cells with identical α- and β-chain rearrangements distributed across the tissue lesions. In PV, single cell TCR analysis of lesional T cells identified clonal CD8(+ T cell expansions that predominated in the epidermis of psoriatic plaques. An MS brain lesion contained two dominant CD8(+ T-cell clones that extended over the white and grey matter and meninges. In both diseases several clonally expanded T cells carried dual TCRs composed of one Vβ and two different Vα-chain rearrangements. These results show that our technology is an efficient instrument to analyse αβ-T cell responses with single cell resolution in man. It should facilitate essential new insights into the mechanisms of protective and pathologic immunity in many human T-cell mediated conditions and allow for resurrecting functional TCRs from any αβ-T cell of choice that can be used for investigating their specificity.

  10. Possibilities of paired comparison of receptor binding parameters obtained in a single experiment

    International Nuclear Information System (INIS)

    Mashilova, K.V.; Kiriakov, G.V.; Malin, K.M.; Rozhanets, V.V.

    1987-01-01

    The authors explore the use of comparing control and experimental groups on the basis of extrapolation parameters obtained from a single pair of experiments. One of the experiments study the parameters of specific binding of 3 H-D-ala-2-enkephelin-5-D-leucine in the striatum of different groups of rats. The analysis was done by the Cornish-Bowden method

  11. Resource allocation for two source-destination pairs sharing a single relay with a buffer

    KAUST Repository

    Zafar, Ammar; Shaqfeh, Mohammad; Alouini, Mohamed-Slim; Alnuweiri, Hussein M.

    2014-01-01

    In this paper, we obtain the optimal resource allocation scheme in order to maximize the achievable rate region in a dual-hop system that consists of two independent source-destination pairs sharing a single half-duplex relay. The relay decodes

  12. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  13. High-fidelity frequency down-conversion of visible entangled photon pairs with superconducting single-photon detectors

    International Nuclear Information System (INIS)

    Ikuta, Rikizo; Kato, Hiroshi; Kusaka, Yoshiaki; Yamamoto, Takashi; Imoto, Nobuyuki; Miki, Shigehito; Yamashita, Taro; Terai, Hirotaka; Wang, Zhen; Fujiwara, Mikio; Sasaki, Masahide; Koashi, Masato

    2014-01-01

    We experimentally demonstrate a high-fidelity visible-to-telecommunicationwavelength conversion of a photon by using a solid-state-based difference frequency generation. In the experiment, one half of a pico-second visible entangled photon pair at 780 nm is converted to a 1522-nm photon. Using superconducting single-photon detectors with low dark count rates and small timing jitters, we observed a fidelity of 0.93±0.04 after the wavelength conversion

  14. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  15. Using Single Colors and Color Pairs to Communicate Basic Tastes II: Foreground–Background Color Combinations

    Science.gov (United States)

    Marmolejo-Ramos, Fernando; Velasco, Carlos; Spence, Charles

    2016-01-01

    People associate basic tastes (e.g., sweet, sour, bitter, and salty) with specific colors (e.g., pink or red, green or yellow, black or purple, and white or blue). In the present study, we investigated whether a color bordered by another color (either the same or different) would give rise to stronger taste associations relative to a single patch of color. We replicate previous findings, highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. On occasion, color pairs were found to communicate taste expectations more consistently than were single color patches. Furthermore, and in contrast to a recent study in which the color pairs were shown side-by-side, participants took no longer to match the color pairs with tastes than the single colors (they had taken twice as long to respond to the color pairs in the previous study). Possible reasons for these results are discussed, and potential applications for the results, and for the testing methodology developed, are outlined. PMID:27708752

  16. Using Single Colors and Color Pairs to Communicate Basic Tastes II: Foreground-Background Color Combinations.

    Science.gov (United States)

    Woods, Andy T; Marmolejo-Ramos, Fernando; Velasco, Carlos; Spence, Charles

    2016-01-01

    People associate basic tastes (e.g., sweet, sour, bitter, and salty) with specific colors (e.g., pink or red, green or yellow, black or purple, and white or blue). In the present study, we investigated whether a color bordered by another color (either the same or different) would give rise to stronger taste associations relative to a single patch of color. We replicate previous findings, highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. On occasion, color pairs were found to communicate taste expectations more consistently than were single color patches. Furthermore, and in contrast to a recent study in which the color pairs were shown side-by-side, participants took no longer to match the color pairs with tastes than the single colors (they had taken twice as long to respond to the color pairs in the previous study). Possible reasons for these results are discussed, and potential applications for the results, and for the testing methodology developed, are outlined.

  17. Switching features of GMO single crystals by contrary motion of pair planar domain boundaries

    International Nuclear Information System (INIS)

    Alekseev, A.N.

    2003-01-01

    Gadolinium molybdate single crystal specimens in the form of square plates 1.2 mm thick, which provide similar conditions of nucleation of domains with differently oriented planar domain boundaries (PDB), are used to study processes of total change-over of orientation states by compressing mechanical action applied alternately to one of two pairs of opposite end faces of the specimen. It is revealed that successive acts of such change-over are always carried out by PDB pairs of alternating mutually orthogonal orientation. A closing stage for every successive change-over is realized through a collapse of either wedge-like or lenticular domain [ru

  18. Pairing fluctuation effects on the single-particle spectra for the superconducting state

    International Nuclear Information System (INIS)

    Pieri, P.; Pisani, L.; Strinati, G.C.

    2004-01-01

    Single-particle spectra are calculated in the superconducting state for a fermionic system with an attractive interaction, as functions of temperature and coupling strength from weak to strong. The fermionic system is described by a single-particle self-energy that includes pairing-fluctuation effects in the superconducting state. The theory reduces to the ordinary BCS approximation in weak coupling and to the Bogoliubov approximation for the composite bosons in strong coupling. Several features of the single-particle spectral function are shown to compare favorably with experimental data for cuprate superconductors

  19. Characteristics between the meshing pairs with different envelope profile in single screw compressors

    Science.gov (United States)

    Huang, R.; Liu, F.; Li, T.; Feng, Q.

    2017-08-01

    Single screw compressors have been used in various industrial fields. However, because the star-wheel teeth are easy to wear, the market for the development of single screw compressors is limited. In order to extend the service life of the star-wheel, researchers have developed different kinds of star-wheel tooth profile, such as single line envelope profile, single column envelope profile, and multi-column envelope profile. These profiles greatly affect the lubrication characteristics between the star-wheel teeth and the screw grooves. In this article, the lubrication characteristics between the meshing pairs with different envelope profiles are analyzed. Results show that the pressure peak of the single line envelope profile, single column envelope profile, and multi-column envelope profile are 3.23×105Pa, 3.38×105Pa, and 4.31×105Pa, respectively. This means that the multi-column enveloped meshing pair can resist the biggest external impact load. The deviation angle (γ) of the single line envelope profile, single column envelope profile, and multi-column envelope profile are 0.0139°~0.0286°, 0.0225°~0.0306° and 0.0122°~0.0262°, respectively. Thus, the self-balancing ability of the multi-column enveloped meshing pair is the strongest, and the oil film thickness on both sides of the multi-column enveloped star-wheel tooth is the most reasonable, which indicates a good lubrication state during operation, that is, longer operation life of the star-wheel teeth.

  20. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  1. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  2. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  3. Pairing in the BCS and LN approximations using continuum single particle level density

    International Nuclear Information System (INIS)

    Id Betan, R.M.; Repetto, C.E.

    2017-01-01

    Understanding the properties of drip line nuclei requires to take into account the correlations with the continuum spectrum of energy of the system. This paper has the purpose to show that the continuum single particle level density is a convenient way to consider the pairing correlation in the continuum. Isospin mean-field and isospin pairing strength are used to find the Bardeen–Cooper–Schrieffer (BCS) and Lipkin–Nogami (LN) approximate solutions of the pairing Hamiltonian. Several physical properties of the whole chain of the Tin isotope, as gap parameter, Fermi level, binding energy, and one- and two-neutron separation energies, were calculated and compared with other methods and with experimental data when they exist. It is shown that the use of the continuum single particle level density is an economical way to include explicitly the correlations with the continuum spectrum of energy in large scale mass calculation. It is also shown that the computed properties are in good agreement with experimental data and with more sophisticated treatment of the pairing interaction.

  4. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  5. Creation of short microwave ablation zones: in vivo characterization of single and paired modified triaxial antennas.

    Science.gov (United States)

    Lubner, Meghan G; Ziemlewicz, Tim J; Hinshaw, J Louis; Lee, Fred T; Sampson, Lisa A; Brace, Christopher L

    2014-10-01

    To characterize modified triaxial microwave antennas configured to produce short ablation zones. Fifty single-antenna and 27 paired-antenna hepatic ablations were performed in domestic swine (N = 11) with 17-gauge gas-cooled modified triaxial antennas powered at 65 W from a 2.45-GHz generator. Single-antenna ablations were performed at 2 (n = 16), 5 (n = 21), and 10 (n = 13) minutes. Paired-antenna ablations were performed at 1-cm and 2-cm spacing for 5 (n = 7 and n = 8, respectively) and 10 minutes (n = 7 and n = 5, respectively). Mean transverse width, length, and aspect ratio of sectioned ablation zones were measured and compared. For single antennas, mean ablation zone lengths were 2.9 cm ± 0.45, 3.5 cm ± 0.55, and 4.2 cm ± 0.40 at 2, 5, and 10 minutes, respectively. Mean widths were 1.8 cm ± 0.3, 2.0 cm ± 0.32, and 2.5 cm ± 0.25 at 2, 5, and 10 minutes, respectively. For paired antennas, mean length at 5 minutes with 1-cm and 2-cm spacing and 10 minutes with 1-cm and 2-cm spacing was 4.2 cm ± 0.9, 4.9 cm ± 1.0, 4.8 cm ± 0.5, and 4.8 cm ± 1.3, respectively. Mean width was 3.1 cm ± 1.0, 4.4 cm ± 0.7, 3.8 cm ± 0.4, and 4.5 cm ± 0.7, respectively. Paired-antenna ablations were more spherical (aspect ratios, 0.72-0.79 for 5-10 min) than single-antenna ablations (aspect ratios, 0.57-0.59). For paired-antenna ablations, 1-cm spacing appeared optimal, with improved circularity and decreased clefting compared with 2-cm spacing (circularity, 0.85 at 1 cm, 0.78 at 2 cm). Modified triaxial antennas can generate relatively short, spherical ablation zones. Paired-antenna ablations were rounder and larger in transverse dimension than single antenna ablations, with 1-cm spacing optimal for confluence of the ablation zone. Copyright © 2014 SIR. Published by Elsevier Inc. All rights reserved.

  6. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  7. A quantitative study of quasiparticle traps using the single-Cooper-pair-transistor

    OpenAIRE

    Court, N. A.; Ferguson, A. J.; Lutchyn, Roman; Clark, R. G.

    2007-01-01

    We use radio-frequency reflectometry to measure quasiparticle tunneling rates in the single-Cooper-pair-transistor. Devices with and without quasiparticle traps in proximity to the island are studied. A $10^2$ to $10^3$-fold reduction in the quasiparticle tunneling rate onto the island is observed in the case of quasiparticle traps. In the quasiparticle trap samples we also measure a commensurate decrease in quasiparticle tunneling rate off the island.

  8. Evidence for a transverse single-spin asymmetry in leptoproduction of π+π- pairs

    International Nuclear Information System (INIS)

    Airapetian, A.

    2008-03-01

    A single-spin asymmetry was measured in the azimuthal distribution of π + π - . pairs produced in semi-inclusive deep-inelastic scattering on a transversely polarized hydrogen target. For the first time, evidence is found for a correlation between the transverse target polarization and the azimuthal orientation of the plane containing the two pions. The corresponding single-spin asymmetry is expected to be related to the product of the little-known quark transversity distribution function and an unknown naive-T-odd chiral-odd dihadron fragmentation function. (orig.)

  9. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  10. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Search for top squark pair production in the single lepton final state at sqrt(s)=13 TeV

    CERN Document Server

    CMS Collaboration

    2017-01-01

    A search for top squark pair production in pp collisions at $\\sqrt{s}=13~\\mathrm{TeV}$ is performed using events with a single isolated electron or muon, jets, and large transverse momentum imbalance. Results are based on a study of data from proton-proton collisions collected in 2016 with the CMS detector at the LHC corresponding to an integrated luminosity of $35.9~\\mathrm{fb}^{-1}$. No significant excess of events is observed above the expectation from standard model processes. Exclusion limits are set in the context of supersymmetric models of pair production of top squarks that decay either to a top quark and a neutralino or to a bottom quark and a chargino. $$\\textit{Figures 10 and 11 have been revised with respect to the version dated March 28, 2017.}$$

  12. Green's tensor calculations of plasmon resonances of single holes and hole pairs in thin gold films

    International Nuclear Information System (INIS)

    Alegret, Joan; Kaell, Mikael; Johansson, Peter

    2008-01-01

    We present numerical calculations of the plasmon properties of single-hole and hole-pair structures in optically thin gold films obtained with the Green's tensor formalism for stratified media. The method can be used to obtain the optical properties of a given hole system, without problems associated with the truncation of the infinite metal film. The calculations are compared with previously published experimental data and an excellent agreement is found. In particular, the calculations are shown to reproduce the evolution of the hole plasmon resonance spectrum as a function of hole diameter, film thickness and hole separation.

  13. Anomalous resonance of the symmetric single-impurity Anderson model in the presence of pairing fluctuations

    International Nuclear Information System (INIS)

    Guang-Ming Zhang; Lu Yu

    1998-10-01

    We consider the symmetric single-impurity Anderson model in the presence of pairing fluctuations. In the isotropic limit, the degrees of freedom of the local impurity are separated into hybridizing and non-hybridizing modes. The self-energy for the hybridizing modes can be obtained exactly, leading to two subbands centered at ±U/2. For the non-hybridizing modes, the second order perturbation yields a singular resonance of the marginal Fermi liquid form. By multiplicative renormalization, the self-energy is derived exactly, showing the resonance is pinned at the Fermi level, while its strength is weakened by renormalization. (author)

  14. Teleportation of a two-atom entangled state using a single EPR pair in cavity QED

    Institute of Scientific and Technical Information of China (English)

    Ji Xin; Li Ke; Zhang Shou

    2006-01-01

    We propose a scheme for teleporting a two-atom entangled state in cavity quantum electrodynamics(QED).In the scheme,we choose a single Einstein-Podolsky-Rosen (EPR) pair as the quantum channel which is shared by the sender and the receiver.By using the atom-cavity-field interaction and introducing an additional atom,we can teleport the two-atom entangled state successfully with a probability of 1.0.Moreover,we show that the scheme is insensitive to cavity decay and thermal field.

  15. An interaction scenario of the galaxy pair NGC 3893/96 (KPG 302): A single passage?

    Energy Technology Data Exchange (ETDEWEB)

    Gabbasov, R. F.; Rosado, M. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexico (UNAM), A.P. 70-264,04510 México D.F. (Mexico); Klapp, J., E-mail: ruslan.gabb@gmail.com [Instituto Nacional de Investigaciones Nucleares, Carretera México-Toluca S/N, La Marquesa, Ocoyoacac, 52750 Estado de México (Mexico)

    2014-05-20

    Using the data obtained previously from Fabry-Perot interferometry, we study the orbital characteristics of the interacting pair of galaxies KPG 302 with the aim to estimate a possible interaction history, the conditions necessary for the spiral arm formation, and initial satellite mass. We found by performing N-body/smoothed particle hydrodynamics simulations of the interaction that a single passage can produce a grand design spiral pattern in less than 1 Gyr. Although we reproduce most of the features with the single passage, the required satellite to host mass ratio should be ∼1:5, which is not confirmed by the dynamical mass estimate made from the measured rotation curve. We conclude that a more realistic interaction scenario would require several passages in order to explain the mass ratio discrepancy.

  16. Simplified Scheme for Teleportation of a Multipartite Quantum State Using a Single Entangled Pair

    Institute of Scientific and Technical Information of China (English)

    YAN Li-Hua; GAO Yun-Feng

    2009-01-01

    A simple scheme for teleporting an unknown M-qubit cat-like state is proposed.The steps of this scheme can be summarized simpIy: disentangle-teleport-reconstruct entanglement.If proper unitary operations and measurements from senders are given, the teleportation of an unknown M-qubit cat-like state can be converted into single qubit teleportation.In the meantime, the receiver should also carry out right unitary operations with the introduction of appropriate ancillary qubits to confirm the successful teleportation of the demanded entangled state.The present scheme can be generalized to teleport an unknown M-quNit state, i.e., an M-quNit state can be teleported by a single quNit entangled pair.

  17. A multi-parametric particle-pairing algorithm for particle tracking in single and multiphase flows

    International Nuclear Information System (INIS)

    Cardwell, Nicholas D; Vlachos, Pavlos P; Thole, Karen A

    2011-01-01

    Multiphase flows (MPFs) offer a rich area of fundamental study with many practical applications. Examples of such flows range from the ingestion of foreign particulates in gas turbines to transport of particles within the human body. Experimental investigation of MPFs, however, is challenging, and requires techniques that simultaneously resolve both the carrier and discrete phases present in the flowfield. This paper presents a new multi-parametric particle-pairing algorithm for particle tracking velocimetry (MP3-PTV) in MPFs. MP3-PTV improves upon previous particle tracking algorithms by employing a novel variable pair-matching algorithm which utilizes displacement preconditioning in combination with estimated particle size and intensity to more effectively and accurately match particle pairs between successive images. To improve the method's efficiency, a new particle identification and segmentation routine was also developed. Validation of the new method was initially performed on two artificial data sets: a traditional single-phase flow published by the Visualization Society of Japan (VSJ) and an in-house generated MPF data set having a bi-modal distribution of particles diameters. Metrics of the measurement yield, reliability and overall tracking efficiency were used for method comparison. On the VSJ data set, the newly presented segmentation routine delivered a twofold improvement in identifying particles when compared to other published methods. For the simulated MPF data set, measurement efficiency of the carrier phases improved from 9% to 41% for MP3-PTV as compared to a traditional hybrid PTV. When employed on experimental data of a gas–solid flow, the MP3-PTV effectively identified the two particle populations and reported a vector efficiency and velocity measurement error comparable to measurements for the single-phase flow images. Simultaneous measurement of the dispersed particle and the carrier flowfield velocities allowed for the calculation of

  18. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  19. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  20. Scheme for Teleportation of a Multipartite Quantum State by Using a Single Entangled Pair as Quantum Channel

    Institute of Scientific and Technical Information of China (English)

    WANG Xin-Wen; WANG Zhi-Yong; XIA Li-Xin

    2007-01-01

    We present a theoretical scheme for perfect teleportation of an unknown multipartite two-level state by a single EPR (Einstein-Podolsky-Rosen) pair,and then generalize it to multilevel,i.e.,an N-quNit state can be teleported by a single quNit entangled pair,with additional local unitary operations.The feature of the scheme is that teleporting a multipartite state with a reduced amount of entanglement costs less classical bits.

  1. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  2. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  3. Performance analysis of the single-stage absorption heat transformer using a new working pair composed of ionic liquid and water

    International Nuclear Information System (INIS)

    Zhang Xiaodong; Hu Dapeng

    2012-01-01

    The performance simulation of a single-stage absorption heat transformer using a new working pair composed of ionic liquids, 1-ethyl-3-methylimidazolium dimethylphosphate, and water (H 2 O + [EMIM][DMP]), was performed based on the thermodynamic properties of the new working pair and on the mass and energy balance for each component of the system. In order to evaluate the new working pair, the simulation results were compared with those of aqueous solution of lithium bromide (H 2 O + LiBr), Trifluoroethanol (TFE) + tetraethylenglycol dimethylether (E181). The results indicate that when generation, evaporation, condensing and absorption temperatures are 90 °C, 90 °C, 35 °C and 130 °C, the coefficients of performance of the single-stage absorption heat transformer using H 2 O + LiBr, H 2 O + [EMIM][DMP] and TFE + E181 as working pairs will reach 0.494, 0.481 and 0.458 respectively. And the corresponding exergy efficiency will reach 0.64, 0.62 and 0.59, respectively. Meanwhile the available heat outputs for per unit mass of refrigerant are 2466 kJ/kg, 2344 kJ/kg and 311 kJ/kg, respectively. The above excellent cycle performance together with the advantages of negligible vapor pressure, no crystallization and more weak corrosion tendency to iron-steel materials may make the new working pair better suited for the industrial absorption heat transformer. - Highlights: ► The cycle performance of the single-stage absorption heat transformer was simulated. ► Water and 1-ethyl-3-methylimidazolium dimethylphosphate was used as new working pair. ► Water and 1-ethyl-3-methylimidazolium dimethylphosphate are entirely miscible. ► The COP and exergy efficiency for this new working pairs were 0.481 and 0.62. ► The new working pairs has potential application to absorption heat transformer.

  4. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  5. CERN, AFS and PLUS credentials converge into one single credential pair

    CERN Multimedia

    IT Department

    2008-01-01

    Over the past few years the IT department has been streamlining CERN users’ access to all central computing services. For each user, the long term goal is to converge on a single CERN Account with a unique credential pair (username and password). This strategy will make IT services more coherent and thus easier for users to understand. It will also simplify account maintenance and give a central point of control where security measures can be applied. As the next step of this process, on the 1st July 2008 your CERN, PLUS and AFS accounts will converge into one single CERN Account. From then on the Account names will already be unique and universal. The passwords will become unique and universal after the first password change, which users are encouraged to do at their earliest convenience. Until then the existing passwords will remain valid on each individual service, but afterwards the new credentials will become truly common to all 3 services. Thus, starting on 1st July 2008, changing the password for PL...

  6. CERN, AFS and PLUS credentials converge into a single credential pair

    CERN Multimedia

    IT Department

    2008-01-01

    Over the past few years the IT Department has been streamlining CERN users’ access to all central computing services. For each user, the long-term goal is to converge on a single CERN account with a unique credential pair (username and password). This strategy will make IT services more coherent and thus easier for users to understand. It will also simplify account maintenance and provide a central point of control where security measures can be applied. As the next step of this process, on 1st July 2008 your CERN, PLUS and AFS accounts will converge into a single CERN Account. From then on the account names will be unique and universal. The passwords will become unique and universal after the first password change, which users are encouraged to make at their earliest convenience. Until then the existing passwords will remain valid on each individual service, but afterwards the new credentials will become truly common to all 3 services. Thus, starting on 1st July 2008, changing the password for PLUS or AFS...

  7. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  8. Generation of a pair of independently binding DNA aptamers in a single round of selection using proximity ligation.

    Science.gov (United States)

    Chumphukam, O; Le, T T; Piletsky, S; Cass, A E G

    2015-05-28

    The ability to rapidly generate a pair of aptamers that bind independently to a protein target would greatly extend their use as reagents for two site ('sandwich') assays. We describe here a method to achieve this through proximity ligation. Using lysozyme as a target we demonstrate that under optimal conditions such a pair of aptamers, with nanomolar affinities, can be generated in a single round.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  11. Resource allocation for two source-destination pairs sharing a single relay with a buffer

    KAUST Repository

    Zafar, Ammar

    2014-05-01

    In this paper, we obtain the optimal resource allocation scheme in order to maximize the achievable rate region in a dual-hop system that consists of two independent source-destination pairs sharing a single half-duplex relay. The relay decodes the received information and possesses buffers to enable storing the information temporarily before forwarding it to the respective destination. We consider both non-orthogonal transmission with successive interference cancellation at the receivers and orthogonal transmission. Also, we consider Gaussian block-fading channels and we assume that the channel state information is known and that no delay constraints are required. We show that, with the aid of buffering at the relay, joint user-and-hop scheduling is optimal and can enhance the achievable rate significantly. This is due to the joint exploitation of multiuser diversity and multihop diversity in the system. We provide closed-form expressions to characterize the average achievable rates in a generic form as functions of the statistical model of the channels. Furthermore, we consider sub-optimal schemes that exploit the diversity in the system partially and we provide numerical results to compare the different schemes and demonstrate the gains of the optimal one. © 2014 IEEE.

  12. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  13. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  14. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  15. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  16. Measurements of Pair Production Under Channelling Conditions by 70-180 GeV Photons Incident on Single Crystals

    CERN Multimedia

    2002-01-01

    This experiment will use the WA69 set-up to deliver a tagged photon beam in the energy range from 15~GeV to 150~GeV with a total angular spread of about @M~0.5~mrad. The incident photon direction is known to about 35~@mrad through the direction of the emitting electron. The photon beam is incident on an about 1~mm thick Ge single crystal in order to investigate pair production in single crystals. Above a certain energy threshold photons incident along crystal axis will show strongly increased pair production yi - the so-called .us Channelling Pair Production (ChPP). The produced pairs are analyzed in the @W-spectrometer. The large spread in incident photon angles offers an excellent opportunity to investigate in one single experiment the pair production in an angular region around a crystal axes and thereby compare ChPP with coherent (CPP) and incoherent (ICPP) processes. The very abrupt onset of ChPP (around threshold) will be measured and give a crucial test of the theoretical calculations. The differential...

  17. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  18. Brachytherapy or Conformal External Radiotherapy for Prostate Cancer: A Single-Institution Matched-Pair Analysis

    International Nuclear Information System (INIS)

    Pickles, Tom; Keyes, Mira; Morris, W. James

    2010-01-01

    Purpose: In the absence of randomized study data, institutional case series have shown brachytherapy (BT) to produce excellent biochemical control (bNED) in patients with localized prostate cancer compared with alternative curative treatments. This study was designed to overcome some of the limitations of case series studies by using a matched-pair design in patients treated contemporaneously with BT and external beam radiation therapy (EBRT) at a single institution. Methods and Materials: Six hundred one eligible patients treated between 1998 and 2001 were prospectively followed up in our institutional databases and matched on a 1:1 basis for the following known prognostic variables: prostate-specific antigen (PSA) level, Gleason score, T stage, the use and duration of neoadjuvant androgen deprivation therapy, and the percentage of positive tissue core samples. Two hundred seventy-eight perfect matches of patients (139 in each group) with low- and intermediate-risk cancer were further analyzed. bNED (Phoenix definition) was the primary endpoint. Other endpoints were toxicity, PSA kinetics, and the secondary use of androgen deprivation therapy. Results: The 5-year bNED rates were 95% (BT) and 85% (EBRT) (p < 0.001). After 7 years, the BT bNED result was unchanged, but the rate in EBRT patients had fallen to 75%. The median posttreatment PSA nadirs were 0.04 ng/mL (BT) and 0.62 ng/mL (EBRT, p < 0.001), which predicted a higher ongoing treatment failure rate in association with EBRT use than with BT use. Late urinary toxicity and rectal/bowel toxicity were worse in patients treated with BT and EBRT, respectively. Conclusions: BT for both low-risk and selected intermediate-risk cancers achieves exceptional cure rates. Even with dose escalation, it will be difficult for EBRT to match the proven track record of BT seen over the past decade.

  19. An experimental study of the effect of external turbulence on the decay of a single vortex and a vortex pair

    NARCIS (Netherlands)

    van Jaarsveld, J.P.J.; Holten, A.P.C.; Elsenaar, A.; Trieling, R.R.; Heijst, van G.J.F.

    2011-01-01

    This study is concerned with the effect of external turbulence on the decay of vortices. Single vortices and vortex pairs were generated with wing(s) mounted in the sidewalls of a wind tunnel. The distance between the two vortices could be adjusted such that they just touched each other or

  20. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  1. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  2. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  3. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  4. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  5. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  6. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  7. Paired single cell co-culture microenvironments isolated by two-phase flow with continuous nutrient renewal.

    Science.gov (United States)

    Chen, Yu-Chih; Cheng, Yu-Heng; Kim, Hong Sun; Ingram, Patrick N; Nor, Jacques E; Yoon, Euisik

    2014-08-21

    Cancer-stromal cell interactions are a critical process in tumorigenesis. Conventional dish-based assays, which simply mix two cell types, have limitations in three aspects: 1) limited control of the cell microenvironment; 2) inability to study cell behavior in a single-cell manner; and 3) have difficulties in characterizing single cell behavior within a highly heterogeneous cell population (e.g. tumor). An innovative use of microfluidic technology is for improving the spatial resolution for single cell assays. However, it is challenging to isolate the paired interacting cells while maintaining nutrient renewal. In this work, two-phase flow was used as a simple isolation method, separating the microenvironment of each individual chamber. As nutrients in an isolated chamber are consumed by cells, media exchange is required. To connect the cell culture chamber to the media exchange layer, we demonstrated a 3D microsystem integration technique using vertical connections fabricated by deep reactive-ion etching (DRIE). Compared to previous approaches, the presented process allows area reduction of vertical connections by an order of magnitude, enabling compact 3D integration. A semi-permeable membrane was sandwiched between the cell culture layer and the media exchange layer. The selectivity of the semi-permeable membrane results in the retention of the signaling proteins within the chamber while allowing free diffusion of nutrients (e.g., glucose and amino acids). Thus, paracrine signals are accumulated inside the chamber without cross-talk between cells in other chambers. Utilizing these innovations, we co-cultured UM-SCC-1 (head and neck squamous cell carcinoma) cells and endothelial cells to simulate tumor proliferation enhancement in the vascular endothelial niche.

  8. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.

    2011-01-01

    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  9. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  10. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  11. Thermal detection of single e-h pairs in a biased silicon crystal detector

    Science.gov (United States)

    Romani, R. K.; Brink, P. L.; Cabrera, B.; Cherry, M.; Howarth, T.; Kurinsky, N.; Moffatt, R. A.; Partridge, R.; Ponce, F.; Pyle, M.; Tomada, A.; Yellin, S.; Yen, J. J.; Young, B. A.

    2018-01-01

    We demonstrate that individual electron-hole pairs are resolved in a 1 cm2 by 4 mm thick silicon crystal (0.93 g) operated at ˜35 mK. One side of the detector is patterned with two quasiparticle-trap-assisted electro-thermal-feedback transition edge sensor arrays held near ground potential. The other side contains a bias grid with 20% coverage. Bias potentials up to ±160 V were used in the work reported here. A fiber optic provides 650 nm (1.9 eV) photons that each produce an electron-hole (e- h+) pair in the crystal near the grid. The energy of the drifting charges is measured with a phonon sensor noise σ ˜0.09 e- h+ pair. The observed charge quantization is nearly identical for h+s or e-s transported across the crystal.

  12. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  13. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  14. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  16. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  17. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  18. Dose-response curve for translocation frequency with single pair of painted chromosome. A comparison with dicentric and micronuclei frequency

    Energy Technology Data Exchange (ETDEWEB)

    Venkatachalam, P.; Paul, S.F.D.; Mohankumar, M.N.; Prabhu, B.K.; Gajendiran, N.; Jeevanram, R.K

    2000-07-01

    A translocation dose-response curve using a single pair of painted chromosomes was constructed. The translocation frequencies observed at different doses were compared to those obtained for dicentrics (DC) and micronuclei (MN). The translocation and DC frequency followed the Poisson distribution and MN showed over-dispersion. The translocation and DC frequencies were nearly the same for each dose point. Micronuclei showed a comparatively lower frequency. The alpha/beta ratio for translocations (0.916) and DC (0.974) were comparable, whereas the value for MN (1.526) was much higher. The equal frequencies of translocations and DC observed for a given dose indicated that genomic translocation frequency estimated using a single pair of painted chromosomes provides a reliable and easy method to measure translocation frequency. (autho000.

  19. Dose-response curve for translocation frequency with single pair of painted chromosome. A comparison with dicentric and micronuclei frequency

    International Nuclear Information System (INIS)

    Venkatachalam, P.; Paul, S.F.D.; Mohankumar, M.N.; Prabhu, B.K.; Gajendiran, N.; Jeevanram, R.K.

    2000-01-01

    A translocation dose-response curve using a single pair of painted chromosomes was constructed. The translocation frequencies observed at different doses were compared to those obtained for dicentrics (DC) and micronuclei (MN). The translocation and DC frequency followed the Poisson distribution and MN showed over-dispersion. The translocation and DC frequencies were nearly the same for each dose point. Micronuclei showed a comparatively lower frequency. The alpha/beta ratio for translocations (0.916) and DC (0.974) were comparable, whereas the value for MN (1.526) was much higher. The equal frequencies of translocations and DC observed for a given dose indicated that genomic translocation frequency estimated using a single pair of painted chromosomes provides a reliable and easy method to measure translocation frequency. (author)

  20. Tunneling couplings in discrete lattices, single-particle band structure, and eigenstates of interacting atom pairs

    International Nuclear Information System (INIS)

    Piil, Rune; Moelmer, Klaus

    2007-01-01

    By adjusting the tunneling couplings over longer than nearest-neighbor distances, it is possible in discrete lattice models to reproduce the properties of the lowest energy band of a real, continuous periodic potential. We propose to include such terms in problems with interacting particles, and we show that they have significant consequences for scattering and bound states of atom pairs in periodic potentials

  1. From joint to single audits – Audit quality differences and auditor pairing background

    DEFF Research Database (Denmark)

    Holm, Claus; Thinggaard, Frank

    A recent EU regulation incentivises the use of joint audits. Concerns motivating this regulation imply that a B4 audit firm is paired with a NB4. However, in the first theoretical study of joint audits Deng et al. (2014) predict that adding a firm with lower technological efficiency to form a joi...

  2. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    Energy Technology Data Exchange (ETDEWEB)

    Kadry, Heba, E-mail: hkadry1@yahoo.com; Abdel-Aty, Abdel-Haleem, E-mail: hkadry1@yahoo.com; Zakaria, Nordin, E-mail: hkadry1@yahoo.com [Computer and Information Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Cheong, Lee Yen [Fundamental and Applied Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia)

    2014-10-24

    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters.

  3. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    International Nuclear Information System (INIS)

    Kadry, Heba; Abdel-Aty, Abdel-Haleem; Zakaria, Nordin; Cheong, Lee Yen

    2014-01-01

    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters

  4. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  5. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  6. Single Frequency Network Based Distributed Passive Radar Technology

    Directory of Open Access Journals (Sweden)

    Wan Xian-rong

    2015-01-01

    Full Text Available The research and application of passive radar are heading from single transmitter-receiver pair to multiple transmitter-receiver pairs. As an important class of the illuminators of opportunity, most of modern digital broadcasting and television systems work on Single Frequency Network (SFN, which intrinsically determines that the passive radar based on such illuminators must be distributed and networked. In consideration of the remarkable working and processing mode of passive radar under SFN configuration, this paper proposes the concept of SFN-based Distributed Passive Radar (SDPR. The main characteristics and key problems of SDPR are first described. Then several potential solutions are discussed for part of the key technologies. The feasibility of SDPR is demonstrated by preliminary experimental results. Finally, the concept of four network convergence that includes the broadcast based passive radar network is conceived, and its application prospects are discussed.

  7. Modeling age differences in effects of pair repetition and proactive interference using a single parameter.

    Science.gov (United States)

    Stephens, Joseph D W; Overman, Amy A

    2018-02-01

    In this article, we apply the REM model (Shiffrin & Steyvers, 1997) to age differences in associative memory. Using Criss and Shiffrin's (2005) associative version of REM, we show that in a task with pairs repeated across 2 study lists, older adults' reduced benefit of pair repetition can be produced by a general reduction in the diagnosticity of information stored in memory. This reduction can be modeled similarly well by reducing the overall distinctiveness of memory features, or by reducing the accuracy of memory encoding. We report a new experiment in which pairs are repeated across 3 study lists and extend the model accordingly. Finally, we extend the model to previously reported data using the same task paradigm, in which the use of a high-association strategy introduced proactive interference effects in young adults but not older adults. Reducing the diagnosticity of information in memory also reduces the proactive interference effect. Taken together, the modeling and empirical results reported here are consistent with the claim that some age differences that appear to be specific to associative information can be produced via general degradation of information stored in memory. The REM model provides a useful framework for examining age differences in memory as well as harmonizing seemingly conflicting prior modeling approaches for the associative deficit. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  8. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  9. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  10. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  11. Intramolecular three-colour single pair FRET of intrinsically disordered proteins with increased dynamic range.

    Science.gov (United States)

    Milles, Sigrid; Koehler, Christine; Gambin, Yann; Deniz, Ashok A; Lemke, Edward A

    2012-10-01

    Single molecule observation of fluorescence resonance energy transfer can be used to provide insight into the structure and dynamics of proteins. Using a straightforward triple-colour labelling strategy, we present a measurement and analysis scheme that can simultaneously study multiple regions within single intrinsically disordered proteins.

  12. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  13. Biexciton emission from single isoelectronic traps formed by nitrogen-nitrogen pairs in GaAs

    Energy Technology Data Exchange (ETDEWEB)

    Takamiya, Kengo; Fukushima, Toshiyuki; Yagi, Shuhei; Hijikata, Yasuto; Yaguchi, Hiroyuki [Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura-ku , Saitama 338-8570 (Japan); Mochizuki, Toshimitsu; Yoshita, Masahiro; Akiyama, Hidefumi [Institute for Solid State Physics, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8581 (Japan); Kuboya, Shigeyuki; Onabe, Kentaro [Department of Advanced Materials Science, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8581 (Japan); Katayama, Ryuji [Institute for Materials Research, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan)

    2013-12-04

    We have studied photoluminescence (PL) from individual isoelectronic traps formed by nitrogen-nitrogen (NN) pairs in GaAs. Sharp emission lines due to exciton and biexciton were observed from individual isoelectronic traps in nitrogen atomic-layer doped (ALD) GaAs. The binding energy of biexciton bound to individual isoelectronic traps was approximately 8 meV. Both the exciton and biexciton luminescence lines show completely random polarization and no fine-structure splitting. These results are desirable to the application to the quantum cryptography used in the field of quantum information technology.

  14. Importance of the single-particle continuum in BCS pairing with a pseudostate basis

    Directory of Open Access Journals (Sweden)

    Lay J. A.

    2016-01-01

    Full Text Available In a recent work [arXiv:1510.03185] the use of the Transformed Harmonic Oscillator (THO basis for the discretization of the singleparticle continuum into a Generalized Bardeen-Cooper-Schrieffer (BCS formalism was proposed for the description of weakly bound nuclei. We make use of the flexibility of this formalism to study the evolution of the pairing when the nucleus becomes more and more weakly bound. Specifically we focus on the evolution of the occupation of the different partial waves in 22O when the Fermi level approaches zero.

  15. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  16. Compact source of narrow-band counterpropagating polarization-entangled photon pairs using a single dual-periodically-poled crystal

    International Nuclear Information System (INIS)

    Gong, Yan-Xiao; Xie, Zhen-Da; Xu, Ping; Zhu, Shi-Ning; Yu, Xiao-Qiang; Xue, Peng

    2011-01-01

    We propose a scheme for the generation of counterpropagating polarization-entangled photon pairs from a dual-periodically-poled crystal. Compared with the usual forward-wave-type source, this source, in the backward-wave way, has a much narrower bandwidth. With a 2-cm-long bulk crystal, the bandwidths of the example sources are estimated to be 3.6 GHz, and the spectral brightnesses are more than 100 pairs/(s GHz mW). Two concurrent quasi-phase-matched spontaneous parametric down-conversion processes in a single crystal enable our source to be compact and stable. This scheme does not rely on any state projection and applies to both degenerate and nondegenerate cases, facilitating applications of the entangled photons.

  17. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  18. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  19. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  20. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  1. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  2. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  3. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  4. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  5. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  6. Paying for Joint or Single Audits? The Importance of Auditor Pairings and Differences in Technology Efficiency

    DEFF Research Database (Denmark)

    Holm, Claus; Thinggaard, Frank

    2016-01-01

    In the first theoretical paper on joint audits, Deng et al. predict that the audit fees for joint audits will be lower than those from single audits. However, the prediction depends on the combination of audit firms involved in the joint audit and on their technology efficiency as well as on the ...

  7. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  8. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  9. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  10. A matched-pair comparison of single plus one port versus standard extraperitoneal laparoscopic radical prostatectomy by a single urologist

    Directory of Open Access Journals (Sweden)

    Dong-Xu Zhang

    2015-07-01

    Full Text Available We conducted this study to report on our initial experience and assess the safety, feasibility, and efficacy of extraperitoneal single plus one port laparoscopic radical prostatectomy (SPOPL-RP, and determine whether it shows any objective advantage over standard laparoscopic radical prostatectomy. From June 2009 to September 2011, 15 extraperitoneal SPOPL-RPs were performed through a 2–3-cm subumbilical longitudinal incision and another 5-mm trocar placed at the McBurney point. This cohort was compared with 37 contemporary patients who underwent standard extraperitoneal laparoscopic radical prostatectomy performed by the same urologist. Peri- and postoperative outcomes, including continence, potency, and scar length, were statistically analyzed. The two groups were comparable with respect to patient demographics, estimated blood loss, drainage time, duration of catheterization, catheterization rate >14 days, complication rate, postoperative hospitalization, and postoperative functional and oncologic outcomes (p > 0.05. The SPOPL-RP procedures had a longer mean operative time (170.1 minutes vs. 139.5 minutes, p = 0.005, but with fewer patients requiring analgesics (20% vs. 54.1%, p = 0.038 and earlier resumption of oral intake (20.7 hours vs. 26.8 hours, p = 0.037. The mean scar length in the SPOPL-RP group was much smaller (3.4 cm vs. 5.8 cm, p = 0.000 owing to the significant reduction of the skin incision. The peri- and postoperative outcomes of SPOPL-RP for low-risk prostate cancer are comparable to those with the standard laparoscopic approach. In addition, SPOPL-RP provides better postoperative pain control, faster recovery of bowel function, and smaller scar length than standard laparoscopy, albeit with a longer operative time.

  11. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  12. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  13. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  15. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  16. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  17. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  18. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    Science.gov (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  19. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  20. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  1. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  2. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  3. Hormone replacement therapy improves contractile function and myonuclear organization of single muscle fibres from postmenopausal monozygotic female twin pairs.

    Science.gov (United States)

    Qaisar, Rizwan; Renaud, Guillaume; Hedstrom, Yvette; Pöllänen, Eija; Ronkainen, Paula; Kaprio, Jaakko; Alen, Markku; Sipilä, Sarianna; Artemenko, Konstantin; Bergquist, Jonas; Kovanen, Vuokko; Larsson, Lars

    2013-05-01

    Ageing is associated with a decline in muscle mass and strength leading to increased physical dependency in old age. Postmenopausal women experience a greater decline than men of similar age in parallel with the decrease in female sex steroid hormone production. We recruited six monozygous female twin pairs (55-59 years old) where only one twin pair was on hormone replacement therapy (HRT use = 7.8 ± 4.3 years) to investigate the association of HRT with the cytoplasmic volume supported by individual myonuclei (myonuclear domain (MND) size,) together with specific force at the single fibre level. HRT use was associated with a significantly smaller (∼27%; P muscle fibres expressing the type I but not the IIa myosin heavy chain (MyHC) isoform. In comparison to non-users, higher specific force was recorded in HRT users both in muscle fibres expressing type I (∼27%; P fibre-type dependent, i.e. the higher specific force in fast-twitch muscle fibres was primarily caused by higher force per cross-bridge while slow-twitch fibres relied on both a higher number and force per cross-bridge. HRT use had no effect on fibre cross-sectional area (CSA), velocity of unloaded shortening (V0) and relative proportion of MyHC isoforms. In conclusion, HRT appears to have significant positive effects on both regulation of muscle contraction and myonuclei organization in postmenopausal women.

  4. Measurement of the Top Quark Pair Production Cross-Section in the Single Lepton Channel with the ATLAS Experiment

    CERN Document Server

    Lange, C; The ATLAS collaboration

    2011-01-01

    The measurement of the top-quark pair production cross-section is a powerful tool to test the Standard Model (SM) at a new energy. With the recent advances in theoretical calculations that led to predictions at a precision level of 10%, this measurement particularly provides a precision test of the theory of Quantum Chromodynamics. At the same time, the decays of top-quark pairs are phenomenologically similar to processes predicted by beyond-SM theories, thus representing an irreducible background that has to be studied thoroughly. In this first phase of data taking of the ATLAS detector, a copious process like $t\\bar{t}$ production can be also exploited to test the performance of the detector itself. The single-lepton channel, in which the W boson produced in the decay of one top quark decays leptonically and the W boson from the other top quak decays hadronically, currently provides the best trade-off between experimental accessibility, production rate and background contamination. The measurement of the $t...

  5. Electron and Cooper-pair transport across a single magnetic molecule explored with a scanning tunneling microscope

    Science.gov (United States)

    Brand, J.; Gozdzik, S.; Néel, N.; Lado, J. L.; Fernández-Rossier, J.; Kröger, J.

    2018-05-01

    A scanning tunneling microscope is used to explore the evolution of electron and Cooper-pair transport across single Mn-phthalocyanine molecules adsorbed on Pb(111) from tunneling to contact ranges. Normal-metal as well as superconducting tips give rise to a gradual transition of the Bardeen-Cooper-Schrieffer energy gap in the tunneling range into a zero-energy resonance close to and at contact. Supporting transport calculations show that in the normal-metal-superconductor junctions this resonance reflects the merging of in-gap Yu-Shiba-Rusinov states as well as the onset of Andreev reflection. For the superconductor-superconductor contacts, the zero-energy resonance is rationalized in terms of a finite Josephson current that is carried by phase-dependent Andreev and Yu-Shiba-Rusinov levels.

  6. Measurements of differential cross-section ratios for single-nucleon transfer reaction pairs near A=25

    Energy Technology Data Exchange (ETDEWEB)

    Howard, A J; Moise, T S [Trinity Coll., Hartford, CT (USA). Dept. of Physics; Champagne, A E [Princeton Univ., NJ (USA). Dept. of Physics; Magnus, P V; Smith, M S [Yale Univ., New Haven, CT (USA). Wright Nuclear Structure Lab.

    1991-06-10

    Differential cross sections for the (d,p), ({sup 3}He,d), ({alpha},t) and ({alpha},{sup 3}He) reactions involving seventy-one residual states in {sup 23}Na, {sup 25}Mg, {sup 25}Al, and {sup 27}Al have been measured at a forward angle with incident energies of 17.5, 20.2, and 34.8 MeV, respectively. The ratio of cross-section pairs involving formation of the same residual state is determined for forty-five cases where both the angular momentum transfer and single-particle spectroscopic strength have been previously established. These are compared to values calculated with conventional distorted-wave Born approximation analysis, and the utility of this technique for identifying some levels which are possible s- or p-wave resonances is demonstrated and discussed for states in the vicinity of proton thresholds. An application is made involving proton threshold states in {sup 27}Al. (orig.).

  7. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  8. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  9. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    Science.gov (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  10. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  11. Search for pair production of supersymmetric top-quark partners in events with a single lepton at CMS

    International Nuclear Information System (INIS)

    Costanza, Francesco

    2014-09-01

    The analysis presented in this thesis is a search for direct pair production of supersymmetric top-quark partners at CMS. Supersymmetry is a compelling theory providing possible solutions to several of the Standard Models limitations. However, previous searches for supersymmetric particles came back with empty hands. These results and the discovery of a Higgs boson with a mass of about 125 GeV by the ATLAS and CMS Collaborations strongly constrain the simplest supersymmetric models. Nevertheless, more sophisticated models with light third-generation squarks did not lose their theoretical appeal and are within the reach of the 8 TeV run of the Large Hadron Collider. In this analysis, a search for direct top-squark (t) pair production is performed in a final state consisting of a single isolated lepton, jets, among which at least one is a b-tagged jet, and large missing transverse energy. Six search regions are defined with a semi-automatic procedure to maximize the sensitivity of the analysis. The background estimation is performed using simulated samples validated in control regions with small or no signal contamination. Scale factors are measured in the control regions and used to correct the background in the search regions if needed. The observed event yields in the search regions agree with the predicted backgrounds within the uncertainties, hence no evidence for pair-produced top-squarks can be inferred. The results are used to constrain top-squark pair production in the framework of simplified models. Two possible top-squark decay modes are considered: the decay to top quark and a neutralino (chiz), t→tχ 0 , and the decay to a bottom quark and a chargino (χ + ), t→bχ + , with the subsequent χ + →W + +χ 0 decay. Exclusion limits are set for branching ratios B(t →tχ 0 )=100% and B(t → tχ 0 )=50%. In the former case, for small mass values of the lightest neutralino, the analysis probes top-squark masses up to 600 GeV and up to 500 GeV in the

  12. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  13. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  14. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  15. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  16. Thermodynamic analysis of single-stage and multi-stage adsorption refrigeration cycles with activated carbon–ammonia working pair

    International Nuclear Information System (INIS)

    Xu, S.Z.; Wang, L.W.; Wang, R.Z.

    2016-01-01

    Highlights: • Activated carbon–ammonia multi-stage adsorption refrigerator was analyzed. • COP, exergetic efficiency and entropy production of cycles were calculated. • Single-stage cycle usually has the advantages of simple structure and high COP. • Multi-stage cycles adapt to critical conditions better than single-stage cycle. • Boundary conditions for choosing optimal cycle were summarized as tables. - Abstract: Activated carbon–ammonia multi-stage adsorption refrigeration cycle was analyzed in this article, which realized deep-freezing for evaporating temperature under −18 °C with heating source temperature much lower than 100 °C. Cycle mathematical models for single, two and three-stage cycles were established on the basis of thorough thermodynamic analysis. According to simulation results of thermodynamic evaluation indicators such as COP (coefficient of performance), exergetic efficiency and cycle entropy production, multi-stage cycle adapts to high condensing temperature, low evaporating temperature and low heating source temperature well. Proposed cycle with selected working pair can theoretically work under very severe conditions, such as −25 °C evaporating temperature, 40 °C condensing temperature, and 70 °C heating source temperature, but under these working conditions it has the drawback of low cycle adsorption quantity. It was found that both COP and exergetic efficiency are of great reference value in the choice of cycle, whereas entropy production is not so useful for cycle stage selection. Finally, the application boundary conditions of single-stage, two-stage, and three-stage cycles were summarized as tables according to the simulation results, which provides reference for choosing optimal cycle under different conditions.

  17. TumorBoost: Normalization of allele-specific tumor copy numbers from a single pair of tumor-normal genotyping microarrays

    Directory of Open Access Journals (Sweden)

    Neuvial Pierre

    2010-05-01

    Full Text Available Abstract Background High-throughput genotyping microarrays assess both total DNA copy number and allelic composition, which makes them a tool of choice for copy number studies in cancer, including total copy number and loss of heterozygosity (LOH analyses. Even after state of the art preprocessing methods, allelic signal estimates from genotyping arrays still suffer from systematic effects that make them difficult to use effectively for such downstream analyses. Results We propose a method, TumorBoost, for normalizing allelic estimates of one tumor sample based on estimates from a single matched normal. The method applies to any paired tumor-normal estimates from any microarray-based technology, combined with any preprocessing method. We demonstrate that it increases the signal-to-noise ratio of allelic signals, making it significantly easier to detect allelic imbalances. Conclusions TumorBoost increases the power to detect somatic copy-number events (including copy-neutral LOH in the tumor from allelic signals of Affymetrix or Illumina origin. We also conclude that high-precision allelic estimates can be obtained from a single pair of tumor-normal hybridizations, if TumorBoost is combined with single-array preprocessing methods such as (allele-specific CRMA v2 for Affymetrix or BeadStudio's (proprietary XY-normalization method for Illumina. A bounded-memory implementation is available in the open-source and cross-platform R package aroma.cn, which is part of the Aroma Project (http://www.aroma-project.org/.

  18. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  20. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  1. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  2. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  3. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  4. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  5. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  6. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  7. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  8. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt

    2018-05-01

    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  9. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  10. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  11. Measurement of the top quark pair production cross-section with ATLAS in the single lepton channel

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdelalim, Ahmed Ali; Abdesselam, Abdelouahab; Abdinov, Ovsat; Abi, Babak; Abolins, Maris; Abramowicz, Halina; Abreu, Henso; Acerbi, Emilio; Acharya, Bobby Samir; Adams, David; Addy, Tetteh; Adelman, Jahred; Aderholz, Michael; Adomeit, Stefanie; Adragna, Paolo; Adye, Tim; Aefsky, Scott; Aguilar-Saavedra, Juan Antonio; Aharrouche, Mohamed; Ahlen, Steven; Ahles, Florian; Ahmad, Ashfaq; Ahsan, Mahsana; Aielli, Giulio; Akdogan, Taylan; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Akiyama, Kunihiro; Alam, Mohammad; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alison, John; Aliyev, Magsud; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral, Pedro; Amelung, Christoph; Ammosov, Vladimir; Amorim, Antonio; Amorós, Gabriel; Amram, Nir; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Andrieux, Marie-Laure; Anduaga, Xabier; Angerami, Aaron; Anghinolfi, Francis; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoun, Sahar; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Archambault, John-Paul; Arfaoui, Samir; Arguin, Jean-Francois; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnault, Christian; Artamonov, Andrei; Artoni, Giacomo; Arutinov, David; Asai, Shoji; Asfandiyarov, Ruslan; Ask, Stefan; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astbury, Alan; Astvatsatourov, Anatoli; Atoian, Grigor; Aubert, Bernard; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Avramidou, Rachel Maria; Axen, David; Ay, Cano; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baccaglioni, Giuseppe; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Bachy, Gerard; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagnaia, Paolo; Bahinipati, Seema; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Mark; Baker, Sarah; Banas, Elzbieta; Banerjee, Piyali; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barashkou, Andrei; Barbaro Galtieri, Angela; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Bardin, Dmitri; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Barrillon, Pierre; Bartoldus, Rainer; Barton, Adam Edward; Bartsch, Valeria; Bates, Richard; Batkova, Lucia; Batley, Richard; Battaglia, Andreas; Battistin, Michele; Battistoni, Giuseppe; Bauer, Florian; Bawa, Harinder Singh; Beare, Brian; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Sebastian; Beckingham, Matthew; Becks, Karl-Heinz; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Begel, Michael; Behar Harpaz, Silvia; Behera, Prafulla; Beimforde, Michael; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellina, Francesco; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Ben Ami, Sagi; Benary, Odette; Benchekroun, Driss; Benchouk, Chafik; Bendel, Markus; Benekos, Nektarios; Benhammou, Yan; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Benoit, Mathieu; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Berry, Tracey; Bertin, Antonio; Bertinelli, Francesco; Bertolucci, Federico; Besana, Maria Ilaria; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biscarat, Catherine; Bitenc, Urban; Black, Kevin; Blair, Robert; Blanchard, Jean-Baptiste; Blanchot, Georges; Blazek, Tomas; Blocker, Craig; Blocki, Jacek; Blondel, Alain; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boelaert, Nele; Böser, Sebastian; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Bolnet, Nayanka Myriam; Bona, Marcella; Bondarenko, Valery; Bondioli, Mario; Boonekamp, Maarten; Boorman, Gary; Booth, Chris; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borjanovic, Iris; Borroni, Sara; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Botterill, David; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Bourdarios, Claire; Bousson, Nicolas; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozhko, Nikolay; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Braem, André; Branchini, Paolo; Brandenburg, George; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brelier, Bertrand; Bremer, Johan; Brenner, Richard; Bressler, Shikma; Breton, Dominique; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brodbeck, Timothy; Brodet, Eyal; Broggi, Francesco; Bromberg, Carl; Brooijmans, Gustaaf; Brooks, William; Brown, Gareth; Brown, Heather; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Buanes, Trygve; Bucci, Francesca; Buchanan, James; Buchanan, Norman; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Büscher, Volker; Bugge, Lars; Buira-Clark, Daniel; Bulekov, Oleg; Bunse, Moritz; Buran, Torleiv; Burckhart, Helfried; Burdin, Sergey; Burgess, Thomas; Burke, Stephen; Busato, Emmanuel; Bussey, Peter; Buszello, Claus-Peter; Butin, François; Butler, Bart; Butler, John; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cambiaghi, Mario; Cameron, David; Caminada, Lea Michaela; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Capasso, Luciano; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capriotti, Daniele; Capua, Marcella; Caputo, Regina; Caramarcu, Costin; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Bryan; Caron, Sascha; Carrillo Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Cascella, Michele; Caso, Carlo; Castaneda Hernandez, Alfredo Martin; Castaneda-Miranda, Elizabeth; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Cataldi, Gabriella; Cataneo, Fernando; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cauz, Diego; Cavalleri, Pietro; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cetin, Serkant Ali; Cevenini, Francesco; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Kevin; Chapleau, Bertrand; Chapman, John Derek; Chapman, John Wehrley; Chareyre, Eve; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Shenjian; Chen, Tingyang; Chen, Xin; Cheng, Shaochen; Cheplakov, Alexander; Chepurnov, Vladimir; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Cheung, Sing-Leung; Chevalier, Laurent; Chiefari, Giovanni; Chikovani, Leila; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chizhov, Mihail; Choudalakis, Georgios; Chouridou, Sofia; Christidi, Illectra-Athanasia; Christov, Asen; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciba, Krzysztof; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciobotaru, Matei Dan; Ciocca, Claudia; Ciocio, Alessandra; Cirilli, Manuela; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Clifft, Roger; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coe, Paul; Cogan, Joshua Godfrey; Coggeshall, James; Cogneras, Eric; Cojocaru, Claudiu; Colas, Jacques; Colijn, Auke-Pieter; Collins, Neil; Collins-Tooth, Christopher; Collot, Johann; Colon, German; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Consonni, Michele; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conventi, Francesco; Cook, James; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Costin, Tudor; Côté, David; Coura Torres, Rodrigo; Courneyea, Lorraine; Cowan, Glen; Cowden, Christopher; Cox, Brian; Cranmer, Kyle; Crescioli, Francesco; Cristinziani, Markus; Crosetti, Giovanni; Crupi, Roberto; Crépé-Renaudin, Sabine; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Curatolo, Maria; Curtis, Chris; Cwetanski, Peter; Czirr, Hendrik; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Silva, Paulo Vitor; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dallapiccola, Carlo; Dam, Mogens; Dameri, Mauro; Damiani, Daniel; Danielsson, Hans Olof; Dannheim, Dominik; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Daum, Cornelis; Davey, Will; Davidek, Tomas; Davidson, Nadia; Davidson, Ruth; Davies, Eleanor; Davies, Merlin; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Dawson, John; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Castro Faria Salgado, Pedro; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lotto, Barbara; de Mora, Lee; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dean, Simon; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Degenhardt, James; Dehchar, Mohamed; Del Papa, Carlo; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delruelle, Nicolas; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demirkoz, Bilge; Deng, Jianrong; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Devetak, Erik; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Luise, Silvestro; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Diaz, Marco Aurelio; Diblen, Faruk; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobbs, Matt; Dobinson, Robert; Dobos, Daniel; Dobson, Ellie; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Doi, Yoshikuni; Dolejsi, Jiri; Dolenc, Irena; Dolezal, Zdenek; Dolgoshein, Boris; Dohmae, Takeshi; Donadelli, Marisilvia; Donega, Mauro; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dosil, Mireia; Dotti, Andrea; Dova, Maria-Teresa; Dowell, John; Doxiadis, Alexander; Doyle, Tony; Drasal, Zbynek; Drees, Jürgen; Dressnandt, Nandor; Drevermann, Hans; Driouichi, Chafik; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Duchovni, Ehud; Duckeck, Guenter; Dudarev, Alexey; Dudziak, Fanny; Dührssen, Michael; Duerdoth, Ian; Duflot, Laurent; Dufour, Marc-Andre; Dunford, Monica; Duran Yildiz, Hatice; Duxfield, Robert; Dwuznik, Michal; Dydak, Friedrich; Düren, Michael; Ebenstein, William; Ebke, Johannes; Eckweiler, Sebastian; Edmonds, Keith; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Ehrich, Thies; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Engelmann, Roderich; Engl, Albert; Epp, Brigitte; Eppig, Andrew; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Fabre, Caroline; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farley, Jason; Farooque, Trisha; Farrington, Sinead; Farthouat, Philippe; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Fazio, Salvatore; Febbraro, Renato; Federic, Pavol; Fedin, Oleg; Fedorko, Woiciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Fellmann, Denis; Feng, Cunfeng; Feng, Eric; Fenyuk, Alexander; Ferencei, Jozef; Ferland, Jonathan; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferrer, Antonio; Ferrer, Maria Lorenza; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filippas, Anastasios; Filthaut, Frank; Fincke-Keeler, Margret; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Gordon; Fischer, Peter; Fisher, Matthew; Flechl, Martin; Fleck, Ivor; Fleckner, Johanna; Fleischmann, Philipp; Fleischmann, Sebastian; Flick, Tobias; Flores Castillo, Luis; Flowerdew, Michael; Fokitis, Manolis; Fonseca Martin, Teresa; Fopma, Johan; Forbush, David Alan; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Foster, Joe; Fournier, Daniel; Foussat, Arnaud; Fowler, Andrew; Fowler, Ken; Fox, Harald; Francavilla, Paolo; Franchino, Silvia; Francis, David; Frank, Tal; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Felix; Froeschl, Robert; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Gan, KK; Gao, Yongsheng; Gapienko, Vladimir; Gaponenko, Andrei; Garberson, Ford; Garcia-Sciveres, Maurice; García, Carmen; García Navarro, José Enrique; Gardner, Robert; Garelli, Nicoletta; Garitaonandia, Hegoi; Garonne, Vincent; Garvey, John; Gatti, Claudio; Gaudio, Gabriella; Gaumer, Olivier; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gayde, Jean-Christophe; Gazis, Evangelos; Ge, Peng; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerlach, Peter; Gershon, Avi; Geweniger, Christoph; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giakoumopoulou, Victoria; Giangiobbe, Vincent; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Adam; Gibson, Stephen; Gilbert, Laura; Gilewsky, Valentin; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Ginzburg, Jonatan; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giunta, Michele; Giusti, Paolo; Gjelsten, Børge Kile; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glitza, Karl-Walter; Glonti, George; Godfrey, Jennifer; Godlewski, Jan; Goebel, Martin; Göpfert, Thomas; Goeringer, Christian; Gössling, Claus; Göttfert, Tobias; Goldfarb, Steven; Golling, Tobias; Golovnia, Serguei; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gonidec, Allain; Gonzalez, Saul; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Gorokhov, Serguei; Goryachev, Vladimir; Gosdzik, Bjoern; Gosselink, Martijn; Gostkin, Mikhail Ivanovitch; Gough Eschrich, Ivo; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Grau, Nathan; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenshaw, Timothy; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grinstein, Sebastian; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Groh, Manfred; Gross, Eilam; Grosse-Knetter, Joern; Groth-Jensen, Jacob; Grybel, Kai; Guarino, Victor; Guest, Daniel; Guicheney, Christophe; Guida, Angelo; Guindon, Stefan; Guler, Hulya; Gunther, Jaroslav; Guo, Bin; Guo, Jun; Gupta, Ambreesh; Gusakov, Yury; Gushchin, Vladimir; Gutierrez, Andrea; Gutierrez, Phillip; Guttman, Nir; Gutzwiller, Olivier; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haas, Stefan; Haber, Carl; Hadavand, Haleh Khani; Hadley, David; Haefner, Petra; Hahn, Ferdinand; Haider, Stefan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haller, Johannes; Hamacher, Klaus; Hamal, Petr; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Hongguang; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Handel, Carsten; Hanke, Paul; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hare, Gabriel; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Karl; Hartert, Jochen; Hartjes, Fred; Haruyama, Tomiyoshi; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Hatch, Mark; Hauff, Dieter; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawes, Brian; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Donovan; Hayakawa, Takashi; Hayashi, Takayasu; Hayden, Daniel; Hayward, Helen; Haywood, Stephen; Hazen, Eric; He, Mao; Head, Simon; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Helary, Louis; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Hemperek, Tomasz; Henderson, Robert; Henke, Michael; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Henry-Couannier, Frédéric; Hensel, Carsten; Henß, Tobias; Medina Hernandez, Carlos; Hernández Jiménez, Yesenia; Herrberg, Ruth; Hershenhorn, Alon David; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hessey, Nigel; Higón-Rodriguez, Emilio; Hill, Daniel; Hill, John; Hill, Norman; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirsch, Florian; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holder, Martin; Holmgren, Sven-Olof; Holy, Tomas; Holzbauer, Jenny; Homma, Yasuhiro; Hong, Tae Min; Hooft van Huysduynen, Loek; Horazdovsky, Tomas; Horn, Claus; Horner, Stephan; Horton, Katherine; Hostachy, Jean-Yves; Hou, Suen; Houlden, Michael; Hoummada, Abdeslam; Howarth, James; Howell, David; Hristova, Ivana; Hrivnac, Julius; Hruska, Ivan; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Huang, Guang Shun; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Hughes-Jones, Richard; Huhtinen, Mika; Hurst, Peter; Hurwitz, Martina; Husemann, Ulrich; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibbotson, Michael; Ibragimov, Iskander; Ichimiya, Ryo; Iconomidou-Fayard, Lydia; Idarraga, John; Iengo, Paolo; Igonkina, Olga; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Yuri; Iliadis, Dimitrios; Imbault, Didier; Imori, Masatoshi; Ince, Tayfun; Inigo-Golfin, Joaquin; Ioannou, Pavlos; Iodice, Mauro; Irles Quiles, Adrian; Isaksson, Charlie; Ishikawa, Akimasa; Ishino, Masaya; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakubek, Jan; Jana, Dilip; Jankowski, Ernest; Jansen, Eric; Jantsch, Andreas; Janus, Michel; Jarlskog, Göran; Jeanty, Laura; Jelen, Kazimierz; Jen-La Plante, Imai; Jenni, Peter; Jeremie, Andrea; Jež, Pavel; Jézéquel, Stéphane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Ge; Jin, Shan; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansen, Lars; Johansen, Marianne; Johansson, Erik; Johansson, Per; Johnert, Sebastian; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tegid; Jones, Tim; Jonsson, Ove; Joram, Christian; Jorge, Pedro; Joseph, John; Jovin, Tatjana; Ju, Xiangyang; Jung, Christian; Juranek, Vojtech; Jussel, Patrick; Juste Rozas, Aurelio; Kabachenko, Vasily; Kabana, Sonja; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kaiser, Steffen; Kajomovitz, Enrique; Kalinin, Sergey; Kalinovskaya, Lidia; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kaplon, Jan; Kar, Deepak; Karagounis, Michael; Karagoz, Muge; Karnevskiy, Mikhail; Karr, Kristo; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Mayuko; Kataoka, Yousuke; Katsoufis, Elias; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kayl, Manuel; Kazanin, Vassili; Kazarinov, Makhail; Keates, James Robert; Keeler, Richard; Kehoe, Robert; Keil, Markus; Kekelidze, George; Kennedy, John; Kenney, Christopher John; Kenyon, Mike; Kepka, Oldrich; Kerschen, Nicolas; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Kholodenko, Anatoli; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Nikolai; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Min Suk; Kim, Peter; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; Kirk, Julie; Kirsch, Lawrence; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kittelmann, Thomas; Kiver, Andrey; Kladiva, Eduard; Klaiber-Lodewigs, Jonas; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klemetti, Miika; Klier, Amit; Klimentov, Alexei; Klingenberg, Reiner; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Klous, Sander; Kluge, Eike-Erik; Kluge, Thomas; Kluit, Peter; Kluth, Stefan; Knecht, Neil; Kneringer, Emmerich; Knobloch, Juergen; Knoops, Edith; Knue, Andrea; Ko, Byeong Rok; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Köneke, Karsten; König, Adriaan; Koenig, Sebastian; Köpke, Lutz; Koetsveld, Folkert; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kohn, Fabian; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kokott, Thomas; Kolachev, Guennady; Kolanoski, Hermann; Kolesnikov, Vladimir; Koletsou, Iro; Koll, James; Kollar, Daniel; Kollefrath, Michael; Kolya, Scott; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kono, Takanori; Kononov, Anatoly; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kootz, Andreas; Koperny, Stefan; Kopikov, Sergey; Korcyl, Krzysztof; Kordas, Kostantinos; Koreshev, Victor; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotamäki, Miikka Juhani; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, James; Kraus, Jana; Kreisel, Arik; Krejci, Frantisek; Kretzschmar, Jan; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruth, Andre; Kubota, Takashi; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kuhn, Dietmar; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kummer, Christian; Kuna, Marine; Kundu, Nikhil; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kus, Vlastimil; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Labbe, Julien; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laisne, Emmanuel; Lamanna, Massimo; Lampen, Caleb; Lampl, Walter; Lancon, Eric; Landgraf, Ulrich; Landon, Murrough; Landsman, Hagar; Lane, Jenna; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larionov, Anatoly; Larner, Aimee; Lasseur, Christian; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Laycock, Paul; Lazarev, Alexandre; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Maner, Christophe; Le Menedeu, Eve; Lebel, Céline; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Michel; Legendre, Marie; Leger, Annie; LeGeyt, Benjamin; Legger, Federica; Leggett, Charles; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Leltchouk, Mikhail; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatiana; Lenzen, Georg; Lenzi, Bruno; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lessard, Jean-Raphael; Lesser, Jonas; Lester, Christopher; Leung Fook Cheong, Annabelle; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levitski, Mikhail; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bo; Li, Haifeng; Li, Shu; Li, Xuefei; Liang, Zhihua; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lichtnecker, Markus; Lie, Ki; Liebig, Wolfgang; Lifshitz, Ronen; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Linnemann, James; Lipeles, Elliot; Lipinsky, Lukas; Lipniacka, Anna; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Chuanlei; Liu, Dong; Liu, Hao; Liu, Jianbei; Liu, Minghui; Liu, Shengli; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Loken, James; Lombardo, Vincenzo Paolo; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Losada, Marta; Loscutoff, Peter; Lo Sterzo, Francesco; Losty, Michael; Lou, Xinchou; Lounis, Abdenour; Loureiro, Karina; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Andreas; Ludwig, Dörthe; Ludwig, Inga; Ludwig, Jens; Luehring, Frederick; Luijckx, Guy; Lumb, Debra; Luminari, Lamberto; Lund, Esben; Lund-Jensen, Bengt; Lundberg, Björn; Lundberg, Johan; Lundquist, Johan; Lungwitz, Matthias; Lutz, Gerhard; Lynn, David; Lys, Jeremy; Lytken, Else; Ma, Hong; Ma, Lian Liang; Macana Goia, Jorge Andres; Maccarrone, Giovanni; Macchiolo, Anna; Maček, Boštjan; Machado Miguens, Joana; Mackeprang, Rasmus; Madaras, Ronald; Mader, Wolfgang; Maenner, Reinhard; Maeno, Tadashi; Mättig, Peter; Mättig, Stefan; Magnoni, Luca; Magradze, Erekle; Mahalalel, Yair; Mahboubi, Kambiz; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malecki, Pawel; Malecki, Piotr; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mameghani, Raphael; Mamuzic, Judita; Manabe, Atsushi; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Mangeard, Pierre-Simon; Manjavidze, Ioseb; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Manz, Andreas; Mapelli, Alessandro; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marin, Alexandru; Marino, Christopher; Marroquim, Fernando; Marshall, Robin; Marshall, Zach; Martens, Kalen; Marti-Garcia, Salvador; Martin, Alex; Martin, Andrew; Martin, Brian; Martin, Brian Thomas; Martin, Franck Francois; Martin, Jean-Pierre; Martin, Philippe; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martin-Haugh, Stewart; Martinez, Mario; Martinez Outschoorn, Verena; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massaro, Graziano; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mathes, Markus; Matricon, Pierre; Matsumoto, Hiroshi; Matsunaga, Hiroyuki; Matsushita, Takashi; Mattravers, Carly; Maugain, Jean-Marie; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; May, Edward; Mayne, Anna; Mazini, Rachid; Mazur, Michael; Mazzanti, Marcello; Mazzoni, Enrico; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; McGlone, Helen; Mchedlidze, Gvantsa; McLaren, Robert Andrew; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meera-Lebbai, Razzak; Meguro, Tatsuma; Mehdiyev, Rashid; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Mendoza Navas, Luis; Meng, Zhaoxia; Mengarelli, Alberto; Menke, Sven; Menot, Claude; Meoni, Evelin; Mercurio, Kevin Michael; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Meyer, Thomas Christian; Meyer, W Thomas; Miao, Jiayuan; Michal, Sebastien; Micu, Liliana; Middleton, Robin; Miele, Paola; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Miller, Robert; Mills, Bill; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Miralles Verge, Lluis; Misiejuk, Andrzej; Mitrevski, Jovan; Mitrofanov, Gennady; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Miyazaki, Kazuki; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mockett, Paul; Moed, Shulamit; Moeller, Victoria; Mönig, Klaus; Möser, Nicolas; Mohapatra, Soumya; Mohr, Wolfgang; Mohrdieck-Möck, Susanne; Moisseev, Artemy; Moles-Valls, Regina; Molina-Perez, Jorge; Monk, James; Monnier, Emmanuel; Montesano, Simone; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moorhead, Gareth; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Morello, Gianfranco; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morii, Masahiro; Morin, Jerome; Morley, Anthony Keith; Mornacchi, Giuseppe; Morozov, Sergey; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mudrinic, Mihajlo; Mueller, Felix; Mueller, James; Mueller, Klemens; Müller, Thomas; Muenstermann, Daniel; Muir, Alex; Munwes, Yonathan; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nadal, Jordi; Nagai, Koichi; Nagano, Kunihiro; Nagasaka, Yasushi; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Nanava, Gizo; Napier, Austin; Nash, Michael; Nation, Nigel; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nebot, Eduardo; Nechaeva, Polina; Negri, Andrea; Negri, Guido; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Silke; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicolas, Ludovic; Nicquevert, Bertrand; Niedercorn, Francois; Nielsen, Jason; Niinikoski, Tapio; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolaev, Kirill; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsen, Henrik; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nishiyama, Tomonori; Nisius, Richard; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nordberg, Markus; Nordkvist, Bjoern; Norton, Peter; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Nugent, Ian Michael; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nyman, Tommi; O'Brien, Brendan Joseph; O'Neale, Steve; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Oda, Susumu; Odaka, Shigeru; Odier, Jerome; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Ohshita, Hidetoshi; Ohsugi, Takashi; Okada, Shogo; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olcese, Marco; Olchevski, Alexander; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Omachi, Chihiro; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlov, Iliya; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Osuna, Carlos; Otero y Garzon, Gustavo; Ottersbach, John; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Ouyang, Qun; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Paleari, Chiara; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panes, Boris; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Panuskova, Monika; Paolone, Vittorio; Papadelis, Aras; Papadopoulou, Theodora; Paramonov, Alexander; Park, Woochun; Parker, Andy; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pecsy, Martin; Pedraza Morales, Maria Isabel; Peleganchuk, Sergey; Peng, Haiping; Pengo, Ruggero; Penson, Alexander; Penwell, John; Perantoni, Marcelo; Perez, Kerstin; Perez Cavalcanti, Tiago; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Perrodo, Pascal; Persembe, Seda; Perus, Antoine; Peshekhonov, Vladimir; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petschull, Dennis; Petteni, Michele; Pezoa, Raquel; Phan, Anna; Phillips, Peter William; Piacquadio, Giacinto; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Ping, Jialun; Pinto, Belmiro; Pirotte, Olivier; Pizio, Caterina; Plamondon, Mathieu; Pleier, Marc-Andre; Pleskach, Anatoly; Poblaguev, Andrei; Poddar, Sahill; Podlyski, Fabrice; Poggioli, Luc; Poghosyan, Tatevik; Pohl, Martin; Polci, Francesco; Polesello, Giacomo; Policicchio, Antonio; Polini, Alessandro; Poll, James; Polychronakos, Venetios; Pomarede, Daniel Marc; Pomeroy, Daniel; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Posch, Christoph; Pospelov, Guennady; Pospisil, Stanislav; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Pretzl, Klaus Peter; Pribyl, Lukas; Price, Darren; Price, Lawrence; Price, Michael John; Prieur, Damien; Primavera, Margherita; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Purdham, John; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Qian, Zuxuan; Qin, Zhonghua; Quadt, Arnulf; Quarrie, David; Quayle, William; Quinonez, Fernando; Raas, Marcel; Radescu, Voica; Radics, Balint; Rador, Tonguc; Ragusa, Francesco; Rahal, Ghita; Rahimi, Amir; Rahm, David; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Ramstedt, Magnus; Randle-Conde, Aidan Sean; Randrianarivony, Koloina; Ratoff, Peter; Rauscher, Felix; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reichold, Armin; Reinherz-Aronis, Erez; Reinsch, Andreas; Reisinger, Ingo; Reljic, Dusan; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Renkel, Peter; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richards, Alexander; Richter, Robert; Richter-Was, Elzbieta; Ridel, Melissa; Rijpstra, Manouk; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Rios, Ryan Randy; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robinson, Mary; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Rodier, Stephane; Rodriguez, Diego; Rodriguez Garcia, Yohany; Roe, Adam; Roe, Shaun; Røhne, Ole; Rojo, Victoria; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romanov, Victor; Romeo, Gaston; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosenbaum, Gabriel; Rosenberg, Eli; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rosselet, Laurent; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexander; Rozen, Yoram; Ruan, Xifeng; Rubinskiy, Igor; Ruckert, Benjamin; Ruckstuhl, Nicole; Rud, Viacheslav; Rudolph, Christian; Rudolph, Gerald; Rühr, Frederik; Ruggieri, Federico; Ruiz-Martinez, Aranzazu; Rumiantsev, Viktor; Rumyantsev, Leonid; Runge, Kay; Runolfsson, Ogmundur; Rurikova, Zuzana; Rusakovich, Nikolai; Rust, Dave; Rutherfoord, John; Ruwiedel, Christoph; Ruzicka, Pavel; Ryabov, Yury; Ryadovikov, Vasily; Ryan, Patrick; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Rzaeva, Sevda; Saavedra, Aldo; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Samset, Björn Hallvard; Sanchez, Arturo; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sandvoss, Stephan; Sankey, Dave; Sansoni, Andrea; Santamarina Rios, Cibran; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Saraiva, João; Sarangi, Tapas; Sarkisyan-Grinbaum, Edward; Sarri, Francesca; Sartisohn, Georg; Sasaki, Osamu; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Lee; Saxon, David; Says, Louis-Pierre; Sbarra, Carla; Sbrizzi, Antonio; Scallon, Olivia; Scannicchio, Diana; Schaarschmidt, Jana; Schacht, Peter; Schäfer, Uli; Schaepe, Steffen; Schaetzel, Sebastian; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Schamov, Andrey; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schioppa, Marco; Schlenker, Stefan; Schlereth, James; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitz, Martin; Schöning, André; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schroeder, Christian; Schroer, Nicolai; Schuh, Silvia; Schuler, Georges; Schultes, Joachim; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Jan; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwemling, Philippe; Schwienhorst, Reinhard; Schwierz, Rainer; Schwindling, Jerome; Schwindt, Thomas; Scott, Bill; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Segura, Ester; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Seliverstov, Dmitry; Sellden, Bjoern; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Seuster, Rolf; Severini, Horst; Sevior, Martin; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaver, Leif; Shaw, Kate; Sherman, Daniel; Sherwood, Peter; Shibata, Akira; Shichi, Hideharu; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Maria; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shupe, Michael; Sicho, Petr; Sidoti, Antonio; Siebel, Anca-Mirela; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simmons, Brinick; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Skvorodnev, Nikolai; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Sloper, John erik; Smakhtin, Vladimir; Smirnov, Sergei; Smirnova, Lidia; Smirnova, Oxana; Smith, Ben Campbell; Smith, Douglas; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snow, Steve; Snow, Joel; Snuverink, Jochem; Snyder, Scott; Soares, Mara; Sobie, Randall; Sodomka, Jaromir; Soffer, Abner; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Sondericker, John; Soni, Nitesh; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soukharev, Andrey; Spagnolo, Stefania; Spanò, Francesco; Spighi, Roberto; Spigo, Giancarlo; Spila, Federico; Spiwoks, Ralf; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahl, Thorsten; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staude, Arnold; Stavina, Pavel; Stavropoulos, Georgios; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stevenson, Kyle; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Strachota, Pavel; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strang, Michael; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Strong, John; Stroynowski, Ryszard; Strube, Jan; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Soh, Dart-yin; Su, Dong; Subramania, Halasya Siva; Succurro, Antonella; Sugaya, Yorihito; Sugimoto, Takuya; Suhr, Chad; Suita, Koichi; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Sushkov, Serge; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Suzuki, Yuta; Svatos, Michal; Sviridov, Yuri; Swedish, Stephen; Sykora, Ivan; Sykora, Tomas; Szeless, Balazs; Sánchez, Javier; Ta, Duc; Tackmann, Kerstin; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Talby, Mossadek; Talyshev, Alexey; Tamsett, Matthew; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanaka, Yoshito; Tani, Kazutoshi; Tannoury, Nancy; Tappern, Geoffrey; Tapprogge, Stefan; Tardif, Dominique; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tassi, Enrico; Tatarkhanov, Mous; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teinturier, Marthe; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Terwort, Mark; Testa, Marianna; Teuscher, Richard; Thadome, Jocelyn; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thioye, Moustapha; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tian, Feng; Tic, Tomáš; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tique Aires Viegas, Florbela De Jes; Tisserant, Sylvain; Toczek, Barbara; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokunaga, Kaoru; Tokushuku, Katsuo; Tollefson, Kirsten; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Guoliang; Tonoyan, Arshak; Topfel, Cyril; Topilin, Nikolai; Torchiani, Ingo; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Traynor, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alesandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Trinh, Thi Nguyet; Tripiana, Martin; Trischuk, William; Trivedi, Arjun; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiakiris, Menelaos; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuggle, Joseph; Turala, Michal; Turecek, Daniel; Turk Cakir, Ilkay; Turlay, Emmanuel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Tyrvainen, Harri; Tzanakos, George; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ugland, Maren; Uhlenbrock, Mathias; Uhrmacher, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Underwood, David; Undrus, Alexander; Unel, Gokhan; Unno, Yoshinobu; Urbaniec, Dustin; Urkovsky, Evgeny; Usai, Giulio; Uslenghi, Massimiliano; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vahsen, Sven; Valenta, Jan; Valente, Paolo; Valentinetti, Sara; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; van der Graaf, Harry; van der Kraaij, Erik; Van Der Leeuw, Robin; van der Poel, Egge; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; van Kesteren, Zdenko; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vandoni, Giovanna; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Varela Rodriguez, Fernando; Vari, Riccardo; Varnes, Erich; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vegni, Guido; Veillet, Jean-Jacques; Vellidis, Constantine; Veloso, Filipe; Veness, Raymond; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinek, Elisabeth; Vinogradov, Vladimir; Virchaux, Marc; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vlasov, Nikolai; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Loeben, Joerg; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobiev, Alexander; Vorwerk, Volker; Vos, Marcel; Voss, Rudiger; Voss, Thorsten Tobias; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Wagner, Wolfgang; Wagner, Peter; Wahlen, Helmut; Wakabayashi, Jun; Walbersloh, Jorg; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Joshua C; Wang, Rui; Wang, Song-Ming; Warburton, Andreas; Ward, Patricia; Warsinsky, Markus; Wastie, Roy; Watkins, Peter; Watson, Alan; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Weber, Jens; Weber, Marc; Weber, Michele; Weber, Pavel; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Wellenstein, Hermann; Wells, Phillippa; Wen, Mei; Wenaus, Torre; Wendler, Shanti; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Werth, Michael; Wessels, Martin; Weydert, Carole; Whalen, Kathleen; Wheeler-Ellis, Sarah Jane; Whitaker, Scott; White, Andrew; White, Martin; Whitehead, Samuel Robert; Whiteson, Daniel; Whittington, Denver; Wicek, Francois; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilhelm, Ivan; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Eric; Williams, Hugh; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Michael Galante; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wooden, Gemma; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Catherine; Wright, Michael; Wrona, Bozydar; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wunstorf, Renate; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xie, Song; Xie, Yigang; Xu, Chao; Xu, Da; Xu, Guofa; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamaoka, Jared; Yamazaki, Takayuki; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Un-Ki; Yang, Yi; Yang, Yi; Yang, Zhaoyu; Yanush, Serguei; Yao, Yushu; Yasu, Yoshiji; Ybeles Smit, Gabriel Valentijn; Ye, Jingbo; Ye, Shuwei; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Riktura; Young, Charles; Youssef, Saul; Yu, Dantong; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaets, Vassilli; Zaidan, Remi; Zaitsev, Alexander; Zajacova, Zuzana; Zalite, Youris; Zanello, Lucia; Zarzhitsky, Pavel; Zaytsev, Alexander; Zeitnitz, Christian; Zeller, Michael; Zeman, Martin; Zemla, Andrzej; Zendler, Carolin; Zenin, Oleg; Ženiš, Tibor; Zinonos, Zinonas; Zenz, Seth; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhan, Zhichao; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Long; Zhao, Tianchi; Zhao, Zhengguo; Zhemchugov, Alexey; Zheng, Shuchen; Zhong, Jiahang; Zhou, Bing; Zhou, Ning; Zhou, Yue; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhuravlov, Vadym; Zieminska, Daria; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Ziolkowski, Michael; Zitoun, Robert; Živković, Lidija; Zmouchko, Viatcheslav; Zobernig, Georg; Zoccoli, Antonio; Zolnierowski, Yves; Zsenei, Andras; zur Nedden, Martin; Zutshi, Vishnu; Zwalinski, Lukasz

    2013-07-16

    A measurement of the production cross-section for top quark pairs ($t\\bar{t}$) in pp collisions at $\\sqrt{s}$ = 7 TeV is presented using data recorded with the ATLAS detector at the Large Hadron Collider. Events are selected in the single lepton topology by requiring an electron or muon, large missing transverse momentum and at least three jets. With a data sample of 35 ipb, two different multivariate methods, one of which uses b-quark jet identification while the other does not, use kinematic variables to obtain cross-section measurements of $\\sigma _{t\\bar{t}} = 187 \\pm 11 (stat.)^{+18}_{-17}(syst.) \\pm 6$ (lumi.) pb and $\\sigma_{t\\bar{t}} = 173 \\pm 17 (stat.)^{+18}_{-16}(syst.) \\pm 6$ (lumi.) pb respectively. The two measurements are in agreement with each other and with QCD calculations. The first measurement has a better a priori sensitivity and constitutes the main result of this Letter.

  12. Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

    Science.gov (United States)

    Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

    2006-03-01

    Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

  13. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  14. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  15. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  16. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  17. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  18. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  20. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  1. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  2. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    OpenAIRE

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  3. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  4. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    Science.gov (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  6. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  7. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  8. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  9. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  10. Time-Resolved Tracking of Mutations Reveals Diverse Allele Dynamics during Escherichia coli Antimicrobial Adaptive Evolution to Single Drugs and Drug Pairs

    DEFF Research Database (Denmark)

    Hickman, Rachel A.; Munck, Christian; Sommer, Morten Otto Alexander

    2017-01-01

    + CHL and CHL + CIP). We find that lineages evolved to antibiotic combinations exhibit different resistance allele dynamics compared with those of single-drug evolved lineages, especially for a drug pair with reciprocal collateral sensitivity. During adaptation, we observed interfering, superimposing...

  11. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  12. Variations in screening outcome among pairs of screening radiologists at non-blinded double reading of screening mammograms: a population-based study

    NARCIS (Netherlands)

    Klompenhouwer, E. G.; Duijm, L. E. M.; Voogd, A. C.; den Heeten, G. J.; Nederend, J.; Jansen, F. H.; Broeders, M. J. M.

    2014-01-01

    Substantial inter-observer variability in screening mammography interpretation has been reported at single reading. However, screening results of pairs of screening radiologists have not yet been published. We determined variations in screening performances among pairs of screening radiologists at

  13. Diamond-based single-photon emitters

    International Nuclear Information System (INIS)

    Aharonovich, I; Castelletto, S; Simpson, D A; Su, C-H; Greentree, A D; Prawer, S

    2011-01-01

    The exploitation of emerging quantum technologies requires efficient fabrication of key building blocks. Sources of single photons are extremely important across many applications as they can serve as vectors for quantum information-thereby allowing long-range (perhaps even global-scale) quantum states to be made and manipulated for tasks such as quantum communication or distributed quantum computation. At the single-emitter level, quantum sources also afford new possibilities in terms of nanoscopy and bio-marking. Color centers in diamond are prominent candidates to generate and manipulate quantum states of light, as they are a photostable solid-state source of single photons at room temperature. In this review, we discuss the state of the art of diamond-based single-photon emitters and highlight their fabrication methodologies. We present the experimental techniques used to characterize the quantum emitters and discuss their photophysical properties. We outline a number of applications including quantum key distribution, bio-marking and sub-diffraction imaging, where diamond-based single emitters are playing a crucial role. We conclude with a discussion of the main challenges and perspectives for employing diamond emitters in quantum information processing.

  14. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  15. Single-photon sources based on single molecules in solids

    International Nuclear Information System (INIS)

    Moerner, W E

    2004-01-01

    Single molecules in suitable host crystals have been demonstrated to be useful single-photon emitters both at liquid-helium temperatures and at room temperature. The low-temperature source achieved controllable emission of single photons from a single terrylene molecule in p-terphenyl by an adiabatic rapid passage technique. In contrast with almost all other single-molecule systems, terrylene single molecules show extremely high photostability under continuous, high-intensity irradiation. A room-temperature source utilizing this material has been demonstrated, in which fast pumping into vibrational sidebands of the electronically excited state achieved efficient inversion of the emissive level. This source yielded a single-photon emission probability p(1) of 0.86 at a detected count rate near 300 000 photons s -1 , with very small probability of emission of more than one photon. Thus, single molecules in solids can be considered as contenders for applications of single-photon sources such as quantum key distribution

  16. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  19. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  20. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  1. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  2. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  3. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  4. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  5. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  6. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  7. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  8. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  9. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  10. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  11. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  12. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  13. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  14. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  15. Single, but not multiple pairings of sucrose and corticosterone enhance memory for sucrose drinking and amplify remote reward relativity effects

    NARCIS (Netherlands)

    Pecoraro, Norman; Gomez, Francisca; La Fleur, Susanne; Roy, Monica; Dallman, Mary F.

    2005-01-01

    This study tested whether pre-training pairings of ingestion of a 32% sucrose solution and injection(s) of corticosterone (B) would enhance later ingestion in the absence of B, and whether these effects would carry over into later contrast-like effects when animals were subsequently shifted to 4%

  16. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    Science.gov (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  18. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  19. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  1. ‘N-of-1-pathways’ unveils personal deregulated mechanisms from a single pair of RNA-Seq samples: towards precision medicine

    Science.gov (United States)

    Gardeux, Vincent; Achour, Ikbel; Li, Jianrong; Maienschein-Cline, Mark; Li, Haiquan; Pesce, Lorenzo; Parinandi, Gurunadh; Bahroos, Neil; Winn, Robert; Foster, Ian; Garcia, Joe G N; Lussier, Yves A

    2014-01-01

    Background The emergence of precision medicine allowed the incorporation of individual molecular data into patient care. Indeed, DNA sequencing predicts somatic mutations in individual patients. However, these genetic features overlook dynamic epigenetic and phenotypic response to therapy. Meanwhile, accurate personal transcriptome interpretation remains an unmet challenge. Further, N-of-1 (single-subject) efficacy trials are increasingly pursued, but are underpowered for molecular marker discovery. Method ‘N-of-1-pathways’ is a global framework relying on three principles: (i) the statistical universe is a single patient; (ii) significance is derived from geneset/biomodules powered by paired samples from the same patient; and (iii) similarity between genesets/biomodules assesses commonality and differences, within-study and cross-studies. Thus, patient gene-level profiles are transformed into deregulated pathways. From RNA-Seq of 55 lung adenocarcinoma patients, N-of-1-pathways predicts the deregulated pathways of each patient. Results Cross-patient N-of-1-pathways obtains comparable results with conventional genesets enrichment analysis (GSEA) and differentially expressed gene (DEG) enrichment, validated in three external evaluations. Moreover, heatmap and star plots highlight both individual and shared mechanisms ranging from molecular to organ-systems levels (eg, DNA repair, signaling, immune response). Patients were ranked based on the similarity of their deregulated mechanisms to those of an independent gold standard, generating unsupervised clusters of diametric extreme survival phenotypes (p=0.03). Conclusions The N-of-1-pathways framework provides a robust statistical and relevant biological interpretation of individual disease-free survival that is often overlooked in conventional cross-patient studies. It enables mechanism-level classifiers with smaller cohorts as well as N-of-1 studies. Software http://lussierlab.org/publications/N-of-1-pathways

  2. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  3. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja

    2006-01-01

    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  4. Comparative analysis of main bio-active components in the herb pair Danshen-Honghua and its single herbs by ultra-high performance liquid chromatography coupled to triple quadrupole tandem mass spectrometry.

    Science.gov (United States)

    Qu, Cheng; Pu, Zong-Jin; Zhou, Gui-Sheng; Wang, Jun; Zhu, Zhen-Hua; Yue, Shi-Jun; Li, Jian-Ping; Shang, Li-Li; Tang, Yu-Ping; Shi, Xu-Qin; Liu, Pei; Guo, Jian-Ming; Sun, Jing; Tang, Zhi-Shu; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-09-01

    A sensitive, reliable, and powerful ultra-high performance liquid chromatography coupled to triple quadrupole tandem mass spectrometry method was developed for simultaneous quantification of the 15 main bio-active components including phenolic acids and flavonoids within 13 min for the first time. The proposed method was first reported and validated by good linearity (r 2  > 0.9975), limit of detection (1.12-7.01 ng/mL), limit of quantification (3.73-23.37 ng/mL), intra- and inter-day precisions (RSD ≤ 1.92%, RSD ≤ 2.45%), stability (RSD ≤ 5.63%), repeatability (RSD ≤ 4.34%), recovery (96.84-102.12%), and matrix effects (0.92-1.02). The established analytical methodology was successfully applied to comparative analysis of main bio-active components in the herb pair Danshen-Honghua and its single herbs. Compared to the single herb, the content of most flavonoid glycosides was remarkably increased in their herb pair, and main phenolic acids were decreased, conversely. The content changes of the main components in the herb pair supported the synergistic effects on promoting blood circulation and removing blood stasis. The results provide a scientific basis and reference for the quality control of Danshen-Honghua herb pair and the drug interactions based on variation of bio-active components in herb pairs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  6. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  7. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  8. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  9. Safety and Tolerability of Theta Burst Stimulation versus Single and Paired Pulse Transcranial Magnetic Stimulation: A Comparative Study of 165 Pediatric Subjects

    Directory of Open Access Journals (Sweden)

    Yaejee H Hong

    2015-02-01

    Full Text Available Background: Although single- and paired-pulse (sp/pp transcranial magnetic stimulation (TMS studies are considered minimal risk in adults and children, the safety profile for theta-burst TMS (TBS is unknown.Objective: In this comparative analysis, we explored the rate, severity, and specific symptoms of TMS-related adverse effects (AEs between sp/ppTMS and TBS in subjects between ages 6 and 18 years.Method: Data from 165 participants from 2009-2014 were analyzed. Assessment of AEs was performed based on baseline and post-TMS administration of a symptom-based questionnaire that rated AEs on a 5-level ordinal scale (minimal, mild, moderate, marked, severe. AE rates and severity were compared using Chi Square or Fisher’s Exact Test depending on data characteristics.Result: Overall, no seizures or severe-rated AEs were reported by 165 pediatric participants. The rate of AE in all TBS sessions was 10.5% (n=76, 95% CI: 4.7 - 19.7%, whereas the rate of AE in all sp/ppTMS sessions was 12.4% (n=89, 95% CI: 6.3 - 21.0%. There was no statistical difference in AE rates between TBS and sp/ppTMS (p=0.71. In all sp/ppTMS and TBS sessions, 20 subjects reported a total of 35 AEs, among these 31 (~88.6% were rated as minimal or mild. There was no difference in the severity of AE between TBS and sp/ppTMS (p=1.0. Only one of 76 TBS participants reported an AE rated as more than minimal/mild.Conclusion: Our comparative analysis showed that TBS appears to be as safe as sp/ppTMS in terms of AE rate and severity. This report supports further investigation of TBS in children.

  10. Precision measurements of the top quark pair production cross section in the single lepton channel with the ATLAS experiment

    International Nuclear Information System (INIS)

    Heinrichs, Anna Christine

    2012-01-01

    Two precision measurements of the top quark pair production cross section in the lepton+jets channel are accomplished using data taken by the ATLAS experiment at the Large Hadron Collider at CERN. The data corresponds to proton-proton collisions taken in 2010 and 2011 at a center-of-mass energy of 7 TeV. The measurement using data from 2010 achieves an overall uncertainty of 12%, while the measurement using 2011 data reaches a precision of 6.6%. Both measurements are in good agreement with theoretical predictions in the framework of the Standard Model of particle physics.

  11. Blinking fluorescence of single donor-acceptor pairs: important role of "dark'' states in resonance energy transfer via singlet levels.

    Science.gov (United States)

    Osad'ko, I S; Shchukina, A L

    2012-06-01

    The influence of triplet levels on Förster resonance energy transfer via singlet levels in donor-acceptor (D-A) pairs is studied. Four types of D-A pair are considered: (i) two-level donor and two-level acceptor, (ii) three-level donor and two-level acceptor, (iii) two-level donor and three-level acceptor, and (iv) three-level donor and three-level acceptor. If singlet-triplet transitions in a three-level acceptor molecule are ineffective, the energy transfer efficiency E=I_{A}/(I_{A}+I_{D}), where I_{D} and I_{A} are the average intensities of donor and acceptor fluorescence, can be described by the simple theoretical equation E(F)=FT_{D}/(1+FT_{D}). Here F is the rate of energy transfer, and T_{D} is the donor fluorescence lifetime. In accordance with the last equation, 100% of the donor electronic energy can be transferred to an acceptor molecule at FT_{D}≫1. However, if singlet-triplet transitions in a three-level acceptor molecule are effective, the energy transfer efficiency is described by another theoretical equation, E(F)=F[over ¯](F)T_{D}/[1+F[over ¯](F)T_{D}]. Here F[over ¯](F) is a function of F depending on singlet-triplet transitions in both donor and acceptor molecules. Expressions for the functions F[over ¯](F) are derived. In this case the energy transfer efficiency will be far from 100% even at FT_{D}≫1. The character of the intensity fluctuations of donor and acceptor fluorescence indicates which of the two equations for E(F) should be used to find the value of the rate F. Therefore, random time instants of photon emission in both donor and acceptor fluorescence are calculated by the Monte Carlo method for all four types of D-A pair. Theoretical expressions for start-stop correlators (waiting time distributions) in donor and acceptor fluorescence are derived. The probabilities w_{N}^{D}(t) and w_{N}^{A}(t) of finding N photons of donor and acceptor fluorescence in the time interval t are calculated for various values of the energy

  12. Single cell FRET analysis for the identification of optimal FRET-pairs in Bacillus subtilis using a prototype MEM-FLIM system.

    Directory of Open Access Journals (Sweden)

    Ruud G J Detert Oude Weme

    Full Text Available Protein-protein interactions can be studied in vitro, e.g. with bacterial or yeast two-hybrid systems or surface plasmon resonance. In contrast to in vitro techniques, in vivo studies of protein-protein interactions allow examination of spatial and temporal behavior of such interactions in their native environment. One approach to study protein-protein interactions in vivo is via Förster Resonance Energy Transfer (FRET. Here, FRET efficiency of selected FRET-pairs was studied at the single cell level using sensitized emission and Frequency Domain-Fluorescence Lifetime Imaging Microscopy (FD-FLIM. For FRET-FLIM, a prototype Modulated Electron-Multiplied FLIM system was used, which is, to the best of our knowledge, the first account of Frequency Domain FLIM to analyze FRET in single bacterial cells. To perform FRET-FLIM, we first determined and benchmarked the best fluorescent protein-pair for FRET in Bacillus subtilis using a novel BglBrick-compatible integration vector. We show that GFP-tagRFP is an excellent donor-acceptor pair for B. subtilis in vivo FRET studies. As a proof of concept, selected donor and acceptor fluorescent proteins were fused using a linker that contained a tobacco etch virus (TEV-protease recognition sequence. Induction of TEV-protease results in loss of FRET efficiency and increase in fluorescence lifetime. The loss of FRET efficiency after TEV induction can be followed in time in single cells via time-lapse microscopy. This work will facilitate future studies of in vivo dynamics of protein complexes in single B. subtilis cells.

  13. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    Science.gov (United States)

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  14. Search for direct top squark pair production in the single lepton final state at $\\sqrt{s}=13~\\mathrm{TeV}$

    CERN Document Server

    CMS Collaboration

    2016-01-01

    A search for direct top squark pair production in pp collisions at $\\sqrt{s}=13~\\mathrm{TeV}$ is presented. The data correspond to an integrated luminosity of $2.3~\\mathrm{fb}^{-1}$ collected with the CMS detector during Run 2 of the LHC. The search is performed using events with a single isolated charged lepton (electron or muon), jets, and large imbalance in the measured transverse momentum. No significant excess in data is observed above the expectation from standard model processes. Exclusion limits are set in the context of supersymmetric models with pair production of top squarks that decay either to a top quark and a neutralino or to a bottom quark and a chargino. A scenario with nearly mass-degenerate chargino and neutralino is also considered for different values of the branching ratio of the top squark to a bottom quark and chargino.

  15. Search for direct top squark pair production in the single lepton final state at $\\sqrt{s}=13~\\mathrm{TeV}$

    CERN Document Server

    CMS Collaboration

    2016-01-01

    A search for direct top squark pair production in pp collisions at $\\sqrt{s}=13~\\mathrm{TeV}$ is performed using events with a single isolated lepton, jets, and large transverse momentum imbalance. This analysis closely follows the strategy of a similar search for the same signature in 2015, using data collected in 2016 at a center-of-mass energy of 13 TeV with the CMS detector and corresponding to an integrated luminosity of $12.9~\\mathrm{fb}^{-1}$. No significant excess in data is observed above the expectation from standard model processes. Exclusion limits are set in the context of supersymmetric models with pair production of top squarks that decay either to a top quark and a neutralino or to a bottom quark and a chargino.

  16. Search for top-squark pair production in the single-lepton final state in pp collisions at $\\sqrt{s}$ = 8 TeV

    CERN Document Server

    Chatrchyan, Serguei; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Krätschmer, Ilse; Liko, Dietrich; Mikulec, Ivan; Rabady, Dinyar; Rahbaran, Babak; Rohringer, Christine; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Treberer-Treberspurg, Wolfgang; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; Bansal, Monika; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Knutsson, Albert; Luyckx, Sten; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Kalogeropoulos, Alexis; Keaveney, James; Lowette, Steven; Maes, Michael; Olbrechts, Annik; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Caillol, Cécile; Clerbaux, Barbara; De Lentdecker, Gilles; Favart, Laurent; Gay, Arnaud; Hreus, Tomas; Léonard, Alexandre; Marage, Pierre Edouard; Mohammadi, Abdollah; Perniè, Luca; Reis, Thomas; Seva, Tomislav; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Adler, Volker; Beernaert, Kelly; Benucci, Leonardo; Cimmino, Anna; Costantini, Silvia; Dildick, Sven; Garcia, Guillaume; Klein, Benjamin; Lellouch, Jérémie; Marinov, Andrey; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Ryckbosch, Dirk; Sigamani, Michael; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Walsh, Sinead; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Beluffi, Camille; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Da Silveira, Gustavo Gil; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Jez, Pavel; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Nuttens, Claude; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Popov, Andrey; Selvaggi, Michele; Vidal Marono, Miguel; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Alves, Gilvan; Correa Martins Junior, Marcos; Martins, Thiago; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Aldá Júnior, Walter Luiz; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Malbouisson, Helena; Malek, Magdalena; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Bernardes, Cesar Augusto; De Almeida Dias, Flavia; Tomei, Thiago; De Moraes Gregores, Eduardo; Lagana, Caio; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Xianyou; Wang, Zheng; Asawatangtrakuldee, Chayanit; Ban, Yong; Guo, Yifei; Li, Wenbo; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Wang, Dayong; Zhang, Linlin; Zou, Wei; Avila, Carlos; Carrillo Montoya, Camilo Andres; Chaparro Sierra, Luisa Fernanda; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Kadija, Kreso; Luetic, Jelena; Mekterovic, Darko; Morovic, Srecko; Tikvica, Lucija; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Finger, Miroslav; Finger Jr, Michael; Abdelalim, Ahmed Ali; Assran, Yasser; Elgammal, Sherif; Ellithi Kamel, Ali; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Müntel, Mait; Murumaa, Marion; Raidal, Martti; Rebane, Liis; Tiko, Andres; Eerola, Paula; Fedi, Giacomo; Voutilainen, Mikko; Härkönen, Jaakko; Karimäki, Veikko; Kinnunen, Ritva; Kortelainen, Matti J; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Millischer, Laurent; Nayak, Aruna; Rander, John; Rosowsky, André; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Benhabib, Lamia; Bluj, Michal; Busson, Philippe; Charlot, Claude; Daci, Nadir; Dahms, Torsten; Dalchenko, Mykhailo; Dobrzynski, Ludwik; Florent, Alice; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Naranjo, Ivo Nicolas; Nguyen, Matthew; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Veelken, Christian; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Goetzmann, Christophe; Juillot, Pierre; Le Bihan, Anne-Catherine; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Beaupere, Nicolas; Boudoul, Gaelle; Brochet, Sébastien; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fan, Jiawei; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sgandurra, Louis; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Xiao, Hong; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Bontenackels, Michael; Calpas, Betty; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Klein, Katja; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Caudron, Julien; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Knutzen, Simon; Kreuzer, Peter; Merschmeyer, Markus; Meyer, Arnd; Olschewski, Mark; Padeken, Klaas; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Thüer, Sebastian; Weber, Martin; Cherepanov, Vladimir; Erdogan, Yusuf; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Lingemann, Joschka; Nowack, Andreas; Nugent, Ian Michael; Perchalla, Lars; Pooth, Oliver; Stahl, Achim; Asin, Ivan; Bartosik, Nazar; Behr, Joerg; Behrenhoff, Wolf; Behrens, Ulf; Bell, Alan James; Bergholz, Matthias; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Choudhury, Somnath; Costanza, Francesco; Diez Pardos, Carmen; Dooling, Samantha; Dorland, Tyler; Eckerlin, Guenter; Eckstein, Doris; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Grebenyuk, Anastasia; Gunnellini, Paolo; Habib, Shiraz; Hauk, Johannes; Hellwig, Gregor; Horton, Dean; Jung, Hannes; Kasemann, Matthias; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Krämer, Mira; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Leonard, Jessica; Lipka, Katerina; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Novgorodova, Olga; Nowak, Friederike; Olzem, Jan; Perrey, Hanno; Petrukhin, Alexey; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Riedl, Caroline; Ron, Elias; Sahin, Mehmet Özgür; Salfeld-Nebgen, Jakob; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Walsh, Roberval; Wissing, Christoph; Aldaya Martin, Maria; Blobel, Volker; Enderle, Holger; Erfle, Joachim; Garutti, Erika; Gebbert, Ulla; Görner, Martin; Gosselink, Martijn; Haller, Johannes; Heine, Kristin; Höing, Rebekka Sophie; Kaussen, Gordon; Kirschenmann, Henning; Klanner, Robert; Kogler, Roman; Lange, Jörn; Marchesini, Ivan; Peiffer, Thomas; Pietsch, Niklas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Schröder, Matthias; Schum, Torben; Seidel, Markus; Sibille, Jennifer; Sola, Valentina; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Barth, Christian; Baus, Colin; Berger, Joram; Böser, Christian; Butz, Erik; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Guthoff, Moritz; Hartmann, Frank; Hauth, Thomas; Held, Hauke; Hoffmann, Karl-Heinz; Husemann, Ulrich; Katkov, Igor; Komaragiri, Jyothsna Rani; Kornmayer, Andreas; Lobelle Pardo, Patricia; Martschei, Daniel; Mozer, Matthias Ulrich; Müller, Thomas; Niegel, Martin; Nürnberg, Andreas; Oberst, Oliver; Ott, Jochen; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Röcker, Steffen; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Zeise, Manuel; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Markou, Athanasios; Markou, Christos; Ntomari, Eleni; Topsis-giotis, Iasonas; Gouskos, Loukas; Panagiotou, Apostolos; Saoulidou, Niki; Stiliaris, Efstathios; Aslanoglou, Xenofon; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Karancsi, János; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Swain, Sanjay Kumar; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Kaur, Manjit; Mehta, Manuk Zubin; Mittal, Monika; Nishu, Nishu; Sharma, Archana; Singh, Jasbir; Kumar, Ashok; Kumar, Arun; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Saxena, Pooja; Sharma, Varun; Shivpuri, Ram Krishen; Banerjee, Sunanda; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Modak, Atanu; Mukherjee, Swagata; Roy, Debarati; Sarkar, Subir; Sharan, Manoj; Singh, Anil; Abdulsalam, Abdulla; Dutta, Dipanwita; Kailas, Swaminathan; Kumar, Vineet; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Chatterjee, Rajdeep Mohan; Ganguly, Sanmay; Ghosh, Saranya; Guchait, Monoranjan; Gurtu, Atul; Kole, Gouranga; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Jafari, Abideh; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Grunewald, Martin; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pompili, Alexis; Pugliese, Gabriella; Selvaggi, Giovanna; Silvestris, Lucia; Singh, Gurpreet; Venditti, Rosamaria; Verwilligen, Piet; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Gonzi, Sandro; Gori, Valentina; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Ferretti, Roberta; Ferro, Fabrizio; Lo Vetere, Maurizio; Musenich, Riccardo; Robutti, Enrico; Tosi, Silvano; Benaglia, Andrea; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Lucchini, Marco Toliman; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; De Cosa, Annapaola; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Dorigo, Tommaso; Galanti, Mario; Gasparini, Fabrizio; Gasparini, Ugo; Giubilato, Piero; Gozzelino, Andrea; Kanishchev, Konstantin; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Michelotto, Michele; Montecassiano, Fabio; Passaseo, Marina; Pazzini, Jacopo; Pegoraro, Matteo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Zotto, Pierluigi; Zucchetta, Alberto; Zumerle, Gianni; Gabusi, Michele; Ratti, Sergio P; Riccardi, Cristina; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Fanò, Livio; Lariccia, Paolo; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Romeo, Francesco; Saha, Anirban; Santocchia, Attilio; Spiezia, Aniello; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; Ciocci, Maria Agnese; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Grippo, Maria Teresa; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Moon, Chang-Seong; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Vernieri, Caterina; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Diemoz, Marcella; Grassi, Marco; Longo, Egidio; Margaroli, Fabrizio; Meridiani, Paolo; Micheli, Francesco; Nourbakhsh, Shervin; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Soffi, Livia; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Casasso, Stefano; Costa, Marco; Degano, Alessandro; Demaria, Natale; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Tamponi, Umberto; Belforte, Stefano; Candelise, Vieri; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; La Licata, Chiara; Marone, Matteo; Montanino, Damiana; Penzo, Aldo; Schizzi, Andrea; Zanetti, Anna; Chang, Sunghyun; Kim, Tae Yeon; Nam, Soon-Kwon; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Lee, Sangeun; Oh, Young Do; Park, Hyangkyu; Son, Dong-Chul; Kim, Jae Yool; Kim, Zero Jaeho; Song, Sanghyeon; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Tae Jeong; Lee, Kyong Sei; Park, Sung Keun; Roh, Youn; Choi, Minkyoo; Kim, Ji Hyun; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Min Suk; Kwon, Eunhyang; Lee, Byounghoon; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Grigelionis, Ignas; Juodagalvis, Andrius; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Lopez-Fernandez, Ricardo; Martínez-Ortega, Jorge; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A; Krofcheck, David; Butler, Philip H; Doesburg, Robert; Reucroft, Steve; Silverwood, Hamish; Ahmad, Muhammad; Asghar, Muhammad Irfan; Butt, Jamila; Hoorani, Hafeez R; Khalid, Shoaib; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Shah, Mehar Ali; Shoaib, Muhammad; Bialkowska, Helena; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Wolszczak, Weronika; Almeida, Nuno; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Nguyen, Federico; Rodrigues Antunes, Joao; Seixas, Joao; Varela, Joao; Vischia, Pietro; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Konoplyanikov, Viktor; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Skatchkov, Nikolai; Smirnov, Vitaly; Zarubin, Anatoli; Evstyukhin, Sergey; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Safronov, Grigory; Semenov, Sergey; Spiridonov, Alexander; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Belyaev, Andrey; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Snigirev, Alexander; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Ekmedzic, Marko; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Merino, Gonzalo; Navarro De Martino, Eduardo; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Senghi Soares, Mara; Willmott, Carlos; Albajar, Carmen; de Trocóniz, Jorge F; Brun, Hugues; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Piedra Gomez, Jonatan; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Graziano, Alberto; Jorda, Clara; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Bachtis, Michail; Baillon, Paul; Ball, Austin; Barney, David; Bendavid, Joshua; Benitez, Jose F; Bernet, Colin; Bianchi, Giovanni; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Bondu, Olivier; Botta, Cristina; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Colafranceschi, Stefano; D'Alfonso, Mariarosaria; D'Enterria, David; Dabrowski, Anne; David Tinoco Mendes, Andre; De Guio, Federico; De Roeck, Albert; De Visscher, Simon; Di Guida, Salvatore; Dobson, Marc; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Eugster, Jürg; Franzoni, Giovanni; Funk, Wolfgang; Georgiou, Georgios; Giffels, Manuel; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Girone, Maria; Giunta, Marina; Glege, Frank; Gomez-Reino Garrido, Robert; Gowdy, Stephen; Guida, Roberto; Hammer, Josef; Hansen, Magnus; Harris, Philip; Hartl, Christian; Hinzmann, Andreas; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Kousouris, Konstantinos; Krajczar, Krisztian; Lecoq, Paul; Lee, Yen-Jie; Lourenco, Carlos; Magini, Nicolo; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mulders, Martijn; Musella, Pasquale; Nesvold, Erik; Orsini, Luciano; Palencia Cortezon, Enrique; Perez, Emmanuelle; Perrozzi, Luca; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Piparo, Danilo; Plagge, Michael; Quertenmont, Loic; Racz, Attila; Reece, William; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Santanastasio, Francesco; Schäfer, Christoph; Schwick, Christoph; Sekmen, Sezen; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Stieger, Benjamin; Stoye, Markus; Tsirou, Andromachi; Veres, Gabor Istvan; Vlimant, Jean-Roch; Wöhri, Hermine Katharina; Worm, Steven; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Renker, Dieter; Rohe, Tilman; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Bortignon, Pierluigi; Buchmann, Marco-Andrea; Casal, Bruno; Chanon, Nicolas; Deisher, Amanda; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Dünser, Marc; Eller, Philipp; Freudenreich, Klaus; Grab, Christoph; Hits, Dmitry; Lecomte, Pierre; Lustermann, Werner; Mangano, Boris; Marini, Andrea Carlo; Martinez Ruiz del Arbol, Pablo; Meister, Daniel; Mohr, Niklas; Moortgat, Filip; Nägeli, Christoph; Nef, Pascal; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pape, Luc; Pauss, Felicitas; Peruzzi, Marco; Quittnat, Milena; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Sanchez, Ann - Karin; Starodumov, Andrei; Takahashi, Maiko; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Hannsjoerg Artur; Amsler, Claude; Chiochia, Vincenzo; Favaro, Carlotta; Ivova Rikova, Mirena; Kilminster, Benjamin; Millan Mejias, Barbara; Robmann, Peter; Snoek, Hella; Taroni, Silvia; Verzetti, Mauro; Yang, Yong; Cardaci, Marco; Chen, Kuan-Hsin; Ferro, Cristina; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Lu, Yun-Ju; Volpe, Roberta; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Majumder, Devdatta; Petrakou, Eleni; Shi, Xin; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Asavapibhop, Burin; Suwonjandee, Narumon; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilin, Bugra; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Karapinar, Guler; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Bahtiyar, Hüseyin; Barlas, Esra; Cankocak, Kerem; Günaydin, Yusuf Oguzhan; Vardarli, Fuat Ilkehan; Yücel, Mete; Levchuk, Leonid; Sorokin, Pavel; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Kreczko, Lukasz; Lucas, Chris; Meng, Zhaoxia; Metson, Simon; Newbold, Dave M; Nirunpong, Kachanon; Paramesvaran, Sudarshan; Poll, Anthony; Senkin, Sergey; Smith, Vincent J; Williams, Thomas; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Ilic, Jelena; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R; Womersley, William John; Bainbridge, Robert; Buchmuller, Oliver; Burton, Darren; Colling, David; Cripps, Nicholas; Cutajar, Michael; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Ferguson, William; Fulcher, Jonathan; Futyan, David; Gilbert, Andrew; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Kenzie, Matthew; Lane, Rebecca; Lucas, Robyn; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Mathias, Bryn; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardle, Nicholas; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Martin, William; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Dittmann, Jay; Hatakeyama, Kenichi; Kasmi, Azeddine; Liu, Hongxuan; Scarborough, Tara; Charaf, Otman; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Heister, Arno; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; St John, Jason; Sulak, Lawrence; Alimena, Juliette; Bhattacharya, Saptaparna; Christopher, Grant; Cutts, David; Demiragli, Zeynep; Ferapontov, Alexey; Garabedian, Alex; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Laird, Edward; Landsberg, Greg; Luk, Michael; Narain, Meenakshi; Segala, Michael; Sinthuprasith, Tutanon; Speer, Thomas; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Gardner, Michael; Houtz, Rachel; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Miceli, Tia; Pellett, Dave; Pilot, Justin; Ricci-Tam, Francesca; Rutherford, Britney; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Wilbur, Scott; Yohay, Rachel; Andreev, Valeri; Cline, David; Cousins, Robert; Erhan, Samim; Everaerts, Pieter; Farrell, Chris; Felcini, Marta; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Takasugi, Eric; Traczyk, Piotr; Valuev, Vyacheslav; Weber, Matthias; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Liu, Hongliang; Long, Owen Rosser; Luthra, Arun; Malberti, Martina; Nguyen, Harold; Shrinivas, Amithabh; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Evans, David; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Macneill, Ian; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Sudano, Elizabeth; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Wasserbaech, Steven; Würthwein, Frank; Yagil, Avraham; Yoo, Jaehyeok; Barge, Derek; Campagnari, Claudio; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; George, Christopher; Golf, Frank; Incandela, Joe; Justus, Christopher; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Magaña Villalba, Ricardo; Mccoll, Nickolas; Pavlunin, Viktor; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; West, Christopher; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Di Marco, Emanuele; Duarte, Javier; Kcira, Dorian; Ma, Yousi; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Rogan, Christopher; Spiropulu, Maria; Timciuc, Vladlen; Veverka, Jan; Wilkinson, Richard; Xie, Si; Zhu, Ren-Yuan; Azzolini, Virginia; Calamba, Aristotle; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Drell, Brian Robert; Ford, William T; Gaz, Alessandro; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Eggert, Nicholas; Gibbons, Lawrence Kent; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Tucker, Jordan; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Gutsche, Oliver; Hare, Daryl; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Kaadze, Ketino; Klima, Boaz; Kunori, Shuichi; Kwan, Simon; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Martinez Outschoorn, Verena Ingrid; Maruyama, Sho; Mason, David; McBride, Patricia; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Ratnikova, Natalia; Sexton-Kennedy, Elizabeth; Sharma, Seema; Spalding, William J; Spiegel, Leonard; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Cheng, Tongguang; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Hugon, Justin; Kim, Bockjoo; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Remington, Ronald; Rinkevicius, Aurelijus; Skhirtladze, Nikoloz; Snowball, Matthew; Yelton, John; Zakaria, Mohammed; Gaultney, Vanessa; Hewamanage, Samantha; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Dorney, Brian; Hohlmann, Marcus; Kalakhety, Himali; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Bucinskaite, Inga; Callner, Jeremy; Cavanaugh, Richard; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Kurt, Pelin; Lacroix, Florent; Moon, Dong Ho; O'Brien, Christine; Silkworth, Christopher; Strom, Derek; Turner, Paul; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Duru, Firdevs; Griffiths, Scott; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Tan, Ping; Tiras, Emrah; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Giurgiu, Gavril; Gritsan, Andrei; Hu, Guofan; Maksimovic, Petar; Martin, Christopher; Swartz, Morris; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Kenny III, Raymond Patrick; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Stringer, Robert; Wood, Jeffrey Scott; Barfuss, Anne-Fleur; Chakaberia, Irakli; Ivanov, Andrew; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Saini, Lovedeep Kaur; Shrestha, Shruti; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Rebassoo, Finn; Wright, Douglas; Baden, Drew; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G; Kolberg, Ted; Lu, Ying; Marionneau, Matthieu; Mignerey, Alice; Pedro, Kevin; Peterman, Alison; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C; Apyan, Aram; Bauer, Gerry; Busza, Wit; Cali, Ivan Amos; Chan, Matthew; Di Matteo, Leonardo; Dutta, Valentina; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Gulhan, Doga; Kim, Yongsun; Klute, Markus; Lai, Yue Shi; Levin, Andrew; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Stephans, George; Stöckli, Fabian; Sumorok, Konstanty; Velicanu, Dragos; Wolf, Roger; Wyslouch, Bolek; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Zhukova, Victoria; Dahmes, Bryan; De Benedetti, Abraham; Gude, Alexander; Haupt, Jason; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Pastika, Nathaniel; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Cremaldi, Lucien Marcus; Kroeger, Rob; Oliveros, Sandra; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Claes, Daniel R; Dominguez, Aaron; Eads, Michael; Gonzalez Suarez, Rebeca; Keller, Jason; Kravchenko, Ilya; Lazo-Flores, Jose; Malik, Sudhir; Meier, Frank; Snow, Gregory R; Dolen, James; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Rappoccio, Salvatore; Wan, Zongru; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Haley, Joseph; Massironi, Andrea; Nash, David; Orimoto, Toyoko; Trocino, Daniele; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Hahn, Kristan Allan; Kubik, Andrew; Lusito, Letizia; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Sung, Kevin; Velasco, Mayda; Won, Steven; Berry, Douglas; Brinkerhoff, Andrew; Chan, Kwok Ming; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Planer, Michael; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Puigh, Darren; Rodenburg, Marissa; Smith, Geoffrey; Vuosalo, Carl; Winer, Brian L; Wolfe, Homer; Berry, Edmund; Elmer, Peter; Halyo, Valerie; Hebda, Philip; Hegeman, Jeroen; Hunt, Adam; Jindal, Pratima; Koay, Sue Ann; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Raval, Amita; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zenz, Seth Conrad; Zuranski, Andrzej; Brownson, Eric; Lopez, Angel; Mendez, Hector; Ramirez Vargas, Juan Eduardo; Alagoz, Enver; Benedetti, Daniele; Bolla, Gino; Bortoletto, Daniela; De Mattia, Marco; Everett, Adam; Hu, Zhen; Jones, Matthew; Jung, Kurt; Koybasi, Ozhan; Kress, Matthew; Leonardo, Nuno; Lopes Pegna, David; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Wang, Fuqiang; Xie, Wei; Xu, Lingshan; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Parashar, Neeti; Adair, Antony; Akgun, Bora; Ecklund, Karl Matthew; Geurts, Frank JM; Li, Wei; Michlin, Benjamin; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Ferbel, Thomas; Garcia-Bellido, Aran; Goldenzweig, Pablo; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Malik, Sarah; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Patel, Rishi; Rekovic, Vladimir; Robles, Jorge; Salur, Sevil; Schnetzer, Steve; Seitz, Claudia; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Cerizza, Giordano; Hollingsworth, Matthew; Rose, Keith; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Bouhali, Othmane; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Perloff, Alexx; Roe, Jeffrey; Safonov, Alexei; Sakuma, Tai; Suarez, Indara; Tatarinov, Aysen; Toback, David; Akchurin, Nural; Cowden, Christopher; Damgov, Jordan; Dragoiu, Cosmin; Dudero, Phillip Russell; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Appelt, Eric; Delannoy, Andrés G; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Maguire, Charles; Mao, Yaxian; Melo, Andrew; Sharma, Monika; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Wood, John; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sakharov, Alexandre; Belknap, Donald; Borrello, Laura; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Duric, Senka; Friis, Evan; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Perry, Thomas; Pierro, Giuseppe Antonio; Polese, Giovanni; Ross, Ian; Sarangi, Tapas; Savin, Alexander; Smith, Wesley H; Swanson, Joshua

    2013-12-21

    This paper presents a search for the pair production of top squarks in events with a single isolated electron or muon, jets, large missing transverse momentum, and large transverse mass. The data sample corresponds to an integrated luminosity of 19.5 inverse femtobarns of pp collisions collected in 2012 by the CMS experiment at the LHC at a center-of-mass energy of $\\sqrt{s}$ = 8 TeV. No significant excess in data is observed above the expectation from standard model processes. The results are interpreted in the context of supersymmetric models with pair production of top squarks that decay either to a top quark and a neutralino or to a bottom quark and a chargino. For small mass values of the lightest supersymmetric particle, top-squark mass values up to around 650 GeV are excluded.

  17. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  18. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  20. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  1. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  2. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  3. A rich solution spray as a refining method in a small capacity, single effect, solar assisted absorption machine with the pair NH3/H2O: Experimental results

    International Nuclear Information System (INIS)

    Mendes, L.F.; Collares-Pereira, M.; Ziegler, F.

    2007-01-01

    Ammonia vapour refining is a common procedure in ammonia-water absorption machines. A solar assisted single effect absorption machine that uses the pair ammonia-water was developed and tested. Its desorber has a built-in adiabatic refining column constituted by a rich solution spray. The refining method proved its feasibility. The spray provided a more or less constant ammonia vapour enrichment of about 1% which is enough for the working temperature ranges of this type of machine. It was also verified that the refining effect of the spray is almost independent of the refrigerant vapour and solution mass flow rates

  4. Graph-based surface reconstruction from stereo pairs using image segmentation

    Science.gov (United States)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  5. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  6. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  7. Conformation-related exciton localization and charge-pair formation in polythiophenes: ensemble and single-molecule study.

    Science.gov (United States)

    Sugimoto, Toshikazu; Habuchi, Satoshi; Ogino, Kenji; Vacha, Martin

    2009-09-10

    We study conformation-dependent photophysical properties of polythiophene (PT) by molecular dynamics simulations and by ensemble and single-molecule optical experiments. We use a graft copolymer consisting of a polythiophene backbone and long polystyrene branches and compare its properties with those obtained on the same polythiophene derivative without the side chains. Coarse-grain molecular dynamics simulations show that in a poor solvent, the PT without the side chains (PT-R) forms a globulelike conformation in which distances between any two conjugated segments on the chain are within the Forster radius for efficient energy transfer. In the PT with the polystyrene branches (PT-PS), the polymer main PT chain retains an extended coillike conformation, even in a poor solvent, and the calculated distances between conjugated segments favor energy transfer only between a few neighboring chromophores. The theoretical predictions are confirmed by measurements of fluorescence anisotropy and fluorescence blinking of the polymers' single chains. High anisotropy ratios and two-state blinking in PT-R are due to localization of the exciton on a single conjugated segment. These signatures of exciton localization are absent in single chains of PT-PS. Electric-field-induced quenching measured as a function of concentration of PT dispersed in an inert matrix showed that in well-isolated chains of PT-PS, the exciton dissociation is an intrachain process and that aggregation of the PT-R chains causes an increase in quenching due to the onset of interchain interactions. Measurements of the field-induced quenching on single chains indicate that in PT-R, the exciton dissociation is a slower process that takes place only after the exciton is localized on one conjugated segment.

  8. A retrospective comparative study of arthroscopic fixation in acute Rockwood type IV acromioclavicular joint dislocation: single versus double paired Endobutton technique.

    Science.gov (United States)

    Xu, Jian; Liu, Haifeng; Lu, Wei; Li, Dingfu; Zhu, Weimin; Ouyang, Kan; Wu, Bing; Peng, Liangquan; Wang, Daping

    2018-05-24

    Rockwood type IV acromioclavicular joint (ACJ) dislocation is a trauma usually needs surgical treatment. Paired EndoButton technique (PET) is used in treating such condition. However, the effect of using different types of PET (single versus double PET) for fixation remains controversial. This study aims to evaluate and compare the efficacy of single and double PET and to provide a suitable option for the surgeons. We retrospectively reviewed the charts of patients with acute Rockwood type IV ACJ dislocation who had undergone arthroscopic fixation using single or double PET fixation between March 2009 and March 2015. Seventy-eight consecutive patients identified from chart review were picked and were divided into the single and double PET group with 39 cases in each group. The indexes of visual analog scale score (VAS) for pain, the radiographs of the affected shoulder at different time points of the follow-up, the time of return to activities and sports, the constant functional score, and the Karlsson acromioclavicular joint (ACJ) score, were assessed in a minimum of 2 years postoperation. The average coracoclavicular (CC) and acromioclavicular (AC) distances of the affected joints in the double PET group were significantly smaller than those of the single PET group 2 years postoperation (P  0.05). The mean VAS pain score was not significantly different, while significant difference was found for the number and times of cases return to activities and sports, constant functional score, and Karlsson ACJ score (P < 0.05) between the two groups. Therefore, the double PET group has better outcome than the single PET group. Complications including redislocation, button slippage, erosion, or AC joint instability occurred in the single PET group, while the complication in the double PET group was rare. Compared with the single PET, the double PET group achieved better outcome with less complications in arthroscopically treating acute Rockwood type IV ACJ

  9. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

    Science.gov (United States)

    Schmitz, Gunnar; Hättig, Christof

    2016-12-21

    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  10. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory

    Science.gov (United States)

    Frank, Marius S.; Hättig, Christof

    2018-04-01

    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  11. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  12. Efficient fiber-coupled single-photon sources based on quantum dots

    DEFF Research Database (Denmark)

    Daveau, Raphaël Sura

    refrigeration with coupled quantum wells. Many photonic quantum information processing applications would benet from a highbrightness, ber-coupled source of triggered single photons. This thesis presents a study of such sources based on quantum dots coupled to unidirectional photonic-crystal waveguide devices.......6 %. This latter method opens a promising future for increasing the eciency and reliability of planar chip-based single-photon sources. Refrigeration of a solid-state system with light has potential applications for cooling small-scale electronic and photonic circuits. We show theoretically that two coupled...... semiconductor quantum wells are ecient cooling media because they support long-lived indirect electron-hole pairs. These pairs can be thermally excited to distinct higher-energy states with faster radiative recombination, thereby creating an ecient escape channel to remove thermal energy from the system. From...

  13. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-01-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  14. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  15. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    Science.gov (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  16. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  17. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  18. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  19. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  20. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    Science.gov (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  1. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Orthogonal image pairs coupled with OSMS for noncoplanar beam angle, intracranial, single-isocenter, SRS treatments with multiple targets on the Varian Edge radiosurgery system

    Directory of Open Access Journals (Sweden)

    Jasmine A. Oliver, PhD

    2017-07-01

    Conclusion: Based on our study, CR-induced shifts with the Varian Edge radiosurgery system will not produce noticeable dosimetric effects for SRS treatments. Thus, replacing cone beam CT with orthogonal kV/kV pairs coupled with OSMS at the treatment couch angle could reduce the number of cone beam CT scans that are acquired during a standard SRS treatment while providing an accurate and safe treatment with negligible dosimetric effects on the treatment plan.

  4. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    Science.gov (United States)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  5. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  6. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin

    2013-04-01

    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  7. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  8. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  9. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  10. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  11. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  12. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  13. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  14. Entangling Higgs production associated with a single top and a top-quark pair in the presence of anomalous top-Yukawa coupling

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Jung [Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Cheung, Kingman [Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Division of Quantum Phases and Devices, School of Physics, Konkuk University,Seoul 143-701 (Korea, Republic of); Department of Physics, National Tsing Hua University,Hsinchu 300, Taiwan (China); Lee, Jae Sik [Physics Division, National Center for Theoretical Sciences,Hsinchu, Taiwan (China); Department of Physics, Chonnam National University, 300 Yongbong-dong, Buk-gu, Gwangju, 500-757 (Korea, Republic of); Lu, Chih-Ting [Department of Physics, National Tsing Hua University,Hsinchu 300, Taiwan (China)

    2017-04-26

    The ATLAS and CMS collaborations observed a mild excess in the associated Higgs production with a top-quark pair (tt̄h) and reported the signal strengths of μ{sub tth}{sup ATLAS}=1.81±0.80 and μ{sub tth}{sup CMS}=2.75±0.99 based on the data collected at √s= 7 and 8 TeV. Although, at the current stage, there is no obvious indication whether the excess is real or due to statistical fluctuations, here we perform a case study of this mild excess by exploiting the strong entanglement between the associated Higgs production with a single top quark (thX) and tt̄h production in the presence of anomalous top-Yukawa coupling. As well known, tt̄h production only depends on the absolute value of the top-Yukawa coupling. Meanwhile, in thX production, this degeneracy is lifted through the strong interference between the two main contributions which are proportional to the top-Yukawa and the gauge-Higgs couplings, respectively. Especially, when the relative sign of the top-Yukawa coupling with respect to the gauge-Higgs coupling is reversed, the thX cross section can be enhanced by more than one order of magnitude. We perform a detailed study of the influence of thX production on tt̄h production in the presence of the anomalous top-Yukawa coupling and point out that it is crucial to include thX production in the analysis of the tt̄h data to pin down the sign and the size of the top-Yukawa coupling in future. While assuming the Standard Model (SM) value for the gauge-Higgs coupling, we vary the top-Yukawa coupling within the range allowed by the current LHC Higgs data. We consider the Higgs decay modes into multileptons, bb̄ and γγ putting a particular emphasis on the same sign dilepton events. We also discuss the prospects for the LHC Run-2 on how to disentangle thX production from tt̄h one and how to probe the anomalous top-Yukawa coupling.

  15. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  16. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  19. Quantum sensors based on single diamond defects

    International Nuclear Information System (INIS)

    Jelezko Fedor

    2014-01-01

    NV centers in diamond are promising sensors able to detect electric and magnetic fields at nanoscale. Here we report on the detection of biomolecules using magnetic noise induced by their electron and nuclear spins. Presented results show first steps towards establishing novel sensing technology for visualizing single proteins and study of their dynamics. (author)

  20. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  1. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  2. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  3. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  4. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  6. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  7. Percutaneous Treatment of Simple Hepatic Cysts: The Long-Term Results of PAIR and Catheterization Techniques as Single-Session Procedures

    International Nuclear Information System (INIS)

    Akhan, Okan; Islim, Filiz; Balci, Sinan; Erbahceci, Aysun; Akpınar, Burcu; Ciftci, Turkmen; Akinci, Devrim

    2016-01-01

    PurposeThe purpose of our study is to evaluate results of percutaneous aspiration with alcohol sclerotherapy in symptomatic patients with simple hepatic cysts by employing single-session techniques either by a needle or a catheter.Materials and MethodsWe retrospectively included 39 simple hepatic cysts in 35 patients treated via percutaneous aspiration and single-session alcohol sclerotherapy between years 1993 and 2012. Indications were pain (n = 28) or ruling out cystic echinococcus (CE) disease (n = 7). 29 cysts in 26 patients were treated by needle technique (Group A) and ten cysts in nine patients were treated by single-session catheter technique (Group B). Patients were followed for 4–173 months (median: 38 months).ResultsAll patients were successfully treated. Before procedure, cyst volumes were 21–676 cc (median: 94 cc). Post-procedure cyst volumes at last follow-up were 0-40 cc (median: 1 cc). The mean decrease in cyst volume was 95.92 ± 2.86 % in all patients (95.96 ± 3.26 % in Group A and 95.80 ± 6.20 % in Group B). There was no statistically significant difference between the volume reduction rates of Group A and Group B. Only one patient, in Group B, developed a major complication, an abscess. Hospitalization period was 1 day for all patients.ConclusionsFor patients with symptomatic simple hepatic cysts smaller than 500 cc in volume by using puncture, aspiration, injection, and reaspiration (PAIR) technique with only needle, single-session alcohol sclerotherapy of 10 min is a safe and effective procedure with high success rate.

  8. Percutaneous Treatment of Simple Hepatic Cysts: The Long-Term Results of PAIR and Catheterization Techniques as Single-Session Procedures

    Energy Technology Data Exchange (ETDEWEB)

    Akhan, Okan, E-mail: akhano@tr.net [Hacettepe University Faculty of Medicine, Department of Radiology (Turkey); Islim, Filiz, E-mail: fislim@yahoo.com [Istanbul Bakirkoy Dr. Sadi Konuk Training and Research Hospital, Department of Radiology (Turkey); Balci, Sinan, E-mail: snnbalci@gmail.com [Hacettepe University Faculty of Medicine, Department of Radiology (Turkey); Erbahceci, Aysun, E-mail: aysunerbahceci@yahoo.com [Istanbul Bakirkoy Dr. Sadi Konuk Training and Research Hospital, Department of Radiology (Turkey); Akpınar, Burcu, E-mail: burcu-akpinar@yahoo.com; Ciftci, Turkmen, E-mail: turkmenciftci@yahoo.com; Akinci, Devrim, E-mail: akincid@hotmail.com [Hacettepe University Faculty of Medicine, Department of Radiology (Turkey)

    2016-06-15

    PurposeThe purpose of our study is to evaluate results of percutaneous aspiration with alcohol sclerotherapy in symptomatic patients with simple hepatic cysts by employing single-session techniques either by a needle or a catheter.Materials and MethodsWe retrospectively included 39 simple hepatic cysts in 35 patients treated via percutaneous aspiration and single-session alcohol sclerotherapy between years 1993 and 2012. Indications were pain (n = 28) or ruling out cystic echinococcus (CE) disease (n = 7). 29 cysts in 26 patients were treated by needle technique (Group A) and ten cysts in nine patients were treated by single-session catheter technique (Group B). Patients were followed for 4–173 months (median: 38 months).ResultsAll patients were successfully treated. Before procedure, cyst volumes were 21–676 cc (median: 94 cc). Post-procedure cyst volumes at last follow-up were 0-40 cc (median: 1 cc). The mean decrease in cyst volume was 95.92 ± 2.86 % in all patients (95.96 ± 3.26 % in Group A and 95.80 ± 6.20 % in Group B). There was no statistically significant difference between the volume reduction rates of Group A and Group B. Only one patient, in Group B, developed a major complication, an abscess. Hospitalization period was 1 day for all patients.ConclusionsFor patients with symptomatic simple hepatic cysts smaller than 500 cc in volume by using puncture, aspiration, injection, and reaspiration (PAIR) technique with only needle, single-session alcohol sclerotherapy of 10 min is a safe and effective procedure with high success rate.

  9. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  10. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  12. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    Science.gov (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  13. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  15. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  16. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    Science.gov (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  17. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  18. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  19. Optimize Etching Based Single Mode Fiber Optic Temperature Sensor

    OpenAIRE

    Ajay Kumar; Dr. Pramod Kumar

    2014-01-01

    This paper presents a description of etching process for fabrication single mode optical fiber sensors. The process of fabrication demonstrates an optimized etching based method to fabricate single mode fiber (SMF) optic sensors in specified constant time and temperature. We propose a single mode optical fiber based temperature sensor, where the temperature sensing region is obtained by etching its cladding diameter over small length to a critical value. It is observed that th...

  20. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  1. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail: b6rgw@fantasy.plala.or.jp; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)

    2007-02-01

    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  2. Polarization entangled photon pair source for space-based quantum communication, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The overall goal of this NASA effort is to develop and deliver efficient, single-pass quantum optical waveguide sources generating high purity hyper-entangled photon...

  3. An automatic single channel analyzer based on single-chip microcomputer

    International Nuclear Information System (INIS)

    Yan Xuekun; Jia Mingchun; Zhang Yan; Liu Mingjian; Luo Ming

    2008-01-01

    The hardware and software of an automatic single channel analyzer based on AT89C51RC single-chip microcomputer is described in this paper. The equipment takes a method of channel-width-adjusting symmetrically, and makes use of single-chip microcomputer to control the two DAC0832 so as to adjust the discriminating threshold and channel-width automatically. As a result, the auto-measuring of the single channel analyzer is realized. Its circuit configuration is simple, and the uniformity of its channel-width is well, too. (authors)

  4. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  5. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  7. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  8. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  9. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  10. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)

    2016-08-11

    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  11. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  12. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  13. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    Science.gov (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  14. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia

    2016-03-01

    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  15. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    Science.gov (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  16. High brightness single photon sources based on photonic wires

    DEFF Research Database (Denmark)

    Claudon, J.; Bleuse, J.; Bazin, M.

    2009-01-01

    We present a novel single-photon-source based on the emission of a semiconductor quantum dot embedded in a single-mode photonic wire. This geometry ensures a very large coupling (> 95%) of the spontaneous emission to the guided mode. Numerical simulations show that a photon collection efficiency...

  17. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  18. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  19. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  1. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    Science.gov (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  2. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

    Science.gov (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

    2009-01-01

    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  3. Tractor performance monitor based on a single-chip microcomputer

    Energy Technology Data Exchange (ETDEWEB)

    Bedri, A.R.; Marley, S.J.; Buchelle, W.F.; Smay, T.A.

    1981-01-01

    A tractor performance monitor based on a single-chip microcomputer was developed to measure ground speed, slip, fuel consumption (rate and total), total area, theoretical time, and total time. Transducers used are presented in detail. 5 refs.

  4. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  5. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  6. Distributed Feedback Laser Based on Single Crystal Perovskite

    Science.gov (United States)

    Sun, Shang; Xiao, Shumin; Song, Qinghai

    2017-06-01

    We demonstrate a single crystal perovskite based, with grating-structured photoresist on top, highly polarized distributed feedback laser. A lower laser threshold than the Fabry-Perot mode lasers from the same single crystal CH3NH3PbBr3 microplate was obtained. Single crystal CH3NH3PbBr3 microplates was synthesized with one-step solution processed precipitation method. Once the photoresist on top of the microplate was patterned with electron beam, the device was realized. This one-step fabrication process utilized the advantage of single crystal to the greatest extend. The ultra-low defect density in single crystalline microplate offer an opportunity for lower threshold lasing action compare with poly-crystal perovskite films. In the experiment, the lasing action based on the distributed feedback grating design was found with lower threshold and higher intensity than the Fabry-Perot mode lasers supported by the flat facets of the same microplate.

  7. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

    Science.gov (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

    2018-05-01

    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  8. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík

    2016-01-01

    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  9. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    Science.gov (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Comparative evaluation of paired blood culture (aerobic/aerobic) and single blood culture, along with clinical importance in catheter versus peripheral line at a tertiary care hospital.

    Science.gov (United States)

    Tarai, B; Das, P; Kumar, D; Budhiraja, S

    2012-01-01

    Paired blood culture (PBC) is uncommon practice in hospitals in India, leading to delayed and inadequate diagnosis. Also contamination remains a critical determinant in hampering the definitive diagnosis. To establish the need of PBC over single blood culture (SBC) along with the degree of contamination, this comparative retrospective study was initiated. We processed 2553 PBC and 4350 SBC in BacT/ALERT 3D (bioMerieux) between October 2010 and June 2011. The positive cultures were identified in VITEK 2 Compact (bioMerieux). True positivity and contaminants were also analyzed in 486 samples received from catheter and peripheral line. Out of 2553 PBC samples, positivity was seen in 350 (13.70%). In 4350 SBC samples, positivity was seen in 200 samples (4.59%). In PBC true pathogens were 267 (10.45%) and contaminants were 83 (3.25%), whereas in SBC 153 (3.51%) were true positives and contaminants were 47 (1.08%). Most of the blood cultures (99.27 %) grew within 72 h and 95.8% were isolated within 48 h. In 486 PBCs received from catheter/periphery (one each), catheter positivity was found in 85 (true positives were 48, false positives 37). In peripheral samples true positives were 50 and false positives were 8. Significantly higher positive rates were seen in PBCs compared with SBCs. Automated blood culture and identification methods significantly reduced the time required for processing of samples and also facilitated yield of diverse/rare organisms. Blood culture from catheter line had higher false positives than peripheral blood culture. Thus every positive result from a catheter must be correlated with clinical findings and requires further confirmation.

  11. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    Science.gov (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    Science.gov (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  13. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  14. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  15. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  16. PENINGKATAN KEMAMPUAN BERPIKIR KRITIS DAN KETERAMPILAN PROSES SAINS SISWA SMA MELALUI IMPLEMENTASI PROBLEM BASED LEARNING DIPADU THINK PAIR SHARE

    Directory of Open Access Journals (Sweden)

    Abu Husen

    2017-06-01

    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  17. Single-Dose Lignocaine-Based Blood Cardioplegia in Single Valve Replacement Patients

    Directory of Open Access Journals (Sweden)

    Jaydip Ramani

    Full Text Available Abstract OBJECTIVE: Myocardial protection is the most important in cardiac surgery. We compared our modified single-dose long-acting lignocaine-based blood cardioplegia with short-acting St Thomas 1 blood cardioplegia in patients undergoing single valve replacement. METHODS: A total of 110 patients who underwent single (aortic or mitral valve replacement surgery were enrolled. Patients were divided in two groups based on the cardioplegia solution used. In group 1 (56 patients, long-acting lignocaine based-blood cardioplegia solution was administered as a single dose while in group 2 (54 patients, standard St Thomas IB (short-acting blood-based cardioplegia solution was administered and repeated every 20 minutes. All the patients were compared for preoperative baseline parameters, intraoperative and all the postoperative parameters. RESULTS: We did not find any statistically significant difference in preoperative baseline parameters. Cardiopulmonary bypass time were 73.8±16.5 and 76.4±16.9 minutes (P=0.43 and cross clamp time were 58.9±10.3 and 66.3±11.2 minutes (P=0.23 in group 1 and group 2, respectively. Mean of maximum inotrope score was 6.3±2.52 and 6.1±2.13 (P=0.65 in group 1 and group 2, respectively. We also did not find any statistically significant difference in creatine-phosphokinase-MB (CPK-MB, Troponin-I levels, lactate level and cardiac functions postoperatively. CONCLUSION: This study proves the safety and efficacy of long-acting lignocaine-based single-dose blood cardioplegia compared to the standard short-acting multi-dose blood cardioplegia in patients requiring the single valve replacement. Further studies need to be undertaken to establish this non-inferiority in situations of complex cardiac procedures especially in compromised patients.

  18. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  19. Single-crystal growth of ceria-based materials

    International Nuclear Information System (INIS)

    Ulbrich, Gregor

    2015-01-01

    In this work it could be shown that Skull-Melting is a suitable method for growing ceria single crystals. Twenty different ceria-based single crystals could be manufactured. It was possible to dope ceria single crystals with Gd, Sm, Y, Zr, Ti, Ta, and Pr in different concentrations. Also co-doping with the named metals was realized. However, there remain some problems for growing ceria-based single crystals by Skull-Melting. As ignition metal zirconium was used because no ceria-based material works well. For that reason all single crystals show small zirconium contamination. Another problem is the formation of oxygen by the heat-induced reduction of ceria during the melting process. Because of that the skull of sintered material is often destroyed by gas pressure. This problem had to be solved individually for every single crystal. The obtained single crystals were characterized using different methods. To ensure the single crystal character the y were examined by Laue diffraction. All manufactured crystals are single crystals. Also powder diffraction patterns of the milled and oxidized samples were measured. For the determination of symmetry and metric the structural parameters were analyzed by the Rietveld method. All synthesized materials crystallize in space group Fm-3m known from calcium fluoride. The cubic lattice parameter a was determined for all crystals. In the case of series with different cerium and zirconium concentrations a linear correlation between cerium content and cubic lattice parameter was detected. The elemental composition was determined by WDX. All crystals show a homogeneous elemental distribution. The oxygen content was calculated because the WDX method isn't useful for determination.

  20. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua

    2014-11-25

    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  1. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Solar-Based Boost Differential Single Phase Inverter | Eya | Nigerian ...

    African Journals Online (AJOL)

    Solar-Based Boost Differential Single Phase Inverter. ... Solar-based boost differential inverter is reduced down to 22.37% in closed loop system with the aid of Proportional –integral-Differential (PID) ... The dc power source is photovoltaic cell.

  3. Single channel blind source separation based on ICA feature extraction

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A new technique is proposed to solve the blind source separation (BSS) given only a single channel observation. The basis functions and the density of the coefficients of source signals learned by ICA are used as the prior knowledge. Based on the learned prior information the learning rules of single channel BSS are presented by maximizing the joint log likelihood of the mixed sources to obtain source signals from single observation,in which the posterior density of the given measurements is maximized. The experimental results exhibit a successful separation performance for mixtures of speech and music signals.

  4. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  5. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    Science.gov (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  6. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  7. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

    Science.gov (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

    2008-07-15

    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  8. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  9. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  10. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    Science.gov (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  11. Alcohol sensor based on single-mode-multimode-single-mode fiber structure

    Science.gov (United States)

    Mefina Yulias, R.; Hatta, A. M.; Sekartedjo, Sekartedjo

    2016-11-01

    Alcohol sensor based on Single-mode -Multimode-Single-mode (SMS) fiber structure is being proposed to sense alcohol concentration in alcohol-water mixtures. This proposed sensor uses refractive index sensing as its sensing principle. Fabricated SMS fiber structure had 40 m of multimode length. With power input -6 dBm and wavelength 1550 nm, the proposed sensor showed good response with sensitivity 1,983 dB per % v/v with measurement range 05 % v/v and measurement span 0,5% v/v.

  12. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    International Nuclear Information System (INIS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Neese, Frank; Valeev, Edward F.

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate

  13. Fluorescent Biosensors Based on Single-Molecule Counting.

    Science.gov (United States)

    Ma, Fei; Li, Ying; Tang, Bo; Zhang, Chun-Yang

    2016-09-20

    Biosensors for highly sensitive, selective, and rapid quantification of specific biomolecules make great contributions to biomedical research, especially molecular diagnostics. However, conventional methods for biomolecular assays often suffer from insufficient sensitivity and poor specificity. In some case (e.g., early disease diagnostics), the concentration of target biomolecules is too low to be detected by these routine approaches, and cumbersome procedures are needed to improve the detection sensitivity. Therefore, there is an urgent need for rapid and ultrasensitive analytical tools. In this respect, single-molecule fluorescence approaches may well satisfy the requirement and hold promising potential for the development of ultrasensitive biosensors. Encouragingly, owing to the advances in single-molecule microscopy and spectroscopy over past decades, the detection of single fluorescent molecule comes true, greatly boosting the development of highly sensitive biosensors. By in vitro/in vivo labeling of target biomolecules with proper fluorescent tags, the quantification of certain biomolecule at the single-molecule level is achieved. In comparison with conventional ensemble measurements, single-molecule detection-based analytical methods possess the advantages of ultrahigh sensitivity, good selectivity, rapid analysis time, and low sample consumption. Consequently, single-molecule detection may be potentially employed as an ideal analytical approach to quantify low-abundant biomolecules with rapidity and simplicity. In this Account, we will summarize our efforts for developing a series of ultrasensitive biosensors based on single-molecule counting. Single-molecule counting is a member of single-molecule detection technologies and may be used as a very simple and ultrasensitive method to quantify target molecules by simply counting the individual fluorescent bursts. In the fluorescent sensors, the signals of target biomolecules may be translated to the

  14. Graphene-Based Josephson-Junction Single-Photon Detector

    Science.gov (United States)

    Walsh, Evan D.; Efetov, Dmitri K.; Lee, Gil-Ho; Heuck, Mikkel; Crossno, Jesse; Ohki, Thomas A.; Kim, Philip; Englund, Dirk; Fong, Kin Chung

    2017-08-01

    We propose to use graphene-based Josephson junctions (GJJs) to detect single photons in a wide electromagnetic spectrum from visible to radio frequencies. Our approach takes advantage of the exceptionally low electronic heat capacity of monolayer graphene and its constricted thermal conductance to its phonon degrees of freedom. Such a system could provide high-sensitivity photon detection required for research areas including quantum information processing and radio astronomy. As an example, we present our device concepts for GJJ single-photon detectors in both the microwave and infrared regimes. The dark count rate and intrinsic quantum efficiency are computed based on parameters from a measured GJJ, demonstrating feasibility within existing technologies.

  15. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian

    2015-08-18

    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  16. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    Science.gov (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  17. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  18. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  19. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park

    2017-06-01

    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  20. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  1. Double minimum creep of single crystal Ni-base superalloys

    Czech Academy of Sciences Publication Activity Database

    WU, X.; Wollgramm, P.; Somsen, C.; Dlouhý, Antonín; Kostka, A.; Eggeler, G.

    2016-01-01

    Roč. 112, JUN (2016), s. 242-260 ISSN 1359-6454 R&D Projects: GA ČR(CZ) GA14-22834S Institutional support: RVO:68081723 Keywords : Single crystal Ni-base superalloys * Primary creep * Transmission electron microscopy * Dislocations * Stacking faults Subject RIV: JG - Metallurgy Impact factor: 5.301, year: 2016

  2. Analysis of InP-based single photon avalanche diodes based on a single recess-etching process

    Science.gov (United States)

    Lee, Kiwon

    2018-04-01

    Effects of the different etching techniques have been investigated by analyzing electrical and optical characteristics of two-types of single-diffused single photon avalanche diodes (SPADs). The fabricated two-types of SPADs have no diffusion depth variation by using a single diffusion process at the same time. The dry-etched SPADs show higher temperature dependence of a breakdown voltage, larger dark-count-rate (DCR), and lower photon-detection-efficiency (PDE) than those of the wet-etched SPADs due to plasma-induced damage of dry-etching process. The results show that the dry etching damages can more significantly affect the performance of the SPADs based on a single recess-etching process.

  3. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    OpenAIRE

    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

    2005-01-01

    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  4. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  6. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash

    2017-01-01

    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  7. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    Science.gov (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  8. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory

    Science.gov (United States)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank

    2016-09-01

    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the

  9. Seniority zero pair coupled cluster doubles theory

    International Nuclear Information System (INIS)

    Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

    2014-01-01

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

  10. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  11. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  12. Electrical signatures of single-stranded DNA with single base mutations in a nanopore capacitor

    International Nuclear Information System (INIS)

    Gracheva, Maria E; Aksimentiev, Aleksei; Leburton, Jean-Pierre

    2006-01-01

    In this paper, we evaluate the magnitude of the electrical signals produced by DNA translocation through a 1 nm diameter nanopore in a capacitor membrane with a numerical multi-scale approach, and assess the possibility of resolving individual nucleotides as well as their types in the absence of conformational disorder. We show that the maximum recorded voltage caused by the DNA translocation is about 35 mV, while the maximum voltage signal due to the DNA backbone is about 30 mV, and the maximum voltage of a DNA base is about 8 mV. Signals from individual nucleotides can be identified in the recorded voltage traces, suggesting a 1 nm diameter pore in a capacitor can be used to accurately count the number of nucleotides in a DNA strand. Furthermore, we study the effect of a single base substitution on the voltage trace, and calculate the differences among the voltage traces due to a single base mutation for the sequences C 3 AC 7 , C 3 CC 7 , C 3 GC 7 and C 3 TC 7 . The calculated voltage differences are in the 5-10 mV range. The calculated maximum voltage caused by the translocation of individual bases varies from 2 to 9 mV, which is experimentally detectable

  13. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Parameter Screening in Microfluidics Based Hydrodynamic Single-Cell Trapping

    Directory of Open Access Journals (Sweden)

    B. Deng

    2014-01-01

    Full Text Available Microfluidic cell-based arraying technology is widely used in the field of single-cell analysis. However, among developed devices, there is a compromise between cellular loading efficiencies and trapped cell densities, which deserves further analysis and optimization. To address this issue, the cell trapping efficiency of a microfluidic device with two parallel micro channels interconnected with cellular trapping sites was studied in this paper. By regulating channel inlet and outlet status, the microfluidic trapping structure can mimic key functioning units of previously reported devices. Numerical simulations were used to model this cellular trapping structure, quantifying the effects of channel on/off status and trapping structure geometries on the cellular trapping efficiency. Furthermore, the microfluidic device was fabricated based on conventional microfabrication and the cellular trapping efficiency was quantified in experiments. Experimental results showed that, besides geometry parameters, cellular travelling velocities and sizes also affected the single-cell trapping efficiency. By fine tuning parameters, more than 95% of trapping sites were taken by individual cells. This study may lay foundation in further studies of single-cell positioning in microfluidics and push forward the study of single-cell analysis.

  15. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    Science.gov (United States)

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  16. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing

    2010-01-01

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  17. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at http://protein.cau.edu.cn/pbPUP/.

  18. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2010-04-15

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  19. Molecular [(Fe3)–(Fe3)] and [(Fe4)–(Fe4)] coordination cluster pairs as single or composite arrays.

    Science.gov (United States)

    Sañudo, E Carolina; Uber, Jorge Salinas; Pons Balagué, Alba; Roubeau, Olivier; Aromí, Guillem

    2012-08-06

    The synthesis of molecular cluster pairs is a challenge for coordination chemists due to the potential applications of these species in molecular spintronics or quantum computing. The ligand H(4)L, 1,3-bis-(3-oxo-3-(2-hydroxyphenyl)-propionyl)-2-methoxybenzene, has been successfully used to obtain a series of such complexes using the basic Fe(III) trinuclear carboxylates as starting materials. Synthetic control has allowed the isolation of the two molecular cluster pairs that form the composite [Fe(4)O(2)(PhCO(2))(6)(H(2)L)(pz)](2)[Fe(3)O(PhCO(2))(5)(py)(H(2)L)](2) (1). The dimers of trinuclear units, [Fe(3)O(PhCO(2))(5)(H(2)O)(H(2)L)](2) (2) and [Fe(3)O(o-MePhCO(2))(5)(H(2)L)(py)](2) (3), and the dimers of tetranuclear units, [Fe(4)O(2)(PhCO(2))(6)(H(2)L)(pz)](2) (4) and [Fe(4)O(2)(o-MePhCO(2))(6)(H(2)L)(pz)](2) (5), are presented here. The magnetic properties of the reported aggregates show that they are pairs of semi-independent clusters weakly interacting magnetically as required for two-qubit quantum gates.

  20. Cu-O network dependence of optical charge-transfer gaps and spin-pair excitations in single-CuO2-layer compounds

    International Nuclear Information System (INIS)

    Tokura, Y.; Koshihara, S.; Arima, T.; Takagi, H.; Ishibashi, S.; Ido, T.; Uchida, S.

    1990-01-01

    Spectra of optical conductivity and magnon Raman scattering have been investigated in single crystals of a parent family of cuprate superconductors with various types of Cu-O single-layer networks. The analysis of the spectra shows the systematic dependence of the charge-transfer gaps and covalent character of Cu-O bonds on the pattern of the Cu-O network, while the spin-exchange energy is rather convergent for all the single-CuO 2 -sheet compounds

  1. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  3. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  4. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    Science.gov (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  5. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang

    2018-02-01

    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  6. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    Science.gov (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  7. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  8. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  9. Superconducting single electron transistor for charge sensing in Si/SiGe-based quantum dots

    Science.gov (United States)

    Yang, Zhen

    Si-based quantum devices, including Si/SiGe quantum dots (QD), are promising candidates for spin-based quantum bits (quits), which are a potential platform for quantum information processing. Meanwhile, qubit readout remains a challenging task related to semiconductor-based quantum computation. This thesis describes two readout devices for Si/SiGe QDs and the techniques for developing them from a traditional single electron transistor (SET). By embedding an SET in a tank circuit and operating it in the radio-frequency (RF) regime, a superconducting RF-SET has quick response as well as ultra high charge sensitivity and can be an excellent charge sensor for the QDs. We demonstrate such RF-SETs for QDs in a Si/SiGe heterostructure. Characterization of the SET in magnetic fields is studied for future exploration of advanced techniques such as spin detection and spin state manipulation. By replacing the tank circuit with a high-quality-factor microwave cavity, the embedded SET will be operated in the supercurrent regime as a single Cooper pair transistor (CPT) to further increase the charge sensitivity and reduce any dissipation. The operating principle and implementation of the cavity-embedded CPT (cCPT) will be introduced.

  10. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  11. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  12. Waterbomb base: a symmetric single-vertex bistable origami mechanism

    International Nuclear Information System (INIS)

    Hanna, Brandon H; Lund, Jason M; Magleby, Spencer P; Howell, Larry L; Lang, Robert J

    2014-01-01

    The origami waterbomb base is a single-vertex bistable origami mechanism that has unique properties which may prove useful in a variety of applications. It also shows promise as a test bed for smart materials and actuation because of its straightforward geometry and multiple phases of motion, ranging from simple to more complex. This study develops a quantitative understanding of the symmetric waterbomb base's kinetic behavior. This is done by completing kinematic and potential energy analyses to understand and predict bistable behavior. A physical prototype is constructed and tested to validate the results of the analyses. Finite element and virtual work analyses based on the prototype are used to explore the locations of the stable equilibrium positions and the force–deflection response. The model results are verified through comparisons to measurements on a physical prototype. The resulting models describe waterbomb base behavior and provide an engineering tool for application development. (paper)

  13. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  14. Single-spin asymmetry in electro-production of {pi}{sup +} {pi}{sup -} pairs from a transversely polarized proton target at the HERMES experiment

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Xiao-Rui

    2008-10-15

    In this thesis, the measurement of an azimuthal amplitude of the asymmetry in the lepto-production of {pi}{sup +}{pi}{sup -} pairs at the HERMES experiment is reported. The experiment was carried out at DESY in Germany, utilizing the longitudinally polarized 27.6 GeV electron/positron beam of the HERA storage ring in combination with a longitudinally or transversely polarized gaseous target internal to the beam pipe. For the present measurement, the transversely polarized proton target was used and the beam polarization was averaged out in order to measure the asymmetry A{sub UT}. A Ring Imaging Cerenkov (RICH) detector allows the precise identification of pions, kaons and protons over essentially the entire momentum range of the experiment. The asymmetry A{sub UT} for {pi}{sup +}{pi}{sup -} pair production was measured for the first time in the world by HERMES. The amplitudes are extracted as functions of different kinematic variables, which can facilitate the comparison with the theoretical models and the extraction of transversity with combination of the measurement of the dihadron fragmentation function. (orig.)

  15. Single-spin asymmetry in electro-production of π+ π- pairs from a transversely polarized proton target at the HERMES experiment

    International Nuclear Information System (INIS)

    Lu, Xiao-Rui

    2008-09-01

    In this thesis, the measurement of an azimuthal amplitude of the asymmetry in the lepto-production of π + π - pairs at the HERMES experiment is reported. The experiment was carried out at DESY in Germany, utilizing the longitudinally polarized 27.6 GeV electron/positron beam of the HERA storage ring in combination with a longitudinally or transversely polarized gaseous target internal to the beam pipe. For the present measurement, the transversely polarized proton target was used and the beam polarization was averaged out in order to measure the asymmetry A UT . A Ring Imaging Cerenkov (RICH) detector allows the precise identification of pions, kaons and protons over essentially the entire momentum range of the experiment. The asymmetry A UT for π + π - pair production was measured for the first time in the world by HERMES. The amplitudes are extracted as functions of different kinematic variables, which can facilitate the comparison with the theoretical models and the extraction of transversity with combination of the measurement of the dihadron fragmentation function. (orig.)

  16. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

    2017-08-15

    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  17. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    Science.gov (United States)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  18. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    Science.gov (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. A Single-Channel EOG-Based Speller.

    Science.gov (United States)

    He, Shenghong; Li, Yuanqing

    2017-11-01

    Electrooculography (EOG) signals, which can be used to infer the intentions of a user based on eye movements, are widely used in human-computer interface (HCI) systems. Most existing EOG-based HCI systems incorporate a limited number of commands because they generally associate different commands with a few different types of eye movements, such as looking up, down, left, or right. This paper presents a novel single-channel EOG-based HCI that allows users to spell asynchronously by only blinking. Forty buttons corresponding to 40 characters displayed to the user via a graphical user interface are intensified in a random order. To select a button, the user must blink his/her eyes in synchrony as the target button is flashed. Two data processing procedures, specifically support vector machine (SVM) classification and waveform detection, are combined to detect eye blinks. During detection, we simultaneously feed the feature vectors extracted from the ongoing EOG signal into the SVM classification and waveform detection modules. Decisions are made based on the results of the SVM classification and waveform detection. Three online experiments were conducted with eight healthy subjects. We achieved an average accuracy of 94.4% and a response time of 4.14 s for selecting a character in synchronous mode, as well as an average accuracy of 93.43% and a false positive rate of 0.03/min in the idle state in asynchronous mode. The experimental results, therefore, demonstrated the effectiveness of this single-channel EOG-based speller.

  20. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  2. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  3. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  5. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  6. Single event upset threshold estimation based on local laser irradiation

    International Nuclear Information System (INIS)

    Chumakov, A.I.; Egorov, A.N.; Mavritsky, O.B.; Yanenko, A.V.

    1999-01-01

    An approach for estimation of ion-induced SEU threshold based on local laser irradiation is presented. Comparative experiment and software simulation research were performed at various pulse duration and spot size. Correlation of single event threshold LET to upset threshold laser energy under local irradiation was found. The computer analysis of local laser irradiation of IC structures was developed for SEU threshold LET estimation. The correlation of local laser threshold energy with SEU threshold LET was shown. Two estimation techniques were suggested. The first one is based on the determination of local laser threshold dose taking into account the relation of sensitive area to local irradiated area. The second technique uses the photocurrent peak value instead of this relation. The agreement between the predicted and experimental results demonstrates the applicability of this approach. (authors)

  7. Faithful One-way Trip Deterministic Secure Quantum Communication Scheme Against Collective Rotating Noise Based on Order Rearrangement of Photon Pairs

    Science.gov (United States)

    Yuan, Hao; Zhang, Qin; Hong, Liang; Yin, Wen-jie; Xu, Dong

    2014-08-01

    We present a novel scheme for deterministic secure quantum communication (DSQC) over collective rotating noisy channel. Four special two-qubit states are found can constitute a noise-free subspaces, and so are utilized as quantum information carriers. In this scheme, the information carriers transmite over the quantum channel only one time, which can effectively reduce the influence of other noise existing in quantum channel. The information receiver need only perform two single-photon collective measurements to decode the secret messages, which can make the present scheme more convenient in practical application. It will be showed that our scheme has a relatively high information capacity and intrisic efficiency. Foremostly, the decoy photon pair checking technique and the order rearrangement of photon pairs technique guarantee that the present scheme is unconditionally secure.

  8. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    Science.gov (United States)

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  9. Search for pair- and single-production of vector-like quarks in final states with at least one $Z$ boson decaying into a pair of electrons or muons in $pp$ collision data collected with the ATLAS detector at $\\sqrt{s} = 13$ TeV

    CERN Document Server

    Aaboud, Morad; ATLAS Collaboration; Abbott, Brad; Abdinov, Ovsat; Abeloos, Baptiste; Abhayasinghe, Deshan Kavishka; Abidi, Syed Haider; Abouzeid, Ossama; Abraham, Nicola; Abramowicz, Halina; Abreu, Henso; Abulaiti, Yiming; Acharya, Bobby Samir; Adachi, Shunsuke; Adamczyk, Leszek; Adelman, Jahred; Adersberger, Michael; Adiguzel, Aytul; Adye, Tim; Affolder, Tony; Afik, Yoav; Agheorghiesei, Catalin; Aguilar Saavedra, Juan Antonio; Ahmadov, Faig; Aielli, Giulio; Akatsuka, Shunichi; Akesson, Torsten Paul Ake; Akilli, Ece; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albicocco, Pietro; Alconada Verzini, Maria Josefina; Alderweireldt, Sara Caroline; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexopoulos, Theodoros; Alhroob, Muhammad; Ali, Babar; Aliev, Malik; Alimonti, Gianluca; Alison, John; Alkire, Steven Patrick; Allaire, Corentin; Allbrooke, Benedict; Allen, Benjamin William; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Alshehri, Azzah Aziz; Alstaty, Mahmoud; Alvarez Gonzalez, Barbara; Alvarez Piqueras, Damian; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amaral Coutinho, Yara; Ambroz, Luca; Amelung, Christoph; Amidei, Dante Eric; Amor Dos Santos, Susana Patricia; Amoroso, Simone; Amrouche, Cherifa Sabrina; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anelli, Christopher Ryan; Angelidakis, Stylianos; Angelozzi, Ivan; Angerami, Aaron; Anisenkov, Alexey; Annovi, Alberto; Antel, Claire; Anthony, Matthew Thomas; Antonelli, Mario; Antrim, Daniel Joseph; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Araque Espinosa, Juan Pedro; Araujo Ferraz, Victor; Araujo Pereira, Rodrigo; Arce, Ayana; Ardell, Rose Elisabeth; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Armbruster, Aaron James; Armitage, Lewis James; Armstrong, Alexander Iii; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Artz, Sebastian; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Asimakopoulou, Eleni Myrto; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkin, Ryan Justin; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Avolio, Giuseppe; Avramidou, Rachel Maria; Ayoub, Mohamad Kassem; Azuelos, Georges; Baas, Alessandra; Baca, Matthew John; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Bagnaia, Paolo; Bahmani, Marzieh; Baluch Bahrasemani, Sina; Bailey, Adam; Baines, John; Bajic, Milena; Bakalis, Christos; Baker, Keith; Bakker, Pepijn Johannes; Bakshi Gupta, Debottam; Baldin, Evgenii; Balek, Petr; Balli, Fabrice; Balunas, William Keaton; Balz, Johannes; Banas, Elzbieta; Bandyopadhyay, Anjishnu; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barbe, William Mickael; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisits, Martin-Stefan; Barkeloo, Jason Tylor Colt; Barklow, Timothy; Barlow, Nick; Barnea, Rotem; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Blenessy, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barranco Navarro, Laura; Barreiro, Fernando; Barreiro Guimaraes da Costa, Joao; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Bates, Richard; Batista, Santiago Juan; Batlamous, Souad; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bauer, Kevin Thomas; Bawa, Harinder Singh; Beacham, James Baker; Beau, Tristan; Beauchemin, Pierre-Hugues; Bechtle, Philip; Beck, Helge Christoph; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Maurice; Becot, Cyril; Beddall, Ayda; Beddall, Andrew; Bednyakov, Vadim; Bedognetti, Matteo; Bee, Christopher; Beermann, Thomas Alfons; Begalli, Marcia; Begel, Michael; Behera, Arabinda; Behr, Katharina; Bell, Andrew Stuart; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Bellos, Panagiotis; Belotskiy, Konstantin; Belyaev, Nikita; Benary, Odette; Benchekroun, Driss; Bender, Michael; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez, Jose; Benjamin, Douglas; Benoit, Mathieu; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Bergsten, Laura Jean; Beringer, Juerg; Berlendis, Simon Paul; Bernard, Nathan Rogers; Bernardi, Gregorio; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertram, Iain Alexander; Besjes, Geert-jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Bethani, Agni; Bethke, Siegfried; Betti, Alessandra; Bevan, Adrian John; Beyer, Julien-christopher; Bianchi, Riccardo-Maria; Biebel, Otmar; Biedermann, Dustin; Bielski, Rafal; Bierwagen, Katharina; Biesuz, Nicolo Vladi; Biglietti, Michela; Billoud, Thomas Remy Victor; Bindi, Marcello; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Birman, Mattias; Bisanz, Tobias; Biswal, Jyoti Prakash; Bittrich, Carsten; Bjergaard, David Martin; Black, James; Black, Kevin; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blue, Andrew; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boerner, Daniela; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bokan, Petar; Bold, Tomasz; Boldyrev, Alexey; Bolz, Arthur Eugen; Bomben, Marco; Bona, Marcella; Bonilla, Johan Sebastian; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Bortfeldt, Jonathan; Bortoletto, Daniela; Bortolotto, Valerio; Boscherini, Davide; Bosman, Martine; Bossio Sola, Jonathan David; Bouaouda, Khalil; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boye, Diallo; Boyko, Igor; Bozson, Adam James; Bracinik, Juraj; Brahimi, Nihal; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Braren, Frued; Bratzler, Uwe; Brau, Benjamin; Brau, James; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Brickwedde, Bernard; Briglin, Daniel Lawrence; Britton, Dave; Britzger, Daniel Andreas; Brock, Ian; Brock, Raymond; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brost, Elizabeth; Broughton, James; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruni, Alessia; Bruni, Graziano; Bruni, Lucrezia Stella; Bruno, Salvatore; Brunt, Benjamin Hylton; Bruschi, Marco; Bruscino, Nello; Bryant, Patrick; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Budagov, Ioulian; Buehrer, Felix; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burch, Tyler James; Burdin, Sergey; Burgard, Carsten Daniel; Burger, Angela Maria; Burghgrave, Blake; Burka, Klaudia; Burke, Stephen; Burmeister, Ingo; Burr, Jonathan Thomas; Buescher, Daniel; Buescher, Volker; Buschmann, Eric; Bussey, Peter; Butler, John; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabras, Grazia; Cabrera Urban, Susana; Caforio, Davide; Cai, Huacheng; Cairo, Valentina Maria; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Callea, Giuseppe; Caloba, Luiz; Calvente Lopez, Sergio; Calvet, David; Calvet, Samuel; Calvet, Thomas Philippe; Calvetti, Milene; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Camincher, Clement; Campana, Simone; Campanelli, Mario; Camplani, Alessandra; Campoverde, Angel; Canale, Vincenzo; Cano Bret, Marc; Cantero, Josu; Cao, Tingting; Cao, Yumeng; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Ina; Carli, Tancredi; Carlino, Gianpaolo; Carlson, Benjamin Taylor; Carminati, Leonardo; Carney, Rebecca; Caron, Sascha; Carquin, Edson; Carra, Sonia; Carrillo Montoya, German David; Casadei, Diego; Casado, Maria Pilar; Casha, Albert Francis; Casper, David William; Castelijn, Remco; Castillo, Florencia Luciana; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavallaro, Emanuele; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Celebi, Emre; Ceradini, Filippo; Cerda Alberich, Leonor; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Stephen Kam-wah; Chan, Wing Sheung; Chan, Yat Long; Chapman, John Derek; Chargeishvili, Bakar; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Che, Siinn; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Cheng; Chen, Chunhui; Chen, Hucheng; Chen, Jing; Chen, Jue; Chen, Shion; Chen, Shenjian; Chen, Xin; Chen, Ye; Chen, Yu-heng; Cheng, Hok Chuen; Cheng, Huajie; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Cheu, Elliott; Cheung, Kingman; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chitan, Adrian; Chiu, I-huan; Chiu, Yu Him Justin; Chizhov, Mihail; Choi, Kyungeon; Chomont, Arthur Rene; Chouridou, Sofia; Chow, Yun Sang; Christodoulou, Valentinos; Chu, Ming Chung; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Citterio, Mauro; Clark, Allan G; Clark, Michael Ryan; Clark, Philip James; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Cohen, Hadar Yosef; Coimbra, Artur Cardoso; Colasurdo, Luca; Cole, Brian; Colijn, Auke-Pieter; Collot, Johann; Conde Muino, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Constantinescu, Serban; Conventi, Francesco; Cooper-Sarkar, Amanda; Cormier, Felix; Cormier, Kyle James Read; Corradi, Massimo; Corrigan, Eric Edward; Corriveau, Francois; Cortes-Gonzalez, Arely; Costa, Maria Jose; Costanzo, Davide; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Crane, Jonathan; Cranmer, Kyle; Crawley, Samuel Joseph; Creager, Rachael Ann; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cristinziani, Markus; Croft, Vincent; Crosetti, Giovanni; Cueto Gomez, Ana Rosario; Cuhadar Donszelmann, Tulay; Cukierman, Aviv Ruben; Cuth, Jakub; Czekierda, Sabina; Czodrowski, Patrick; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dado, Tomas; Dahbi, Salah-eddine; Dai, Tiesheng; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; D'amen, Gabriele; Damp, Johannes Frederic; Dandoy, Jeffrey Rogers; Daneri, Maria Florencia; Dang, Nguyen Phuong; Dann, Nicholas Stuart; Danninger, Matthias; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dartsi, Olympia; Dattagupta, Aparajita; Daubney, Thomas; D'Auria, Saverio; Davey, Will; David, Claire; Davidek, Tomas; Davis, Douglas; Dawe, Edmund; Dawson, Ian; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Beurs, Marcus; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Maria, Antonio; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santis, Maurizio; De Santo, Antonella; De Vasconcelos Corga, Kevin; De Vivie De Regie, Jean-Baptiste; Debenedetti, Chiara; Dedovich, Dmitri; Dehghanian, Nooshin; Del Gaudio, Michela; Del Peso, Jose; Delabat Diaz, Yasiel; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Della Pietra, Massimo; della Volpe, Domenico; Dell'Acqua, Andrea; Dell'Asta, Lidia; Delmastro, Marco; Delporte, Charles; Delsart, Pierre-Antoine; Demarco, David; Demers, Sarah; Demichev, Mikhail; Denisov, Sergey; Denysiuk, Denys; D'eramo, Louis; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Devesa, Maria Roberta; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Bello, Francesco Armando; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Clemente, William Kennedy; Di Donato, Camilla; Di Girolamo, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Petrillo, Karri Folan; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; De Almeida Dias, Flavia; Dias do vale, Tiago; Diaz, Marco Aurelio; Dickinson, Jennet; Diehl, Edward; Dietrich, Janet; Díez Cornell, Sergio; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dittus, Fido; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobre, Monica; Dodsworth, David; Doglioni, Caterina; Dolejsi, Jiri; Dolezal, Zdenek; Donadelli, Marisilvia; Donini, Julien; D'onofrio, Adelina; D'Onofrio, Monica; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dreyer, Etienne; Dreyer, Timo; Du, Yanyan; Duarte Campderros, Jorge; Dubinin, Filipp; Dubovsky, Michal; Dubreuil, Arnaud; Duchovni, Ehud; Duckeck, Guenter; Ducourthial, Audrey; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudder, Andreas Christian; Duffield, Emily Marie; Duflot, Laurent; Duehrssen, Michael; Dulsen, Carsten; Dumancic, Mirta; Dumitriu, Ana Elena; Duncan, Anna Kathryn; Dunford, Monica; Duperrin, Arnaud; Duran Yildiz, Hatice; Dueren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Duvnjak, Damir; Dyndal, Mateusz; Dysch, Samuel; Dziedzic, Bartosz Sebastian; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; El Kosseifi, Rima; Ellajosyula, Venugopal; Ellert, Mattias; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Ennis, Joseph Stanford; Epland, Matthew Berg; Erdmann, Johannes; Ereditato, Antonio; Errede, Steven; Escalier, Marc; Escobar, Carlos; Estrada Pastor, Oscar; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Ezzi, Mohammed; Fabbri, Federica; Fabbri, Laura; Fabiani, Veronica; Facini, Gabriel John; Faisca Rodrigues Pereira, Rui Miguel; Fakhrutdinov, Rinat; Falciano, Speranza; Falke, Peter Johannes; Falke, Saskia; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farina, Edoardo Maria; Farooque, Trisha; FARRELL, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fawcett, William James; Fayard, Louis; Fedin, Oleg; Fedorko, Woiciech; Feickert, Matthew; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Minyu; Fenton, Michael James; Fenyuk, Alexander; Feremenga, Last; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Fiedler, Frank; Filipcic, Andrej; Filthaut, Frank; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Fischer, Cora; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Rob Roy Mac Gregor; Flick, Tobias; Flierl, Bernhard Matthias; Flores, Lucas Macrorie; Flores Castillo, Luis; Follega, Francesco Maria; Fomin, Nikolai; Forcolin, Giulio Tiziano; Formica, Andrea; Foerster, Fabian Alexander; Forti, Alessandra; Foster, Andrew Geoffrey; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; Fressard-Batraneanu, Silvia Maria; Freund, Benjamin; Spolidoro Freund, Werner; Freundlich, Elena Murielle; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fusayasu, Takahiro; Fuster, Juan; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz Pawel; Gadatsch, Stefan; Gadow, Paul Philipp; Gagliardi, Guido; Gagnon, Louis Guillaume; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram; Gamboa Goni, Rodrigo; Gan, KK; Ganguly, Sanmay; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; García, Carmen; García Navarro, José Enrique; Garcia Pascual, Juan Antonio; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gasnikova, Ksenia; Gaudiello, Andrea; Gaudio, Gabriella; Gavrilenko, Igor; Gavrilyuk, Alexander; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Gee, Norman; Geisen, Jannik; Geisen, Marc; Geisler, Manuel Patrice; Gellerstedt, Karl; Gemme, Claudia; Genest, Marie-Helene; Geng, Cong; Gentile, Simonetta; George, Simon; Gerbaudo, Davide; Gessner, Gregor; Ghasemi, Sara; Ghasemi Bostanabad, Meisam; Ghneimat, Mazuza; Giacobbe, Benedetto; Giagu, Stefano; Giangiacomi, Nico; Giannetti, Paola; Giannini, Antonio; Gibson, Stephen; Gignac, Matthew; Gillberg, Dag Ingemar; Gilles, Geoffrey; Gingrich, Douglas; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giraud, Pierre-Francois; Giromini, Paolo; Giugliarelli, Gilberto; Giugni, Danilo; Giuli, Francesco; Giulini, Maddalena; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos; Gkountoumis, Panagiotis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian Maximilian Volker; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Goncalves Gama, Rafael; Goncalo, Ricardo; Gonella, Giulia; Gonella, Laura; Gongadze, Alexi; Gonnella, Francesco; Gonski, Julia Lynne; Gonzalez de la Hoz, Santiago; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorini, Benedetto; Gorini, Edoardo; Gorisek, Andrej; Goshaw, Alfred; Goessling, Claus; Gostkin, Mikhail Ivanovitch; Gottardo, Carlo Alberto; Goudet, Christophe Raymond; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Goy, Corinne; Gozani, Eitan; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Graham, Emily Charlotte; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gravila, Paul Mircea; Gravili, Francesco Giuseppe; Gray, Chloe; Gray, Heather; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Grevtsov, Kirill; Grieser, Nathan Allen; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Groh, Sabrina; Gross, Eilam; Grosse-Knetter, Jorn; Grossi, Giulio Cornelio; Grout, Zara Jane; Grud, Christopher; Grummer, Aidan; Guan, Liang; Guan, Wen; Guenther, Jaroslav; Guerguichon, Antinea; Guescini, Francesco; Guest, Daniel; Gugel, Ralf; Gui, Bin; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Wen; Guo, Yicheng; Guo, Ziyu; Gupta, Ruchi; Gurbuz, Saime; Gustavino, Giuliano; Gutelman, Benjamin Jacque; Gutierrez, Phillip; Gutschow, Christian; Guyot, Claude; Guzik, Marcin Pawel; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Hadef, Asma; Hageboeck, Stephan; Hagihara, Mutsuto; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Han, Kunlin; Han, Liang; Han, Shuo; Hanagaki, Kazunori; Hance, Michael; Handl, David Michael; Haney, Bijan; Hankache, Robert; Hanke, Paul; Hansen, Eva; Hansen, Jorgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew Straiton; Harenberg, Torsten; Harkusha, Siarhei; Harrison, Paul Fraser; Hartmann, Nikolai Marcel; Hasegawa, Yoji; Hasib, Ahmed; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havener, Laura Brittany; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard; Hayden, Daniel; Hayes, Christopher; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Heath, Matthew Peter; Hedberg, Vincent; Heelan, Louise; Heer, Sebastian; Heidegger, Kim Katrin; Heilman, Jesse; Heim, Sarah; Heim, Timon Frank-thomas; Heinemann, Beate; Heinrich, Jochen Jens; Heinrich, Lukas; Heinz, Christian; Hejbal, Jiri; Helary, Louis; Held, Alexander; Hellesund, Simen; Hellman, Sten; Helsens, Clement; Henderson, Robert; Heng, Yang; Henkelmann, Steffen; Henriques Correia, Ana Maria; Herbert, Geoffrey Henry; Herde, Hannah; Herget, Verena; Hernandez Jimenez, Yesenia; Herr, Holger; Herrmann, Maximilian Georg; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Herwig, Theodor Christian; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Higashino, Satoshi; Higon-Rodriguez, Emilio; Hildebrand, Kevin; Hill, Ewan; Hill, John; Hill, Kurt Keys; Hiller, Karl Heinz; Hillier, Stephen; Hils, Maximilian; Hinchliffe, Ian; Hirose, Minoru; Hirschbuehl, Dominic; Hiti, Bojan; Hladik, Ondrej; Hlaluku, Dingane Reward; Hoad, Xanthe; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohn, David; Hohov, Dmytro; Holmes, Tova Ray; Holzbock, Michael; Homann, Michael; Honda, Shunsuke; Honda, Takuya; Hong, Tae Min; Honle, Andreas; Hooberman, Benjamin Henry; Hopkins, Walter Howard; Horii, Yasuyuki; Horn, Philipp; Horton, Arthur James; Horyn, Lesya Anna; Hostachy, Jean-Yves; Hostiuc, Alexandru; Hou, Suen; Hoummada, Abdeslam; Howarth, James; Hoya, Joaquin; Hrabovsky, Miroslav; Hrdinka, Julia; Hristova, Ivana; Hrivnac, Julius; Hrynevich, Aliaksei; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Qipeng; Hu, Shuyang; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huebner, Michael; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Huhtinen, Mika; Hunter, Robert Francis; Huo, Peng; Hupe, Andre Marc; Huseynov, Nazim; Huston, Joey; Huth, John; Hyneman, Rachel; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idrissi, Zineb; Iengo, Paolo; Ignazzi, Rosanna; Igonkina, Olga; Iguchi, Ryunosuke; Iizawa, Tomoya; Ikegami, Yoichi; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Iltzsche Speiser, Franziska; Introzzi, Gianluca; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Isacson, Max Fredrik; Ishijima, Naoki; Ishino, Masaya; Ishitsuka, Masaki; Islam, Wasikul; Issever, Cigdem; Istin, Serhat; Ito, Fumiaki; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivina, Anna; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jacka, Petr; Jackson, Paul; Jacobs, Ruth Magdalena; Jain, Vivek; Jakel, Gunnar; Jakobi, Katharina Bianca; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jamin, David Olivier; Jana, Dilip; Jansky, Roland; Janssen, Jens; Janus, Michel; Janus, Piotr Andrzej; Jarlskog, Goeran; Javadov, Namig; Javurek, Tomas; Javurkova, Martina; Jeanneau, Fabien; Jeanty, Laura; Jejelava, Juansher; Jelinskas, Adomas; Jenni, Peter; Jeong, Jihyun; Jezequel, Stephane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Hai; Jiang, Yi; Jiang, Zihao; Jiggins, Stephen; Jimenez Morales, Fabricio Andres; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Jivan, Harshna; Johansson, Per; Johns, Kenneth; Johnson, Christian; Johnson, William Joseph; Jon-And, Kerstin; Jones, Roger; Jones, Samuel David; Jones, Sarah; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Jovicevic, Jelena; Ju, Xiangyang; Junggeburth, Johannes Josef; Juste Rozas, Aurelio; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kaji, Toshiaki; Kajomovitz, Enrique; Kalderon, Charles William; Kaluza, Adam; Kama, Sami; Kamenshchikov, Andrey; Kanjir, Luka; Kano, Yuya; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kar, Deepak; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karpov, Sergey; Karpova, Zoya; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katzy, Judith; Kawade, Kentaro; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kay, Ellis Fawn; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John Stakely; Kellermann, Edgar; Kempster, Jacob Julian; Kendrick, James Andrew; Kepka, Oldrich; Kersten, Susanne; Kersevan, Borut Paul; Keyes, Robert; Khader, Mazin; Khalil-zada, Farkhad; Khanov, Alexander; Kharlamov, Alexey; Kharlamova, Tatyana; Khoda, Elham E; Khodinov, Alexander; Khoo, Teng Jian; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kiehn, Moritz; Kilby, Callum Robert; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver; King, Barry; Kirchmeier, David; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kitali, Vincent; Kivernyk, Oleh; Kladiva, Eduard; Klapdor-kleingrothaus, Thorwald; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klingl, Tobias; Klioutchnikova, Tatiana; Klitzner, Felix Fidelio; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith B F G; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koenig, Philipp Thomas; Koffas, Thomas; Koffeman, Els; Koehler, Nicolas Maximilian; Koi, Tatsumi; Kolb, Mathis; Koletsou, Iro; Kondo, Takahiko; Kondrashova, Natalia; Koeneke, Karsten; Koenig, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinides, Vasilis; Konstantinidis, Nikolaos; Konya, Balazs; Kopeliansky, Revital; Koperny, Stefan; Korcyl, Krzysztof; Kordas, Konstantinos; Koren, Guy; Korn, Andreas; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotwal, Ashutosh; Koulouris, Aimilianos; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kourlitis, Evangelos; Kouskoura, Vasiliki; Kowalewska, Anna Bozena; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozakai, Chihiro; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitrii; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Krauss, Dominik; Kremer, Jakub Andrzej; Kretzschmar, Jan; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Jiri; Kroll, Joe; Krstic, Jelena; Kruchonak, Uladzimir; Krueger, Hans; Krumnack, Nils; Kruse, Mark; Kubota, Takashi; Kuday, Sinan; Kuechler, Jan Thomas; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kulinich, Yakov Petrovich; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kupfer, Tobias; Kuprash, Oleg; Kurashige, Hisaya; Kurchaninov, Leonid; Kurochkin, Yurii; Kurth, Matthew Glenn; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; La Ruffa, Francesco; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lack, David Philip John; Lacker, Heiko; Lacour, Didier; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lammers, Sabine; Lampl, Walter; Lancon, Eric; Landgraf, Ulrich; Landon, Murrough; Lanfermann, Marie Christine; Lang, Valerie Susanne; Lange, Joern Christian; Langenberg, Robert Johannes; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Lapertosa, Alessandro; Laplace, Sandrine; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Lau, Tak Shun; Laudrain, Antoine; Lavorgna, Marco; Law, Alexander Thomas; Laycock, Paul; Lazzaroni, Massimo; Le, Brian; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Quilleuc, Eloi Paul; Leblanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne; Lee, Claire Alexandra; Lee, Graham Richard; Lee JR, Lawrence; Lee, Shih-Chang; Lefebvre, Benoit; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehmann, Konstantin; Lehmann, Niklaus; Lehmann Miotto, Giovanna; Leight, William Axel; Leisos, Antonios; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Lerner, Giuseppe; Leroy, Claude; Les, Robert; Lesage, Arthur; Lester, Christopher; Levchenko, Mikhail; Leveque, Jessica; Levin, Daniel; Levinson, Lorne; Lewis, Dave; Li, Bing; Li, Changqiao; Li, Haifeng; Li, Liang; Li, Qi; Li, Quanyin; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liberti, Barbara; Liblong, Aaron; Lie, Ki; Liem Arvidsson, Sebastian; Limosani, Antonio; Lin, Chiao-ying; Lin, Kuan-yu; Lin, Tai-hua; Linck, Rebecca Anne; Lindon, Jack Henry; Lindquist, Brian Edward; Lionti, Anthony Eric; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lister, Alison; Litke, Alan; Little, Jared David; Liu, Bo; Liu, Bingxuan; Liu, Hongbin; Liu, Hao; Liu, Jianbei; Liu, Jesse Kar Kee; Liu, Kun; Liu, Minghui; Liu, Peilian; Liu, Yanwen; Liu, Yang; Liu, Yanlin; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo, Cheuk Yee; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Loesle, Alena; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Longo, Luigi; Looper, Kristina Anne; Lopez Lopez, Jorge Andres; Lopez Paz, Ivan; Lopez Solis, Alvaro; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Losel, Philipp Jonathan; Lou, Xuanhong; Lou, Xinchou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lozano Bahilo, Jose Julio; Lu, Haonan; Lu, Miaoran; Lu, Nan; Lu, Yun-Ju; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Fred; Luise, Ilaria; Luminari, Lamberto; Lund-Jensen, Bengt; Lutz, Margaret Susan; Luzi, Pierre Marc; Lynn, David; Lysak, Roman; Lytken, Else; Lyu, Feng; Lyubushkin, Vladimir; Ma, Hong; Ma, LianLiang; Ma, Yanhui; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Machado Miguens, Joana; Madaffari, Daniele; Madar, Romain; Mader, Wolfgang; Madsen, Alexander; Madysa, Nico; Maeda, Jumpei; Maekawa, Koki; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magerl, Veronika; Maidantchik, Carmen; Maier, Thomas; Maio, Amelia; Majersky, Oliver; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Claire; Maltezos, Stavros; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandic, Igor; Maneira, Jose; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mankinen, Katja Hannele; Mann, Alexander; Manousos, Athanasios; Mansoulie, Bruno; Mansour, Jason Dhia; Mantoani, Matteo; Manzoni, Stefano; Marceca, Gino; March Ruiz, Luis; Marchese, Luigi; Marchiori, Giovanni; Marcisovsky, Michal; Marin Tobon, Cesar Augusto; Marjanovic, Marija; Marley, Daniel Edison; Marroquim, Fernando; Marshall, Zach; Martensson, Ulf Fredrik Mikael; Marti i Garcia, Salvador; Martin, Christopher Blake; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez Perez, Mario; Martinez Outschoorn, Verena; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Mason, Lara Hannan; Massa, Lorenzo; Massarotti, Paolo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Maettig, Peter; Maurer, Julien; Macek, Bostjan; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Maznas, Ioannis; Mazza, Simone Michele; Mc Fadden, Neil Christopher; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Tom; McClymont, Laurie Iain; McDonald, Emily; Mcfayden, Joshua Angus; Mchedlidze, Gvantsa; McKay, Madalyn Ann; McLean, Kayla Dawn; McMahon, Steve; Mcnamara, Peter Charles; Mcnicol, Christopher John; McPherson, Robert; Mdhluli, Joyful Elma; Meadows, Zachary Alden; Meehan, Samuel; Megy, Theo Jean; Mehlhase, Sascha; Mehta, Andrew; Meideck, Thomas; Meirose, Bernhard; Melini, Davide; Mellado Garcia, Bruce Rafael; Mellenthin, Johannes Donatus; Melo, Matej; Meloni, Federico; Melzer, Alexander; Menary, Stephen Burns; Mendes Gouveia, Emanuel Demetrio; Meng, Lingxin; Meng, Xiangting; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mergelmeyer, Sebastian; Merlassino, Claudia; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Christopher; Meyer, Jochen; Meyer, Jean-Pierre; Meyer Zu Theenhausen, Hanno; Miano, Fabrizio; Middleton, Robin; Mijovic, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuz, Marko; Milesi, Marco; Milic, Adriana; Millar, Declan Andrew; Miller, David; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minano, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Minegishi, Yuji; Ming, Yao; Mir, Lluisa-Maria; Mirto, Alessandro; Mistry, Khilesh Pradip; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mizukami, Atsushi; Mjoernmark, Jan-Ulf; Mkrtchyan, Tigran; Mlynarikova, Michaela; Moa, Torbjoern; Mochizuki, Kazuya; Mogg, Philipp; Mohapatra, Soumya; Molander, Simon; Moles-Valls, Regina; Mondragon, Matthew Craig; Moenig, Klaus; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Morange, Nicolas; Moreno, Deywis; Moreno Llacer, Maria; Morettini, Paolo; Morgenstern, Marcus; Morgenstern, Stefanie; Mori, Daniel; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, Alice Polyxeni; Morris, John; Morvaj, Ljiljana; Moschovakos, Paraschos; Mosidze, Maia; Moss, Harry James; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Moyse, Edward; Muanza, Steve; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Muenstermann, Daniel; Mullier, Geoffrey Andre; Munoz Sanchez, Francisca Javiela; Murin, Pavel; Murray, Bill; Murrone, Alessia; Muskinja, Miha; Mwewa, Chilufya; Myagkov, Alexey; Myers, John; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nagai, Koichi; Nagano, Kunihiro; Nagasaka, Yasushi; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Nanjo, Hajime; Napolitano, Fabrizio; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naryshkin, Iouri; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Michael Edward; Nemecek, Stanislav; Nemethy, Peter; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Newman, Paul; Ng, Tsz Yu; Ng, Yan Wing; Nguyen, Hoang Dai Nghia; Nguyen Manh, Tuan; Nibigira, Emery; Nickerson, Richard; Nicolaidou, Rosy; Nielsen, Jason; Nikiforou, Nikiforos; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nishu, Nishu; Nisius, Richard; Nitsche, Isabel; Nitta, Tatsumi; Nobe, Takuya; Noguchi, Yohei; Nomachi, Masaharu; Nomidis, Ioannis; Nomura, Marcelo Ayumu; Nooney, Tamsin; Nordberg, Markus; BIN NORJOHARUDDEEN, Nurfikri; Novak, Tadej; Novgorodova, Olga; Novotny, Radek; Nozka, Libor; Ntekas, Konstantinos; Nurse, Emily; Nuti, Francesco; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Abreu Juliao Ochoa De Castro, Maria Ines; Ochoa, Jean-pierre; O'Connor, Kelsey; Oda, Susumu; Odaka, Shigeru; Oerdek, Serhat; Oh, Alexander; Oh, Seog; Ohm, Christian; Oide, Hideyuki; Ojeda, Martina Laura; Okawa, Hideki; Okazaki, Yuta; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Oleiro Seabra, Luis Filipe; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver, Jason Lea; Olsson, Mats Joakim Robert; Olszewski, Andrzej; Olszowska, Jolanta; O'Neil, Dugan; Onofre, Antonio; Onogi, Kouta; Onyisi, Peter; Oppen, Henrik; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orgill, Emily Claire; Orlando, Nicola; O'Rourke, Abigail Alexandra; Orr, Robert; Osculati, Bianca; O'Shea, Val; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Ouyang, Qun; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pacalt, Josef; Pacey, Holly Ann; Pachal, Katherine; Pacheco Pages, Andres; Pacheco Rodriguez, Laura; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganini, Michela; Palacino, Gabriel; Palazzo, Serena; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Panagoulias, Ilias; Pandini, Carlo Enrico; Panduro Vazquez, Jose Guillermo; Pani, Priscilla; Panizzo, Giancarlo; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Paredes Saenz, Santiago Rafael; Parida, Bibhuti; Parker, Adam Jackson; Parker, Kerry Ann; Parker, Andy; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pascuzzi, Vincent; Pasner, Jacob Martin; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Francesca; Pasuwan, Patrawan; Pataraia, Sophio; Pater, Joleen; Pathak, Atanu; Pauly, Thilo; Pearson, Benjamin; Pedersen, Maiken; Pedraza Diaz, Lucia; Costa Batalha Pedro, Rute; Peleganchuk, Sergey; Penc, Ondrej; Peng, Cong; Peng, Haiping; Sotto-Maior Peralva, Bernardo; Perego, Marta Maria; Pereira Peixoto, Ana Paula; Perepelitsa, Dennis; Peri, Francesco; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Reinhild; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrov, Mariyan; Petrucci, Fabrizio; Pettee, Mariel Nelson; Pettersson, Nora Emilia; Peyaud, Alan; Pezoa, Raquel; Pham, Thu; Phillips, Forrest Hays; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Pickering, Mark Andrew; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pinamonti, Michele; Pinfold, James; Pitt, Michael; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Pluth, Daniel; Podberezko, Pavel; Poettgen, Ruth; Poggi, Riccardo; Poggioli, Luc; Pogrebnyak, Ivan; Pohl, David-leon; Pokharel, Ishan; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Ponomarenko, Daniil; Pontecorvo, Ludovico; Popeneciu, Gabriel Alexandru; Portillo Quintero, Dilia Maria; Pospisil, Stanislav; Potamianos, Karolos Jozef; Potrap, Igor; Potter, Christina; Potti, Harish; Poulsen, Trine; Poveda, Joaquin; Powell, Thomas Dennis; Pozo Astigarraga, Mikel Eukeni; Pralavorio, Pascal; Prell, Soeren; Price, Darren; Primavera, Margherita; Prince, Sebastien; Proklova, Nadezda; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Puri, Akshat; Puzo, Patrick; Qian, Jianming; Qin, Yang; Quadt, Arnulf; Queitsch-maitland, Michaela; Qureshi, Anum; Rados, Petar Kevin; Ragusa, Francesco; Rahal, Ghita; Raine, John Andrew; Rajagopalan, Srinivasan; Ramirez Morales, Andres; Rashid, Tasneem; Raspopov, Sergii; Ratti, Maria Giulia; Rauch, Daniel Mauricio; Rauscher, Felix; Rave, Stefan; Ravina, Baptiste; Ravinovich, Ilia; Rawling, Jacob Henry; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Reale, Marilea; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reed, Robert; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reiss, Andreas; Rembser, Christoph; Ren, Huan; Rescigno, Marco; Resconi, Silvia; Resseguie, Elodie Deborah; Rettie, Sebastien; Reynolds, Elliot; Rezanova, Olga; Reznicek, Pavel; Ricci, Ester; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rimoldi, Marco; Rinaldi, Lorenzo; Ripellino, Giulia; Ristic, Branislav; Ritsch, Elmar; Riu, Imma; Rivera Vergara, Juan Cristobal; Rizatdinova, Flera; Rizvi, Eram; Rizzi, Chiara; Roberts, Rhys Thomas; Robertson, Steven; Robinson, Dave; Robinson, James; Robson, Aidan; Rocco, Elena; Roda, Chiara; Rodina, Yulia; Rodriguez Bosca, Sergi; Rodriguez Perez, Andrea; Rodriguez Rodriguez, Daniel; Rodriguez Vera, Ana Maria; Roe, Shaun; Rogan, Christopher Sean; Rohne, Ole; Roehrig, Rainer; Roland, Christophe Pol A; Roloff, Jennifer Kathryn; Romaniouk, Anatoli; Romano, Marino; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosien, Nils-arne; Rossi, Edoardo; Rossi, Elvira; Rossi, Leonardo Paolo; Rossini, Lorenzo; Rosten, Jonatan Hans; Rosten, Rachel; Rotaru, Marina; Rothberg, Joseph; Rousseau, David; Roy, Avik; Roy, Debarati; Rozanov, Alexander; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Ruehr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Russell, Heather Lynn; Rutherfoord, John; Ruttinger, Elias Michael; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryu, Soo; Ryzhov, Andrey; Rzehorz, Gerhard Ferdinand; Sabatini, Paolo; Sabato, Gabriele; Sacerdoti, Sabrina; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Sahu, Arunika; Saimpert, Matthias; Saito, Masahiko; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakharov, Alexander; Salamani, Dalila; Salamanna, Giuseppe; Salazar Loyola, Javier Esteban; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Samarati, Jerome; Sammel, Dirk; Sampsonidis, Dimitrios; Sampsonidou, Despoina; Sánchez, Javier; Sanchez Pineda, Arturo Rodolfo; Sandaker, Heidi; Sander, Christian Oliver; Sandhoff, Marisa; Sandoval Usme, Carlos; Sankey, Dave; Sannino, Mario; Sano, Yuta; Sansoni, Andrea; Santoni, Claudio; Santos, Helena; Santoyo Castillo, Itzebelt; Santra, Arka; Sapronov, Andrey; Saraiva, Joao; Sasaki, Osamu; Sato, Koji; Sauvan, Emmanuel; Savard, Pierre; Savic, Natascha; Sawada, Ryu; Sawyer, Craig; Sawyer, Lee; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Timothy Paul; Schaarschmidt, Jana; Schacht, Peter; Schachtner, Balthasar Maria; Schaefer, Douglas; Schaefer, Leigh; Schaeffer, Jan; Schaepe, Steffen; Schaefer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharmberg, Nicolas; Schegelsky, Valery; Scheirich, Daniel; Schenck, Ferdinand; Schernau, Michael; Schiavi, Carlo; Schier, Sheena; Schildgen, Lara Katharina; Schillaci, Zachary Michael; Schioppa, Enrico Junior; Schioppa, Marco; Schleicher, Katharina; Schlenker, Stefan; Schmidt-Sommerfeld, Korbinian Ralf; Schmieden, Kristof; Schmitt, Christian; Schmitt, Stefan; Schmitz, Simon; Schmoeckel, Julian Constantin; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schopf, Elisabeth; Schott, Matthias; Schouwenberg, Jeroen; Schovancova, Jaroslava; Schramm, Steven; Schulte, Alexandra; Schultz-Coulon, Hans-Christian; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Sciandra, Andrea; Sciolla, Gabriella; Scornajenghi, Matteo; Scuri, Fabrizio; Scutti, Federico; Scyboz, Ludovic Michel; Searcy, Jacob; Sebastiani, Cristiano David; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seiss, Todd; Seixas, Jose; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen Jacob; Semprini-Cesari, Nicola; Sen, Sourav; Senkin, Sergey; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Sessa, Marco; Severini, Horst; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shahinian, Jeffrey David; Shaikh, Nabila Wahab; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Sharma, Abhishek; Sharma, Abhishek; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shen, Yu-Ting; Sherafati, Nima; Sherman, Alexander David; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shipsey, Ian Peter Joseph; Shirabe, Shohei; Shiyakova, Mariya; Shlomi, Jonathan; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyed Ruhollah; Shope, David Richard; Shrestha, Suyog; Shulga, Evgeny; Sicho, Petr; Sickles, Anne Marie; Sidebo, Per Edvin; Sideras Haddad, Elias; Sidiropoulou, Ourania; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, Jose Manuel; Silva, Manuel Jr; Silva Oliveira, Marcos Vinicius; Silverstein, Samuel; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simon, Manuel; Simoniello, Rosa; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Siral, Ismet; Sivoklokov, Serguei; Sjoelin, Joergen; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Slovak, Radim; Smakhtin, Vladimir; Smart, Ben; Smiesko, Juraj; Smirnov, Nikita; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Joshua Wyatt; Smith, Matthew; Smizanska, Maria; Smolek, Karel; Smykiewicz, Andrzej; Snesarev, Andrei; Snyder, Ian Michael; Snyder, Scott; Sobie, Randall; Soffa, Aaron Michael; Soffer, Abner; Sogaard, Andreas; Su, Daxian; Sokhrannyi, Grygorii; Solans, Carlos; Solar, Michael; Soldatov, Evgeny; Soldevila- Serrano, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Son, Hyungsuk; Song, Weimin; Sopczak, Andre; Sopkova, Filomena; Sosa Corral, David Eduardo; Sotiropoulou, Calliope Louisa; Sottocornola, Simone; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin Charles; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spano, Francesco; Sperlich, Dennis; Spettel, Fabian; Spieker, Thomas Malte; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spiteri, Dwayne Patrick; Spousta, Martin; Stabile, Alberto; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanislaus, Beojan; Stanitzki, Marcel Michael; Stapf, Birgit Sylvia; Stapnes, Steinar; Starchenko, Evgeny; Stark, Giordon Holtsberg; Stark, Jan; Stark, Simon Holm; Staroba, Pavel; Starovoitov, Pavel; Staerz, Steffen; Staszewski, Rafal; Stegler, Martin; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stevenson, Thomas James; Stewart, Graeme; Stockton, Mark; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara Kristina; Strauss, Michael; Strizenec, Pavol; Stroehmer, Raimund; Strom, David; Stroynowski, Ryszard; Struebig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Stupak, John; Styles, Nicholas Adam; Su, Dong; Su, Jun; Suchek, Stanislav; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultan, Dms; Sultanov, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Suruliz, Kerim; Suster, Carl; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian J; Swift, Stewart Patrick; Sydorenko, Alexander; Sykora, Ivan; Sykora, Tomas; Ta, Duc Bao; Tackmann, Kerstin; Kinghorn-taenzer, Joseph Peter; Taffard, Anyes; Tafirout, Reda; Tahirovic, Elvedin; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takasugi, Eric Hayato; Takeda, Kosuke; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tanaka, Junichi; Tanaka, Masahiro; Tanaka, Reisaburo; Tannenwald, Benjamin Bordy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarek Abouelfadl Mohamed, Ahmed; Tarem, Shlomit; Tarna, Grigore; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Aaron; Taylor, Alan James; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Tee, Amy Selvi; Teixeira-Dias, Pedro; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Thais, Savannah Jennifer; Theveneaux-Pelzer, Timothee; Thiele, Fabian; Thomas, David William; Thomas, Juergen; Thompson, Stan; Thompson, Paul; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Tian, Yun; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorova-Nova, Sharka; Todt, Stefanie; Tojo, Junji; Tokar, Stanislav; Tokushuku, Katsuo; Tolley, Emma; Tomiwa, Kehinde Gbenga; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Baojia; Tornambe, Peter; Torrence, Eric; Torres, Heberth; Torro Pastor, Emma; Tosciri, Cecilia; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Treado, Colleen Jennifer; Trefzger, Thomas; Tresoldi, Fabio; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocme, Benjamin; Trofymov, Artur; Troncon, Clara; Trovatelli, Monica; Trovato, Fabrizio; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tsai, Fang-ying; Tseng, Jeffrey; Tsiareshka, Pavel; Tsirigotis, Apostolos; Tsirintanis, Nikolaos; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tu, Yanjun; Tudorache, Alexandra; Tudorache, Valentina; Tulbure, Traian Tiberiu; Tuna, Alexander Naip; Turchikhin, Semen; Turgeman, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tzovara, Eftychia; Ucchielli, Giulia; Ueda, Ikuo; Ughetto, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Uno, Kenta; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usui, Junya; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vadla, Knut Oddvar Hoie; Vaidya, Amal; Valderanis, Chrysostomos; Valdes Santurio, Eduardo; Valente, Marco; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Vallance, Robert Adam; Vallier, Alexis Roger Louis; Valls Ferrer, Juan Antonio; Van Daalen, Tal Roelof; van der Graaf, Harry; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vaniachine, Alexandre; Vankov, Peter; Vari, Riccardo; Varnes, Erich; Varni, Carlo; Varol, Tulin; Varouchas, Dimitris; Varvell, Kevin; Vasquez Arenas, Gerardo Alexis; Vasquez, Jared Gregory; Vazeille, Francois; Vazquez Furelos, David; Vazquez Schroeder, Tamara; Veatch, Jason; Vecchio, Valentina; Veloce, Laurelle Maria; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Vergel Infante, Carlos Miguel; Vergis, Christos; Verkerke, Wouter; Vermeulen, Ambrosius Thomas; Vermeulen, Jos; Vetterli, Michel; Viaux Maira, Nicolas; Vicente Barreto Pinto, Mateus; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigani, Luigi; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vishwakarma, Akanksha; Vittori, Camilla; Vivarelli, Iacopo; Vlachos, Sotirios; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Von Buddenbrock, Stefan Erich; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Sfiligoj, Tina; Vuillermet, Raphael; Vukotic, Ilija; Zenis, Tibor; Zivkovic, Lidija; Wagner, Peter; Wagner, Wolfgang; Wagner-kuhr, Jeannine; Wahlberg, Hernan; Wahrmund, Sebastian; Wakamiya, Kotaro; Walbrecht, Verena Maria; Walder, James; Walker, Rodney; Walker, Stuart Derek; Walkowiak, Wolfgang; Wallangen, Veronica; Wang, Ann Miao; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jin; Wang, Jike; Wang, Peilong; Wang, Qing; Wang, Renjie; Wang, Rongkun; Wang, Rui; Wang, Song-Ming; Wang, Wei; Wang, Wenxiao; Wang, Weitao; Wang, Yufeng; Wang, Zirui; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Watkins, Peter; Watson, Alan; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Aaron Foley; Webb, Samuel; Weber, Christian; Weber, Michele; Weber, Stephen Albert; Weber, Sebastian Mario; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weirich, Marcel; Weiser, Christian; Wells, Pippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Michael David; Werner, Per; Wessels, Martin; Weston, Thomas Daniel; Whalen, Kathleen; Whallon, Nikola Lazar; Wharton, Andrew Mark; White, Aaron; White, Andrew; White, Martin; White, Ryan; Whiteson, Daniel; Whitmore, Ben William; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wiglesworth, Craig; Wiik, Liv Antje Mari; Wildauer, Andreas; Wilk, Fabian; Wilkens, Henric George; Wilkins, Lewis Joseph; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wingerter-Seez, Isabelle; Winkels, Emma; Winklmeier, Frank; Winston, Oliver James; Winter, Benedict Tobias; Wittgen, Matthias; Wobisch, Markus; Wolf, Anton; Wolf, Tim Michael Heinz; Wolff, Robert; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Vincent Wai Sum; Woods, Natasha Lee; Worm, Steven; Wosiek, Barbara; Wozniak, Krzysztof; Wraight, Kenneth; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xi, Zhaoxu; Xia, Ligang; Xu, Da; Xu, Hanlin; Xu, Lailin; Xu, Tairan; Xu, Wenhao; Yabsley, Bruce; Yacoob, Sahal; Yajima, Kazuki; Yallup, David Paul; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamanaka, Takashi; Yamane, Fumiya; Yamatani, Masahiro; Yamazaki, Tomohiro; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Siqi; Yang, Yi-lin; Yang, Zongchang; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yigitbasi, Efe; Yildirim, Eda; Yorita, Kohei; Yoshihara, Keisuke; Young, Christopher John; Young, Charles; Yu, Jaehoon; Yu, Jie; Yue, Xiaoguang; Yuen, Stephanie Pui Yan; Zabinski, Bartlomiej; Zacharis, George; Zaffaroni, Ettore; Zaidan, Remi; Zaitsev, Alexander; Zakareishvili, Tamar; Zakharchuk, Nataliia; Zalieckas, Justas; Zambito, Stefano; Zanzi, Daniele; Zaripovas, Donatas Ramilas; Zeissner, Sonja Verena; Zeitnitz, Christian; Zemaityte, Gabija; Zeng, Jian Cong; Zeng, Qi; Zenin, Oleg; Zerwas, Dirk; Zgubic, Miha; Zhang, Dongliang; Zhang, Dengfeng; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Liqing; Zhang, Matt; Zhang, Peng; Zhang, Ruiqi; Zhang, Rui; Zhang, Xueyao; Zhang, Yu; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhou, Bing; Zhou, Chen; Zhou, Li; Zhou, Maosen; Zhou, Mingliang; Zhou, Ning; Zhou, You; Zhu, Cheng Guang; Zhu, Heling; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zhulanov, Vladimir; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; Zoch, Knut; Zorbas, Theodoros Georgio; Zou, Rui; zur Nedden, Martin; Zwalinski, Lukasz

    2018-01-01

    A search for vector-like quarks is presented, which targets their decay into a $Z$ boson and a third-generation Standard Model quark. In the case of a vector-like quark $T$ ($B$) with charge $+2/3e$ ($-1/3e$), the decay searched for is $T \\rightarrow Zt$ ($B \\rightarrow Zb$). Data for this analysis were taken during 2015 and 2016 with the ATLAS detector at the Large Hadron Collider and correspond to 36.1 fb$^{-1}$ of $pp$ collisions at $\\sqrt{s} = 13$ TeV. The final state used is characterized by the presence of a $Z$ boson with high transverse momentum, which is reconstructed from a pair of opposite-sign same-flavor leptons, as well as $b$-tagged jets. Pair- and single-production of vector-like quarks are both taken into account and are each searched for using optimized dileptonic exclusive and trileptonic inclusive event selections. In these selections, the high scalar sum of jet transverse momenta, the presence of high-transverse-momentum large-radius jets, as well as - in the case of the single-production...

  10. Experimental evidence for s-wave pairing symmetry in superconducting Cu(x)Bi2Se3 single crystals using a scanning tunneling microscope.

    Science.gov (United States)

    Levy, Niv; Zhang, Tong; Ha, Jeonghoon; Sharifi, Fred; Talin, A Alec; Kuk, Young; Stroscio, Joseph A

    2013-03-15

    Topological superconductors represent a newly predicted phase of matter that is topologically distinct from conventional superconducting condensates of Cooper pairs. As a manifestation of their topological character, topological superconductors support solid-state realizations of Majorana fermions at their boundaries. The recently discovered superconductor Cu(x)Bi(2)Se(3) has been theoretically proposed as an odd-parity superconductor in the time-reversal-invariant topological superconductor class, and point-contact spectroscopy measurements have reported the observation of zero-bias conductance peaks corresponding to Majorana states in this material. Here we report scanning tunneling microscopy measurements of the superconducting energy gap in Cu(x)Bi(2)Se(3) as a function of spatial position and applied magnetic field. The tunneling spectrum shows that the density of states at the Fermi level is fully gapped without any in-gap states. The spectrum is well described by the Bardeen-Cooper-Schrieffer theory with a momentum independent order parameter, which suggests that Cu(x)Bi(2)Se(3) is a classical s-wave superconductor contrary to previous expectations and measurements.

  11. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  12. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    Science.gov (United States)

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  13. Chip based single cell analysis for nanotoxicity assessment.

    Science.gov (United States)

    Shah, Pratikkumar; Kaushik, Ajeet; Zhu, Xuena; Zhang, Chengxiao; Li, Chen-Zhong

    2014-05-07

    Nanomaterials, because of their tunable properties and performances, have been utilized extensively in everyday life related consumable products and technology. On exposure, beyond the physiological range, nanomaterials cause health risks via affecting the function of organisms, genomic systems, and even the central nervous system. Thus, new analytical approaches for nanotoxicity assessment to verify the feasibility of nanomaterials for future use are in demand. The conventional analytical techniques, such as spectrophotometric assay-based techniques, usually require a lengthy and time-consuming process and often produce false positives, and often cannot be implemented at a single cell level measurement for studying cell behavior without interference from its surrounding environment. Hence, there is a demand for a precise, accurate, sensitive assessment for toxicity using single cells. Recently, due to the advantages of automation of fluids and minimization of human errors, the integration of a cell-on-a-chip (CoC) with a microfluidic system is in practice for nanotoxicity assessments. This review explains nanotoxicity and its assessment approaches with advantages/limitations and new approaches to overcome the confines of traditional techniques. Recent advances in nanotoxicity assessment using a CoC integrated with a microfluidic system are also discussed in this review, which may be of use for nanotoxicity assessment and diagnostics.

  14. Fast recognition of single molecules based on single-event photon statistics

    International Nuclear Information System (INIS)

    Dong Shuangli; Huang Tao; Liu Yuan; Wang Jun; Zhang Guofeng; Xiao Liantuan; Jia Suotang

    2007-01-01

    Mandel's Q parameter, which is determined from single-event photon statistics, provides an alternative way to recognize single molecules with fluorescence detection, other than the second-order correlation function. It is shown that the Q parameter of an assumed ideal double-molecule fluorescence with the same average photon number as that of the sample fluorescence can act as the criterion for single-molecule recognition. The influence of signal-to-background ratio and the error estimates for photon statistics are also presented. We have applied this method to ascertain single Cy5 dye molecules within hundreds of milliseconds

  15. Single-fraction vs. fractionated linac-based stereotactic radiosurgery for vestibular schwannoma: a single-institution study

    NARCIS (Netherlands)

    Meijer, O. W. M.; Vandertop, W. P.; Baayen, J. C.; Slotman, B. J.

    2003-01-01

    PURPOSE: In this single-institution trial, we investigated whether fractionated stereotactic radiation therapy is superior to single-fraction linac-based radiosurgery with respect to treatment-related toxicity and local control in patients with vestibular schwannoma. METHODS AND MATERIALS: All 129

  16. Optical Sensor Based on a Single CdS Nanobelt

    Directory of Open Access Journals (Sweden)

    Lei Li

    2014-04-01

    Full Text Available In this paper, an optical sensor based on a cadmium sulfide (CdS nanobelt has been developed. The CdS nanobelt was synthesized by the vapor phase transportation (VPT method. X-Ray Diffraction (XRD and Transmission Electron Microscopy (TEM results revealed that the nanobelt had a hexagonal wurtzite structure of CdS and presented good crystal quality. A single nanobelt Schottky contact optical sensor was fabricated by the electron beam lithography (EBL technique, and the device current-voltage results showed back-to-back Schottky diode characteristics. The photosensitivity, dark current and the decay time of the sensor were 4 × 104, 31 ms and 0.2 pA, respectively. The high photosensitivity and the short decay time were because of the exponential dependence of photocurrent on the number of the surface charges and the configuration of the back to back Schottky junctions.

  17. Optical sensor based on a single CdS nanobelt.

    Science.gov (United States)

    Li, Lei; Yang, Shuming; Han, Feng; Wang, Liangjun; Zhang, Xiaotong; Jiang, Zhuangde; Pan, Anlian

    2014-04-23

    In this paper, an optical sensor based on a cadmium sulfide (CdS) nanobelt has been developed. The CdS nanobelt was synthesized by the vapor phase transportation (VPT) method. X-Ray Diffraction (XRD) and Transmission Electron Microscopy (TEM) results revealed that the nanobelt had a hexagonal wurtzite structure of CdS and presented good crystal quality. A single nanobelt Schottky contact optical sensor was fabricated by the electron beam lithography (EBL) technique, and the device current-voltage results showed back-to-back Schottky diode characteristics. The photosensitivity, dark current and the decay time of the sensor were 4 × 10⁴, 31 ms and 0.2 pA, respectively. The high photosensitivity and the short decay time were because of the exponential dependence of photocurrent on the number of the surface charges and the configuration of the back to back Schottky junctions.

  18. Threshold quantum secret sharing based on single qubit

    Science.gov (United States)

    Lu, Changbin; Miao, Fuyou; Meng, Keju; Yu, Yue

    2018-03-01

    Based on unitary phase shift operation on single qubit in association with Shamir's ( t, n) secret sharing, a ( t, n) threshold quantum secret sharing scheme (or ( t, n)-QSS) is proposed to share both classical information and quantum states. The scheme uses decoy photons to prevent eavesdropping and employs the secret in Shamir's scheme as the private value to guarantee the correctness of secret reconstruction. Analyses show it is resistant to typical intercept-and-resend attack, entangle-and-measure attack and participant attacks such as entanglement swapping attack. Moreover, it is easier to realize in physic and more practical in applications when compared with related ones. By the method in our scheme, new ( t, n)-QSS schemes can be easily constructed using other classical ( t, n) secret sharing.

  19. Single image interpolation via adaptive nonlocal sparsity-based modeling.

    Science.gov (United States)

    Romano, Yaniv; Protter, Matan; Elad, Michael

    2014-07-01

    Single image interpolation is a central and extensively studied problem in image processing. A common approach toward the treatment of this problem in recent years is to divide the given image into overlapping patches and process each of them based on a model for natural image patches. Adaptive sparse representation modeling is one such promising image prior, which has been shown to be powerful in filling-in missing pixels in an image. Another force that such algorithms may use is the self-similarity that exists within natural images. Processing groups of related patches together exploits their correspondence, leading often times to improved results. In this paper, we propose a novel image interpolation method, which combines these two forces-nonlocal self-similarities and sparse representation modeling. The proposed method is contrasted with competitive and related algorithms, and demonstrated to achieve state-of-the-art results.

  20. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  1. Remote heterodyne millimeter-wave over fiber based OFDM-PON with master-to-slave injected dual-mode colorless FPLD pair.

    Science.gov (United States)

    Chen, Hsiang-Yu; Chi, Yu-Chieh; Lin, Gong-Ru

    2015-08-24

    A remote heterodyne millimeter-wave (MMW) carrier at 47.7 GHz over fiber synthesized with the master-to-slave injected dual-mode colorless FPLD pair is proposed, which enables the future connection between the wired fiber-optic 64-QAM OFDM-PON at 24 Gb/s with the MMW 4-QAM OFDM wireless network at 2 Gb/s. Both the single- and dual-mode master-to-slave injection-locked colorless FPLD pairs are compared to optimize the proposed 64-QAM OFDM-PON. For the unamplified single-mode master, the slave colorless FPLD successfully performs the 64-QAM OFDM data at 24 Gb/s with EVM, SNR and BER of 8.5%, 21.5 dB and 2.9 × 10(-3), respectively. In contrast, the dual-mode master-to-slave injection-locked colorless FPLD pair with amplified and unfiltered master can transmit 64-QAM OFDM data at 18 Gb/s over 25-km SMF to provide EVM, SNR and BER of 8.2%, 21.8 dB and 2.2 × 10(-3), respectively. For the dual-mode master-to-slave injection-locked colorless FPLD pair, even though the modal dispersion occurred during 25-km SMF transmission makes it sacrifice the usable OFDM bandwidth by only 1 GHz, which guarantees the sufficient encoding bitrate for the optically generated MMW carrier to implement the fusion of MMW wireless LAN and DWDM-PON with cost-effective and compact architecture. As a result, the 47.7-GHz MMW carrier remotely beat from the dual-mode master-to-slave injection-locked colorless FPLD pair exhibits an extremely narrow bandwidth of only 0.48 MHz. After frequency down-conversion operation, the 47.7-GHz MMW carrier successfully delivers 4-QAM OFDM data up to 2 Gb/s with EVM, SNR and BER of 33.5%, 9.51 dB and 1.4 × 10(-3), respectively.

  2. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    Science.gov (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to p