Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
van der Linde, Karina; Doehlemann, Gunther
2013-01-01
While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.
A conversation analysis of the function of silence in writing conferences
Directory of Open Access Journals (Sweden)
Milad Mirzaee
2016-07-01
Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.
Stability of RNA silencing-based traits after virus infection
DEFF Research Database (Denmark)
Jørgensen, Bodil; Albrechtsen, Merete
2007-01-01
with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Cui, Hongguang; Wang, Aiming
2017-03-01
RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.
Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A
2016-06-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.
Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E
2010-12-15
N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.
Bodies, Spaces, Voices, Silences
Directory of Open Access Journals (Sweden)
Donatella Mazzoleni
2013-07-01
Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.
van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther
2011-01-01
Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).
Communicative Silences: Forms and Functions
Bruneau, Thomas J.
1973-01-01
The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN
Mei, Yu; Kernodle, Bliss M.; Hill, John H.
2016-01-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311
Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis
Directory of Open Access Journals (Sweden)
Rita Marta
2014-10-01
Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.
DEFF Research Database (Denmark)
Gomes, Maria João; Kennedy, Patrick J; Martins, Susana
2017-01-01
AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.
2004-01-01
Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Li, Airong; Hooli, Basavaraj; Mullin, Kristina; Tate, Rebecca E; Bubnys, Adele; Kirchner, Rory; Chapman, Brad; Hofmann, Oliver; Hide, Winston; Tanzi, Rudolph E
2017-04-15
SOX5 encodes a transcription factor that is expressed in multiple tissues including heart, lung and brain. Mutations in SOX5 have been previously found in patients with amyotrophic lateral sclerosis (ALS) and developmental delay, intellectual disability and dysmorphic features. To characterize the neuronal role of SOX5, we silenced the Drosophila ortholog of SOX5, Sox102F, by RNAi in various neuronal subtypes in Drosophila. Silencing of Sox102F led to misorientated and disorganized michrochaetes, neurons with shorter dendritic arborization (DA) and reduced complexity, diminished larval peristaltic contractions, loss of neuromuscular junction bouton structures, impaired olfactory perception, and severe neurodegeneration in brain. Silencing of SOX5 in human SH-SY5Y neuroblastoma cells resulted in a significant repression of WNT signaling activity and altered expression of WNT-related genes. Genetic association and meta-analyses of the results in several large family-based and case-control late-onset familial Alzheimer's disease (LOAD) samples of SOX5 variants revealed several variants that show significant association with AD disease status. In addition, analysis for rare and highly penetrate functional variants revealed four novel variants/mutations in SOX5, which taken together with functional prediction analysis, suggests a strong role of SOX5 causing AD in the carrier families. Collectively, these findings indicate that SOX5 is a novel candidate gene for LOAD with an important role in neuronal function. The genetic findings warrant further studies to identify and characterize SOX5 variants that confer risk for AD, ALS and intellectual disability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Identification and characterization of two RNA silencing suppressors encoded by ophioviruses
Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura
2017-01-01
Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the
Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S
2012-03-01
Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.
Directory of Open Access Journals (Sweden)
Dashuai Mu
Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.
Directory of Open Access Journals (Sweden)
Huijuan Zhang
2016-08-01
Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.
PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.
Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong
2017-02-01
Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald
2016-10-01
Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.
2012-01-01
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.
The dynamics and efficacy of antiviral RNA silencing: A model study
Directory of Open Access Journals (Sweden)
Hogeweg Paulien
2008-03-01
Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.
DEFF Research Database (Denmark)
Søndergaard, Katia Dupret
The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...
Optical silencing of C. elegans cells with arch proton pump.
Directory of Open Access Journals (Sweden)
Ayako Okazaki
Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.
Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun
2016-01-01
ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors
Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping
2016-11-15
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate
Energy Technology Data Exchange (ETDEWEB)
Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)
2012-09-10
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.
Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L
DEFF Research Database (Denmark)
Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon
2017-01-01
Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity
DEFF Research Database (Denmark)
Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C
2011-01-01
expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...
DEFF Research Database (Denmark)
Nielsen, Troels T; Nielsen, Jørgen E
2013-01-01
Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...
Directory of Open Access Journals (Sweden)
Tanurdzic Milos
2004-04-01
Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.
Calcium signalling silencing in atrial fibrillation.
Greiser, Maura
2017-06-15
Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio
2012-01-01
RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Anti-viral RNA silencing: do we look like plants ?
Directory of Open Access Journals (Sweden)
Lecellier Charles-Henri
2006-01-01
Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.
Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.
Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio
2016-09-01
We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.
A novel RNA transcript with antiapoptotic function is silenced in fragile X syndrome.
Directory of Open Access Journals (Sweden)
Ahmad M Khalil
2008-01-01
Full Text Available Several genome-wide transcriptomics efforts have shown that a large percentage of the mammalian genome is transcribed into RNAs, however, only a small percentage (1-2% of these RNAs is translated into proteins. Currently there is an intense interest in characterizing the function of the different classes of noncoding RNAs and their relevance to human disease. Using genomic approaches we discovered FMR4, a primate-specific noncoding RNA transcript (2.4 kb that resides upstream and likely shares a bidirectional promoter with FMR1. FMR4 is a product of RNA polymerase II and has a similar half-life to FMR1. The CGG expansion in the 5' UTR of FMR1 appears to affect transcription in both directions as we found FMR4, similar to FMR1, to be silenced in fragile X patients and up-regulated in premutation carriers. Knockdown of FMR4 by several siRNAs did not affect FMR1 expression, nor vice versa, suggesting that FMR4 is not a direct regulatory transcript for FMR1. However, FMR4 markedly affected human cell proliferation in vitro; siRNAs knockdown of FMR4 resulted in alterations in the cell cycle and increased apoptosis, while the overexpression of FMR4 caused an increase in cell proliferation. Collectively, our results demonstrate an antiapoptotic function of FMR4 and provide evidence that a well-studied genomic locus can show unexpected functional complexity. It cannot be excluded that altered FMR4 expression might contribute to aspects of the clinical presentation of fragile X syndrome and/or related disorders.
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien
2017-07-01
The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.
Directory of Open Access Journals (Sweden)
Le Wang
2016-01-01
Full Text Available Dihydroflavanol 4-reductase (DFR is a key later enzyme involved in two polyphenols’ (anthocyanins and proanthocyanidins (PAs biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1 was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (–-epicatachin and (–-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (–-catachin and (–-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.
Directory of Open Access Journals (Sweden)
Adrian Valli
Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S
2006-11-01
Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.
Directory of Open Access Journals (Sweden)
Changho Eun
Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.
Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.
Directory of Open Access Journals (Sweden)
Guido Veit
2016-05-01
Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
Numerical methods for characterization of synchrotron radiation based on the Wigner function method
Directory of Open Access Journals (Sweden)
Takashi Tanaka
2014-06-01
Full Text Available Numerical characterization of synchrotron radiation based on the Wigner function method is explored in order to accurately evaluate the light source performance. A number of numerical methods to compute the Wigner functions for typical synchrotron radiation sources such as bending magnets, undulators and wigglers, are presented, which significantly improve the computation efficiency and reduce the total computation time. As a practical example of the numerical characterization, optimization of betatron functions to maximize the brilliance of undulator radiation is discussed.
Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing
Directory of Open Access Journals (Sweden)
Elisabeth H. Vollmann
2017-06-01
Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester
Directory of Open Access Journals (Sweden)
Amelia Peral Crespo
2015-11-01
Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word
DEFF Research Database (Denmark)
Dupret, Katia
2018-01-01
static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...
[Cloning and functional characterization of phytoene desaturase in Andrographis paniculata].
Shen, Qin-qin; Li, Li-xia; Zhan, Peng-lin; Wang, Qiang
2015-10-01
A full-length cDNA of phytoene desaturase (PDS) gene from Andrographis paniculata was obtained through RACE-PCR. The cDNA sequence consists of 2 224 bp with an intact ORF of 1 752 bp (GeneBank: KP982892), encoding a ploypeptide of 584 amino acids. Homology analysis showed that the deduced protein has extensive sequence similarities to PDS from other plants, and contains a conserved NAD ( H) -binding domain of plant dehydrase cofactor binding-domain in N-terminal. Phylogenetic analysis demonstrated that ApPDS was more related to PDS of Sesamum indicum and Pogostemon cablin. The semi-quantitative RT-PCR analysis revealed that ApPDS expressed in whole aboveground tissues with the highest expression in leaves. Virus induced gene silencing (VIGS) was performed to characterize the functional of ApPDS in planta. Significant photobleaching was not observed in infiltrated leaves, while the PDS gene has been down-regulated significantly at the yellowish area. To the best of our knowledge, this represents the first report of PDS gene cloning and functional characterization from A. paniculata, which lays the foundation for further investigation of new genes, especially that correlative to andrographolide biosynthetic pathway.
Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu
2016-11-01
Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.
Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian
2012-02-01
Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.
Directory of Open Access Journals (Sweden)
Đerić Gordana
2007-01-01
Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.
Silence in liturgy as the space for the Holy Ghost’s activity
Directory of Open Access Journals (Sweden)
Adelajda Sielepin
2006-06-01
Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.
Antiviral RNA silencing viral counter defense in plants
Bucher, E.C.
2006-01-01
The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing
Boron-based nanostructures: Synthesis, functionalization, and characterization
Bedasso, Eyrusalam Kifyalew
Boron-based nanostructures have not been explored in detail; however, these structures have the potential to revolutionize many fields including electronics and biomedicine. The research discussed in this dissertation focuses on synthesis, functionalization, and characterization of boron-based zero-dimensional nanostructures (core/shell and nanoparticles) and one-dimensional nanostructures (nanorods). The first project investigates the synthesis and functionalization of boron-based core/shell nanoparticles. Two boron-containing core/shell nanoparticles, namely boron/iron oxide and boron/silica, were synthesized. Initially, boron nanoparticles with a diameter between 10-100 nm were prepared by decomposition of nido-decaborane (B10H14) followed by formation of a core/shell structure. The core/shell structures were prepared using the appropriate precursor, iron source and silica source, for the shell in the presence of boron nanoparticles. The formation of core/shell nanostructures was confirmed using high resolution TEM. Then, the core/shell nanoparticles underwent a surface modification. Boron/iron oxide core/shell nanoparticles were functionalized with oleic acid, citric acid, amine-terminated polyethylene glycol, folic acid, and dopamine, and boron/silica core/shell nanoparticles were modified with 3-(amino propyl) triethoxy silane, 3-(2-aminoethyleamino)propyltrimethoxysilane), citric acid, folic acid, amine-terminated polyethylene glycol, and O-(2-Carboxyethyl)polyethylene glycol. A UV-Vis and ATR-FTIR analysis established the success of surface modification. The cytotoxicity of water-soluble core/shell nanoparticles was studied in triple negative breast cancer cell line MDA-MB-231 and the result showed the compounds are not toxic. The second project highlights optimization of reaction conditions for the synthesis of boron nanorods. This synthesis, done via reduction of boron oxide with molten lithium, was studied to produce boron nanorods without any
Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping
2017-08-15
Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N
[E. M. Jellinek's silenced and silencing transgenerational story].
Kelemen, Gábor; Márk, Mónika
2013-01-01
Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.
F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function
Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique
2006-01-01
Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454
The Role of Silence at the Retreats of a Buddhist Community
Directory of Open Access Journals (Sweden)
Orsolya Huszár
2016-12-01
Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
"Listening Silence" and Its Discursive Effects
Applebaum, Barbara
2016-01-01
While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…
Directory of Open Access Journals (Sweden)
Vijayalakshmi H Nagaraj
Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.
Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata
DEFF Research Database (Denmark)
Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie
2008-01-01
Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...
The physics of chromatin silencing: Bi-stability and front propagation
Sedighi, Mohammad
A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
The effects of sedative music, arousal music, and silence on electrocardiography signals.
Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid
2011-01-01
Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.
Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo
2016-12-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.
Directory of Open Access Journals (Sweden)
Luciano Marcondes Godoy
1999-01-01
Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.
Voice and silence in organizations
Directory of Open Access Journals (Sweden)
Moaşa, H.
2011-01-01
Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt
2017-07-27
In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Zeenia Jagga
Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a
Organizational Silence in Universities as the Predictor of Organizational Culture
Directory of Open Access Journals (Sweden)
Erkan YAMAN
2014-04-01
Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and
Directory of Open Access Journals (Sweden)
Mehdi Aghamohammadi
2017-04-01
Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.
Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian
2012-07-01
HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.
Strategy of gene silencing in cassava for validation of resistance genes
International Nuclear Information System (INIS)
Cortes, Simon; Lopez, Camilo
2010-01-01
Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced
Ombuds’ corner: Employee silence
Vincent Vuillemin
2013-01-01
Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct. For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...
Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W
Lou, Yonggen; Baldwin, Ian T.
2006-01-01
Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Active compressor engine silencer reduces exhaust noise
International Nuclear Information System (INIS)
Denenberg, J.N.; Miller, S.K.; Jay, M.A.
1994-01-01
An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Energy Technology Data Exchange (ETDEWEB)
Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi
2016-03-18
Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Millenson, Michael L
2003-01-01
Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.
Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G
2014-01-01
Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Directory of Open Access Journals (Sweden)
Jill C Preston
Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Surface functionalisation of PLGA nanoparticles for gene silencing
DEFF Research Database (Denmark)
Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob
2010-01-01
. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....
Directory of Open Access Journals (Sweden)
Christiane Noronha Fernandes-Brum
Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.
How Silent is the Right to Silence?
Directory of Open Access Journals (Sweden)
Katherine Biber
2012-11-01
Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.
Directory of Open Access Journals (Sweden)
Carlos R. Morales
2014-01-01
Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.
Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide
2017-10-13
Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Judicial review of administrative silence
Directory of Open Access Journals (Sweden)
Radošević Ratko S.
2015-01-01
Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.
Durability of timber silencers at Wairakei geothermal steam field
Energy Technology Data Exchange (ETDEWEB)
Hedley, M E
1979-02-01
After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.
The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.
Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique
2007-09-18
Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.
Directory of Open Access Journals (Sweden)
Saeedeh Shafiee Nahrkhalaji
2013-05-01
Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.
Directory of Open Access Journals (Sweden)
Oliver A Zill
Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.
Energy Technology Data Exchange (ETDEWEB)
Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)
2013-05-10
Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.
ABCE1 is a highly conserved RNA silencing suppressor.
Directory of Open Access Journals (Sweden)
Kairi Kärblane
Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing; Zhu, Jian-Kang
2010-01-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Breaching cultural silence: enhancing resilience among Ugandan ...
African Journals Online (AJOL)
Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Directory of Open Access Journals (Sweden)
Laura Mejía-Teniente
2015-11-01
Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Organizational Silence in Sports Employees
Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker
2016-01-01
Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…
Aghamohammadi, Mehdi
2017-01-01
One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing
2010-05-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.
Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S
2004-02-01
The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.
Directory of Open Access Journals (Sweden)
Ana Neves-Costa
2009-12-01
Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.
Characterization of the Diamond-like Carbon Based Functionally Gradient Film
Institute of Scientific and Technical Information of China (English)
无
2002-01-01
Diamond-like carbon coatings have been used as solid lubricating coatings in vacuum technology for their goodphysical and chemical properties. In this paper, the hybrid technique of unbalanced magnetron sputtering and plasmaimmersion ion implantation (PIll) was adopted to fabricate diamond-like carbon-based functionally gradient film,N/TiN/Ti(N,C)/DLC, on the 304 stainless steel substrate. The film was characterized by using Raman spectroscopyand glancing X-ray diffraction (GXRD), and the topography and surface roughness of the film was observed usingAFM. The mechanical properties of the film were evaluated by nano-indentation. The results showed that the surfaceroughness of the film was approximately 0.732 nm. The hardness and elastic modulus, fracture toughness andinterfacial fracture toughness of N/TiN/Ti(N,C)/DLC functionally gradient film were about 19.84 GPa, 190.03 GPa,3.75 MPa.m1/2 and 5.68 MPa@m1/2, respectively. Compared with that of DLC monolayer and C/TiC/DLC multilayer,this DLC gradient film has better qualities as a solid lubricating coating.
Small RNA-Mediated Epigenetic Myostatin Silencing
Directory of Open Access Journals (Sweden)
Thomas C Roberts
2012-01-01
Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.
Alfisyahrin; Isranuri, I.
2018-02-01
Active Noise Control is a technique to overcome noisy with noise or sound countered with sound in scientific terminology i.e signal countered with signals. This technique can be used to dampen relevant noise in accordance with the wishes of the engineering task and reducing automotive muffler noise to a minimum. Objective of this study is to develop a Active Noise Control which should cancel the noise of automotive Exhaust (Silencer) through Signal Processing Simulation methods. Noise generator of Active Noise Control is to make the opponent signal amplitude and frequency of the automotive noise. The steps are: Firstly, the noise of automotive silencer was measured to characterize the automotive noise that its amplitude and frequency which intended to be expressed. The opposed sound which having similar character with the signal source should be generated by signal function. A comparison between the data which has been completed with simulation calculations Fourier transform field data is data that has been captured on the muffler (noise silencer) Toyota Kijang Capsule assembly 2009. MATLAB is used to simulate how the signal processing noise generated by exhaust (silencer) using FFT. This opponent is inverted phase signal from the signal source 180° conducted by Instruments of Signal Noise Generators. The process of noise cancelation examined through simulation using computer software simulation. The result is obtained that attenuation of sound (noise cancellation) has a difference of 33.7%. This value is obtained from the comparison of the value of the signal source and the signal value of the opponent. So it can be concluded that the noisy signal can be attenuated by 33.7%.
Chinanteco children’s silences in different classroom situations
Directory of Open Access Journals (Sweden)
Valeria Rebolledo Angulo
2016-01-01
Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.
Zheng, Zhimin
2010-01-06
RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Helena Honig Mondekova
2017-12-01
Full Text Available Ticks are important vectors of serious human and animal disease-causing organisms, but their innate immunity can fight invading pathogens and may have the ability to reduce or block transmission to mammalian hosts. Lectins, sugar-binding proteins, can distinguish between self and non-self-oligosaccharide motifs on pathogen surfaces. Although tick hemolymph possesses strong lectin activity, and several lectins have already been isolated and characterized, little is known about the implementation of these molecules in tick immunity. Here, we have described and functionally characterized fibrinogen-related protein (FReP lectins in Ixodes ticks. We have shown that the FReP family contains at least 27 genes (ixoderins, ixo that could, based on phylogenetic and expression analyses, be divided into three groups with differing degrees of expansion. By using RNA interference-mediated gene silencing (RNAi we demonstrated that IXO-A was the main lectin in tick hemolymph. Further, we found that ixoderins were important for phagocytosis of Gram-negative bacteria and yeasts by tick hemocytes and that their expression was upregulated upon injection of microbes, wounding, or after blood feeding. However, although the tick hemocytes could swiftly phagocytose Borrelia afzelii spirochetes, their transmission and burst of infection in mice was not altered. Our results demonstrate that tick ixoderins are crucial immune proteins that work as opsonins in the tick hemolymph, targeting microbes for phagocytosis or lysis.
Exon silencing by UAGG motifs in response to neuronal excitation.
Directory of Open Access Journals (Sweden)
Ping An
2007-02-01
Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.
Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène
2007-11-01
Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry
Directory of Open Access Journals (Sweden)
Mehdi Afkhami Ardakani
2015-05-01
Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and
Choosing Silence for Equality in and through Schooling
Lees, Helen E.
2016-01-01
This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…
Zheng, Zheng; Appiano, Michela; Pavan, Stefano; Bracuto, Valentina; Ricciardi, Luigi; Visser, Richard G F; Wolters, Anne-Marie A; Bai, Yuling
2016-01-01
The MLO (Mildew Locus O) gene family encodes plant-specific proteins containing seven transmembrane domains and likely acting in signal transduction in a calcium and calmodulin dependent manner. Some members of the MLO family are susceptibility factors toward fungi causing the powdery mildew disease. In tomato, for example, the loss-of-function of the MLO gene SlMLO1 leads to a particular form of powdery mildew resistance, called ol-2, which arrests almost completely fungal penetration. This type of penetration resistance is characterized by the apposition of papillae at the sites of plant-pathogen interaction. Other MLO homologs in Arabidopsis regulate root response to mechanical stimuli (AtMLO4 and AtMLO11) and pollen tube reception by the female gametophyte (AtMLO7). However, the role of most MLO genes remains unknown. In this work, we provide a genome-wide study of the tomato SlMLO gene family. Besides SlMLO1, other 15 SlMLO homologs were identified and characterized with respect to their structure, genomic organization, phylogenetic relationship, and expression profile. In addition, by analysis of transgenic plants, we demonstrated that simultaneous silencing of SlMLO1 and two of its closely related homologs, SlMLO5 and SlMLO8, confer higher level of resistance than the one associated with the ol-2 mutation. The outcome of this study provides evidence for functional redundancy among tomato homolog genes involved in powdery mildew susceptibility. Moreover, we developed a series of transgenic lines silenced for individual SlMLO homologs, which lay the foundation for further investigations aimed at assigning new biological functions to the MLO gene family.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Functional Characterization of 4´OMT and 7OMT Genes in BIA Biosynthesis
Directory of Open Access Journals (Sweden)
Tugba eGurkok
2016-02-01
Full Text Available Alkaloids are diverse group of secondary metabolites generally found in plants. Opium poppy (Papaver somniferum L., the only commercial source of morphinan alkaloids, has been used as a medicinal plant since ancient times. It produces benzylisoquinoline alkaloids (BIA including the narcotic analgesic morphine, the muscle relaxant papaverine, and the anti-cancer agent noscapine. Though BIAs play crucial roles in many biological mechanisms their steps in biosynthesis and the responsible genes remain to be revealed. In this study, expressions of 3-hydroxy-N-methylcoclaurine 4´-O-methyltransferase (4´OMT and reticuline 7-O-methyltransferase (7OMT genes were subjected tomanipulation to functionally characterize their roles in BIA biosynthesis. Measurements of alkaloid accumulation were performed in leaf, stem and capsule tissues accordingly. Suppression of 4´OMT expression caused reduction in the total alkaloid content in stem tissue whereas total alkaloid content was significantly induced in the capsule. Silencing of the 7OMT gene also caused repression in total alkaloid content in the stem. On the other hand, over-expression of 4´OMT and 7OMT resulted in higher morphine accumulation in the stem but suppressed amount in the capsule. Moreover, differential expression in several BIA synthesis genes (CNMT, TYDC, 6OMT, SAT, COR, 4´OMT and 7OMT were observed upon manipulation of 4´OMT and 7OMT expression. Upon silencing and overexpression applications, tissue specific effects of these genes were identified. Manipulation of 4´OMT and 7OMT genes caused differentiated accumulation of BIAs including morphine and noscapine in capsule and stem tissues.
Transcriptional Silencing of Retroviral Vectors
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M.; Pedersen, F.S.
1996-01-01
. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...
International Nuclear Information System (INIS)
Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup
2015-01-01
RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)
Listen and the question of silence
DEFF Research Database (Denmark)
Doubinsky, Sebastien
2018-01-01
Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...
The ethics of silence: Does conflict of interest explain employee silence?
Anderson, James
2018-03-01
Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.
Silence as a Response to Everyday Violence
DEFF Research Database (Denmark)
Gammeltoft, Tine
2016-01-01
Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.
Directory of Open Access Journals (Sweden)
Jinhuan Pang
Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.
Directory of Open Access Journals (Sweden)
Xing-sheng Shu
Full Text Available BACKGROUND: PRDM (PRDI-BF1 and RIZ domain containing proteins are zinc finger proteins involved in multiple cellular regulations by acting as epigenetic modifiers. We studied a recently identified PRDM member PRDM5 for its epigenetic abnormality and tumor suppressive functions in multiple tumorigeneses. METHODOLOGY/PRINCIPAL FINDINGS: Semi-quantitative RT-PCR showed that PRDM5 was broadly expressed in human normal tissues, but frequently silenced or downregulated in multiple carcinoma cell lines due to promoter CpG methylation, including 80% (4/5 nasopharyngeal, 44% (8/18 esophageal, 76% (13/17 gastric, 50% (2/4 cervical, and 25% (3/12 hepatocellular carcinoma cell lines, but not in any immortalized normal epithelial cell lines. PRDM5 expression could be restored by 5-aza-2'-deoxycytidine demethylation treatment in silenced cell lines. PRDM5 methylation was frequently detected by methylation-specific PCR (MSP in multiple primary tumors, including 93% (43/46 nasopharyngeal, 58% (25/43 esophageal, 88% (37/42 gastric and 63% (29/46 hepatocellular tumors. PRDM5 was further found a stress-responsive gene, but its response was impaired when the promoter was methylated. Ectopic PRDM5 expression significantly inhibited tumor cell clonogenicity, accompanied by the inhibition of TCF/β-catenin-dependent transcription and downregulation of CDK4, TWIST1 and MDM2 oncogenes, while knocking down of PRDM5 expression lead to increased cell proliferation. ChIP assay showed that PRDM5 bound to its target gene promoters and suppressed their transcription. An inverse correlation between the expression of PRDM5 and activated β-catenin was also observed in cell lines. CONCLUSIONS/SIGNIFICANCE: PRDM5 functions as a tumor suppressor at least partially through antagonizing aberrant WNT/β-catenin signaling and oncogene expression. Frequent epigenetic silencing of PRDM5 is involved in multiple tumorigeneses, which could serve as a tumor biomarker.
LNA-antisense rivals siRNA for gene silencing
DEFF Research Database (Denmark)
Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan
2004-01-01
Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Characterization of the oncogenic function of centromere protein F in hepatocellular carcinoma
Energy Technology Data Exchange (ETDEWEB)
Dai, Yongdong; Liu, Lulu; Zeng, Tingting; Zhu, Ying-Hui [State Key Laboratory of Oncology in Southern China, Sun Yat-Sen University Cancer Center, Guangzhou (China); Li, Jiangchao [Vascular Biology Research Institute, Guangdong Pharmaceutical University, Guangzhou (China); Chen, Leilei [Department of Clinical Oncology, The University of Hong Kong, Pokfulam, Hong Kong (China); Li, Yan; Yuan, Yun-Fei [State Key Laboratory of Oncology in Southern China, Sun Yat-Sen University Cancer Center, Guangzhou (China); Ma, Stephanie, E-mail: stefma@hku.hk [Department of Clinical Oncology, The University of Hong Kong, Pokfulam, Hong Kong (China); State Key Laboratory for Liver Research, The University of Hong Kong, Pokfulam, Hong Kong (China); Guan, Xin-Yuan, E-mail: xyguan@hkucc.hku.hk [State Key Laboratory of Oncology in Southern China, Sun Yat-Sen University Cancer Center, Guangzhou (China); Department of Clinical Oncology, The University of Hong Kong, Pokfulam, Hong Kong (China); State Key Laboratory for Liver Research, The University of Hong Kong, Pokfulam, Hong Kong (China)
2013-07-12
Highlights: •Overexpression of CENPF is frequently detected in HCC. •Upregulation of CENPF serves as an independent prognosis factor in HCC patients. •CENPF functions as an oncogene in HCC by promoting cell G2/M transition. -- Abstract: Centromere protein F (CENPF) is an essential nuclear protein associated with the centromere-kinetochore complex and plays a critical role in chromosome segregation during mitosis. Up-regulation of CENPF expression has previously been detected in several solid tumors. In this study, we aim to study the expression and functional role of CENPF in hepatocellular carcinoma (HCC). We found CENPF was frequently overexpressed in HCC as compared with non-tumor tissue. Up-regulated CENPF expression in HCC was positively correlated with serum AFP, venous invasion, advanced differentiation stage and a shorter overall survival. Cox regression analysis found that overexpression of CENPF was an independent prognosis factor in HCC. Functional studies found that silencing CENPF could decrease the ability of the cells to proliferate, form colonies and induce tumor formation in nude mice. Silencing CENPF also resulted in the cell cycle arrest at G2/M checkpoint by down-regulating cell cycle proteins cdc2 and cyclin B1. Our data suggest that CENPF is frequently overexpressed in HCC and plays a critical role in driving HCC tumorigenesis.
Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna
2012-11-07
CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively
Mutuality, Self-Silencing, and Disordered Eating in College Women
Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.
2006-01-01
The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…
After the Blackbird Whistles: Listening to Silence in Classrooms
Schultz, Katherine
2010-01-01
Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…
Directory of Open Access Journals (Sweden)
Sandra Patricia Arenas Grisales
2012-08-01
Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Xiao Hui
2015-09-01
Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.
Tospovirus : induction and suppression of RNA silencing
Hedil, Marcio
2016-01-01
While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers
Ussher, Jane M.; Perz, Janette
2010-01-01
This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…
Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo
2015-01-01
Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.
Conifers have a unique small RNA silencing signature
Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.
2008-01-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela
2013-02-01
Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Directory of Open Access Journals (Sweden)
Louise E Atkinson
2013-02-01
Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong
2016-05-01
Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Control of thermoacoustic instability with a drum-like silencer
Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng
2017-10-01
Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.
Histone Methylation and Epigenetic Silencing in Breast Cancer
National Research Council Canada - National Science Library
Simon, Jeffrey A; Lange, Carol A
2008-01-01
.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...
Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?
Directory of Open Access Journals (Sweden)
Subhasis Banerjee
2001-01-01
Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.
No-Big-Silence teeb klubituuri / Urmas Hännile
Hännile, Urmas
2009-01-01
Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar
Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.
Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni
2015-12-02
Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette
2012-01-01
and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...
Toward a science of silence: The consequences of leaving a memory unsaid
DEFF Research Database (Denmark)
Stone, Charles; Coman, Alin; Brown, Adam
2012-01-01
of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.
Directory of Open Access Journals (Sweden)
Yan Liang
2013-11-01
Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.
Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut
2014-01-01
ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173
In vivo silencing of alpha-synuclein using naked siRNA
Directory of Open Access Journals (Sweden)
Charisse Klaus
2008-11-01
Full Text Available Abstract Background Overexpression of α-synuclein (SNCA in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD, possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked, murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression.
In vivo silencing of alpha-synuclein using naked siRNA
Lewis, Jada; Melrose, Heather; Bumcrot, David; Hope, Andrew; Zehr, Cynthia; Lincoln, Sarah; Braithwaite, Adam; He, Zhen; Ogholikhan, Sina; Hinkle, Kelly; Kent, Caroline; Toudjarska, Ivanka; Charisse, Klaus; Braich, Ravi; Pandey, Rajendra K; Heckman, Michael; Maraganore, Demetrius M; Crook, Julia; Farrer, Matthew J
2008-01-01
Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked), murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression. PMID:18976489
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
Directory of Open Access Journals (Sweden)
Jose C Garcia-Garcia
2009-06-01
Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.
Bibby, Chris; Hodgson, Murray
2017-01-01
The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
International Nuclear Information System (INIS)
Beck, Markus; Strand, Michael R.
2003-01-01
The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2004-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2005-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2006-01-01
...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...
A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.
Directory of Open Access Journals (Sweden)
Pengfei Ding
2015-06-01
Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.
Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong
2014-01-01
We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893
Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M
2014-10-01
Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing
Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie
2016-04-15
Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Johann Lavaud
Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.
Vugrinec, Sascha; Kroth, Peter G.
2012-01-01
Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333
The Silencing of the Knowledge-Base in Early Childhood Education and Care Professionalism
Campbell-Barr, Verity
2018-01-01
It is widely accepted that the early childhood education and care (ECEC) workforce is central to the quality of services. Modernist constructs of quality signal the importance of qualifications for quality, but the preoccupation with qualification levels silences questions about the knowledge required of ECEC professionals. Postmodern perspectives…
Huang, Feiyi; Liu, Tongkun; Hou, Xilin
2018-01-01
MADS-box genes form a large gene family in plants and are involved in multiple biological processes, such as flowering. However, the regulation mechanism of MADS-box genes in flowering remains unresolved, especially under short-term cold conditions. In the present study, we isolated BcMAF1 , a Pak-choi ( Brassica rapa ssp. Chinensis ) MADS AFFECTING FLOWERING ( MAF ), as a floral repressor and functionally characterized BcMAF1 in Arabidopsis and Pak-choi. Subcellular localization and sequence analysis indicated that BcMAF1 was a nuclear protein and contained a conserved MADS-box domain. Expression analysis revealed that BcMAF1 had higher expression levels in leaves, stems, and petals, and could be induced by short-term cold conditions in Pak-choi. Overexpressing BcMAF1 in Arabidopsis showed that BcMAF1 had a negative function in regulating flowering, which was further confirmed by silencing endogenous BcMAF1 in Pak-choi. In addition, qPCR results showed that AtAP3 expression was reduced and AtMAF2 expression was induced in BcMAF1 -overexpressing Arabidopsis . Meanwhile, BcAP3 transcript was up-regulated and BcMAF2 transcript was down-regulated in BcMAF1 -silencing Pak-choi. Yeast one-hybrid and dual luciferase transient assays showed that BcMAF1 could bind to the promoters of BcAP3 and BcMAF2 . These results indicated that BcAP3 and BcMAF2 might be the targets of BcMAF1. Taken together, our results suggested that BcMAF1 could negatively regulate flowering by directly activating BcMAF2 and repressing BcAP3 .
RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice
Directory of Open Access Journals (Sweden)
Jian Liu
2014-01-01
Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.
Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.
Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R
2017-05-01
Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain
Directory of Open Access Journals (Sweden)
Julia F Alterman
2015-01-01
Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.
Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David
2014-01-01
Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370
Relationship between Organizational Mobbing and Silence Behavior among Teachers
Hüsrevsahi, Selda Polat
2015-01-01
This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
The organisational silence of midwives and nurses: reasons and results.
Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra
2016-07-01
The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.
The RNA silencing pathway: the bits and pieces that matter.
Directory of Open Access Journals (Sweden)
2005-07-01
Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.
Matarazzo, Valery; Muscatelli, Françoise
2013-01-01
Genomic imprinting is a normal process of epigenetic regulation leading some autosomal genes to be expressed from one parental allele only, the other parental allele being silenced. The reasons why this mechanism has been selected throughout evolution are not clear; however, expression dosage is critical for imprinted genes. There is a paradox between the fact that genomic imprinting is a robust mechanism controlling the expression of specific genes and the fact that this mechanism is based on epigenetic regulation that, per se, should present some flexibility. The robustness has been well studied, revealing the epigenetic modifications at the imprinted locus, but the flexibility has been poorly investigated. Prader-Willi syndrome is the best-studied disease involving imprinted genes caused by the absence of expression of paternally inherited alleles of genes located in the human 15q11-q13 region. Until now, the silencing of the maternally inherited alleles was like a dogma. Rieusset et al. showed that in absence of the paternal Ndn allele, in Ndn +m/-p mice, the maternal Ndn allele is expressed at an extremely low level with a high degree of non-genetic heterogeneity. In about 50% of these mutant mice, this stochastic expression reduces birth lethality and severity of the breathing deficiency, correlated with a reduction in the loss of serotonergic neurons. Furthermore, using several mouse models, they reveal a competition between non-imprinted Ndn promoters, which results in monoallelic (paternal or maternal) Ndn expression, suggesting that Ndn monoallelic expression occurs in the absence of imprinting regulation. Importantly, specific expression of the maternal NDN allele is also detected in post-mortem brain samples of PWS individuals. Here, similar expression of the Magel2 maternal allele is reported in Magel2 +m/-p mice, suggesting that this loss of imprinting can be extended to other PWS genes. These data reveal an unexpected epigenetic flexibility of PWS
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
Directory of Open Access Journals (Sweden)
Ximena Suárez
2017-10-01
Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.
Flexible tools for gene expression and silencing in tomato.
Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre
2009-12-01
As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.
Characterization and Prediction of Chemical Functions and ...
Assessing exposures from the thousands of chemicals in commerce requires quantitative information on the chemical constituents of consumer products. Unfortunately, gaps in available composition data prevent assessment of exposure to chemicals in many products. Here we propose filling these gaps via consideration of chemical functional role. We obtained function information for thousands of chemicals from public sources and used a clustering algorithm to assign chemicals into 35 harmonized function categories (e.g., plasticizers, antimicrobials, solvents). We combined these functions with weight fraction data for 4115 personal care products (PCPs) to characterize the composition of 66 different product categories (e.g., shampoos). We analyzed the combined weight fraction/function dataset using machine learning techniques to develop quantitative structure property relationship (QSPR) classifier models for 22 functions and for weight fraction, based on chemical-specific descriptors (including chemical properties). We applied these classifier models to a library of 10196 data-poor chemicals. Our predictions of chemical function and composition will inform exposure-based screening of chemicals in PCPs for combination with hazard data in risk-based evaluation frameworks. As new information becomes available, this approach can be applied to other classes of products and the chemicals they contain in order to provide essential consumer product data for use in exposure-b
Suppressors of RNA silencing encoded by tomato leaf curl ...
Indian Academy of Sciences (India)
2013-01-06
Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.
Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death
Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P
2010-01-01
Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858
Huang, Zhao
2011-12-01
Compared to 'conventional' materials made from metal, glass, or ceramics, protein-based materials have unique mechanical properties. Furthermore, the morphology, mechanical properties, and functionality of protein-based materials may be optimized via sequence engineering for use in a variety of applications, including textile materials, biosensors, and tissue engineering scaffolds. The development of recombinant DNA technology has enabled the production and engineering of protein-based materials ex vivo. However, harsh production conditions can compromise the mechanical properties of protein-based materials and diminish their ability to incorporate functional proteins. Developing a new generation of protein-based materials is crucial to (i) improve materials assembly conditions, (ii) create novel mechanical properties, and (iii) expand the capacity to carry functional protein/peptide sequences. This thesis describes development of novel protein-based materials using Ultrabithorax, a member of the Hox family of proteins that regulate developmental pathways in Drosophila melanogaster. The experiments presented (i) establish the conditions required for the assembly of Ubx-based materials, (ii) generate a wide range of Ubx morphologies, (iii) examine the mechanical properties of Ubx fibers, (iv) incorporate protein functions to Ubx-based materials via gene fusion, (v) pattern protein functions within the Ubx materials, and (vi) examine the biocompatibility of Ubx materials in vitro. Ubx-based materials assemble at mild conditions compatible with protein folding and activity, which enables Ubx chimeric materials to retain the function of appended proteins in spatial patterns determined by materials assembly. Ubx-based materials also display mechanical properties comparable to existing protein-based materials and demonstrate good biocompatibility with living cells in vitro. Taken together, this research demonstrates the unique features and future potential of novel Ubx-based
Devulapally, Rammohan; Paulmurugan, Ramasamy
2013-01-01
Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830
Directory of Open Access Journals (Sweden)
Marek Ostaszewski
Full Text Available The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research.
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Idris, Ali
2010-12-01
A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
Directory of Open Access Journals (Sweden)
Valentina Bracuto
2017-09-01
Full Text Available Specific syntaxins, such as Arabidopsis AtPEN1 and its barley ortholog ROR2, play a major role in plant defense against powdery mildews. Indeed, the impairment of these genes results in increased fungal penetration in both host and non-host interactions. In this study, a genome-wide survey allowed the identification of 21 tomato syntaxins. Two of them, named SlPEN1a and SlPEN1b, are closely related to AtPEN1. RNAi-based silencing of SlPEN1a in a tomato line carrying a loss-of-function mutation of the susceptibility gene SlMLO1 led to compromised resistance toward the tomato powdery mildew fungus Oidium neolycopersici. Moreover, it resulted in a significant increase in the penetration rate of the non-adapted powdery mildew fungus Blumeria graminis f. sp. hordei. Codon-based evolutionary analysis and multiple alignments allowed the detection of amino acid residues that are under purifying selection and are specifically conserved in syntaxins involved in plant-powdery mildew interactions. Our findings provide both insights on the evolution of syntaxins and information about their function which is of interest for future studies on plant–pathogen interactions and tomato breeding.
Bracuto, Valentina; Appiano, Michela; Zheng, Zheng; Wolters, Anne-Marie A; Yan, Zhe; Ricciardi, Luigi; Visser, Richard G F; Pavan, Stefano; Bai, Yuling
2017-01-01
Specific syntaxins, such as Arabidopsis AtPEN1 and its barley ortholog ROR2, play a major role in plant defense against powdery mildews. Indeed, the impairment of these genes results in increased fungal penetration in both host and non-host interactions. In this study, a genome-wide survey allowed the identification of 21 tomato syntaxins. Two of them, named SlPEN1a and SlPEN1b , are closely related to AtPEN1 . RNAi-based silencing of SlPEN1a in a tomato line carrying a loss-of-function mutation of the susceptibility gene SlMLO1 led to compromised resistance toward the tomato powdery mildew fungus Oidium neolycopersici . Moreover, it resulted in a significant increase in the penetration rate of the non-adapted powdery mildew fungus Blumeria graminis f. sp. hordei . Codon-based evolutionary analysis and multiple alignments allowed the detection of amino acid residues that are under purifying selection and are specifically conserved in syntaxins involved in plant-powdery mildew interactions. Our findings provide both insights on the evolution of syntaxins and information about their function which is of interest for future studies on plant-pathogen interactions and tomato breeding.
Directory of Open Access Journals (Sweden)
Alison E Ringel
Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.
The Shadow of Silence on the Sexual Rights of Married Iranian Women
Directory of Open Access Journals (Sweden)
Roksana Janghorban
2015-01-01
Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:
Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity
Directory of Open Access Journals (Sweden)
Dawn Llewellyn
2016-06-01
Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...
Directory of Open Access Journals (Sweden)
Ebrahim Parcham
2017-01-01
Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
Directory of Open Access Journals (Sweden)
Katherine S. Bridge
2017-07-01
Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.
DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
Directory of Open Access Journals (Sweden)
Sizolwenkosi Mlotshwa
2008-03-01
Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.
FXR silencing in human colon cancer by DNA methylation and KRAS signaling.
Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L
2014-01-01
Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.
Directory of Open Access Journals (Sweden)
Paul McVeigh
2014-09-01
Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control
Uncertainty Analysis via Failure Domain Characterization: Unrestricted Requirement Functions
Crespo, Luis G.; Kenny, Sean P.; Giesy, Daniel P.
2011-01-01
This paper proposes an uncertainty analysis framework based on the characterization of the uncertain parameter space. This characterization enables the identification of worst-case uncertainty combinations and the approximation of the failure and safe domains with a high level of accuracy. Because these approximations are comprised of subsets of readily computable probability, they enable the calculation of arbitrarily tight upper and lower bounds to the failure probability. The methods developed herein, which are based on nonlinear constrained optimization, are applicable to requirement functions whose functional dependency on the uncertainty is arbitrary and whose explicit form may even be unknown. Some of the most prominent features of the methodology are the substantial desensitization of the calculations from the assumed uncertainty model (i.e., the probability distribution describing the uncertainty) as well as the accommodation for changes in such a model with a practically insignificant amount of computational effort.
The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence
Directory of Open Access Journals (Sweden)
Michael Gary Duncan
2012-03-01
Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.
Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.
Suhor, Charles
1991-01-01
Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)
The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA
Directory of Open Access Journals (Sweden)
Logan M. Decker
2017-04-01
Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Foda, Bardees M; Singh, Upinder
2015-08-21
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.
Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki
2011-01-01
Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...
Marie Nimier, au cœur du silence
Directory of Open Access Journals (Sweden)
Joëlle Papillon
2012-01-01
Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.
Methods for transient assay of gene function in floral tissues
Directory of Open Access Journals (Sweden)
Pathirana Nilangani N
2007-01-01
Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to
Bhati, Kaushal Kumar; Alok, Anshu; Kumar, Anil; Kaur, Jagdeep; Tiwari, Siddharth; Pandey, Ajay Kumar
2016-07-01
Low phytic acid is a trait desired in cereal crops and can be achieved by manipulating the genes involved either in its biosynthesis or its transport in the vacuoles. Previously, we have demonstrated that the wheat TaABCC13 protein is a functional transporter, primarily involved in heavy metal tolerance, and a probable candidate gene to achieve low phytate wheat. In the current study, RNA silencing was used to knockdown the expression of TaABCC13 in order to evaluate its functional importance in wheat. Transgenic plants with significantly reduced TaABCC13 transcripts in either seeds or roots were selected for further studies. Homozygous RNAi lines K1B4 and K4G7 exhibited 34-22% reduction of the phytic acid content in the mature grains (T4 seeds). These transgenic lines were defective for spike development, as characterized by reduced grain filling and numbers of spikelets. The seeds of transgenic wheat had delayed germination, but the viability of the seedlings was unaffected. Interestingly, early emergence of lateral roots was observed in TaABCC13-silenced lines as compared to non-transgenic lines. In addition, these lines also had defects in metal uptake and development of lateral roots in the presence of cadmium stress. Our results suggest roles of TaABCC13 in lateral root initiation and enhanced sensitivity towards heavy metals. Taken together, these data demonstrate that wheat ABCC13 is functionally important for grain development and plays an important role during detoxification of heavy metals. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops
Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo
2016-01-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...
3D Acoustic Modelling of Dissipative Silencers with Nonhomogeneous Properties and Mean Flow
Directory of Open Access Journals (Sweden)
E. M. Sánchez-Orgaz
2014-07-01
Full Text Available A finite element approach is proposed for the acoustic analysis of automotive silencers including a perforated duct with uniform axial mean flow and an outer chamber with heterogeneous absorbent material. This material can be characterized by means of its equivalent acoustic properties, considered coordinate-dependent via the introduction of a heterogeneous bulk density, and the corresponding material airflow resistivity variations. An approach has been implemented to solve the pressure wave equation for a nonmoving heterogeneous medium, associated with the problem of sound propagation in the outer chamber. On the other hand, the governing equation in the central duct has been solved in terms of the acoustic velocity potential considering the presence of a moving medium. The coupling between both regions and the corresponding acoustic fields has been carried out by means of a perforated duct and its acoustic impedance, adapted here to include absorbent material heterogeneities and mean flow effects simultaneously. It has been found that bulk density heterogeneities have a considerable influence on the silencer transmission loss.
Advances in methods for identification and characterization of plant transporter function
DEFF Research Database (Denmark)
Larsen, Bo; Xu, Deyang; Halkier, Barbara Ann
2017-01-01
Transport proteins are crucial for cellular function at all levels. Numerous importers and exporters facilitate transport of a diverse array of metabolites and ions intra- and intercellularly. Identification of transporter function is essential for understanding biological processes at both......-based approaches. In this review, we highlight examples that illustrate how new technology and tools have advanced identification and characterization of plant transporter functions....
ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL
Directory of Open Access Journals (Sweden)
Berta Bekti Retnawati
2016-11-01
Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity
Haas, Ann-Karin; Kleinau, Gunnar; Hoyer, Inna; Neumann, Susanne; Furkert, Jens; Rutz, Claudia; Schülein, Ralf; Gershengorn, Marvin C; Krause, Gerd
2011-01-01
The thyrotropin receptor (TSHR) exhibits elevated cAMP signaling in the basal state and becomes fully activated by thyrotropin. Previously we presented evidence that small-molecule ligands act allosterically within the transmembrane region in contrast to the orthosteric extracellular hormone-binding sites. Our goal in this study was to identify positions that surround the allosteric pocket and that are sensitive for inactivation of TSHR. Homology modeling combined with site-directed mutagenesis and functional characterization revealed seven mutants located in the allosteric binding site that led to a decrease of basal cAMP signaling activity. The majority of these silencing mutations, which constrain the TSHR in an inactive conformation, are found in two clusters when mapped onto the 3D structural model. We suggest that the amino acid positions identified herein are indicating locations where small-molecule antagonists, both neutral antagonists and inverse agonists, might interfere with active TSHR conformations.
Haskins, Cathleen
2011-01-01
Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…
Simultaneous Silencing of Xylanase Genes in Botrytis cinerea
Directory of Open Access Journals (Sweden)
Néstor García
2017-12-01
Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.
Strategies underlying RNA silencing suppression by negative strand RNA viruses
Hemmes, J.C.
2007-01-01
The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double
Directory of Open Access Journals (Sweden)
Jérôme Meizoz
2009-10-01
Full Text Available Après la parution de Postures littéraires (2007 cet article revient sur la visée méthodologique de la notion de « posture », en la confrontant à deux notions voisines, celles d’« ethos » et d’« image d’auteur ». Il propose de hiérarchiser ces trois notions dans un ensemble conceptuel. Une brève analyse du Silence de la mer (1942 de Vercors illustre cette réflexion.After the publication of Literary postures (2007, this article revisits the methodological approach based on the notion of “posture” by comparing it with two related notions, “ethos” and “author’s image”. It shows how these three notions can be organized into a hierarchy inside an integrated conceptual whole. A brief analysis of Vercors’ TheSilence of the Sea (1942 illustrates this proposition.
Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo
2014-12-01
The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.
Directory of Open Access Journals (Sweden)
Yu Hong
2007-02-01
Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.
Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing
Directory of Open Access Journals (Sweden)
Chantelle Ahlenstiel
2015-01-01
Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.
Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women
Shouse, Sarah H.; Nilsson, Johanna
2011-01-01
Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…
L’architecture du silence de la Shoah dans les fictions de Sylvie Germain
Directory of Open Access Journals (Sweden)
José Luis Arráez Llobregat
2015-11-01
Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.
The molecular basis for stability of heterochromatin-mediated silencing in mammals.
Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard
2009-11-04
The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
The molecular basis for stability of heterochromatin-mediated silencing in mammals
Directory of Open Access Journals (Sweden)
Hiragami-Hamada Kyoko
2009-11-01
Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
Precedents and consequences of prosocial behaviors of voice and silence
Directory of Open Access Journals (Sweden)
Alicia Omar
2015-09-01
Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization.
RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION
Directory of Open Access Journals (Sweden)
Fitnat Nazlı Sayğan
2011-07-01
Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested
Gas turbine exhaust system silencing design
International Nuclear Information System (INIS)
Ozgur, D.
1991-01-01
Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting
Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng
2018-01-01
The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Satoshi Iizuka
Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.
A Day of Silence, a Day of Truth, and a Lawsuit
Fusarelli, Bonnie C.; Eaton, Lucy E.
2011-01-01
This case study focuses on issues of freedom of speech and freedom of religion in public schools. It involves a rural, southern high school where a group of students participated in a Day of Silence. The school allowed the students to participate based on the principal's understanding of the students' First Amendment rights. However, the next day,…
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins
Directory of Open Access Journals (Sweden)
Marcio Hedil
2016-07-01
Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.
Hedil, Marcio; Kormelink, Richard
2016-07-23
The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Energy Technology Data Exchange (ETDEWEB)
Stoddard, Ethan G. [Chemical Biology and Exposure; Killinger, Bryan J. [Chemical Biology and Exposure; Nair, Reji N. [Chemical Biology and Exposure; Sadler, Natalie C. [Chemical Biology and Exposure; Volk, Regan F. [Chemical Biology and Exposure; Purvine, Samuel O. [Chemical Biology and Exposure; Shukla, Anil K. [Chemical Biology and Exposure; Smith, Jordan N. [Chemical Biology and Exposure; Wright, Aaron T. [Chemical Biology and Exposure
2017-11-01
Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “H site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.
Adaptation of the Four Forms of Employee Silence Scale in a Polish sample
Directory of Open Access Journals (Sweden)
Krystyna Adamska
2017-06-01
Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.
Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.
Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian
2018-06-01
Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Decreasing erucic acid level by RNAi-mediated silencing of fatty ...
African Journals Online (AJOL)
To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...
RNA silencing is required for Arabidopsis defence against Verticillium wilt disease
Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.
2009-01-01
RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,
Driving in unheard silence: Disability and the politics of shutting up.
Lourens, Heidi
2018-03-01
The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.
Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict
Directory of Open Access Journals (Sweden)
Line Kikkenborg Christensen
2018-02-01
Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.
Brescó de Luna, Ignacio
2018-05-04
This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.
Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun
Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.
Mandriota, Stefano J.; Valentijn, Linda J.; Lesne, Laurence; Betts, David R.; Marino, Denis; Boudal-Khoshbeen, Mary; London, Wendy B.; Rougemont, Anne-Laure; Attiyeh, Edward F.; Maris, John M.; Hogarty, Michael D.; Koster, Jan; Molenaar, Jan J.; Versteeg, Rogier
2015-01-01
Neuroblastoma, a childhood cancer with highly heterogeneous biology and clinical behavior, is characterized by genomic aberrations including amplification of MYCN. Hemizygous deletion of chromosome 11q is a well-established, independent marker of poor prognosis. While 11q22-q23 is the most frequently deleted region, the neuroblastoma tumor suppressor in this region remains to be identified. Chromosome bands 11q22-q23 contain ATM, a cell cycle checkpoint kinase and tumor suppressor playing a pivotal role in the DNA damage response. Here, we report that haploinsufficiency of ATM in neuroblastoma correlates with lower ATM expression, event-free survival, and overall survival. ATM loss occurs in high stage neuroblastoma without MYCN amplification. In SK-N-SH, CLB-Ga and GI-ME-N human neuroblastoma cells, stable ATM silencing promotes neuroblastoma progression in soft agar assays, and in subcutaneous xenografts in nude mice. This effect is dependent on the extent of ATM silencing and does not appear to involve MYCN. Our findings identify ATM as a potential haploinsufficient neuroblastoma tumor suppressor, whose inactivation mirrors the increased aggressiveness associated with 11q deletion in neuroblastoma. PMID:26053094
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.
Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M
2017-10-10
The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.
Directory of Open Access Journals (Sweden)
Gyöngyi Munkácsy
2016-01-01
Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.
Directory of Open Access Journals (Sweden)
Satoru Noguchi
2014-01-01
Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
Directory of Open Access Journals (Sweden)
Cem KAHYA
2015-06-01
Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.
Yangin, Demet; Elma, Cevat
2017-01-01
The purpose of this study was to determine the relationship between the manager trust and interactional justice perceptions and organizational silence behaviors of those teachers who work in primary and secondary schools. The research is based on the survey model and the population consists of 4761 teachers who worked in Samsun, Turkey. The sample…
Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide
Directory of Open Access Journals (Sweden)
Dacheng Liang
2014-12-01
Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.
Directory of Open Access Journals (Sweden)
Susheela Kushwaha
Full Text Available The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes.In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds.The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.
Characterization of Microbiota in Children with Chronic Functional Constipation.
de Meij, Tim G J; de Groot, Evelien F J; Eck, Anat; Budding, Andries E; Kneepkens, C M Frank; Benninga, Marc A; van Bodegraven, Adriaan A; Savelkoul, Paul H M
2016-01-01
Disruption of the intestinal microbiota is considered an etiological factor in pediatric functional constipation. Scientifically based selection of potential beneficial probiotic strains in functional constipation therapy is not feasible due to insufficient knowledge of microbiota composition in affected subjects. The aim of this study was to describe microbial composition and diversity in children with functional constipation, compared to healthy controls. Fecal samples from 76 children diagnosed with functional constipation according to the Rome III criteria (median age 8.0 years; range 4.2-17.8) were analyzed by IS-pro, a PCR-based microbiota profiling method. Outcome was compared with intestinal microbiota profiles of 61 healthy children (median 8.6 years; range 4.1-17.9). Microbiota dissimilarity was depicted by principal coordinate analysis (PCoA), diversity was calculated by Shannon diversity index. To determine the most discriminative species, cross validated logistic ridge regression was performed. Applying total microbiota profiles (all phyla together) or per phylum analysis, no disease-specific separation was observed by PCoA and by calculation of diversity indices. By ridge regression, however, functional constipation and controls could be discriminated with 82% accuracy. Most discriminative species were Bacteroides fragilis, Bacteroides ovatus, Bifidobacterium longum, Parabacteroides species (increased in functional constipation) and Alistipes finegoldii (decreased in functional constipation). None of the commonly used unsupervised statistical methods allowed for microbiota-based discrimination of children with functional constipation and controls. By ridge regression, however, both groups could be discriminated with 82% accuracy. Optimization of microbiota-based interventions in constipated children warrants further characterization of microbial signatures linked to clinical subgroups of functional constipation.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-10-01
Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-12-01
Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
DEFF Research Database (Denmark)
Bengtsson, Tea Torbenfeldt; Fynbo, Lars
2017-01-01
In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing
Directory of Open Access Journals (Sweden)
Adriana F. Fusaro
2017-10-01
Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.
Is our knowledge of voice and silence in organizations growing?
DEFF Research Database (Denmark)
Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine
2016-01-01
This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...
The Ebola virus VP35 protein is a suppressor of RNA silencing.
Directory of Open Access Journals (Sweden)
Joost Haasnoot
2007-06-01
Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.
Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann
2015-06-01
Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.
Synthesis of dye/fluorescent functionalized dendrons based on cyclotriphosphazene
Directory of Open Access Journals (Sweden)
Aurélien Hameau
2011-11-01
Full Text Available Functionalized phenols based on tyramine were synthesized in order to be selectively grafted on to hexachlorocyclotriphosphazene, affording a variety of functionalized dendrons of type AB5. The B functions comprised fluorescent groups (dansyl or dyes (dabsyl, whereas the A function was provided by either an aldehyde or an amine. The characterization of these dendrons is reported. An unexpected behaviour of a fluorescent and water-soluble dendron based on dansyl groups in mixtures of dioxane/water was observed.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Kirti, P B
2017-07-01
The epitome of any genome research is to identify all the existing genes in a genome and investigate their roles. Various techniques have been applied to unveil the functions either by silencing or over-expressing the genes by targeted expression or random mutagenesis. Rice is the most appropriate model crop for generating a mutant resource for functional genomic studies because of the availability of high-quality genome sequence and relatively smaller genome size. Rice has syntenic relationships with members of other cereals. Hence, characterization of functionally unknown genes in rice will possibly provide key genetic insights and can lead to comparative genomics involving other cereals. The current review attempts to discuss the available gain-of-function mutagenesis techniques for functional genomics, emphasizing the contemporary approach, activation tagging and alterations to this method for the enhancement of yield and productivity of rice. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching
2013-06-01
The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...
DEFF Research Database (Denmark)
Souza, Danielle Maia de; Flynn, Dan F. B.; DeClerck, Fabrice
2013-01-01
the distinctiveness of species; this paper proposes the use of an FD index to calculate characterization factors (CFs) for land use impacts. Furthermore, we compare the results of the CFs to current practice and assess the increase in complexity introduced by the use of the new indicator.The model proposed is based...... challenges. Such indices are data hungry (requiring species composition and traits) require more complex calculations than current common practice, including decisions on the choice of a method to calculate FD and the selection of traits.......The focus of land use modeling in life cycle impact assessment has been mainly on taxonomic measures of biodiversity, namely species richness (SR). However, increasing availability of trait data for species has led to the use of functional diversity (FD) as a promising metric to reflect...
Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L
2018-05-10
Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.
Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455
DEFF Research Database (Denmark)
Foote, Jonathan
2016-01-01
In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....
MicroRNA silencing in primates: towards development of novel therapeutics
DEFF Research Database (Denmark)
Petri, Andreas; Lindow, Morten; Kauppinen, Sakari
2009-01-01
MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....
Veiled Word(s) – Sacred Silence
DEFF Research Database (Denmark)
Isar, Nicoletta
2014-01-01
or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...
Functional characterization of a prokaryotic Kir channel.
Enkvetchakul, Decha; Bhattacharyya, Jaya; Jeliazkova, Iana; Groesbeck, Darcy K; Cukras, Catherine A; Nichols, Colin G
2004-11-05
The Kir gene family encodes inward rectifying K+ (Kir) channels that are widespread and critical regulators of excitability in eukaryotic cells. A related gene family (KirBac) has recently been identified in prokaryotes. While a crystal structure of one member, Kir-Bac1.1, has been solved, there has been no functional characterization of any KirBac gene products. Here we present functional characterization of KirBac1.1 reconstituted in liposomes. Utilizing a 86Rb+ uptake assay, we demonstrate that KirBac1.1 generates a K+ -selective permeation path that is inhibited by extraliposomal Ba2+ and Ca2+ ions. In contrast to KcsA (an acid-activated bacterial potassium channel), KirBac1.1 is inhibited by extraliposomal acid (pKa approximately 6). This characterization of KirBac1.1 activity now paves the way for further correlation of structure and function in this model Kir channel.
DEFF Research Database (Denmark)
Lischetti, Tiziana; Zhang, Gang; Sedgwick, Garry G
2014-01-01
Improperly attached kinetochores activate the spindle assembly checkpoint (SAC) and by an unknown mechanism catalyse the binding of two checkpoint proteins, Mad2 and BubR1, to Cdc20 forming the mitotic checkpoint complex (MCC). Here, to address the functional role of Cdc20 kinetochore localization...... in the SAC, we delineate the molecular details of its interaction with kinetochores. We find that BubR1 recruits the bulk of Cdc20 to kinetochores through its internal Cdc20 binding domain (IC20BD). We show that preventing Cdc20 kinetochore localization by removal of the IC20BD has a limited effect...... on the SAC because the IC20BD is also required for efficient SAC silencing. Indeed, the IC20BD can disrupt the MCC providing a mechanism for its role in SAC silencing. We thus uncover an unexpected dual function of the second Cdc20 binding site in BubR1 in promoting both efficient SAC signalling and SAC...
Characterization of SWNT based Polystyrene Nanocomposites
Mitchell, Cynthia; Bahr, Jeffrey; Tour, James; Arepalli, Sivaram; Krishnamoorti, Ramanan
2003-03-01
Polystyrene nanocomposites with functionalized single walled carbon nanotubes (SWNTs), prepared by the in-situ generation and addition of organic diazonium compounds, were characterized using a range of structural and dynamic methods. These were contrasted to the properties of polystyrene composites prepared with unfunctionalized SWNTs at the same loadings. The functionalized nanocomposites demonstrated a percolated SWNT network structure at concentrations of 1 vol SWNT based composites at similar loadings of SWNT exhibited behavior comparable to that of the unfilled polymer. This formation of the SWNT network structure is because of the improved compatibility between the SWNTs and the polymer matrix due to the functionalization. Further structural evidence for the compatibility of the modified SWNTs and the polymer matrix will be discussed in the presentation.
Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L
2006-12-20
MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.
Uncertainty Analysis via Failure Domain Characterization: Polynomial Requirement Functions
Crespo, Luis G.; Munoz, Cesar A.; Narkawicz, Anthony J.; Kenny, Sean P.; Giesy, Daniel P.
2011-01-01
This paper proposes an uncertainty analysis framework based on the characterization of the uncertain parameter space. This characterization enables the identification of worst-case uncertainty combinations and the approximation of the failure and safe domains with a high level of accuracy. Because these approximations are comprised of subsets of readily computable probability, they enable the calculation of arbitrarily tight upper and lower bounds to the failure probability. A Bernstein expansion approach is used to size hyper-rectangular subsets while a sum of squares programming approach is used to size quasi-ellipsoidal subsets. These methods are applicable to requirement functions whose functional dependency on the uncertainty is a known polynomial. Some of the most prominent features of the methodology are the substantial desensitization of the calculations from the uncertainty model assumed (i.e., the probability distribution describing the uncertainty) as well as the accommodation for changes in such a model with a practically insignificant amount of computational effort.
Directory of Open Access Journals (Sweden)
Ivyna Pau Ni Bong
2016-11-01
Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
DEFF Research Database (Denmark)
Riviere, M.P.; Marais, A.; Ponchet, M.
2008-01-01
silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...
Overlapping functions of argonaute proteins in patterning and morphogenesis of Drosophila embryos.
Directory of Open Access Journals (Sweden)
Wibke J Meyer
2006-08-01
Full Text Available Argonaute proteins are essential components of the molecular machinery that drives RNA silencing. In Drosophila, different members of the Argonaute family of proteins have been assigned to distinct RNA silencing pathways. While Ago1 is required for microRNA function, Ago2 is a crucial component of the RNA-induced silencing complex in siRNA-triggered RNA interference. Drosophila Ago2 contains an unusual amino-terminus with two types of imperfect glutamine-rich repeats (GRRs of unknown function. Here we show that the GRRs of Ago2 are essential for the normal function of the protein. Alleles with reduced numbers of GRRs cause specific disruptions in two morphogenetic processes associated with the midblastula transition: membrane growth and microtubule-based organelle transport. These defects do not appear to result from disruption of siRNA-dependent processes but rather suggest an interference of the mutant Ago2 proteins in an Ago1-dependent pathway. Using loss-of-function alleles, we further demonstrate that Ago1 and Ago2 act in a partially redundant manner to control the expression of the segment-polarity gene wingless in the early embryo. Our findings argue against a strict separation of Ago1 and Ago2 functions and suggest that these proteins act in concert to control key steps of the midblastula transition and of segmental patterning.
DEFF Research Database (Denmark)
Stonebloom, Solomon; Ebert, Berit; Xiong, Guangyan
2016-01-01
rates of pollen tube formation in pollen from pagr heterozygotes. To characterize a loss-of-function phenotype for PAGR, the Nicotiana benthamiana orthologs, NbPAGR-A and B, were transiently silenced using Virus Induced Gene Silencing. NbPAGR-silenced plants exhibited reduced internode and petiole...
The Application of Coconut Fiber as Dissipative Silencer
Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.
2017-01-01
Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.
Silencing Deafness: Displacing Disability in the Nineteenth Century
Directory of Open Access Journals (Sweden)
Esme Cleall
2015-03-01
Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.
de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard
2014-02-01
Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.
Friction coefficient measurements of silencers on specialized duct tract
Directory of Open Access Journals (Sweden)
Sehnalek Stanislav
2016-01-01
Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
International Nuclear Information System (INIS)
Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B
2012-01-01
epigenetic silencing mechanism of the Wnt/β-catenin pathway inhibitor genes in CLL. Hypermethylation and silencing of functionally related genes may not be completely stochastic but result from the tumour epigenome reprogramming orchestrated by Polycomb-group repressive complexes. The data are of interest in the context of epigenetic-based therapy
Silence in the second language classroom
King, J
2013-01-01
Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.
Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N
2018-02-01
Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Bi YZ
2016-11-01
Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Directory of Open Access Journals (Sweden)
Shu-Kui Zhou
2014-12-01
Conclusion: Silencing Cbl-b significantly enhanced T lymphocyte function and T lymphocyte cytotoxicity activity against a model prostate cancer cell line in vitro. This study suggests a potentially novel immunotherapeutic strategy against prostate cancer.
Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio
2013-01-01
.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Meng, Wenbo; Li, Xun; Bai, Zhongtian; Li, Yan; Yuan, Jinqiu; Liu, Tao; Yan, Jun; Zhou, Wence; Zhu, Kexiang; Zhang, Hui; Li, Yumin
2014-01-01
Alpha-fetoprotein not only serves as a diagnostic marker for liver cancer, but also posses a variety of biological functions. However, the role of Alpha-fetoprotein on tumor angiogenesis and cell invasion remains incompletely understood. In this study, we aimed to evaluate if Alpha-fetoprotein can regulate the major angiogenic factors and matrix metalloproteinases in human liver cancer cells. Alpha-fetoprotein silencing was achieved by Stealth RNAi. Expression of Alpha-fetoprotein was examined by a full-automatic electrochemistry luminescence immunity analyzer. Expression of VEGF, VEGFR-2, MMP-9, and MMP-2 was examined by Western blot and immunocytochemistry. Apoptosis was detected by TUNEL assay. Angiogenesis was detected by in vitro angiogenesis assay kit. Silencing of Alpha-fetoprotein led to an increased apoptosis, which was associated with a decreased expression of vascular endothelial growth factor, vascular endothelial growth factor receptor 2, matrix metalloproteinases-2/9. These results suggest that Alpha-fetoprotein may play a regulatory role on angiogenesis and cell invasion during liver cancer development.
Directory of Open Access Journals (Sweden)
Yao Han
Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.
Directory of Open Access Journals (Sweden)
Guillaume Jannot
2016-12-01
Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.
Probability-density-function characterization of multipartite entanglement
International Nuclear Information System (INIS)
Facchi, P.; Florio, G.; Pascazio, S.
2006-01-01
We propose a method to characterize and quantify multipartite entanglement for pure states. The method hinges upon the study of the probability density function of bipartite entanglement and is tested on an ensemble of qubits in a variety of situations. This characterization is also compared to several measures of multipartite entanglement
Directory of Open Access Journals (Sweden)
Noreen F Rizvi
Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.
Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.
Directory of Open Access Journals (Sweden)
Sirjana Devi Shrestha
Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.
Optical silencing of C. elegans cells with light-driven proton pumps.
Okazaki, Ayako; Takahashi, Megumi; Toyoda, Naoya; Takagi, Shin
2014-08-01
Recent development of optogenetic techniques, which utilize light-driven ion channels or ion pumps for controlling the activity of excitable cells, has greatly facilitated the investigation of nervous systems in vivo. A new generation of optical silencers includes outward-directed proton pumps, such as Arch, which have several advantages over currently widely used halorhodopsin (NpHR). These advantages include the resistance to inactivation during prolonged illumination and the ability to generate a larger optical current from low intensity light. C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. In this article, we will outline the practical aspects of using of Arch and other proton pumps as optogenetic tools in C. elegans. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad
2014-01-01
Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Development of a gene silencing DNA vector derived from a broad host range geminivirus
Directory of Open Access Journals (Sweden)
Hancock Leandria C
2009-07-01
Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Directory of Open Access Journals (Sweden)
Jiangyu Wu
2013-01-01
Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Huang, Weizhe; He, Ziying
2013-01-01
RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498
CRISPR-Cas9-Mediated Silencing of CD44 in Human Highly Metastatic Osteosarcoma Cells
Directory of Open Access Journals (Sweden)
Tang Liu
2018-04-01
Full Text Available Background/Aims: Metastasis is the major cause of death in patients with osteosarcoma. There is an urgent need to identify molecular markers that promote metastasis. Cluster of differentiation 44 is a receptor for hyaluronic acid (HA and HA-binding has been proven to participate in various biological tumor activities, including tumor progression and metastasis. Methods: We performed a meta-analysis to investigate the relationship between CD44 expression, survival, and metastasis in patients with osteosarcoma. We then utilized the CRISPR-Cas9 system to specifically silence CD44 in highly metastatic human osteosarcoma cells (MNNG/HOS and 143B and further determined the functional effects of CD44 knockout in these cells. Results: The meta-analysis demonstrated that a high level of CD44 may predict poor survival and higher potential of metastasis in patients with osteosarcoma. The expression of CD44 in highly metastatic human osteosarcoma cell lines was efficiently blocked by CRISPR-Cas9. When CD44 was silenced, the proliferation and spheroid formation of these osteosarcoma cells was inhibited under 3-D culture conditions. Furthermore, the migratory and invasive functions were also impaired in these highly metastatic osteosarcoma cells. Conclusion: These results suggest that developing new strategies to target CD44 in osteosarcoma may prevent metastasis and improve the clinical outcome of osteosarcoma patients.
Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.
Directory of Open Access Journals (Sweden)
Stella Marie Reamon-Buettner
Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.
[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].
Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie
2012-12-01
To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.
Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena
2018-01-01
Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
Directory of Open Access Journals (Sweden)
Francis Onyilo
2018-03-01
Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.
2016-01-01
The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…
H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis
Zolea, Fabiana
2015-10-09
The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.
H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis
Zolea, Fabiana; Biamonte, Flavia; Candeloro, Patrizio; Di Sanzo, Maddalena; Cozzi, Anna; Di Vito, Anna; Quaresima, Barbara; Lobello, Nadia; Trecroci, Francesca; Di Fabrizio, Enzo M.; Levi, Sonia; Cuda, Giovanni; Costanzo, Francesco
2015-01-01
The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance
Characterization of BJT-based particle detectors
International Nuclear Information System (INIS)
Piemonte, C.; Batignani, G.; Bettarini, S.; Bondioli, M.; Boscardin, M.; Bosisio, L.; Dalla Betta, G.-F.; Dittongo, S.; Forti, F.; Giorgi, M.; Gregori, P.; Rachevskaia, I.; Ronchin, S.; Zorzi, N.
2004-01-01
We report on the static and dynamic behavior of BJT-based particle detectors realized on high-resistivity silicon. Several prototypes, featuring different doping profiles and geometries, have been fabricated at ITC-irst (Trento, Italy). These devices have been thoroughly characterized from the electrical viewpoint, and, in order to understand the fundamental parameters of the structure, device simulations have been performed, whose results are in very good agreement with experimental data. Preliminary functional measurements have been carried out by using a 109Cd source excitation
Nifontova, Galina; Zvaigzne, Maria; Baryshnikova, Maria; Korostylev, Evgeny; Ramos-Gomes, Fernanda; Alves, Frauke; Nabiev, Igor; Sukhanova, Alyona
2018-01-01
Fabrication of polyelectrolyte microcapsules and their use as carriers of drugs, fluorescent labels, and metal nanoparticles is a promising approach to designing theranostic agents. Semiconductor quantum dots (QDs) are characterized by extremely high brightness and photostability that make them attractive fluorescent labels for visualization of intracellular penetration and delivery of such microcapsules. Here, we describe an approach to design, fabricate, and characterize physico-chemical and functional properties of polyelectrolyte microcapsules encoded with water-solubilized and stabilized with three-functional polyethylene glycol derivatives core/shell QDs. Developed microcapsules were characterized by dynamic light scattering, electrophoretic mobility, scanning electronic microscopy, and fluorescence and confocal microscopy approaches, providing exact data on their size distribution, surface charge, morphological, and optical characteristics. The fluorescence lifetimes of the QD-encoded microcapsules were also measured, and their dependence on time after preparation of the microcapsules was evaluated. The optimal content of QDs used for encoding procedure providing the optimal fluorescence properties of the encoded microcapsules was determined. Finally, the intracellular microcapsule uptake by murine macrophages was demonstrated, thus confirming the possibility of efficient use of developed system for live cell imaging and visualization of microcapsule transportation and delivery within the living cells.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
Directory of Open Access Journals (Sweden)
Praveen Guleria
Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.
Multiscale Persistent Functions for Biomolecular Structure Characterization
Energy Technology Data Exchange (ETDEWEB)
Xia, Kelin [Nanyang Technological University (Singapore). Division of Mathematical Sciences, School of Physical, Mathematical Sciences and School of Biological Sciences; Li, Zhiming [Central China Normal University, Wuhan (China). Key Laboratory of Quark and Lepton Physics (MOE) and Institute of Particle Physics; Mu, Lin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Computer Science and Mathematics Division
2017-11-02
Here in this paper, we introduce multiscale persistent functions for biomolecular structure characterization. The essential idea is to combine our multiscale rigidity functions (MRFs) with persistent homology analysis, so as to construct a series of multiscale persistent functions, particularly multiscale persistent entropies, for structure characterization. To clarify the fundamental idea of our method, the multiscale persistent entropy (MPE) model is discussed in great detail. Mathematically, unlike the previous persistent entropy (Chintakunta et al. in Pattern Recognit 48(2):391–401, 2015; Merelli et al. in Entropy 17(10):6872–6892, 2015; Rucco et al. in: Proceedings of ECCS 2014, Springer, pp 117–128, 2016), a special resolution parameter is incorporated into our model. Various scales can be achieved by tuning its value. Physically, our MPE can be used in conformational entropy evaluation. More specifically, it is found that our method incorporates in it a natural classification scheme. This is achieved through a density filtration of an MRF built from angular distributions. To further validate our model, a systematical comparison with the traditional entropy evaluation model is done. Additionally, it is found that our model is able to preserve the intrinsic topological features of biomolecular data much better than traditional approaches, particularly for resolutions in the intermediate range. Moreover, by comparing with traditional entropies from various grid sizes, bond angle-based methods and a persistent homology-based support vector machine method (Cang et al. in Mol Based Math Biol 3:140–162, 2015), we find that our MPE method gives the best results in terms of average true positive rate in a classic protein structure classification test. More interestingly, all-alpha and all-beta protein classes can be clearly separated from each other with zero error only in our model. Finally, a special protein structure index (PSI) is proposed, for the first
Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages
Directory of Open Access Journals (Sweden)
Maria Gaglione
2014-01-01
Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.
Epigenetic silencing of CYP24 in the tumor microenvironment
Johnson, Candace S.; Chung, Ivy; Trump, Donald L.
2010-01-01
Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059
Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.
Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J
2017-11-21
Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.
Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.
Directory of Open Access Journals (Sweden)
Jiexiong Feng
Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.
Excavating silences and tensions of agency|passivity in science education reform
Rivera Maulucci, Maria S.
2010-12-01
I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame
2014-04-20
A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.
Evolved Escherichia coli strains for amplified, functional expression of membrane proteins.
Gul, Nadia; Linares, Daniel M; Ho, Franz Y; Poolman, Bert
2014-01-09
The major barrier to the physical characterization and structure determination of membrane proteins is low protein yield and/or low functionality in recombinant expression. The enteric bacterium Escherichia coli is the most widely employed organism for producing recombinant proteins. Beside several advantages of this expression host, one major drawback is that the protein of interest does not always adopt its native conformation and may end up in large insoluble aggregates. We describe a robust strategy to increase the likelihood of overexpressing membrane proteins in a functional state. The method involves fusion in tandem of green fluorescent protein and the erythromycin resistance protein (23S ribosomal RNA adenine N-6 methyltransferase, ErmC) to the C-terminus of a target membrane protein. The fluorescence of green fluorescent protein is used to report the folding state of the target protein, whereas ErmC is used to select for increased expression. By gradually increasing the erythromycin concentration of the medium and testing different membrane protein targets, we obtained a number of evolved strains of which four (NG2, NG3, NG5 and NG6) were characterized and their genome was fully sequenced. Strikingly, each of the strains carried a mutation in the hns gene, whose product is involved in genome organization and transcriptional silencing. The degree of expression of (membrane) proteins correlates with the severity of the hns mutation, but cells in which hns was deleted showed an intermediate expression performance. We propose that (partial) removal of the transcriptional silencing mechanism changes the levels of proteins essential for the functional overexpression of membrane proteins. © 2013.
Properties of field functionals and characterization of local functionals
Brouder, Christian; Dang, Nguyen Viet; Laurent-Gengoux, Camille; Rejzner, Kasia
2018-02-01
Functionals (i.e., functions of functions) are widely used in quantum field theory and solid-state physics. In this paper, functionals are given a rigorous mathematical framework and their main properties are described. The choice of the proper space of test functions (smooth functions) and of the relevant concept of differential (Bastiani differential) are discussed. The relation between the multiple derivatives of a functional and the corresponding distributions is described in detail. It is proved that, in a neighborhood of every test function, the support of a smooth functional is uniformly compactly supported and the order of the corresponding distribution is uniformly bounded. Relying on a recent work by Dabrowski, several spaces of functionals are furnished with a complete and nuclear topology. In view of physical applications, it is shown that most formal manipulations can be given a rigorous meaning. A new concept of local functionals is proposed and two characterizations of them are given: the first one uses the additivity (or Hammerstein) property, the second one is a variant of Peetre's theorem. Finally, the first step of a cohomological approach to quantum field theory is carried out by proving a global Poincaré lemma and defining multi-vector fields and graded functionals within our framework.
Issa, Mohamad; Bisconti, Silvia; Kovelman, Ioulia; Kileny, Paul; Basura, Gregory J
2016-01-01
Tinnitus is the phantom perception of sound in the absence of an acoustic stimulus. To date, the purported neural correlates of tinnitus from animal models have not been adequately characterized with translational technology in the human brain. The aim of the present study was to measure changes in oxy-hemoglobin concentration from regions of interest (ROI; auditory cortex) and non-ROI (adjacent nonauditory cortices) during auditory stimulation and silence in participants with subjective tinnitus appreciated equally in both ears and in nontinnitus controls using functional near-infrared spectroscopy (fNIRS). Control and tinnitus participants with normal/near-normal hearing were tested during a passive auditory task. Hemodynamic activity was monitored over ROI and non-ROI under episodic periods of auditory stimulation with 750 or 8000 Hz tones, broadband noise, and silence. During periods of silence, tinnitus participants maintained increased hemodynamic responses in ROI, while a significant deactivation was seen in controls. Interestingly, non-ROI activity was also increased in the tinnitus group as compared to controls during silence. The present results demonstrate that both auditory and select nonauditory cortices have elevated hemodynamic activity in participants with tinnitus in the absence of an external auditory stimulus, a finding that may reflect basic science neural correlates of tinnitus that ultimately contribute to phantom sound perception.
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Characterization and prediction of chemical functions and weight fractions in consumer products
Directory of Open Access Journals (Sweden)
Kristin K. Isaacs
Full Text Available Assessing exposures from the thousands of chemicals in commerce requires quantitative information on the chemical constituents of consumer products. Unfortunately, gaps in available composition data prevent assessment of exposure to chemicals in many products. Here we propose filling these gaps via consideration of chemical functional role. We obtained function information for thousands of chemicals from public sources and used a clustering algorithm to assign chemicals into 35 harmonized function categories (e.g., plasticizers, antimicrobials, solvents. We combined these functions with weight fraction data for 4115 personal care products (PCPs to characterize the composition of 66 different product categories (e.g., shampoos. We analyzed the combined weight fraction/function dataset using machine learning techniques to develop quantitative structure property relationship (QSPR classifier models for 22 functions and for weight fraction, based on chemical-specific descriptors (including chemical properties. We applied these classifier models to a library of 10196 data-poor chemicals. Our predictions of chemical function and composition will inform exposure-based screening of chemicals in PCPs for combination with hazard data in risk-based evaluation frameworks. As new information becomes available, this approach can be applied to other classes of products and the chemicals they contain in order to provide essential consumer product data for use in exposure-based chemical prioritization. Keywords: Chemical function, Exposure modeling, Chemical prioritization, Consumer products, Cosmetics, ExpoCast
Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah
2016-01-01
Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
-strand siRNA elements, which possibly increase the assembly of antisense-strand (guide siRNAs into RNA-induced silencing complexes (RISCs, may enhance ASP-RNAi in the case of inert siRNA duplexes. Therefore, the data presented here suggest that structural modification of functional portions of an siRNA duplex by base substitution could greatly influence allele discrimination and gene silencing, thereby contributing to enhancement of ASP-RNAi.
RNA-directed DNA methylation: Mechanisms and functions
Mahfouz, Magdy M.
2010-01-01
Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response
The great silence science and philosophy of Fermi's paradox
Cirkovic, Milan M
2018-01-01
The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.
DEFF Research Database (Denmark)
Shunmugavel, Saravanamurugan; Fehrmann, Rasmus; Riisager, Anders
2012-01-01
New homologous ammonium-, pyridinium-, and pyrrolidinium-based sulfonamido functionalized ionic liquids have been synthesized in two steps using monoethanolamine, methanesulfonyl chloride, and tosyl chloride as precursors with ethanol as solvent. Attempts to synthesize dual amino functionalized i...... and thermogravimetric analysis....
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the
Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping
2018-02-19
Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.
Functional Characterization of a Novel Shape Memory Alloy
Collado, M.; Cabás, R.; San Juan, J.; López-Ferreño, I.
2014-07-01
A novel shape memory alloy (SMA) has been developed as an alternative to currently available alloys. This alloy, commercially known by its proprietary brand SMARQ, shows a higher working range of temperatures with respect to the SMA materials used until now in actuators, limited to environment temperatures below 90 °C. SMARQ is a high temperature SMA (HTSMA) based on a fully European material technology and production processes, which allows the manufacture of high quality products, with tuneable transformation temperatures up to 200 °C. Both, material and production processes have been evaluated for its use in space applications. A full characterization test campaign has been completed in order to obtain the material properties and check its suitability to be used as active material in space actuators. In order to perform the functional characterization of the material, it has been considered as the key element of a basic SMA actuator, consisting in the SMA wire and the mechanical and electrical interfaces. The functional tests presented in this work have been focused on the actuator behavior when heated by means of an electrical current. Alloy composition has been adjusted in order to match a transition temperature (As) of +145 °C, which satisfies the application requirements of operating temperatures in the range of -70 and +125 °C. Details of the tests and results of the characterization test campaign, focused in the material unique properties for their use in actuators, will be presented in this work. Some application examples in the field of space mechanisms and actuators, currently under development, will be summarized as part of this work, demonstrating the technology suitability as active material for space actuators.
Directory of Open Access Journals (Sweden)
Masaki Takahashi
2015-01-01
Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.
Directory of Open Access Journals (Sweden)
Rosa Lozano-Durán
2013-03-01
Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the
Marco Antonio, David Santos; Guidugli-Lazzarini, Karina Rosa; Do Nascimento, Adriana Mendes; Simões, Zilá Luz Paulino; Hartfelder, Klaus
2008-10-01
The switch from within-hive activities to foraging behavior is a major transition in the life cycle of a honeybee ( Apis mellifera) worker. A prominent regulatory role in this switch has long been attributed to juvenile hormone (JH), but recent evidence also points to the yolk precursor protein vitellogenin as a major player in behavioral development. In the present study, we injected vitellogenin double-stranded RNA (dsVg) into newly emerged worker bees of Africanized genetic origin and introduced them together with controls into observation hives to record flight behavior. RNA interference-mediated silencing of vitellogenin gene function shifted the onset of long-duration flights (>10 min) to earlier in life (by 3 4 days) when compared with sham and untreated control bees. In fact, dsVg bees were observed conducting such flights extremely precociously, when only 3 days old. Short-duration flights (<10 min), which bees usually perform for orientation and cleaning, were not affected. Additionally, we found that the JH titer in dsVg bees collected after 7 days was not significantly different from the controls. The finding that depletion of the vitellogenin titer can drive young bees to become extremely precocious foragers could imply that vitellogenin is the primary switch signal. At this young age, downregulation of vitellogenin gene activity apparently had little effect on the JH titer. As this unexpected finding stands in contrast with previous results on the vitellogenin/JH interaction at a later age, when bees normally become foragers, we propose a three-step sequence in the constellation of physiological parameters underlying behavioral development.
Directory of Open Access Journals (Sweden)
Ruilin Wang
Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.
Guleria, Praveen; Yadav, Sudesh Kumar
2013-01-01
Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961
Ensemble-Based Data Assimilation in Reservoir Characterization: A Review
Directory of Open Access Journals (Sweden)
Seungpil Jung
2018-02-01
Full Text Available This paper presents a review of ensemble-based data assimilation for strongly nonlinear problems on the characterization of heterogeneous reservoirs with different production histories. It concentrates on ensemble Kalman filter (EnKF and ensemble smoother (ES as representative frameworks, discusses their pros and cons, and investigates recent progress to overcome their drawbacks. The typical weaknesses of ensemble-based methods are non-Gaussian parameters, improper prior ensembles and finite population size. Three categorized approaches, to mitigate these limitations, are reviewed with recent accomplishments; improvement of Kalman gains, add-on of transformation functions, and independent evaluation of observed data. The data assimilation in heterogeneous reservoirs, applying the improved ensemble methods, is discussed on predicting unknown dynamic data in reservoir characterization.
Refracted arrival waves in a zone of silence from a finite thickness mixing layer.
Suzuki, Takao; Lele, Sanjiva K
2002-02-01
Refracted arrival waves which propagate in the zone of silence of a finite thickness mixing layer are analyzed using geometrical acoustics in two dimensions. Here, two simplifying assumptions are made: (i) the mean flow field is transversely sheared, and (ii) the mean velocity and temperature profiles approach the free-stream conditions exponentially. Under these assumptions, ray trajectories are analytically solved, and a formula for acoustic pressure amplitude in the far field is derived in the high-frequency limit. This formula is compared with the existing theory based on a vortex sheet corresponding to the low-frequency limit. The analysis covers the dependence on the Mach number as well as on the temperature ratio. The results show that both limits have some qualitative similarities, but the amplitude in the zone of silence at high frequencies is proportional to omega(-1/2), while that at low frequencies is proportional to omega(-3/2), omega being the angular frequency of the source.
Directory of Open Access Journals (Sweden)
Sajad Zare
2017-08-01
Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.
An investigation of noise produced by unsteady gas flow through silencer elements
Mawhinney, Graeme Hugh
This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.
Using the structure-function linkage database to characterize functional domains in enzymes.
Brown, Shoshana; Babbitt, Patricia
2014-12-12
The Structure-Function Linkage Database (SFLD; http://sfld.rbvi.ucsf.edu/) is a Web-accessible database designed to link enzyme sequence, structure, and functional information. This unit describes the protocols by which a user may query the database to predict the function of uncharacterized enzymes and to correct misannotated functional assignments. The information in this unit is especially useful in helping a user discriminate functional capabilities of a sequence that is only distantly related to characterized sequences in publicly available databases. Copyright © 2014 John Wiley & Sons, Inc.
Conifers have a unique small RNA silencing signature.
Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J
2008-08-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.
Gasparis, Sebastian; Orczyk, Waclaw; Nadolska-Orczyk, Anna
2013-11-26
Secaloindoline a (Sina) and secaloindoline b (Sinb) genes of hexaploid triticale (x Triticosecale Wittmack) are orthologs of puroindoline a (Pina) and puroindoline b (Pinb) in hexaploid wheat (Triticum aestivum L.). It has already been proven that RNA interference (RNAi)-based silencing of Pina and Pinb genes significantly decreased the puroindoline a and puroindoline b proteins in wheat and essentially increased grain hardness (J Exp Bot 62:4025-4036, 2011). The function of Sina and Sinb in triticale was tested by means of RNAi silencing and compared to wheat. Novel Sina and Sinb alleles in wild-type plants of cv. Wanad were identified and their expression profiles characterized. Alignment with wheat Pina-D1a and Pinb-D1a alleles showed 95% and 93.3% homology with Sina and Sinb coding sequences. Twenty transgenic lines transformed with two hpRNA silencing cassettes directed to silence Sina or Sinb were obtained by the Agrobacterium-mediated method. A significant decrease of expression of both Sin genes in segregating progeny of tested T1 lines was observed independent of the silencing cassette used. The silencing was transmitted to the T4 kernel generation. The relative transcript level was reduced by up to 99% in T3 progeny with the mean for the sublines being around 90%. Silencing of the Sin genes resulted in a substantial decrease of secaloindoline a and secaloindoline b content. The identity of SIN peptides was confirmed by mass spectrometry. The hardness index, measured by the SKCS (Single Kernel Characterization System) method, ranged from 22 to 56 in silent lines and from 37 to 49 in the control, and the mean values were insignificantly lower in the silent ones, proving increased softness. Additionally, the mean total seed protein content of silenced lines was about 6% lower compared with control lines. Correlation coefficients between hardness and transcript level were weakly positive. We documented that RNAi-based silencing of Sin genes resulted in
DEFF Research Database (Denmark)
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria
2016-01-01
/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...
Synthesis and characterization of sulfur-functionalized silica nanocapsules as mercury adsorbents
Palaniappan, Thenappan; Saman, Norasikin; Mat, Hanapi; Johari, Khairiraihanna
2017-12-01
Sulfur functionalized silica nanocapsules (S-SiNC) was successfully synthesized and characterized as a potential adsorbent for industrial applications. The synthesis of S-SiNC was carried out using the mircoemulsion templating method using cetyltrimethylammonium bromide (CTAB) as cationic surfactant, toluene as co-solvent, ammonia solution as catalyst, and tetraethylorthosilicate (TEOS) as the silica base. The S-SiNC adsorbent was characterized using Transmission Electron Microscope, Fourier Transformed Infra Red spectroscopy and nitrogen adsorption/desorption analysis. The physical and chemical properties of the SiNC changed as a result of the functionalization, hence affecting the extent of Hg(II) adsorption. The S-SiNCs were also tested in mercury ion [Hg(II)] adsorption via batch adsorption process with variation in initial Hg (II) concentration. It was found that there is a significant improvement in Hg(II) adsorption performance after being functionalized with elemental sulfur. The highest Hg(II) adsorption capacity was obtained for S-SiNC (107.875 mg/g), which significantly outperformed the blank SiNC. The experimental data obtained was found to be fitting well to the Langmuir isotherm model (R2= 0.979) compared to Freundlich isotherm model. Thus, the results demonstrated the potential application of sulfur functionalized silica nanocapsules as adsorbent in industrial applications.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Tacit Authorization : A Legal Solution for Administrative Silence
Hoogstra, Nicole; de Graaf, K.J.
2016-01-01
This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if
PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun
2017-02-02
Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
RNAi-Based Functional Genomics Identifies New Virulence Determinants in Mucormycosis.
Directory of Open Access Journals (Sweden)
Trung Anh Trieu
2017-01-01
Full Text Available Mucorales are an emerging group of human pathogens that are responsible for the lethal disease mucormycosis. Unfortunately, functional studies on the genetic factors behind the virulence of these organisms are hampered by their limited genetic tractability, since they are reluctant to classical genetic tools like transposable elements or gene mapping. Here, we describe an RNAi-based functional genomic platform that allows the identification of new virulence factors through a forward genetic approach firstly described in Mucorales. This platform contains a whole-genome collection of Mucor circinelloides silenced transformants that presented a broad assortment of phenotypes related to the main physiological processes in fungi, including virulence, hyphae morphology, mycelial and yeast growth, carotenogenesis and asexual sporulation. Selection of transformants with reduced virulence allowed the identification of mcplD, which encodes a Phospholipase D, and mcmyo5, encoding a probably essential cargo transporter of the Myosin V family, as required for a fully virulent phenotype of M. circinelloides. Knock-out mutants for those genes showed reduced virulence in both Galleria mellonella and Mus musculus models, probably due to a delayed germination and polarized growth within macrophages. This study provides a robust approach to study virulence in Mucorales and as a proof of concept identified new virulence determinants in M. circinelloides that could represent promising targets for future antifungal therapies.
Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati
2000-01-01
Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"
Directory of Open Access Journals (Sweden)
Yixiang Han
Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.
Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.
Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan
2018-04-06
The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Directory of Open Access Journals (Sweden)
Yuh Chwen G Lee
2015-06-01
Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously
Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis
Directory of Open Access Journals (Sweden)
Diana eSánchez-Rangel
2016-03-01
Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.
Preparation and characterization of ω-functionalized polystyrene-magnetite nanocomposites
International Nuclear Information System (INIS)
Jiang Liming; Sun Weilin; Kim, Jungahn
2007-01-01
Magnetite (Fe 3 O 4 ) nanoparticles were prepared by in situ precipitation and oxidation of ferrous ions in the presence of ω-functionalized polystyrenes having carboxylate, sulfonate, thiol, and thiolated groups. Based on the results for the orthogonal experimental design, both the ratio of the concentration of iron precursor to polymer and the reaction temperature were the major factors controlling the particle size and its shape morphology. By adjusting the reaction conditions, the iron oxide particle size can be effectively controlled in the range between 2 and 20 nm. The magnetite-based polymer composite was characterized by UV-vis spectroscopy, thermogravimetric analysis, transmission electron microscopy, and X-ray diffraction. Magnetization measurements revealed that the nanocomposite materials exhibit superparamagnetic behavior at room temperature
Preparation and characterization of {omega}-functionalized polystyrene-magnetite nanocomposites
Energy Technology Data Exchange (ETDEWEB)
Jiang Liming [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China)]. E-mail: cejlm@zju.edu.cn; Sun Weilin [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Kim, Jungahn [Polymer Hybrids Center, Korea Institute of Science and Technology, Seoul 130-650 (Korea, Republic of)
2007-02-15
Magnetite (Fe{sub 3}O{sub 4}) nanoparticles were prepared by in situ precipitation and oxidation of ferrous ions in the presence of {omega}-functionalized polystyrenes having carboxylate, sulfonate, thiol, and thiolated groups. Based on the results for the orthogonal experimental design, both the ratio of the concentration of iron precursor to polymer and the reaction temperature were the major factors controlling the particle size and its shape morphology. By adjusting the reaction conditions, the iron oxide particle size can be effectively controlled in the range between 2 and 20 nm. The magnetite-based polymer composite was characterized by UV-vis spectroscopy, thermogravimetric analysis, transmission electron microscopy, and X-ray diffraction. Magnetization measurements revealed that the nanocomposite materials exhibit superparamagnetic behavior at room temperature.
What does it take to break the silence in teams: Authentic leadership or proactive followership?
Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua
2017-01-01
Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in
Resounding Silences : Subtle Norm Regulation in Everyday Interactions
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.
In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to
Ronningstam, Elsa
2006-10-01
Cultural experience of silence and individual vicissitudes between talking and being silent influence the way individuals form an alliance and pursue the analytic process. This is of relevance both for the patient and for the psychoanalyst/therapist. The author describes a patient, whose silent phase occurred in the fifth and sixth year of intensive psychoanalytic psychotherapy. She suggests that a) the silence functioned as a protection of a space for the core self and promoted inner transformation and psychological development; b) the silence involved a transference-countertransference matrix with projective identifications of the patient's internalized mother- and father-related objects that caused a tenuous balance between maintaining and erasing the relationship between the patient and the author; c) the silence phase was highly influenced by the author's own cultural background and what she brought into the relationship of tolerance of being silent in the presence of another, and understanding of the many complex functions of silence. During the silent phase the patient moved from simply describing and naming her affects and inner experiences or expressing them as somatic processes, to being able to internally access and verbally convey her own affects and experiences in the therapeutic alliance. This process involved both affect desomatization, affect differentiation, and affect verbalization.
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T
2016-02-24
There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.
Directory of Open Access Journals (Sweden)
Barra Viviana
2012-02-01
Full Text Available Abstract Background Aneuploidy has been acknowledged as a major source of genomic instability in cancer, and it is often considered the result of chromosome segregation errors including those caused by defects in genes controlling the mitotic spindle assembly, centrosome duplication and cell-cycle checkpoints. Aneuploidy and chromosomal instability has been also correlated with epigenetic alteration, however the molecular basis of this correlation is poorly understood. Results To address the functional connection existing between epigenetic changes and aneuploidy, we used RNA-interference to silence the DNMT1 gene, encoding for a highly conserved member of the DNA methyl-transferases. DNMT1 depletion slowed down proliferation of near-diploid human tumor cells (HCT116 and triggered G1 arrest in primary human fibroblasts (IMR90, by inducing p53 stabilization and, in turn, p21waf1 transactivation. Remarkably, p53 increase was not caused by DNA damage and was not observed after p14-ARF post-transcriptional silencing. Interestingly, DNMT1 silenced cells with p53 or p14-ARF depleted did not arrest in G1 but, instead, underwent DNA hypomethylation and became aneuploid. Conclusion Our results suggest that DNMT1 depletion triggers a p14ARF/p53 dependent cell cycle arrest to counteract the aneuploidy induced by changes in DNA methylation.
SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.
Directory of Open Access Journals (Sweden)
Xiao-Peng Xiong
2015-08-01
Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.
Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur
2017-07-01
Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
International Nuclear Information System (INIS)
Patel, N. V.; Parmar, R. J.; Parmar, J. S.
2003-01-01
The acrylamide based curing agents were prepared form methyl methacrylate-acrylamide copolymers by further methylolation and subsequent etherification with butanol. These were characterized for their various physico-chemical characteristics. Various sets of these ACAs were blended with hydroxyl functional acrylic resin to prepare the staving compared with the conventional melamine-formaldehyde based curing agent containing compositions. The films were also characterized thermogravimetric analysis and IR-spectra. The result reveals that the properties of certain compositions based on ACAs were remarkably better than those of conventional melamine-formaldehyde based curing agent based coatings
Breaking Classroom Silences: A View from Linguistic Ethnography
Rampton, Ben; Charalambous, Constadina
2016-01-01
This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…
Breaking the Silence Surrounding Mental Health on Campus
Roper, Larry D.
2013-01-01
Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…
Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C
2016-01-01
Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the
Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.
2014-01-01
Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119
Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.
2004-01-01
RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing
Underground laboratories: Cosmic silence, loud science
Energy Technology Data Exchange (ETDEWEB)
Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)
2010-01-01
Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.
Tindwa, Hamisi; Jo, Yong Hun; Patnaik, Bharat Bhusan; Lee, Yong Seok; Kang, Sang Sun; Han, Yeon Soo
2015-07-01
Macroautophagy (hereinafter called autophagy) is a highly regulated process used by eukaryotic cells to digest portions of the cytoplasm that remodels and recycles nutrients and disposes of unwanted cytoplasmic constituents. Currently 36 autophagy-related genes (ATG) and their homologs have been characterized in yeast and higher eukaryotes, including insects. In the present study, we identified and functionally characterized the immune function of an ATG8 homolog in a coleopteran insect, Tenebrio molitor (TmATG8). The cDNA of TmATG8 comprises of an ORF of 363 bp that encodes a protein of 120 amino acid residues. TmATG8 transcripts are detected in all the developmental stages analyzed. TmAtg8 protein contains a highly conserved C-terminal glycine residue (Gly116) and shows high amino acid sequence identity (98%) to its Tribolium castaneum homolog, TcAtg8. Loss of function of TmATG8 by RNAi led to a significant increase in the mortality rates of T. molitor larvae against Listeria monocytogenes. Unlike dsEGFP-treated control larvae, TmATG8-silenced larvae failed to turn-on autophagy in hemocytes after injection with L. monocytogenes. These data suggest that TmATG8 play a role in mediating autophagy-based clearance of Listeria in T. molitor. Copyright © 2015 Elsevier Ltd. All rights reserved.
Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo
Directory of Open Access Journals (Sweden)
Tasleem Arif
2014-01-01
Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.
Production And Characterization Of Tungsten-Based Positron Moderators
International Nuclear Information System (INIS)
Lucio, O. G. de; Morales, J. G.; Cruz-Manjarrez, H.
2011-01-01
Experiments of interest in Atomic Physics require production of well-defined low-energy positron beams through a moderation process of high-energy positrons, which can be produced by either the use of a radioactive source or by accelerator based pair production process. Tungsten is one of the most commonly used moderator materials because of its reasonable efficiency, high work function and relatively low cost. In this work we present different methods to produce tungsten-based candidate moderators in a variety of shapes. We also present results from characterizing these candidate moderators by ion beam analysis and microscopy techniques.
Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo
2017-08-15
Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Directory of Open Access Journals (Sweden)
Mohamad Issa
2016-01-01
Full Text Available Tinnitus is the phantom perception of sound in the absence of an acoustic stimulus. To date, the purported neural correlates of tinnitus from animal models have not been adequately characterized with translational technology in the human brain. The aim of the present study was to measure changes in oxy-hemoglobin concentration from regions of interest (ROI; auditory cortex and non-ROI (adjacent nonauditory cortices during auditory stimulation and silence in participants with subjective tinnitus appreciated equally in both ears and in nontinnitus controls using functional near-infrared spectroscopy (fNIRS. Control and tinnitus participants with normal/near-normal hearing were tested during a passive auditory task. Hemodynamic activity was monitored over ROI and non-ROI under episodic periods of auditory stimulation with 750 or 8000 Hz tones, broadband noise, and silence. During periods of silence, tinnitus participants maintained increased hemodynamic responses in ROI, while a significant deactivation was seen in controls. Interestingly, non-ROI activity was also increased in the tinnitus group as compared to controls during silence. The present results demonstrate that both auditory and select nonauditory cortices have elevated hemodynamic activity in participants with tinnitus in the absence of an external auditory stimulus, a finding that may reflect basic science neural correlates of tinnitus that ultimately contribute to phantom sound perception.
Qing, Tian; Yamin, Zhang; Guijie, Wang; Yan, Jin; Zhongyang, Shen
2017-08-01
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC) patients. The objective of this study was to investigate the effects and mechanism of STAT6 in human HCC cells. We found that STAT6 silencing significantly inhibited HepG2 and Hep3B cell survival and proliferation. We observed that depletion of STAT6 increased HepG2 and Hep3B cell apoptosis by using a histone DNA ELISA detection kit. STAT6 silencing induced expression of apoptosis-associated genes Bax and caspase-3/7 and inhibited anti-apoptosis gene Bcl-2 levels. We also observed that STAT6 silencing downregulated the expression of receptor activator of NF-κB ligand (RANKL). Our results demonstrated that treatment with pcDNA3.1-RANKL abolished STAT6 depletion-induced HepG2 and Hep3B cell apoptosis and growth inhibition. Based on these findings, we believe that RANKL plays a major role in STAT6-induced HCC cell apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots
Directory of Open Access Journals (Sweden)
Ida Bagus Andika
2016-09-01
Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.
Energy Technology Data Exchange (ETDEWEB)
Basiruddin, SK; Swain, Sarat K., E-mail: swainsk2@yahoo.co.in
2016-01-01
Reduced graphene has emerged as promising tools for detection based application of biomolecules as it has high surface area with strong fluorescence quenching property. We have used the concept of fluorescent quenching property of reduced graphene oxide to the fluorescent probes which are close vicinity of its surface. In present work, we have synthesized fluorescent based nano-sensor consist of phenylboronic acid functionalized reduced graphene oxide (rGO–PBA) and di-ol modified fluorescent probe for detection of biologically important glucose molecules. This fluorescent graphene based nano-probe has been characterized by high resolution transmission electron microscope (HRTEM), Atomic force microscope (AFM), UV–visible, Photo-luminescence (PL) and Fourier transformed infrared (FT-IR) spectroscopy. Finally, using this PBA functionalized reduced GO based nano-sensor, we were able to detect glucose molecule in the range of 2 mg/mL to 75 mg/mL in aqueous solution of pH 7.4. - Highlights: • Easy and simple synthesis of PBA functionalized reduced GO based nano probe. • PBA functionalized reduced GO graphene based nano-probes are characterized. • PBA functionalized reduced GO nano probe is used to detect glucose molecules. • It is very cost-effective and enzyme-free detection of glucose in solution.
International Nuclear Information System (INIS)
Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki
2009-01-01
Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.
Hovav, Ran; Chehanovsky, Noam; Moy, Michal; Jetter, Reinhard; Schaffer, Arthur A
2007-11-01
One of the most intriguing phenomena of fleshy fruit is the ability to maintain high water content at maturity, even following harvest. This is accomplished by a fruit cuticle that is highly impermeable to water diffusion. In this paper, we report on a novel genotype of tomato, developed via introgression from the wild species Solanum habrochaites, which is characterized by microfissuring of the fruit cuticle and dehydration of the mature fruit. The microfissure/dehydration phenotype is inherited as a single gene, termed Cwp1 (cuticular water permeability). The gene was fine mapped, and its identity was determined by map-based cloning and differential expression analysis in near-isogenic lines. Causality of the Cwp1 gene was shown by the heterologous transgenic expression of the gene in the cultivated tomato, which caused a microfissured fruit cuticle leading to dehydrated fruit. Cwp1 encodes for a protein of unidentified function in the DUF833 domain family. The gene is expressed in the fruit epidermis of the dehydrating genotype harbouring the wild-species introgression, but not in the cultivated tomato. It is expressed only in the primitive green-fruited wild tomato species, but is not expressed in the cultivated Solanum lycopersicum and the closely related Solanum cheesmaniae and Solanum pimpinellifolium, indicating a pre-adaptive role for Cwp1 silencing in the evolution and domestication of the cultivated tomato.
Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.
Rober, Peter; Rosenblatt, Paul C
2017-03-01
A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.
Vortex structure and characterization of quasiperiodic functions
International Nuclear Information System (INIS)
Dana, Itzhack; Chernov, Vladislav E
2002-01-01
Quasiperiodic functions (QPFs) are characterized by their full vortex structure in one unit cell. This characterization is much finer and more sensitive than the topological one given by the total vorticity per unit cell (the 'Chern index'). It is shown that QPFs with an arbitrarily prescribed vortex structure exist by constructing explicitly such a 'standard' QPF. Two QPFs with the same vortex structure are equivalent, in the sense that their ratio is a function which is strictly periodic, nonvanishing and at least continuous. A general QPF can then be approximately reconstructed from its vortex structure on the basis of the standard QPF and the equivalence concept. As another application of this concept, a simple method is proposed for calculating the quasiperiodic eigenvectors of periodic matrices. Possible applications to the quantum-chaos problem on a phase-space torus are briefly discussed
47 CFR 80.304 - Watch requirement during silence periods.
2010-10-01
....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...
Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C
2011-12-01
Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Cummings, A.; Chang, I.-J.
1988-11-01
Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.
Energy Technology Data Exchange (ETDEWEB)
Li, Minjing [School; Qian, Wei-jun [Pacific Northwest National Laboratory, Richland, Washington 99354, United States; Gao, Yuqian [Pacific Northwest National Laboratory, Richland, Washington 99354, United States; Shi, Liang [School; Liu, Chongxuan [Pacific Northwest National Laboratory, Richland, Washington 99354, United States; School
2017-09-28
The kinetics of biogeochemical processes in natural and engineered environmental systems are typically described using Monod-type or modified Monod-type models. These models rely on biomass as surrogates for functional enzymes in microbial community that catalyze biogeochemical reactions. A major challenge to apply such models is the difficulty to quantitatively measure functional biomass for constraining and validating the models. On the other hand, omics-based approaches have been increasingly used to characterize microbial community structure, functions, and metabolites. Here we proposed an enzyme-based model that can incorporate omics-data to link microbial community functions with biogeochemical process kinetics. The model treats enzymes as time-variable catalysts for biogeochemical reactions and applies biogeochemical reaction network to incorporate intermediate metabolites. The sequences of genes and proteins from metagenomes, as well as those from the UniProt database, were used for targeted enzyme quantification and to provide insights into the dynamic linkage among functional genes, enzymes, and metabolites that are necessary to be incorporated in the model. The application of the model was demonstrated using denitrification as an example by comparing model-simulated with measured functional enzymes, genes, denitrification substrates and intermediates
A loss in the family: silence, memory, and narrative identity after bereavement.
Baddeley, Jenna; Singer, Jefferson A
2010-02-01
Grief theories have converged on the idea that the sharing of autobiographical memory narratives of loss and of the deceased person, especially within the family, is a major way to maintain and/or reconfigure a healthy sense of identity after a loss. In contrast, we examine unspoken memory-the withholding of socially sharing autobiographical memories about the loss and the departed family member-as a way to either conserve an existing narrative identity or assert a new narrative identity. Depending on its context and function, silence about memory can play either a positive or negative role in an individual griever's ongoing narrative identity, as well as in the larger family narrative in which the griever's identity is embedded.
Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian
2011-01-01
A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179
Directory of Open Access Journals (Sweden)
Thanh Theresa Dinh
2014-07-01
Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.
Moll, Sandra E; Patten, Scott; Stuart, Heather; MacDermid, Joy C; Kirsh, Bonnie
2018-01-01
This study sought to evaluate whether a contact-based workplace education program was more effective than standard mental health literacy training in promoting early intervention and support for healthcare employees with mental health issues. A parallel-group, randomised trial was conducted with employees in 2 multi-site Ontario hospitals with the evaluators blinded to the groups. Participants were randomly assigned to 1 of 2 group-based education programs: Beyond Silence (comprising 6 in-person, 2-h sessions plus 5 online sessions co-led by employees who personally experienced mental health issues) or Mental Health First Aid (a standardised 2-day training program led by a trained facilitator). Participants completed baseline, post-group, and 3-mo follow-up surveys to explore perceived changes in mental health knowledge, stigmatized beliefs, and help-seeking/help-outreach behaviours. An intent-to-treat analysis was completed with 192 participants. Differences were assessed using multi-level mixed models accounting for site, group, and repeated measurement. Neither program led to significant increases in help-seeking or help-outreach behaviours. Both programs increased mental health literacy, improved attitudes towards seeking treatment, and decreased stigmatized beliefs, with sustained changes in stigmatized beliefs more prominent in the Beyond Silence group. Beyond Silence, a new contact-based education program customised for healthcare workers was not superior to standard mental health literacy training in improving mental health help-seeking or help-outreach behaviours in the workplace. The only difference was a reduction in stigmatized beliefs over time. Additional research is needed to explore the factors that lead to behaviour change.
Cao, Xianxiang; Xu, Jing; Yue, Dong
2018-02-01
More and more evidences have ensured the crucial functions of long non-coding RNAs (lncRNAs) in multiple tumors. It has been discovered that lncRNA-SNHG16 is involved in many tumors. Even so, it is still necessary to study SNHG16 comprehensively in bladder cancer. In terms of our study, the level of SNHG16 both in the tumor tissues and cell lines was measured and the relationship among SNHG16, clinicopathological traits and prognosis was explored. Interference assays were applied to determine the biological functions of SNHG16. It was discovered that the level of SNHG16 was evidently enhanced both in tissues and cell lines of bladder cancer. Patients with highly expressed SNHG16 suffered from poor overall survival. Multivariable Cox proportional hazards regression analysis implied that highly expressed SNHG16 could be used as an independent prognostic marker. It could be known from functional assays that silenced SNHG16 impaired cell proliferation, owing to the effects of SNHG16 on cell cycle and apoptosis. Finally, mechanism experiments revealed that SNHG16 could epigenetically silence the expression of p21. The facts above pointed out that lncRNA-SNHG16 might be quite vital for the diagnosis and development of bladder cancer, and could even become an important therapeutic target for bladder cancer.
Nutritional and functional characterization of barley flaxseed based functional dry soup mix.
Kaur, Sumeet; Das, Madhusweta
2015-09-01
Barley flaxseed based functional dry soup mix (BFSM) was developed from whole barely flour (46.296%), roasted flaxseed powder (23.148%) and the seasoning (30.555%) comprising several flavoring compounds and anticaking agent, using simple processing technique. Developed BFSM was nutritious. On dry matter basis it contained: protein (14.31%), carbohydrate excluding crude fiber (54.70%), fat (8.70%), ash (17.45%) and crude fiber (4.84%). It was low glycemic soup, free of antinutritional risk and had calorific value of 319.77 kcal/100 g (wet or sample basis, sb) estimated from its composition. 100 g (sb) of BFSM contained 4.36 g β-glucans and 8.08 g total lipid of which 25.6% was ω-3 fatty acids. Different extracts of BFSM revealed the presence of total phenols (0.57-1.86 mg gallic acid equivalent/g, sb) with antioxidants equivalence of DPPH (20.69-39.07%) and FRAP (120-331 μm Fe (II)/g, sb).
Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako
2015-12-16
MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.
Li, Airong; Ahsen, Osman O; Liu, Jonathan J; Du, Chuang; McKee, Mary L; Yang, Yan; Wasco, Wilma; Newton-Cheh, Christopher H; O'Donnell, Christopher J; Fujimoto, James G; Zhou, Chao; Tanzi, Rudolph E
2013-09-15
The SRY-related HMG-box 5 (SOX5) gene encodes a member of the SOX family of transcription factors. Recently, genome-wide association studies have implicated SOX5 as a candidate gene for susceptibility to four cardiac-related endophenotypes: higher resting heart rate (HR), the electrocardiographic PR interval, atrial fibrillation and left ventricular mass. We have determined that human SOX5 has a highly conserved Drosophila ortholog, Sox102F, and have employed transgenic Drosophila models to quantitatively measure cardiac function in adult flies. For this purpose, we have developed a high-speed and ultrahigh-resolution optical coherence tomography imaging system, which enables rapid cross-sectional imaging of the heart tube over various cardiac cycles for the measurement of cardiac structural and dynamical parameters such as HR, dimensions and areas of heart chambers, cardiac wall thickness and wall velocities. We have found that the silencing of Sox102F resulted in a significant decrease in HR, heart chamber size and cardiac wall velocities, and a significant increase in cardiac wall thickness that was accompanied by disrupted myofibril structure in adult flies. In addition, the silencing of Sox102F in the wing led to increased L2, L3 and wing marginal veins and increased and disorganized expression of wingless, the central component of the Wnt signaling pathway. Collectively, the silencing of Sox102F resulted in severe cardiac dysfunction and structural defects with disrupted Wnt signaling transduction in flies. This implicates an important functional role for SOX5 in heart and suggests that the alterations in SOX5 levels may contribute to the pathogenesis of multiple cardiac diseases or traits.
Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans
Directory of Open Access Journals (Sweden)
Heikkinen Liisa
2008-06-01
Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.
Directory of Open Access Journals (Sweden)
Fangfang Li
2017-09-01
Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.
Functional requirements for gas characterization system computer software
International Nuclear Information System (INIS)
Tate, D.D.
1996-01-01
This document provides the Functional Requirements for the Computer Software operating the Gas Characterization System (GCS), which monitors the combustible gasses in the vapor space of selected tanks. Necessary computer functions are defined to support design, testing, operation, and change control. The GCS requires several individual computers to address the control and data acquisition functions of instruments and sensors. These computers are networked for communication, and must multi-task to accommodate operation in parallel
Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S
2015-06-01
Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.
Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M
2017-01-01
Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered
Stiegler, Sam
2008-01-01
This interview-based essay explores how a teacher-training program, while ostensibly dedicated to the idea of teaching for social justice, completely neglected issues of homophobia and heterosexism. How did silence around queer issues leave a dedicated group of young, queer teachers-in-training without the academic, intellectual, or psychological…
Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T
2014-12-01
Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.
Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine
2014-12-01
RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence
Directory of Open Access Journals (Sweden)
Beatrice Nori
2017-07-01
Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author identifies the broken syntax and the combination of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonment of chronological time in linguistic terms conveys the subjective, circular, and illogical element of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their present experiences. The present work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.
Directory of Open Access Journals (Sweden)
Aude Deschuyteneer
Full Text Available Proteins of the conserved Mep-Amt-Rh family, including mammalian Rhesus factors, mediate transmembrane ammonium transport. Ammonium is an important nitrogen source for the biosynthesis of amino acids but is also a metabolic waste product. Its disposal in urine plays a critical role in the regulation of the acid/base homeostasis, especially with an acid diet, a trait of Western countries. Ammonium accumulation above a certain concentration is however pathologic, the cytotoxicity causing fatal cerebral paralysis in acute cases. Alteration in ammonium transport via human Rh proteins could have clinical outcomes. We used a yeast-based expression assay to characterize human Rh variants resulting from non synonymous single nucleotide polymorphisms (nsSNPs with known or unknown clinical phenotypes and assessed their ammonium transport efficiency, protein level, localization and potential trans-dominant impact. The HsRhAG variants (I61R, F65S associated to overhydrated hereditary stomatocytosis (OHSt, a disease affecting erythrocytes, proved affected in intrinsic bidirectional ammonium transport. Moreover, this study reveals that the R202C variant of HsRhCG, the orthologue of mouse MmRhcg required for optimal urinary ammonium excretion and blood pH control, shows an impaired inherent ammonium transport activity. Urinary ammonium excretion was RHcg gene-dose dependent in mouse, highlighting MmRhcg as a limiting factor. HsRhCG(R202C may confer susceptibility to disorders leading to metabolic acidosis for instance. Finally, the analogous R211C mutation in the yeast ScMep2 homologue also impaired intrinsic activity consistent with a conserved functional role of the preserved arginine residue. The yeast expression assay used here constitutes an inexpensive, fast and easy tool to screen nsSNPs reported by high throughput sequencing or individual cases for functional alterations in Rh factors revealing potential causal variants.
Sox6 directly silences epsilon globin expression in definitive erythropoiesis.
Directory of Open Access Journals (Sweden)
2006-02-01
Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
Modulation Based on Probability Density Functions
Williams, Glenn L.
2009-01-01
A proposed method of modulating a sinusoidal carrier signal to convey digital information involves the use of histograms representing probability density functions (PDFs) that characterize samples of the signal waveform. The method is based partly on the observation that when a waveform is sampled (whether by analog or digital means) over a time interval at least as long as one half cycle of the waveform, the samples can be sorted by frequency of occurrence, thereby constructing a histogram representing a PDF of the waveform during that time interval.
Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil
2017-09-01
Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C
2012-01-01
RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.
Wu, Baolei; Wei, Jianhua; Hu, Zhiqiang; Shan, Chun; Wang, Lei; Zhang, Chenping; Yang, Xi; Yang, Xinjie; Lei, Delin
2016-02-01
Salivary adenoid cystic carcinoma (SACC) is the most frequent salivary gland malignancy with a unique characteristic that has been named perineural invasion (PNI). EMMPRIN is a transmembrane glycoprotein that has been demonstrated to promote PNI in SACC. Slug, one of the most effective promoters of the epithelial-to-mesenchymal transition (EMT), has been found to be associated with PNI in SACC. The aim of the present study was to investigate the roles and relationships of Slug, EMMPRIN, and E-cadherin in the PNI process of SACC. The expression levels of Slug, EMMPRIN, and E-cadherin in 115 primary SACC cases were statistically analyzed by immunohistochemistry. Simultaneously, the SACC cell line SACC-83 was transfected with recombinant plasmids of silencing Slug (si-Slug) and/or silencing EMMPRIN (si-EMMPRIN). The functions of Slug and EMMPRIN in the EMT and PNI process were assessed by reverse transcription PCR (RT-PCR), western blotting, morphological observation, scratch test, migration assay, and in vitro perineural invasion assay. The immunohistochemical statistics revealed that the high expression of Slug and EMMPRIN and the low expression of E-cadherin were significantly associated with the PNI of SACC (P EMMPRIN expression (P EMMPRIN expression were both significantly negatively associated with E-cadherin expression (P EMMPRIN silencing both significantly inhibited EMMPRIN expression but promoted E-cadherin expression in SACC-83 cells (P EMMPRIN, or both induced cell morphology changes and inhibited tumor cell motility and PNI ability in SACC-83 cells (P EMMPRIN and then upregulating E-cadherin in the PNI process of SACC. The present study indicated that Slug and EMMPRIN are potential biomarkers and therapeutic targets for the diagnosis and treatment of PNI in human SACC.
Speaking of Silence: Comments from an Irish Studies Perspective
DEFF Research Database (Denmark)
McQuaid, Sara Dybris; Beville, Maria
2012-01-01
argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...
Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing
Ullman, Jacqueline; Ferfolja, Tania
2015-01-01
National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…
Characterization of the materials for functional application
International Nuclear Information System (INIS)
Duh, J.-G.
1997-01-01
The development of material products with extended performances has been equally pushed by the advancement of analysis techniques. Characterization of materials for functional application will be a challenge for further analytical methodology development. In this lecture, several characterization techniques will be outlined and emphasized with respect to special function applications as follows. 1. Phase analysis, crystallite size and microstrain of chemically synthesized ceramic powders in relation to phase transformation. 2. Microstructural evolution and reliability test in the solder joint of microelectronic package. The growth morphology of the intermetallic compound and its effects on the solder joint reliability will be highlighted and discussed. 3. Mechanical properties of thin films and metallized substrates, including adhesion strength, microhardness, scratch behavior, wear resistance. Special interest will be focused on the indentation-scratch deformation associated with the coating/substrate assembly. Employment of atomic force microscope in the evaluation of nano-tribology will also be probed. 4. Diffusion-related kinetics at interface by means of theoretical modelling and electron microanalysis. (author)
Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato
Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo
2016-12-01
Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.
Characterizing the Spatial Density Functions of Neural Arbors
Teeter, Corinne Michelle
Recently, it has been proposed that a universal function describes the way in which all arbors (axons and dendrites) spread their branches over space. Data from fish retinal ganglion cells as well as cortical and hippocampal arbors from mouse, rat, cat, monkey and human provide evidence that all arbor density functions (adf) can be described by a Gaussian function truncated at approximately two standard deviations. A Gaussian density function implies that there is a minimal set of parameters needed to describe an adf: two or three standard deviations (depending on the dimensionality of the arbor) and an amplitude. However, the parameters needed to completely describe an adf could be further constrained by a scaling law found between the product of the standard deviations and the amplitude of the function. In the following document, I examine the scaling law relationship in order to determine the minimal set of parameters needed to describe an adf. First, I find that the at, two-dimensional arbors of fish retinal ganglion cells require only two out of the three fundamental parameters to completely describe their density functions. Second, the three-dimensional, volume filling, cortical arbors require four fundamental parameters: three standard deviations and the total length of an arbor (which corresponds to the amplitude of the function). Next, I characterize the shape of arbors in the context of the fundamental parameters. I show that the parameter distributions of the fish retinal ganglion cells are largely homogenous. In general, axons are bigger and less dense than dendrites; however, they are similarly shaped. The parameter distributions of these two arbor types overlap and, therefore, can only be differentiated from one another probabilistically based on their adfs. Despite artifacts in the cortical arbor data, different types of arbors (apical dendrites, non-apical dendrites, and axons) can generally be differentiated based on their adfs. In addition, within
Silencing cinema: film censorship around the world
Biltereyst, Daniël; Vande Winkel, Roel
2013-01-01
Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...
Directory of Open Access Journals (Sweden)
Wen Zhang
Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of
International Nuclear Information System (INIS)
Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S
2010-01-01
Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials
Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.
2014-01-01
Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)
Cloning and characterization of a y-type inactive HMW glutenin ...
African Journals Online (AJOL)
The high molecular weight glutenin subunits (HMW-GS) are key factors of the breadmaking quality of common wheat flour. In the present study, one unexpressed 1By gene from Triticum durum cultivar youmangbingmai was cloned and characterized. The results indicated that the silenced 1By gene in youmangbingmai ...
Small silencing RNAs: an expanding universe.
Ghildiyal, Megha; Zamore, Phillip D
2009-02-01
Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.
Adaptive endpoint detection of seismic signal based on auto-correlated function
International Nuclear Information System (INIS)
Fan Wanchun; Shi Ren
2001-01-01
Based on the analysis of auto-correlation function, the notion of the distance between auto-correlation function was quoted, and the characterization of the noise and the signal with noise were discussed by using the distance. Then, the method of auto- adaptable endpoint detection of seismic signal based on auto-correlated similarity was summed up. The steps of implementation and determining of the thresholds were presented in detail. The experimental results that were compared with the methods based on artificial detecting show that this method has higher sensitivity even in a low signal with noise ratio circumstance
Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M
2018-04-01
Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host
Duplication of an upstream silencer of FZP increases grain yield in rice.
Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong
2017-11-01
Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
Bhattacharya, Labanya; Sahu, Sridhar
2018-05-01
Two different oligomers, containing methyl substituted Benzodithiophene (BDT) as donor unit, fluorinated thiophene as the π-bridge unit and two different kinds of acceptors based on fluorinated benzothiadiazole, fluorinated benzoselenadiazole units are designed for bulk heterojunction (BHJ) organic solar cell (OSC). The ground and excited state properties of those donor-π-acceptor-π-donor (D-π-A-π-D) oligomeric configurations are characterized via density functional (DFT) and time dependent density functional theory (TD-DFT). The parameters such as dipole moment (ρ), chemical potential (µ), electronegativity (χ), frontier molecular orbital (FMO) analysis, HOMO-LUMO gap, open circuit voltage (Voc) and driving force (ΔE) are calculated to analyze geometrical, electronic structural, quantum chemical and photovoltaic properties of the compounds. In addition, optical absorption spectra are also presented for the optical characterization of the compounds.
Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.
2016-01-01
Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2014-06-01
Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.
Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana
2016-01-01
Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,
Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai
2012-10-05
The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.
Performances of Student Activism: Sound, Silence, Gender, and Dis/ability
Pasque, Penny A.; Vargas, Juanita Gamez
2014-01-01
This chapter explores the various performances of activism by students through sound, silence, gender, and dis/ability and how these performances connect to social change efforts around issues such as human trafficking, homeless children, hunger, and children with varying abilities.
Directory of Open Access Journals (Sweden)
Jin Dong-Il
2011-05-01
Full Text Available Abstract Background The unfolded protein response (UPR is an evolutionary conserved adaptive reaction for increasing cell survival under endoplasmic reticulum (ER stress conditions. X-box-binding protein-1 (Xbp1 is a key transcription factor of UPR that activates genes involved in protein folding, secretion, and degradation to restore ER function. The UPR induced by ER stress was extensively studied in diseases linked to protein misfolding and aggregations. However, in the porcine system, genes in the UPR pathway were not investigated. In this study, we isolated and characterized the porcine Xbp1 (pXbp1 gene in ER stress using porcine embryonic fibroblast (PEF cells and porcine organs. ER stress was induced by the treatment of tunicamycin and cell viability was investigated by the MTT assay. For cloning and analyzing the expression pattern of pXbp1, RT-PCR analysis and Western blot were used. Knock-down of pXbp1 was performed by the siRNA-mediated gene silencing. Results We found that the pXbp1 mRNA was the subject of the IRE1α-mediated unconventional splicing by ER stress. Knock-down of pXbp1 enhanced ER stress-mediated cell death in PEF cells. In adult organs, pXbp1 mRNA and protein were expressed and the spliced forms were detected. Conclusions It was first found that the UPR mechanisms and the function of pXbp1 in the porcine system. These results indicate that pXbp1 plays an important role during the ER stress response like other animal systems and open a new opportunity for examining the UPR pathway in the porcine model system.
Development and characterization of a soymilk Kefir-based functional beverage
Directory of Open Access Journals (Sweden)
Camilla Fernanda Godinho da SILVA
2018-03-01
Full Text Available Abstract Kefir is a fermented beverage that deserves special attention, since it has probiotic activity and unique sensory, nutritional, and therapeutic properties. Given that both kefir and soymilk are beneficial to human health, this study aimed to assess the physicochemical characteristics and acceptability of soymilk Kefir-based functional beverages (SKB properly inoculated with lactobacilli strain after 16h of incubation at 37 °C. It was monitored lactobacilli cell viability, yeasts count, pH, titratable acidity, lipids, proteins, ash, total solid, carbohydrates, caloric values and acceptability of the products. Additionally was conducted a shelf-life study of SKB added of peach-flavor. The lactobacilli cell count ranged from 7.0 to 8.0 Log10 CFUmL-1 and pH values from 4.5 to 4.6. SKB samples with higher soymilk kefir percent presented higher lactobacilli cell count and lower lipid, ash, total solid, carbohydrate and caloric value. Results showed similar preferential rates for the SKB up to 30% of added soymilk kefir. The functional peach-flavored beverage presented appropriate pH value (4.3 and high viable cells count (7.0 Log10 CFUmL-1 up to the 28th day of cold storage, showed high acceptability (94.5% and positive purchase intention (83.4% among consumers.
Directory of Open Access Journals (Sweden)
Kishor Duwadi
Full Text Available Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10 were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER, suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves.
Ventura, Tomer; Manor, Rivka; Aflalo, Eliahu D; Weil, Simy; Rosen, Ohad; Sagi, Amir
2012-03-01
In Crustacea, an early evolutionary group (∼50 000 species) inhabiting most ecological niches, sex differentiation is regulated by a male-specific androgenic gland (AG). The identification of AG-specific insulin-like factors (IAGs) and genomic sex markers offers an opportunity for a deeper understanding of the sexual differentiation mechanism in crustaceans and other arthropods. Here, we report, to our knowledge, the first full and functional sex reversal of male freshwater prawns (Macrobrachium rosenbergii) through the silencing of a single IAG-encoding gene. These "neofemales" produced all-male progeny, as proven by sex-specific genomic markers. This finding offers an insight regarding the biology and evolution of sex differentiation regulation, with a novel perspective for the evolution of insulin-like peptides. Our results demonstrate how temporal intervention with a key regulating gene induces a determinative, extreme phenotypic shift. Our results also carry tremendous ecological and commercial implications. Invasive and pest crustacean species represent genuine concerns worldwide without an apparent solution. Such efforts might, therefore, benefit from sexual manipulations, as has been successfully realized with other arthropods. Commercially, such manipulation would be significant in sexually dimorphic cultured species, allowing the use of nonbreeding, monosex populations while dramatically increasing yield and possibly minimizing the invasion of exotic cultured species into the environment.
Silencing of Stress-Regulated miRNAs in Plants by Short Tandem Target Mimic (STTM) Approach.
Teotia, Sachin; Tang, Guiliang
2017-01-01
In plants, microRNAs (miRNAs) regulate more than hundred target genes comprising largely transcription factors that control growth and development as well as stress responses. However, the exact functions of miRNA families could not be deciphered because each miRNA family has multiple loci in the genome, thus are functionally redundant. Therefore, an ideal approach to study the function of a miRNA family is to silence the expression of all members simultaneously, which is a daunting task. However, this can be partly overcome by Target Mimic (TM) approach that can knockdown an entire miRNA family. STTM is a modification of TM approach and complements it. STTMs have been successfully used in monocots and dicots to block miRNA functions. miR159 has been shown to be differentially regulated by various abiotic stresses including ABA in various plant species. Here, we describe in detail the protocol for designing STTM construct to block miR159 functions in Arabidopsis, with the potential to apply this technique on a number of other stress-regulated miRNAs in plants.
Xu, Zejing
Silicon nanoparticles are attractive candidates for biological, photovoltaic and energy storage applications due to their size dependent optoelectronic properties. These include tunable light emission, high brightness, and stability against photo-bleaching relative to organic dyes (see Chapter 1). The preparation and characterization of silicon nanoparticle based hybrid nanomaterials and their relevance to photovoltaic and biological applications are described. The surface-passivated silicon nanoparticles were produced in one step from the reactive high-energy ball milling (RHEBM) of silicon wafers with various organic ligands. The surface structure and optical properties of the passivated silicon nanoparticles were systematically characterized. Fast approaches for purifying and at the same time size separating the silicon nanoparticles using a gravity GPC column were developed. The hydrodynamic diameter and size distribution of these size-separated silicon nanoparticles were determined using GPC and Diffusion Ordered NMR Spectroscopy (DOSY) as fast, reliable alternative approaches to TEM. Water soluble silicon nanoparticles were synthesized by grafting PEG polymers onto functionalized silicon nanoparticles with distal alkyne or azide moieties. The surface-functionalized silicon nanoparticles were produced from the reactive high-energy ball milling (RHEBM) of silicon wafers with a mixture of either 5-chloro-1-pentyne in 1-pentyne or 1,7 octadiyne in 1-hexyne to afford air and water stable chloroalkyl or alkynyl terminated nanoparticles, respectively. Nanoparticles with the ω-chloroalkyl substituents were easily converted to ω-azidoalkyl groups through the reaction of the silicon nanoparticles with sodium azide in DMF. The azido terminated nanoparticles were then grafted with monoalkynyl-PEG polymers using a copper catalyzed alkyne-azide cycloaddition (CuAAC) reaction to afford core-shell silicon nanoparticles with a covalently attached PEG shell. Covalently
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Pierron, Denis; Opazo, Juan C; Heiske, Margit; Papper, Zack; Uddin, Monica; Chand, Gopi; Wildman, Derek E; Romero, Roberto; Goodman, Morris; Grossman, Lawrence I
2011-01-01
Cytochrome c (cyt c) participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i) loss of the paralogous testis isoform, (ii) an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii) atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection) occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Directory of Open Access Journals (Sweden)
Denis Pierron
Full Text Available Cytochrome c (cyt c participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i loss of the paralogous testis isoform, (ii an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing
Kelleher, Erin S.
2016-01-01
Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614
Functional characterization of transmembrane adenylyl cyclases from the honeybee brain.
Balfanz, Sabine; Ehling, Petra; Wachten, Sebastian; Jordan, Nadine; Erber, Joachim; Mujagic, Samir; Baumann, Arnd
2012-06-01
The second messenger cAMP has a pivotal role in animals' physiology and behavior. Intracellular concentrations of cAMP are balanced by cAMP-synthesizing adenylyl cyclases (ACs) and cAMP-cleaving phosphodiesterases. Knowledge about ACs in the honeybee (Apis mellifera) is rather limited and only an ortholog of the vertebrate AC3 isoform has been functionally characterized, so far. Employing bioinformatics and functional expression we characterized two additional honeybee genes encoding membrane-bound (tm)ACs. The proteins were designated AmAC2t and AmAC8. Unlike the common structure of tmACs, AmAC2t lacks the first transmembrane domain. Despite this unusual topography, AmAC2t-activity could be stimulated by norepinephrine and NKH477 with EC(50s) of 0.07 μM and 3 μM. Both ligands stimulated AmAC8 with EC(50s) of 0.24 μM and 3.1 μM. In brain cryosections, intensive staining of mushroom bodies was observed with specific antibodies against AmAC8, an expression pattern highly reminiscent of the Drosophila rutabaga AC. In a current release of the honeybee genome database we identified three additional tmAC- and one soluble AC-encoding gene. These results suggest that (1) the AC-gene family in honeybees is comparably large as in other species, and (2) based on the restricted expression of AmAC8 in mushroom bodies, this enzyme might serve important functions in honeybee behavior. Copyright © 2012 Elsevier Ltd. All rights reserved.
Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional
Retnawati, Berta Bekti
2003-01-01
There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...
From land cover change to land function dynamics: A major challenge to improve land characterization
Verburg, P.H.; Steeg, van de J.; Veldkamp, A.; Willemen, L.
2009-01-01
Land cover change has always had a central role in land change science. This central role is largely the result of the possibilities to map and characterize land cover based on observations and remote sensing. This paper argues that more attention should be given to land use and land functions and