WorldWideScience

Sample records for silencing suppressor proteins

  1. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  2. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  3. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  4. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  5. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  6. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  7. The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

    Science.gov (United States)

    Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

    2007-09-18

    Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

  8. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

    Directory of Open Access Journals (Sweden)

    Adriana F. Fusaro

    2017-10-01

    Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

  9. The Ebola virus VP35 protein is a suppressor of RNA silencing.

    Directory of Open Access Journals (Sweden)

    Joost Haasnoot

    2007-06-01

    Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.

  10. F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

    Science.gov (United States)

    Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

    2006-01-01

    Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

  11. Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

    Science.gov (United States)

    Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

    2015-10-02

    Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  13. Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

    Science.gov (United States)

    Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

    2015-06-01

    Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  14. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  15. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  16. The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

    Science.gov (United States)

    de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

    2015-11-01

    In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

  17. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

  18. A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines.

    Science.gov (United States)

    Oliveira, Virgínia Carla; Bartasson, Lorrainy; de Castro, Maria Elita Batista; Corrêa, José Raimundo; Ribeiro, Bergmann Morais; Resende, Renato Oliveira

    2011-01-01

    The nonstructural protein (NSs) of the Tomato spotted wilt virus (TSWV) has been identified as an RNAi suppressor in plant cells. A recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) designated vAcNSs, containing the NSs gene under the control of the viral polyhedrin (polh) gene promoter, was constructed and the effects of NSs in permissive, semipermissive and nonpermissive insect cells to vAcNSs infection were evaluated. vAcNSs produced more budded virus when compared to wild type in semipermissive cells. Co-infection of vAcNSs with wild type baculoviruses clearly enhanced polyhedra production in all host cells. Confocal microscopy analysis showed that NSs accumulated in abundance in the cytoplasm of permissive and semipermissive cells. In contrast, high amounts of NSs were detected in the nuclei of nonpermissive cells. Co-infection of vAcNSs with a recombinant AcMNPV containing the enhanced green fluorescent protein (egfp) gene, significantly increased EGFP expression in semipermissive cells and in Anticarsia gemmatalis-hemocytes. Absence of small RNA molecules of egfp transcripts in this cell line and in a permissive cell line indicates the suppression of gene silencing activity. On the other hand, vAcNSs was not able to suppress RNAi in a nonpermissive cell line. Our data showed that NSs protein of TSWV facilitates baculovirus replication in different lepidopteran cell lines, and these results indicate that NSs could play a similar role during TSWV-infection in its thrips vector. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  20. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  1. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  2. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  3. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  4. Visualization of plant viral suppressor silencing activity in intact leaf lamina by quantitative fluorescent imaging

    Directory of Open Access Journals (Sweden)

    Francis Kevin P

    2011-08-01

    Full Text Available Abstract Background Transient expression of proteins in plants has become a favoured method over the production of stably transformed plants because, in addition to enabling high protein yields, it is both fast and easy to apply. An enhancement of transient protein expression can be achieved by plant virus-encoded RNA silencing suppressor proteins. Since viral suppressor proteins differ in their efficiency to enhance transient protein expression in plants, we developed a whole-leaf green fluorescent protein (GFP-based imaging assay to quantitatively assess suppressor protein activity. Results In a transient GFP-expression assay using wild-type and GFP-transgenic N. benthamiana, addition of the plant viral suppressors Beet mild yellowing virus (BMYV-IPP P0 or Plum pox virus (PPV HC-Pro was shown to increase fluorescent protein expression 3-4-fold, 7 days post inoculation (dpi when compared to control plants. In contrast, in agroinfiltrated patches without suppressor activity, near complete silencing of the GFP transgene was observed in the transgenic N. benthamiana at 21 dpi. Both co-infiltrated suppressors significantly enhanced GFP expression over time, with HC-Pro co-infiltrations leading to higher short term GFP fluorescence (at 7 dpi and P0 giving higher long term GFP fluorescence (at 21 dpi. Additionally, in contrast to HC-Pro co-infiltrations, an area of complete GFP silencing was observed at the edge of P0 co-infiltrated areas. Conclusions Fluorescence imaging of whole intact leaves proved to be an easy and effective method for spatially and quantitatively observing viral suppressor efficiency in plants. This suppressor assay demonstrates that plant viral suppressors greatly enhanced transient GFP expression, with P0 showing a more prolonged suppressor activity over time than HC-Pro. Both suppressors could prove to be ideal candidates for enhancing target protein expression in plants.

  5. Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

    Directory of Open Access Journals (Sweden)

    Kittipong Rattanaporn

    2011-08-01

    Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  6. Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

    Science.gov (United States)

    Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

    2011-01-01

    Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  7. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  8. Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

    DEFF Research Database (Denmark)

    Nagasawa, T; Zhang, Q; Raghunath, P N

    2006-01-01

    To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

  9. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  10. Suppressors of RNA silencing encoded by tomato leaf curl

    Indian Academy of Sciences (India)

    Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

  11. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  12. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  13. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  15. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  16. The Heterologous Expression of the p22 RNA Silencing Suppressor of the Crinivirus Tomato Chlorosis Virus from Tobacco Rattle Virus and Potato Virus X Enhances Disease Severity but Does Not Complement Suppressor-Defective Mutant Viruses.

    Science.gov (United States)

    Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen

    2017-11-24

    To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.

  17. Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

    Science.gov (United States)

    Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

    2012-07-01

    HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

  18. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  19. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  20. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  1. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  2. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  3. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  4. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

    2004-01-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  5. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

    Science.gov (United States)

    Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

    2004-03-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

  6. Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

    Directory of Open Access Journals (Sweden)

    Howard Amanda

    2005-03-01

    Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

  7. Epigenetic silencing of MAL, a putative tumor suppressor gene, can contribute to human epithelium cell carcinoma

    Directory of Open Access Journals (Sweden)

    Zhang Jun

    2010-11-01

    Full Text Available Abstract Background To identify new and useful candidate biomarkers in head and neck squamous cell carcinoma (HNSCC, we performed a genome-wide survey and found that Myelin and lymphocyte-associated protein (MAL was a gene that was markedly down-regulated in HNSCC. Hence, we investigated the mechanism of MAL silencing and the effects of MAL on the proliferation, invasion, and apoptotic potential in HNSCC. Results MAL was significantly down-regulated in 91.7% of HNSCC specimens at the mRNA level as compared with adjacent normal tissues (P = 0.0004. Moreover, the relative transcript levels of the MAL gene were remarkably decreased by five-fold in nine HNSCC cell lines as compared with normal head and neck epithelium cells. MAL gene expression was restored in 44%, 67%, and 89% in HNSCC cell lines treated with TSA, 5-Aza-dC, and TSA plus 5-Aza-dC, respectively. Furthermore, bisulfate-treated DNA sequencing demonstrated that the two CpG islands (that is, M1 and M2 located in MAL promoter region were completely methylated in the HNSCC cell lines (CpG methylated ratio was more than 90%, and only one CpG island (that is, M1 was partially methylated in HNSCC tissues (CpG methylated ratio between 20% and 90%. A significant reduction in cell proliferation and a change in the cell cycle profile were also observed in MAL transfectants. Matrigel assay demonstrated that the invasiveness of HNSCC cells significantly decreased. A significant increase in the population of apoptotic cells was observed in MAL transfected cells. The exogenous expression of the MAL gene suppressed malignant phenotypes, while the cell death induced by MAL gene transfer was a result of apoptosis as demonstrated by the induction of cleavage of the poly (that is, ADP-ribose polymerase. Additionally, tumor growth was suppressed in cells expressing MAL as compared with cells not expressing MAL. Conclusion Our data suggest that the epigenetic inactivation of MAL, as a candidate tumor

  8. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  9. The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

    Science.gov (United States)

    Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

    2007-11-01

    The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

  10. The Cucumber vein yellowing virus silencing suppressor P1b can functionally replace HCPro in Plum pox virus infection in a host-specific manner.

    Science.gov (United States)

    Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian

    2012-02-01

    Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.

  11. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  12. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  13. Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

    Science.gov (United States)

    Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

    2010-10-10

    Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  16. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  17. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    Science.gov (United States)

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  18. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  19. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  20. The epigenetic modifier PRDM5 functions as a tumor suppressor through modulating WNT/β-catenin signaling and is frequently silenced in multiple tumors.

    Directory of Open Access Journals (Sweden)

    Xing-sheng Shu

    Full Text Available BACKGROUND: PRDM (PRDI-BF1 and RIZ domain containing proteins are zinc finger proteins involved in multiple cellular regulations by acting as epigenetic modifiers. We studied a recently identified PRDM member PRDM5 for its epigenetic abnormality and tumor suppressive functions in multiple tumorigeneses. METHODOLOGY/PRINCIPAL FINDINGS: Semi-quantitative RT-PCR showed that PRDM5 was broadly expressed in human normal tissues, but frequently silenced or downregulated in multiple carcinoma cell lines due to promoter CpG methylation, including 80% (4/5 nasopharyngeal, 44% (8/18 esophageal, 76% (13/17 gastric, 50% (2/4 cervical, and 25% (3/12 hepatocellular carcinoma cell lines, but not in any immortalized normal epithelial cell lines. PRDM5 expression could be restored by 5-aza-2'-deoxycytidine demethylation treatment in silenced cell lines. PRDM5 methylation was frequently detected by methylation-specific PCR (MSP in multiple primary tumors, including 93% (43/46 nasopharyngeal, 58% (25/43 esophageal, 88% (37/42 gastric and 63% (29/46 hepatocellular tumors. PRDM5 was further found a stress-responsive gene, but its response was impaired when the promoter was methylated. Ectopic PRDM5 expression significantly inhibited tumor cell clonogenicity, accompanied by the inhibition of TCF/β-catenin-dependent transcription and downregulation of CDK4, TWIST1 and MDM2 oncogenes, while knocking down of PRDM5 expression lead to increased cell proliferation. ChIP assay showed that PRDM5 bound to its target gene promoters and suppressed their transcription. An inverse correlation between the expression of PRDM5 and activated β-catenin was also observed in cell lines. CONCLUSIONS/SIGNIFICANCE: PRDM5 functions as a tumor suppressor at least partially through antagonizing aberrant WNT/β-catenin signaling and oncogene expression. Frequent epigenetic silencing of PRDM5 is involved in multiple tumorigeneses, which could serve as a tumor biomarker.

  1. Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

    Science.gov (United States)

    Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

    2015-01-01

    The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

  2. Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

    Science.gov (United States)

    Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

    2017-01-10

    In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

  3. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal for avirulence and RNA silencing suppression

    NARCIS (Netherlands)

    Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.

    2014-01-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)

  4. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  5. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  6. The protein histidine phosphatase LHPP is a tumour suppressor.

    Science.gov (United States)

    Hindupur, Sravanth K; Colombi, Marco; Fuhs, Stephen R; Matter, Matthias S; Guri, Yakir; Adam, Kevin; Cornu, Marion; Piscuoglio, Salvatore; Ng, Charlotte K Y; Betz, Charles; Liko, Dritan; Quagliata, Luca; Moes, Suzette; Jenoe, Paul; Terracciano, Luigi M; Heim, Markus H; Hunter, Tony; Hall, Michael N

    2018-03-29

    Histidine phosphorylation, the so-called hidden phosphoproteome, is a poorly characterized post-translational modification of proteins. Here we describe a role of histidine phosphorylation in tumorigenesis. Proteomic analysis of 12 tumours from an mTOR-driven hepatocellular carcinoma mouse model revealed that NME1 and NME2, the only known mammalian histidine kinases, were upregulated. Conversely, expression of the putative histidine phosphatase LHPP was downregulated specifically in the tumours. We demonstrate that LHPP is indeed a protein histidine phosphatase. Consistent with these observations, global histidine phosphorylation was significantly upregulated in the liver tumours. Sustained, hepatic expression of LHPP in the hepatocellular carcinoma mouse model reduced tumour burden and prevented the loss of liver function. Finally, in patients with hepatocellular carcinoma, low expression of LHPP correlated with increased tumour severity and reduced overall survival. Thus, LHPP is a protein histidine phosphatase and tumour suppressor, suggesting that deregulated histidine phosphorylation is oncogenic.

  7. PML tumor suppressor protein is required for HCV production

    International Nuclear Information System (INIS)

    Kuroki, Misao; Ariumi, Yasuo; Hijikata, Makoto; Ikeda, Masanori; Dansako, Hiromichi; Wakita, Takaji; Shimotohno, Kunitada; Kato, Nobuyuki

    2013-01-01

    Highlights: ► PML tumor suppressor protein is required for HCV production. ► PML is dispensable for HCV RNA replication. ► HCV could not alter formation of PML-NBs. ► INI1 and DDX5, PML-related proteins, are involved in HCV life cycle. -- Abstract: PML tumor suppressor protein, which forms discrete nuclear structures termed PML-nuclear bodies, has been associated with several cellular functions, including cell proliferation, apoptosis and antiviral defense. Recently, it was reported that the HCV core protein colocalizes with PML in PML-NBs and abrogates the PML function through interaction with PML. However, role(s) of PML in HCV life cycle is unknown. To test whether or not PML affects HCV life cycle, we examined the level of secreted HCV core and the infectivity of HCV in the culture supernatants as well as the level of HCV RNA in HuH-7-derived RSc cells, in which HCV-JFH1 can infect and efficiently replicate, stably expressing short hairpin RNA targeted to PML. In this context, the level of secreted HCV core and the infectivity in the supernatants from PML knockdown cells was remarkably reduced, whereas the level of HCV RNA in the PML knockdown cells was not significantly affected in spite of very effective knockdown of PML. In fact, we showed that PML is unrelated to HCV RNA replication using the subgenomic HCV-JFH1 replicon RNA, JRN/3-5B. Furthermore, the infectivity of HCV-like particle in the culture supernatants was significantly reduced in PML knockdown JRN/3-5B cells expressing core to NS2 coding region of HCV-JFH1 genome using the trans-packaging system. Finally, we also demonstrated that INI1 and DDX5, the PML-related proteins, are involved in HCV production. Taken together, these findings suggest that PML is required for HCV production.

  8. PML tumor suppressor protein is required for HCV production

    Energy Technology Data Exchange (ETDEWEB)

    Kuroki, Misao [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Research Fellow of the Japan Society for the Promotion of Science (Japan); Center for AIDS Research, Kumamoto University, Kumamoto 860-0811 (Japan); Ariumi, Yasuo, E-mail: ariumi@kumamoto-u.ac.jp [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Center for AIDS Research, Kumamoto University, Kumamoto 860-0811 (Japan); Hijikata, Makoto [Department of Viral Oncology, Institute for Virus Research, Kyoto University, Kyoto 606-8507 (Japan); Ikeda, Masanori; Dansako, Hiromichi [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Wakita, Takaji [Department of Virology II, National Institute of Infectious Diseases, Tokyo 162-8640 (Japan); Shimotohno, Kunitada [Research Center for Hepatitis and Immunology, National Center for Global Health and Medicine, Ichikawa, Chiba 272-8516 (Japan); Kato, Nobuyuki [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan)

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer PML tumor suppressor protein is required for HCV production. Black-Right-Pointing-Pointer PML is dispensable for HCV RNA replication. Black-Right-Pointing-Pointer HCV could not alter formation of PML-NBs. Black-Right-Pointing-Pointer INI1 and DDX5, PML-related proteins, are involved in HCV life cycle. -- Abstract: PML tumor suppressor protein, which forms discrete nuclear structures termed PML-nuclear bodies, has been associated with several cellular functions, including cell proliferation, apoptosis and antiviral defense. Recently, it was reported that the HCV core protein colocalizes with PML in PML-NBs and abrogates the PML function through interaction with PML. However, role(s) of PML in HCV life cycle is unknown. To test whether or not PML affects HCV life cycle, we examined the level of secreted HCV core and the infectivity of HCV in the culture supernatants as well as the level of HCV RNA in HuH-7-derived RSc cells, in which HCV-JFH1 can infect and efficiently replicate, stably expressing short hairpin RNA targeted to PML. In this context, the level of secreted HCV core and the infectivity in the supernatants from PML knockdown cells was remarkably reduced, whereas the level of HCV RNA in the PML knockdown cells was not significantly affected in spite of very effective knockdown of PML. In fact, we showed that PML is unrelated to HCV RNA replication using the subgenomic HCV-JFH1 replicon RNA, JRN/3-5B. Furthermore, the infectivity of HCV-like particle in the culture supernatants was significantly reduced in PML knockdown JRN/3-5B cells expressing core to NS2 coding region of HCV-JFH1 genome using the trans-packaging system. Finally, we also demonstrated that INI1 and DDX5, the PML-related proteins, are involved in HCV production. Taken together, these findings suggest that PML is required for HCV production.

  9. DMPD: Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18406369 Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins...svg) (.html) (.csml) Show Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. ...PubmedID 18406369 Title Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins

  10. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  11. Metastasis suppressor proteins in cutaneous squamous cell carcinoma.

    Science.gov (United States)

    Bozdogan, Onder; Vargel, Ibrahim; Cavusoglu, Tarik; Karabulut, Ayse A; Karahan, Gurbet; Sayar, Nilufer; Atasoy, Pınar; Yulug, Isik G

    2016-07-01

    Cutaneous squamous cell carcinomas (cSCCs) are common human carcinomas. Despite having metastasizing capacities, they usually show less aggressive progression compared to squamous cell carcinoma (SCC) of other organs. Metastasis suppressor proteins (MSPs) are a group of proteins that control and slow-down the metastatic process. In this study, we established the importance of seven well-defined MSPs including NDRG1, NM23-H1, RhoGDI2, E-cadherin, CD82/KAI1, MKK4, and AKAP12 in cSCCs. Protein expression levels of the selected MSPs were detected in 32 cSCCs, 6 in situ SCCs, and two skin cell lines (HaCaT, A-431) by immunohistochemistry. The results were evaluated semi-quantitatively using the HSCORE system. In addition, mRNA expression levels were detected by qRT-PCR in the cell lines. The HSCOREs of NM23-H1 were similar in cSCCs and normal skin tissues, while RGHOGDI2, E-cadherin and AKAP12 were significantly downregulated in cSCCs compared to normal skin. The levels of MKK4, NDRG1 and CD82 were partially conserved in cSCCs. In stage I SCCs, nuclear staining of NM23-H1 (NM23-H1nuc) was significantly lower than in stage II/III SCCs. Only nuclear staining of MKK4 (MKK4nuc) showed significantly higher scores in in situ carcinomas compared to invasive SCCs. In conclusion, similar to other human tumors, we have demonstrated complex differential expression patterns for the MSPs in in-situ and invasive cSCCs. This complex MSP signature warrants further biological and experimental pathway research. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

    Science.gov (United States)

    Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

    2014-12-01

    The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

  13. LACTB, a novel epigenetic silenced tumor suppressor, inhibits colorectal cancer progression by attenuating MDM2-mediated p53 ubiquitination and degradation.

    Science.gov (United States)

    Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui

    2018-06-13

    Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.

  14. Isoform-specific interactions of the von Hippel-Lindau tumor suppressor protein

    OpenAIRE

    Minervini, Giovanni; Mazzotta, Gabriella M.; Masiero, Alessandro; Sartori, Elena; Corr?, Samantha; Potenza, Emilio; Costa, Rodolfo; Tosatto, Silvio C. E.

    2015-01-01

    Deregulation of the von Hippel-Lindau tumor suppressor protein (pVHL) is considered one of the main causes for malignant renal clear-cell carcinoma (ccRCC) insurgence. In human, pVHL exists in two isoforms, pVHL19 and pVHL30 respectively, displaying comparable tumor suppressor abilities. Mutations of the p53 tumor suppressor gene have been also correlated with ccRCC insurgence and ineffectiveness of treatment. A recent proteomic analysis linked full length pVHL30 with p53 pathway regulation t...

  15. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  16. DMPD: Suppressor of cytokine signaling (SOCS) 2, a protein with multiple functions. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17070092 Suppressor of cytokine signaling (SOCS) 2, a protein with multiple function...Epub 2006 Oct 27. (.png) (.svg) (.html) (.csml) Show Suppressor of cytokine signaling (SOCS) 2, a protein with multiple function...SOCS) 2, a protein with multiple functions. Authors Rico-Bautista E, Flores-Morales A, Fernandez-Perez L. Pu

  17. Mechanism of inhibition of growth hormone receptor signaling by suppressor of cytokine signaling proteins

    DEFF Research Database (Denmark)

    Hansen, J A; Lindberg, K; Hilton, D J

    1999-01-01

    In this study we have investigated the role of suppressor of cytokine signaling (SOCS) proteins in GH receptor-mediated signaling. GH-induced transcription was inhibited by SOCS-1 and SOCS-3, while SOCS-2 and cytokine inducible SH2-containing protein (CIS) had no effect By using chimeric SOCS pro...

  18. Identification of a third protein 4.1 tumor suppressor, protein 4.1R, in meningioma pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Robb, Victoria A.; Li, Wen; Gascard, Philippe; Perry, Arie; Mohandas, Narla; Gutmann, David H.

    2003-06-11

    Meningiomas are common tumors of the central nervous system, however, the mechanisms under lying their pathogenesis are largely undefined. Two members of the Protein 4.1 super family, the neuro fibromatosis 2 (NF2) gene product (merlin/schwannomin) and Protein 4.1B have been implicated as meningioma tumor suppressors. In this report, we demonstrate that another Protein 4.1 family member, Protein 4.1R, also functions as a meningioma tumor suppressor. Based on the assignment of the Protein 4.1R gene to chromosome 1p32-36, a common region of deletion observed in meningiomas, we analyzed Protein 4.1R expression in meningioma cell lines and surgical tumor specimens. We observed loss of Protein 4.1R protein expression in two meningioma cell lines (IOMM-Lee, CH157-MN) by Western blotting as well as in 6 of 15 sporadic meningioma as by immuno histo chemistry (IHC). Analysis of a subset of these sporadic meningiomas by fluorescent in situ hybridization (FISH) with a Protein 4.1R specific probe demonstrated 100 percent concordance with the IHC results. In support of a meningioma tumor suppressor function, over expression of Protein 4.1R resulted in suppression of IOMM-Lee and CH157MN cell proliferation. Similar to the Protein 4.1B and merlin meningioma tumor suppressors, Protein 4.1R localization in the membrane fraction increased significantly under conditions of growth arrest in vitro. Lastly, Protein 4.1R interacted with some known merlin/Protein 4.1B interactors such as CD44 and bII-spectrin, but did not associate with the Protein 4.1B interactors 14-3-3 and PRMT3 or the merlin binding proteins SCHIP-1 and HRS. Collectively, these results suggest that Protein 4.1R functions as an important tumor suppressor important in the molecular pathogenesis of meningioma.

  19. Intragenic suppressor of Osiaa23 revealed a conserved tryptophan residue crucial for protein-protein interactions.

    Directory of Open Access Journals (Sweden)

    Jun Ni

    Full Text Available The Auxin/Indole-3-Acetic Acid (Aux/IAA and Auxin Response Factor (ARF are two important families that play key roles in auxin signal transduction. Both of the families contain a similar carboxyl-terminal domain (Domain III/IV that facilitates interactions between these two families. In spite of the importance of protein-protein interactions among these transcription factors, the mechanisms involved in these interactions are largely unknown. In this study, we isolated six intragenic suppressors of an auxin insensitive mutant, Osiaa23. Among these suppressors, Osiaa23-R5 successfully rescued all the defects of the mutant. Sequence analysis revealed that an amino acid substitution occurred in the Tryptophan (W residue in Domain IV of Osiaa23. Yeast two-hybrid experiments showed that the mutation in Domain IV prevents the protein-protein interactions between Osiaa23 and OsARFs. Phylogenetic analysis revealed that the W residue is conserved in both OsIAAs and OsARFs. Next, we performed site-specific amino acid substitutions within Domain IV of OsARFs, and the conserved W in Domain IV was exchanged by Serine (S. The mutated OsARF(WSs can be released from the inhibition of Osiaa23 and maintain the transcriptional activities. Expression of OsARF(WSs in Osiaa23 mutant rescued different defects of the mutant. Our results suggest a previously unknown importance of Domain IV in both families and provide an indirect way to investigate functions of OsARFs.

  20. Influence of anticancer drugs on interactions of tumor suppressor protein p53 with DNA

    Czech Academy of Sciences Publication Activity Database

    Pivoňková, Hana; Němcová, Kateřina; Brázdová, Marie; Kašpárková, Jana; Brabec, Viktor; Fojta, Miroslav

    2005-01-01

    Roč. 272, Suppl. 1 (2005), s. 562 ISSN 1474-3833. [FEBS Congress /30./ and IUBMB Conference /9./. 02.07.2005-07.07.2005, Budapest] R&D Projects: GA MZd(CZ) NC7574 Institutional research plan: CEZ:AV0Z50040507 Keywords : tumour suppressor protein p53 * anticancer drugs * interaction with DNA Subject RIV: BO - Biophysics

  1. Electrochemical sensing of tumor suppressor protein p53-deoxyribonucleic acid complex stability at an electrified interface

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Černocká, Hana; Ostatná, Veronika; Navrátilová, Lucie; Brázdová, Marie

    2014-01-01

    Roč. 828, MAY2014 (2014), s. 1-8 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA13-00956S; GA ČR(CZ) GA13-36108S Institutional support: RVO:68081707 Keywords : Deoxyribonucleic acid-protein binding * Tumor suppressor protein p53 * Electrochemical sensing Subject RIV: BO - Biophysics Impact factor: 4.513, year: 2014

  2. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  3. Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

    Directory of Open Access Journals (Sweden)

    Oliver A Zill

    Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

  4. Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

    International Nuclear Information System (INIS)

    Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

    1988-01-01

    In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

  5. BASP1 is a transcriptional cosuppressor for the Wilms' tumor suppressor protein WT1

    DEFF Research Database (Denmark)

    Carpenter, Brian; Hill, Kathryn J; Charalambous, Marika

    2004-01-01

    The Wilms' tumor suppressor protein WT1 is a transcriptional regulator that plays a key role in the development of the kidneys. The transcriptional activation domain of WT1 is subject to regulation by a suppression region within the N terminus of WT1. Using a functional assay, we provide direct...... evidence that this requires a transcriptional cosuppressor, which we identify as brain acid soluble protein 1 (BASP1). WT1 and BASP1 associate within the nuclei of cells that naturally express both proteins. BASP1 can confer WT1 cosuppressor activity in transfection assays, and elimination of endogenous...

  6. Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

    Directory of Open Access Journals (Sweden)

    Jiexiong Feng

    Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

  7. Dissecting functions of the retinoblastoma tumor suppressor and the related pocket proteins by integrating genetic, cell biology, and electrophoretic techniques

    DEFF Research Database (Denmark)

    Hansen, Klaus; Lukas, J; Holm, K

    1999-01-01

    The members of the 'pocket protein' family, comprising the retinoblastoma tumor suppressor (pRB) and its relatives, p107 and p130, negatively regulate cell proliferation and modulate fundamental biological processes including embryonic development, differentiation, homeostatic tissue renewal...

  8. LRIG1, a 3p tumor suppressor, represses EGFR signaling and is a novel epigenetic silenced gene in colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Kou, Changhua, E-mail: chkoukou@hotmail.com [Department of Oncological Surgery, The Central Hospital of Xuzhou City, Xuzhou, Jiangsu 221000 (China); Zhou, Tian [Department of Gastroenterology, The Central Hospital of Xuzhou City, Xuzhou, Jiangsu 221000 (China); Han, Xilin; Zhuang, Huijie [Department of Oncological Surgery, The Central Hospital of Xuzhou City, Xuzhou, Jiangsu 221000 (China); Qian, Haixin, E-mail: qianhaixin@hotmail.com [The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215000 (China)

    2015-08-21

    Downregulation of LRIG1 was found in many types of cancer. However, data concerning the possible mechanism of LRIG1 reduction in cancers were not reported yet. To analyze the regulation and function of LRIG1 in colorectal cancer (CRC), 6 cell lines, 46 paired tissues from primary CRC cases were employed in this study. In CRC cell lines, under-expression of LRIG1 was correlated with promoter region hypermethylation, and restoration of LRIG1 was induced by 5-Aza-2'-deoxyazacytidine treatment. Subsequently, we ectopically expressed LRIG1 in LRIG1 low-expressing HCT-116 cells and suppressed LRIG1 in LRIG1 high-expressing LoVo cells. We found that over-expression of LRIG1 inhibits cell proliferation and colony formation and tumor growth, while knockdown of LRIG1 promotes cell proliferation and colony formation. Decreased and increased EGFR/AKT signaling pathway may partially explain the lower and higher rates of proliferation in CRC cells transfected with LRIG1 cDNA or shRNA. In clinical samples, we compared the methylation, mRNA and protein expression of LRIG1 in samples of CRC tissues. A significant increase in LRIG1 methylation was identified in CRC specimens compared to adjacent normal tissues and that it was negatively correlated with its mRNA and protein expression. In conclusion, LRIG1 is frequently methylated in human CRC and consequent mRNA and protein downregulation may contribute to tumor growth by activating EGFR/AKT signaling. - Highlights: • Promoter methylation of LRIG1 occurred in colorectal cancer cells and tumors. • Restoration of LRIG1 inhibits tumor growth in vitro and in vivo. • Overexpression or knockdown of LRIG1 regulates EGFR/AKT and downstream apoptosis. • Methylation of LRIG1 correlates with its mRNA and protein downregulation. • LRIG1 was firstly identified as an epigenetic target in cancer.

  9. Suppressor of cytokine signaling 1 interacts with oncogenic lymphocyte-specific protein tyrosine kinase.

    Science.gov (United States)

    Venkitachalam, Srividya; Chueh, Fu-Yu; Leong, King-Fu; Pabich, Samantha; Yu, Chao-Lan

    2011-03-01

    Lymphocyte-specific protein tyrosine kinase (Lck) plays a key role in T cell signal transduction and is tightly regulated by phosphorylation and dephosphorylation. Lck can function as an oncoprotein when overexpressed or constantly activated by mutations. Our previous studies showed that Lck-induced cellular transformation could be suppressed by enforced expression of suppressor of cytokine signaling 1 (SOCS1), a SOCS family member involved in the negative feedback control of cytokine signaling. We observed attenuated Lck kinase activity in SOCS1-expressing cells, suggesting an important role of SOCS in regulating Lck functions. It remains largely unknown whether and how SOCS proteins interact with the oncogenic Lck kinase. Here, we report that among four SOCS family proteins, SOCS1, SOCS2, SOCS3 and CIS (cytokine-inducible SH2 domain containing protein), SOCS1 has the highest affinity in binding to the oncogenic Lck kinase. We identified the positive regulatory phosphotyrosine 394 residue in the kinase domain as the key interacting determinant in Lck. Additionally, the Lck kinase domain alone is sufficient to bind SOCS1. While the SH2 domain in SOCS1 is important in its association with the oncogenic Lck kinase, other functional domains may also contribute to overall binding affinity. These findings provide important mechanistic insights into the role of SOCS proteins as tumor suppressors in cells transformed by oncogenic protein tyrosine kinases.

  10. Evaluating the silencing suppressor activity of proteins encoded by maize rayado fino virus

    Science.gov (United States)

    Maize rayado fino virus (MRFV), the type member of the genus Marafivirus, family Tymoviridae, is transmitted in a persistent, circulative manner by leafhoppers of the genus Dalbulus. Symptoms of MRFV infection on leaves of its maize host are small chlorotic spots that coalesce into short stripes. T...

  11. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  12. Suppressor of cytokine signaling (SOCS genes are silenced by DNA hypermethylation and histone deacetylation and regulate response to radiotherapy in cervical cancer cells.

    Directory of Open Access Journals (Sweden)

    Moon-Hong Kim

    Full Text Available Suppressor of cytokine signaling (SOCS family is an important negative regulator of cytokine signaling and deregulation of SOCS has been involved in many types of cancer. All cervical cancer cell lines tested showed lower expression of SOCS1, SOCS3, and SOCS5 than normal tissue or cell lines. The immunohistochemistry result for SOCS proteins in human cervical tissue also confirmed that normal tissue expressed higher level of SOCS proteins than neighboring tumor. Similar to the regulation of SOCS in other types of cancer, DNA methylation contributed to SOCS1 downregulation in CaSki, ME-180, and HeLa cells. However, the expression of SOCS3 or SOCS5 was not recovered by the inhibition of DNA methylation. Histone deacetylation may be another regulatory mechanism involved in SOCS1 and SOCS3 expression, however, SOCS5 expression was neither affected by DNA methylation nor histone deacetylation. Ectopic expression of SOCS1 or SOCS3 conferred radioresistance to HeLa cells, which implied SOCS signaling regulates the response to radiation in cervical cancer. In this study, we have shown that SOCS expression repressed by, in part, epigenetically and altered SOCS1 and SOCS3 expression could contribute to the radiosensitive phenotype in cervical cancer.

  13. ZNF649, a novel Kruppel type zinc-finger protein, functions as a transcriptional suppressor

    International Nuclear Information System (INIS)

    Yang Hong; Yuan Wuzhou; Wang Ying; Zhu Chuanbing; Liu Bisheng; Wang Yuequn; Yang, Dan; Li Yongqing; Wang Canding; Wu Xiushan; Liu Mingyao

    2005-01-01

    Cardiac differentiation involves a cascade of coordinated gene expression that regulates cell proliferation and matrix protein formation in a defined temporo-spatial manner. Many of the KRAB-ZFPs are involved in cardiac development or cardiovascular diseases. Here we report the identification and characterization of a novel human zinc-finger gene named ZNF649. The cDNA of ZNF649 is 3176 bp, encoding a protein of 505 amino acids in the nuclei. Northern blot analysis indicates that ZNF649 is expressed in most of the examined human adult and embryonic tissues. ZNF649 is a transcription suppressor when fused to GAL-4 DNA-binding domain and cotransfected with VP-16. Overexpression of ZNF649 in COS-7 cells inhibits the transcriptional activities of SRE and AP-1. Deletion analysis with a series of truncated fusion proteins indicates that the KRAB motif is a basal repression domain when the truncated fusion proteins were assayed for the transcriptional activities of SRE and AP-1. These results suggest that ZNF649 protein may act as a transcriptional repressor in mitogen-activated protein kinase signaling pathway to mediate cellular functions

  14. Tumor suppressor protein SMAR1 modulates the roughness of cell surface: combined AFM and SEM study

    Directory of Open Access Journals (Sweden)

    Mamgain Hitesh

    2009-10-01

    Full Text Available Abstract Background Imaging tools such as scanning electron microscope (SEM and atomic force microscope (AFM can be used to produce high-resolution topographic images of biomedical specimens and hence are well suited for imaging alterations in cell morphology. We have studied the correlation of SMAR1 expression with cell surface smoothness in cell lines as well as in different grades of human breast cancer and mouse tumor sections. Methods We validated knockdown and overexpression of SMAR1 using RT-PCR as well as Western blotting in human embryonic kidney (HEK 293, human breast cancer (MCF-7 and mouse melanoma (B16F1 cell lines. The samples were then processed for cell surface roughness studies using atomic force microscopy (AFM and scanning electron microscopy (SEM. The same samples were used for microarray analysis as well. Tumors sections from control and SMAR1 treated mice as well as tissues sections from different grades of human breast cancer on poly L-lysine coated slides were used for AFM and SEM studies. Results Tumor sections from mice injected with melanoma cells showed pronounced surface roughness. In contrast, tumor sections obtained from nude mice that were first injected with melanoma cells followed by repeated injections of SMAR1-P44 peptide, exhibited relatively smoother surface profile. Interestingly, human breast cancer tissue sections that showed reduced SMAR1 expression exhibited increased surface roughness compared to the adjacent normal breast tissue. Our AFM data establishes that treatment of cells with SMAR1-P44 results into increase in cytoskeletal volume that is supported by comparative gene expression data showing an increase in the expression of specific cytoskeletal proteins compared to the control cells. Altogether, these findings indicate that tumor suppressor function of SMAR1 might be exhibited through smoothening of cell surface by regulating expression of cell surface proteins. Conclusion Tumor suppressor

  15. A storage-protein marker associated with the suppressor of Pm8 for powdery mildew resistance in wheat.

    Science.gov (United States)

    Ren, S X; McIntosh, R A; Sharp, P J; The, T T

    1996-11-01

    A suppressor of resistance to powdery mildew conferred by Pm8 showed complete association with the presence of a storage-protein marker resolved by electrophoresis on SDS-PAGE gels. This marker was identified as the product of the gliadin allele Gli-A1a. The mildewresponse phenotypes of wheats possessing the 1BL.1RS translocation were completely predictable from electrophoretograms. The suppressor, designated SuPm8, was located on chromosome 1AS. It was specific in its suppression of Pm8, and did not affect the rye-derived resistance phenotypes of wheat lines with Pm17, also located in 1RS, or of lines with Pm7.

  16. Differential expression patterns of metastasis suppressor proteins in basal cell carcinoma.

    Science.gov (United States)

    Bozdogan, Onder; Yulug, Isik G; Vargel, Ibrahim; Cavusoglu, Tarik; Karabulut, Ayse A; Karahan, Gurbet; Sayar, Nilufer

    2015-08-01

    Basal cell carcinomas (BCCs) are common malignant skin tumors. Despite having a significant invasion capacity, they metastasize only rarely. Our aim in this study was to detect the expression patterns of the NM23-H1, NDRG1, E-cadherin, RHOGDI2, CD82/KAI1, MKK4, and AKAP12 metastasis suppressor proteins in BCCs. A total of 96 BCC and 10 normal skin samples were included for the immunohistochemical study. Eleven frozen BCC samples were also studied by quantitative real time polymerase chain reaction (qRT-PCR) to detect the gene expression profile. NM23-H1 was strongly and diffusely expressed in all types of BCC. Significant cytoplasmic expression of NDRG1 and E-cadherin was also detected. However, AKAP12 and CD82/KAI1 expression was significantly decreased. The expressions of the other proteins were somewhere between the two extremes. Similarly, qRT-PCR analysis showed down-regulation of AKAP12 and up-regulation of NM23-H1 and NDRG1 in BCC. Morphologically aggressive BCCs showed significantly higher cytoplasmic NDRG1 expression scores and lower CD82/KAI1 scores than non-aggressive BCCs. The relatively preserved levels of NM23-H1, NDRG1, and E-cadherin proteins may have a positive effect on the non-metastasizing features of these tumors. © 2014 The International Society of Dermatology.

  17. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana

    2015-10-09

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  18. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana; Biamonte, Flavia; Candeloro, Patrizio; Di Sanzo, Maddalena; Cozzi, Anna; Di Vito, Anna; Quaresima, Barbara; Lobello, Nadia; Trecroci, Francesca; Di Fabrizio, Enzo M.; Levi, Sonia; Cuda, Giovanni; Costanzo, Francesco

    2015-01-01

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  19. Protein tyrosine phosphatase receptor delta acts as a neuroblastoma tumor suppressor by destabilizing the aurora kinase a oncogene

    LENUS (Irish Health Repository)

    Meehan, Maria

    2012-02-05

    Abstract Background Protein tyrosine phosphatase receptor delta (PTPRD) is a member of a large family of protein tyrosine phosphatases which negatively regulate tyrosine phosphorylation. Neuroblastoma is a major childhood cancer arising from precursor cells of the sympathetic nervous system which is known to acquire deletions and alterations in the expression patterns of PTPRD, indicating a potential tumor suppressor function for this gene. The molecular mechanism, however, by which PTPRD renders a tumor suppressor effect in neuroblastoma is unknown. Results As a molecular mechanism, we demonstrate that PTPRD interacts with aurora kinase A (AURKA), an oncogenic protein that is over-expressed in multiple forms of cancer, including neuroblastoma. Ectopic up-regulation of PTPRD in neuroblastoma dephosphorylates tyrosine residues in AURKA resulting in a destabilization of this protein culminating in interfering with one of AURKA\\'s primary functions in neuroblastoma, the stabilization of MYCN protein, the gene of which is amplified in approximately 25 to 30% of high risk neuroblastoma. Conclusions PTPRD has a tumor suppressor function in neuroblastoma through AURKA dephosphorylation and destabilization and a downstream destabilization of MYCN protein, representing a novel mechanism for the function of PTPRD in neuroblastoma.

  20. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    Science.gov (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  1. Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.

    Science.gov (United States)

    Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel

    2012-01-01

    γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.

  2. Improved crystallization and diffraction of caffeine-induced death suppressor protein 1 (Cid1)

    Energy Technology Data Exchange (ETDEWEB)

    Yates, Luke A., E-mail: luke@strubi.ox.ac.uk; Durrant, Benjamin P.; Barber, Michael; Harlos, Karl [University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Fleurdépine, Sophie; Norbury, Chris J. [University of Oxford, South Parks Road, Oxford OX1 3RE (United Kingdom); Gilbert, Robert J. C., E-mail: luke@strubi.ox.ac.uk [University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2015-02-21

    The use of truncation and RNA-binding mutations of caffeine induced death suppressor protein 1 (Cid1) as a means to enhance crystallogenesis leading to an improvement of X-ray diffraction resolution by 1.5 Å is reported. The post-transcriptional addition of uridines to the 3′-end of RNAs is an important regulatory process that is critical for coding and noncoding RNA stability. In fission yeast and metazoans this untemplated 3′-uridylylation is catalysed by a single family of terminal uridylyltransferases (TUTs) whose members are adapted to specific RNA targets. In Schizosaccharomyces pombe the TUT Cid1 is responsible for the uridylylation of polyadenylated mRNAs, targeting them for destruction. In metazoans, the Cid1 orthologues ZCCHC6 and ZCCHC11 uridylate histone mRNAs, targeting them for degradation, but also uridylate microRNAs, altering their maturation. Cid1 has been studied as a model TUT that has provided insights into the larger and more complex metazoan enzyme system. In this paper, two strategies are described that led to improvements both in the crystallogenesis of Cid1 and in the resolution of diffraction by ∼1.5 Å. These advances have allowed high-resolution crystallo@@graphic studies of this TUT system to be initiated.

  3. Improved crystallization and diffraction of caffeine-induced death suppressor protein 1 (Cid1)

    International Nuclear Information System (INIS)

    Yates, Luke A.; Durrant, Benjamin P.; Barber, Michael; Harlos, Karl; Fleurdépine, Sophie; Norbury, Chris J.; Gilbert, Robert J. C.

    2015-01-01

    The use of truncation and RNA-binding mutations of caffeine induced death suppressor protein 1 (Cid1) as a means to enhance crystallogenesis leading to an improvement of X-ray diffraction resolution by 1.5 Å is reported. The post-transcriptional addition of uridines to the 3′-end of RNAs is an important regulatory process that is critical for coding and noncoding RNA stability. In fission yeast and metazoans this untemplated 3′-uridylylation is catalysed by a single family of terminal uridylyltransferases (TUTs) whose members are adapted to specific RNA targets. In Schizosaccharomyces pombe the TUT Cid1 is responsible for the uridylylation of polyadenylated mRNAs, targeting them for destruction. In metazoans, the Cid1 orthologues ZCCHC6 and ZCCHC11 uridylate histone mRNAs, targeting them for degradation, but also uridylate microRNAs, altering their maturation. Cid1 has been studied as a model TUT that has provided insights into the larger and more complex metazoan enzyme system. In this paper, two strategies are described that led to improvements both in the crystallogenesis of Cid1 and in the resolution of diffraction by ∼1.5 Å. These advances have allowed high-resolution crystallo@@graphic studies of this TUT system to be initiated

  4. Genetic and Epigenetic Tumor Suppressor Gene Silencing are Distinct Molecular Phenotypes Driven by Growth Promoting Mutations in Non small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Marsit, C. J.; Kelsey, K. T.; Houseman, E. A.; Kelsey, K. T.; Houseman, E. A.; Nelson, H. H.

    2008-01-01

    Both genetic and epigenetic alterations characterize human non small cell lung cancer (NSCLC), but the biological processes that create or select these alterations remain incompletely investigated. Our hypothesis posits that a roughly reciprocal relationship between the propensity for promoter hyper methylation and a propensity for genetic deletion leads to distinct molecular phenotypes of lung cancer. To test this hypothesis, we examined promoter hyper methylation of 17 tumor suppressor genes, as a marker of epigenetic alteration propensity, and deletion events at the 3p21 region, as a marker of genetic alteration. To model the complex biology between these somatic alterations, we utilized an item response theory model. We demonstrated that tumors exhibiting LOH at greater than 30% of informative alleles in the 3p21 region have a significantly reduced propensity for hyper methylation. At the same time, tumors with activating KRAS mutations showed a significantly increased propensity for hyper methylation of the loci examined, a result similar to what has been observed in colon cancer. These data suggest that NSCLCs have distinct epigenetic or genetic alteration phenotypes acting upon tumor suppressor genes and that mutation of oncogenic growth promoting genes, such as KRAS, is associated with the epigenetic phenotype.

  5. Genetic and Epigenetic Tumor Suppressor Gene Silencing Are Distinct Molecular Phenotypes Driven by Growth Promoting Mutations in Nonsmall Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Carmen J. Marsit

    2008-01-01

    Full Text Available Both genetic and epigenetic alterations characterize human nonsmall cell lung cancer (NSCLC, but the biological processes that create or select these alterations remain incompletely investigated. Our hypothesis posits that a roughly reciprocal relationship between the propensity for promoter hypermethylation and a propensity for genetic deletion leads to distinct molecular phenotypes of lung cancer. To test this hypothesis, we examined promoter hypermethylation of 17 tumor suppressor genes, as a marker of epigenetic alteration propensity, and deletion events at the 3p21 region, as a marker of genetic alteration. To model the complex biology between these somatic alterations, we utilized an item response theory model. We demonstrated that tumors exhibiting LOH at greater than 30% of informative alleles in the 3p21 region have a significantly reduced propensity for hypermethylation. At the same time, tumors with activating KRAS mutations showed a significantly increased propensity for hypermethylation of the loci examined, a result similar to what has been observed in colon cancer. These data suggest that NSCLCs have distinct epigenetic or genetic alteration phenotypes acting upon tumor suppressor genes and that mutation of oncogenic growth promoting genes, such as KRAS, is associated with the epigenetic phenotype.

  6. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  7. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  8. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  9. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

    Science.gov (United States)

    de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

    2014-02-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  10. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  11. Enlightened protein: Fhit tumor suppressor protein structure and function and its role in the toxicity of protoporphyrin IX-mediated photodynamic reaction

    International Nuclear Information System (INIS)

    Zawacka-Pankau, Joanna

    2009-01-01

    The Fhit tumor suppressor protein possesses Ap 3 A (diadenosine triphosphate - ApppA) hydrolytic activity in vitro and its gene is found inactive in many pre-malignant states due to gene inactivation. For several years Fhit has been a widely investigated protein as its cellular function still remains largely unsolved. Fhit was shown to act as a molecular 'switch' of cell death via cascade operating on the influence of ATR-Chk1 pathway but also through the mitochondrial apoptotic pathway. Notably, Fhit was reported by our group to enhance the overall eradication effect of porphyrin-mediated photodynamic treatment (PDT). In this review the up-to-date findings on Fhit protein as a tumor suppressor and its role in PDT are presented.

  12. The influence of cis-acting P1 protein and translational elements on the expression of Potato virus Y helper-component proteinase (HCPro) in heterologous systems and its suppression of silencing activity.

    Science.gov (United States)

    Tena Fernández, Fátima; González, Inmaculada; Doblas, Paula; Rodríguez, César; Sahana, Nandita; Kaur, Harpreet; Tenllado, Francisco; Praveen, Shelly; Canto, Tomas

    2013-06-01

    In the Potyvirus genus, the P1 protein is the first N-terminal product processed from the viral polyprotein, followed by the helper-component proteinase (HCPro). In silencing suppression patch assays, we found that Potato virus Y (PVY) HCPro expressed from a P1-HCPro sequence increased the accumulation of a reporter gene, whereas protein expressed from an HCPro sequence did not, even with P1 supplied in trans. This enhancing effect of P1 has been noted in other potyviruses, but has remained unexplained. We analysed the accumulation of PVY HCPro in infiltrated tissues and found that it was higher when expressed from P1-HCPro than from HCPro sequences. Co-expression of heterologous suppressors increased the steady-state level of mRNA expressed from the HCPro sequence, but not that of protein. This suggests that, in the absence of P1 upstream, either HCPro acquires a conformation that affects negatively its activity or stability, or that its translation is reduced. To test these options, we purified HCPro expressed in the presence or absence of upstream P1, and found no difference in purification pattern and final soluble state. By contrast, alteration of the Kozak context in the HCPro mRNA sequence to favour translation increased partially suppressor accumulation and activity. Furthermore, protein activity was not lower than in protein expressed from P1-HCPro sequences. Thus, a direct role for P1 on HCPro suppressor activity or stability, by influencing its conformation during translation, can be excluded. However, P1 could still have an indirect effect favouring HCPro accumulation. Our data highlight the relevance of cis-acting translational elements in the heterologous expression of HCPro. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  13. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    International Nuclear Information System (INIS)

    Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

    2012-01-01

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

  14. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  15. Ubiquitin-specific protease 11 (USP11) functions as a tumor suppressor through deubiquitinating and stabilizing VGLL4 protein

    Science.gov (United States)

    Zhang, Encheng; Shen, Bing; Mu, Xingyu; Qin, Yan; Zhang, Fang; Liu, Yong; Xiao, Jiantao; Zhang, Pingzhao; Wang, Chenji; Tan, Mingyue; Fan, Yu

    2016-01-01

    VGLL4 is a transcriptional repressor that interacts with transcription factors TEADs and inhibits YAP-induced overgrowth and tumorigenesis. VGLL4 protein was dramatically reduced in various types of human cancers. But how VGLL4 protein is post-transcriptional regulated is poorly understood. In this study, we identify deubiquitinating enzyme USP11 as a novel VGLL4 interactor. We reveal that the USP domain of USP11 and the N-terminal region of VGLL4 are required for mutual binding. USP11 controls VGLL4 protein stability by promoting its deubiquitination. Furthermore, our results show that knockdown of USP11 promotes cell growth, migration, and invasion in a YAP-dependent manner. Together, our results suggest that USP11 may exert its tumor suppressor role by modulating VGLL4/YAP-TEADs regulatory loop. PMID:28042509

  16. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  17. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    International Nuclear Information System (INIS)

    Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

    2006-01-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

  18. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

    2013-01-01

    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  19. A conserved small RNA promotes silencing of the outer membrane protein YbfM

    DEFF Research Database (Denmark)

    Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S

    2009-01-01

    important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

  20. Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

    Science.gov (United States)

    Malmstrom, Carolyn M; Bigelow, Patrick; Trębicki, Piotr; Busch, Anna K; Friel, Colleen; Cole, Ellen; Abdel-Azim, Heba; Phillippo, Colin; Alexander, Helen M

    2017-09-15

    As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most

  1. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  2. Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant.

    Science.gov (United States)

    Garcia-Ruiz, Hernan; Gabriel Peralta, Sergio M; Harte-Maxwell, Patricia A

    2018-03-14

    Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana . Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection.

  3. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

    2016-03-18

    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

  4. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  5. A tumor suppressor role of the Bub3 spindle checkpoint protein after apoptosis inhibition

    Science.gov (United States)

    Moutinho-Santos, Tatiana

    2013-01-01

    Most solid tumors contain aneuploid cells, indicating that the mitotic checkpoint is permissive to the proliferation of chromosomally aberrant cells. However, mutated or altered expression of mitotic checkpoint genes accounts for a minor proportion of human tumors. We describe a Drosophila melanogaster tumorigenesis model derived from knocking down spindle assembly checkpoint (SAC) genes and preventing apoptosis in wing imaginal discs. Bub3-deficient tumors that were also deficient in apoptosis displayed neoplastic growth, chromosomal aneuploidy, and high proliferative potential after transplantation into adult flies. Inducing aneuploidy by knocking down CENP-E and preventing apoptosis does not induce tumorigenesis, indicating that aneuploidy is not sufficient for hyperplasia. In this system, the aneuploidy caused by a deficient SAC is not driving tumorigenesis because preventing Bub3 from binding to the kinetochore does not cause hyperproliferation. Our data suggest that Bub3 has a nonkinetochore-dependent function that is consistent with its role as a tumor suppressor. PMID:23609535

  6. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  7. Structure-function analysis of the retinoblastoma tumor suppressor protein – is the whole a sum of its parts?

    Directory of Open Access Journals (Sweden)

    Dick Frederick A

    2007-09-01

    Full Text Available Abstract Biochemical analysis of the retinoblastoma protein's function has received considerable attention since it was cloned just over 20 years ago. During this time pRB has emerged as a key regulator of the cell division cycle and its ability to block proliferation is disrupted in the vast majority of human cancers. Much has been learned about the regulation of E2F transcription factors by pRB in the cell cycle. However, many questions remain unresolved and researchers continue to explore this multifunctional protein. In particular, understanding how its biochemical functions contribute to its role as a tumor suppressor remains to be determined. Since pRB has been shown to function as an adaptor molecule that links different proteins together, or to particular promoters, analyzing pRB by disrupting individual protein interactions holds tremendous promise in unraveling the intricacies of its function. Recently, crystal structures have reported how pRB interacts with some of its molecular partners. This information has created the possibility of rationally separating pRB functions by studying mutants that disrupt individual binding sites. This review will focus on literature that investigates pRB by isolating functions based on binding sites within the pocket domain. This article will also discuss the prospects for using this approach to further explore the unknown functions of pRB.

  8. Protein Interaction Screening for the Ankyrin Repeats and Suppressor of Cytokine Signaling (SOCS) Box (ASB) Family Identify Asb11 as a Novel Endoplasmic Reticulum Resident Ubiquitin Ligase

    DEFF Research Database (Denmark)

    Andresen, Christina Aaen; Smedegaard, Stine; Sylvestersen, Kathrine Beck

    2014-01-01

    The Ankyrin and SOCS (Suppressor of Cytokine Signaling) box (ASB) family of proteins function as the substrate recognition subunit in a subset of Elongin-Cullin-SOCS (ECS) E3 ubiquitin ligases. Despite counting with 18 members in humans, the identity of the physiological targets of the Asb protei...

  9. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  10. Sumoylation of the Tumor Suppressor Promyelocytic Leukemia Protein Regulates Arsenic Trioxide-Induced Collagen Synthesis in Osteoblasts.

    Science.gov (United States)

    Xu, Wen-Xiao; Liu, Sheng-Zhi; Wu, Di; Qiao, Guo-Fen; Yan, Jinglong

    2015-01-01

    Promyelocytic leukemia (PML) protein is a tumor suppressor that fuses with retinoic acid receptor-α (PML-RARα) to contribute to the initiation of acute promyelocytic leukemia (APL). Arsenic trioxide (ATO) upregulates expression of TGF-β1, promoting collagen synthesis in osteoblasts, and ATO binds directly to PML to induce oligomerization, sumoylation, and ubiquitination. However, how ATO upregulates TGF-β1 expression is uncertain. Thus, we suggested that PML sumoylation is responsible for regulation of TGF-β1 protein expression. Kunming mice were treated with ATO, and osteoblasts were counted under scanning electron microscopy. Masson's staining was used to quantify collagen content. hFOB1.19 cells were transfected with siRNA against UBC9 or RNF4, and then treated with ATO or FBS. TGF-β1, PML expression, and sumoylation were quantified with Western blot, and collagen quantified via immunocytochemistry. ATO enhanced osteoblast accumulation, collagen synthesis, and PML-NB formation in vivo. Knocking down UBC9 in hFOB1.19 cells inhibited ATO- and FBS-induced PML sumoylation, TGF-β1 expression, and collagen synthesis. Conversely, knocking down RNF4 enhanced ATO- and FBS-induced PML sumoylation, TGF-β1 expression, and collagen synthesis. These data suggest that PML sumoylation is required for ATO-induced collagen synthesis in osteoblasts. © 2015 S. Karger AG, Basel.

  11. Link of the unique oncogenic properties of adenovirus type 9 E4-ORF1 to a select interaction with the candidate tumor suppressor protein ZO-2

    OpenAIRE

    Glaunsinger, Britt A.; Weiss, Robert S.; Lee, Siu Sylvia; Javier, Ronald

    2001-01-01

    Adenovirus type 9 (Ad9) is distinct among human adenoviruses because it elicits solely mammary tumors in animals and its primary oncogenic determinant is the E4 region-encoded ORF1 (E4-ORF1) protein. We report here that the PDZ domain-containing protein ZO-2, which is a candidate tumor suppressor protein, is a cellular target for tumorigenic Ad9 E4-ORF1 but not for non-tumorigenic wild-type E4-ORF1 proteins encoded by adenovirus types 5 and 12. Complex formation was mediated by the C-terminal...

  12. INHIBITION OF THE DNA-BINDING ACTIVITY OF DROSOPHILA SUPPRESSOR OF HAIRLESS AND OF ITS HUMAN HOMOLOG, KBF2/RBP-J-KAPPA, BY DIRECT PROTEIN-PROTEIN INTERACTION WITH DROSOPHILA HAIRLESS

    NARCIS (Netherlands)

    BROU, C; LOGEAT, F; LECOURTOIS, M; VANDEKERCKHOVE, Joël; KOURILSKY, P; SCHWEISGUTH, F; ISRAEL, A

    1994-01-01

    We have purified the sequence-specific DNA-binding protein KBF2 and cloned the corresponding cDNA, which is derived from the previously described RBP-J kappa gene, the human homolog of the Drosophila Suppressor of Hairless [Su(H)] gene. Deletion studies of the RBP-J kappa and Su(H) proteins allowed

  13. Transcriptome and proteome analyses and the role of atypical calpain protein and autophagy in the spliced leader silencing pathway in Trypanosoma brucei.

    Science.gov (United States)

    Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit

    2016-10-01

    Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.

  14. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    Directory of Open Access Journals (Sweden)

    Bruno Pagano

    Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  15. A screen for genetic suppressor elements of hepatitis C virus identifies a supercharged protein inhibitor of viral replication.

    Directory of Open Access Journals (Sweden)

    Rudo L Simeon

    Full Text Available Genetic suppressor elements (GSEs are biomolecules derived from a gene or genome of interest that act as transdominant inhibitors of biological functions presumably by disruption of critical biological interfaces. We exploited a cell death reporter cell line for hepatitis C virus (HCV infection, n4mBid, to develop an iterative selection/enrichment strategy for the identification of anti-HCV GSEs. Using this approach, a library of fragments of an HCV genome was screened for sequences that suppress HCV infection. A 244 amino acid gene fragment, B1, was strongly enriched after 5 rounds of selection. B1 derives from a single-base frameshift of the enhanced green fluorescent protein (eGFP which was used as a filler during fragment cloning. B1 has a very high net positive charge of 43 at neutral pH and a high charge-to-mass (kDa ratio of 1.5. We show that B1 expression specifically inhibits HCV replication. In addition, five highly positively charged B1 fragments produced from progressive truncation at the C-terminus all retain the ability to inhibit HCV, suggesting that a high positive charge, rather than a particular motif in B1, likely accounts for B1's anti-HCV activity. Another supercharged protein, +36GFP, was also found to strongly inhibit HCV replication when added to cells at the time of infection. This study reports a new methodology for HCV inhibitor screening and points to the anti-HCV potential of positively charged proteins/peptides.

  16. Myeloid-Derived Suppressor Cells in Checkpoint Protein Inhibition for Melanoma

    Science.gov (United States)

    2017-09-01

    9 5. Changes/Problems ------------------------------------------------------------------------------- 11 6. Products ...reverse transcription polymerase chain reaction endoplasmic reticulum inositol-requiring enzyme 1 x-box binding protein-1 osteoprotegerin TNF...interests, and values ; and guides them through creating an IDP that includes both research and career goals. A written plan is created, and a

  17. Evidence for protein 4.1B acting as a metastasis suppressor

    Czech Academy of Sciences Publication Activity Database

    Cavanna, T.; Pokorná, Eva; Veselý, Pavel; Gray, C.; Zicha, D.

    2007-01-01

    Roč. 120, č. 4 (2007), s. 606-616 ISSN 0021-9533 Institutional research plan: CEZ:AV0Z50520514 Keywords : 4.1B protein * metastasis * migration Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.383, year: 2007

  18. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  19. Slit-Robo GTPase-Activating Protein 2 as a metastasis suppressor in osteosarcoma

    OpenAIRE

    Marko, Tracy A.; Shamsan, Ghaidan A.; Edwards, Elizabeth N.; Hazelton, Paige E.; Rathe, Susan K.; Cornax, Ingrid; Overn, Paula R.; Varshney, Jyotika; Diessner, Brandon J.; Moriarity, Branden S.; O?Sullivan, M. Gerard; Odde, David J.; Largaespada, David A.

    2016-01-01

    Osteosarcoma is the most common primary bone tumor, with metastatic disease responsible for most treatment failure and patient death. A forward genetic screen utilizing Sleeping Beauty mutagenesis in mice previously identified potential genetic drivers of osteosarcoma metastasis, including Slit-Robo GTPase-Activating Protein 2 (Srgap2). This study evaluates the potential role of SRGAP2 in metastases-associated properties of osteosarcoma cell lines through Srgap2 knockout via the CRISPR/Cas9 n...

  20. Raf kinase inhibitory protein: a signal transduction modulator and metastasis suppressor.

    Science.gov (United States)

    Granovsky, Alexey E; Rosner, Marsha Rich

    2008-04-01

    Cells have a multitude of controls to maintain their integrity and prevent random switching from one biological state to another. Raf Kinase Inhibitory Protein (RKIP), a member of the phosphatidylethanolamine binding protein (PEBP) family, is representative of a new class of modulators of signaling cascades that function to maintain the "yin yang" or balance of biological systems. RKIP inhibits MAP kinase (Raf-MEK-ERK), G protein-coupled receptor (GPCR) kinase and NFkappaB signaling cascades. Because RKIP targets different kinases dependent upon its state of phosphorylation, RKIP also acts to integrate crosstalk initiated by multiple environmental stimuli. Loss or depletion of RKIP results in disruption of the normal cellular stasis and can lead to chromosomal abnormalities and disease states such as cancer. Since RKIP and the PEBP family have been reviewed previously, the goal of this analysis is to provide an update and highlight some of the unique features of RKIP that make it a critical player in the regulation of cellular signaling processes.

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  2. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  3. Cancer Chemoprevention by Resveratrol: The p53 Tumor Suppressor Protein as a Promising Molecular Target

    Directory of Open Access Journals (Sweden)

    Danielly C. Ferraz da Costa

    2017-06-01

    Full Text Available Increasing epidemiological and experimental evidence has demonstrated an inverse relationship between the consumption of plant foods and the incidence of chronic diseases, including cancer. Microcomponents that are naturally present in such foods, especially polyphenols, are responsible for the benefits to human health. Resveratrol is a diet-derived cancer chemopreventive agent with high therapeutic potential, as demonstrated by different authors. The aim of this review is to collect and present recent evidence from the literature regarding resveratrol and its effects on cancer prevention, molecular signaling (especially regarding the involvement of p53 protein, and therapeutic perspectives with an emphasis on clinical trial results to date.

  4. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

    Science.gov (United States)

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

    2015-05-01

    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Polerovirus protein P0 prevents the assembly of small RNA-containing RISC complexes and leads to degradation of ARGONAUTE1.

    Science.gov (United States)

    Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József

    2010-05-01

    RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.

  6. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

    Science.gov (United States)

    Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

    2006-10-01

    Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

  7. Protein tyrosine phosphatase 1B deficiency ameliorates murine experimental colitis via the expansion of myeloid-derived suppressor cells.

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B is a key molecule in modulating low-degree inflammatory conditions such as diabetes. The role of PTP1B in other chronic inflammations, however, remains unknown. Here, we report that PTP1B deficiency ameliorates Dextran Sulfate Sodium (DSS-induced murine experimental colitis via expanding CD11b(+Gr-1(+ myeloid-derived suppressor cells (MDSCs. Employing DSS-induced murine experimental colitis as inflammatory animal model, we found that, compared with wild-type littermates, PTP1B-null mice demonstrated greater resistance to DSS-induced colitis, as reflected by slower weight-loss, greater survival rates and decreased PMN and macrophage infiltration into the colon. The evidence collectively also demonstrated that the resistance of PTP1B-null mice to DSS-induced colitis is based on the expansion of MDSCs. First, PTP1B-null mice exhibited a greater frequency of MDSCs in the bone marrow (BM, peripheral blood and spleen when compared with wild-type littermates. Second, PTP1B levels in BM leukocytes were significantly decreased after cells were induced into MDSCs by IL-6 and GM-CSF, and the MDSC induction occurred more rapidly in PTP1B-null mice than in wild-type littermates, suggesting PTP1B as a negative regulator of MDSCs. Third, the adoptive transfer of MDSCs into mice with DSS-colitis significantly attenuated colitis, which accompanies with a decreased serum IL-17 level. Finally, PTP1B deficiency increased the frequency of MDSCs from BM cells likely through enhancing the activities of signal transducer and activator of transcription 3 (STAT3 and Janus kinase 2 (JAK2. In conclusion, our study provides the first evidences that PTP1B deficiency ameliorates murine experimental colitis via expanding MDSCs.

  8. Nuclear location of tumor suppressor protein maspin inhibits proliferation of breast cancer cells without affecting proliferation of normal epithelial cells

    International Nuclear Information System (INIS)

    Machowska, Magdalena; Wachowicz, Katarzyna; Sopel, Mirosław; Rzepecki, Ryszard

    2014-01-01

    Maspin, which is classified as a tumor suppressor protein, is downregulated in many types of cancer. Several studies have suggested potential anti-proliferative activity of maspin as well as sensitizing activity of maspin for therapeutic cytotoxic agents in breast cancer tissue culture and animal models. All of the experimental data gathered so far have been based on studies with maspin localized cytoplasmically, while maspin in breast cancer tumor cells may be located in the cytoplasm, nucleus or both. In this study, the effect of maspin cytoplasmic and nuclear location and expression level on breast cancer proliferation and patient survival was studied. Tissue sections from 166 patients with invasive ductal breast cancer were stained by immunohistochemistry for maspin and Ki-67 protein. The localization and expression level of maspin were correlated with estimated patient overall survival and percent of Ki-67-positive cells. In further studies, we created constructs for transient transfection of maspin into breast cancer cells with targeted cytoplasmic and nuclear location. We analyzed the effect of maspin location in normal epithelial cell line MCF10A and three breast cancer cell lines - MCF-7, MDA-MB-231 and SKBR-3 - by immunofluorescence and proliferation assay. We observed a strong positive correlation between moderate and high nuclear maspin level and survival of patients. Moreover, a statistically significant negative relationship was observed between nuclear maspin and Ki-67 expression in patients with invasive ductal breast cancer. Spearman’s correlation analysis showed a negative correlation between level of maspin localized in nucleus and percentage of Ki-67 positive cells. No such differences were observed in cells with cytoplasmic maspin. We found a strong correlation between nuclear maspin and loss of Ki-67 protein in breast cancer cell lines, while there was no effect in normal epithelial cells from breast. The anti-proliferative effect of nuclear

  9. Nuclear location of tumor suppressor protein maspin inhibits proliferation of breast cancer cells without affecting proliferation of normal epithelial cells

    Science.gov (United States)

    2014-01-01

    Background Maspin, which is classified as a tumor suppressor protein, is downregulated in many types of cancer. Several studies have suggested potential anti-proliferative activity of maspin as well as sensitizing activity of maspin for therapeutic cytotoxic agents in breast cancer tissue culture and animal models. All of the experimental data gathered so far have been based on studies with maspin localized cytoplasmically, while maspin in breast cancer tumor cells may be located in the cytoplasm, nucleus or both. In this study, the effect of maspin cytoplasmic and nuclear location and expression level on breast cancer proliferation and patient survival was studied. Methods Tissue sections from 166 patients with invasive ductal breast cancer were stained by immunohistochemistry for maspin and Ki-67 protein. The localization and expression level of maspin were correlated with estimated patient overall survival and percent of Ki-67-positive cells. In further studies, we created constructs for transient transfection of maspin into breast cancer cells with targeted cytoplasmic and nuclear location. We analyzed the effect of maspin location in normal epithelial cell line MCF10A and three breast cancer cell lines - MCF-7, MDA-MB-231 and SKBR-3 - by immunofluorescence and proliferation assay. Results We observed a strong positive correlation between moderate and high nuclear maspin level and survival of patients. Moreover, a statistically significant negative relationship was observed between nuclear maspin and Ki-67 expression in patients with invasive ductal breast cancer. Spearman’s correlation analysis showed a negative correlation between level of maspin localized in nucleus and percentage of Ki-67 positive cells. No such differences were observed in cells with cytoplasmic maspin. We found a strong correlation between nuclear maspin and loss of Ki-67 protein in breast cancer cell lines, while there was no effect in normal epithelial cells from breast. The anti

  10. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    Science.gov (United States)

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    Science.gov (United States)

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  12. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  13. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  14. Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

    Science.gov (United States)

    Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2014-06-01

    Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

  15. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  16. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  17. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  18. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  19. Antihelminthic drug niclosamide inhibits CIP2A and reactivates tumor suppressor protein phosphatase 2A in non-small cell lung cancer cells.

    Science.gov (United States)

    Kim, Myeong-Ok; Choe, Min Ho; Yoon, Yi Na; Ahn, Jiyeon; Yoo, Minjin; Jung, Kwan-Young; An, Sungkwan; Hwang, Sang-Gu; Oh, Jeong Su; Kim, Jae-Sung

    2017-11-15

    Protein phosphatase 2A (PP2A) is a critical tumor suppressor complex responsible for the inactivation of various oncogenes. Recently, PP2A reactivation has emerged asan anticancer strategy. Cancerous inhibitor of protein phosphatase 2A (CIP2A), an endogenous inhibitor of PP2A, is upregulated in many cancer cells, including non-small cell lung cancer (NSCLC) cells. We demonstrated that the antihelminthic drug niclosamide inhibited the expression of CIP2A and reactivated the tumor suppressor PP2A in NSCLC cells. We performed a drug-repurposing screen and identified niclosamide asa CIP2A suppressor in NSCLC cells. Niclosamide inhibited cell proliferation, colony formation, and tumor sphere formation, and induced mitochondrial dysfunction through increased mitochondrial ROS production in NSCLC cells; however, these effects were rescued by CIP2A overexpression, which indicated that the antitumor activity of niclosamide was dependent on CIP2A. We found that niclosamide increased PP2A activity through CIP2A inhibition, which reduced the phosphorylation of several oncogenic proteins. Moreover, we found that a niclosamide analog inhibited CIP2A expression and increased PP2A activity in several types of NSCLC cells. Finally, we showed that other well-known PP2A activators, including forskolin and FTY720, did not inhibit CIP2A and that their activities were not dependent on CIP2A. Collectively, our data suggested that niclosamide effectively suppressed CIP2A expression and subsequently activated PP2A in NSCLC cells. This provided strong evidence for the potential use of niclosamide asa PP2A-activating drug in the clinical treatment of NSCLC. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  1. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  2. Isonicotinamide Enhances Sir2 Protein-mediated Silencing and Longevity in Yeast by Raising Intracellular NAD+ Concentration*

    Science.gov (United States)

    McClure, Julie M.; Wierman, Margaret B.; Maqani, Nazif; Smith, Jeffrey S.

    2012-01-01

    Sirtuins are an evolutionarily conserved family of NAD+-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD+ concentration through the combined action of NAD+ biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD+ precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD+ salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD+ concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD+. The INAM-induced increase in NAD+ was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD+ salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD+. We also provide evidence suggesting that INAM influences the expression of multiple NAD+ biosynthesis and salvage pathways to promote homeostasis during stationary phase. PMID:22539348

  3. Isonicotinamide enhances Sir2 protein-mediated silencing and longevity in yeast by raising intracellular NAD+ concentration.

    Science.gov (United States)

    McClure, Julie M; Wierman, Margaret B; Maqani, Nazif; Smith, Jeffrey S

    2012-06-15

    Sirtuins are an evolutionarily conserved family of NAD(+)-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD(+) concentration through the combined action of NAD(+) biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD(+) precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD(+) salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD(+) concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD(+). The INAM-induced increase in NAD(+) was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD(+) salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD(+). We also provide evidence suggesting that INAM influences the expression of multiple NAD(+) biosynthesis and salvage pathways to promote homeostasis during stationary phase.

  4. Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

    Science.gov (United States)

    Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

    2018-06-15

    The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

    Science.gov (United States)

    Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

    2011-01-01

    RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

  6. Identification of Proteins Using iTRAQ and Virus-Induced Gene Silencing Reveals Three Bread Wheat Proteins Involved in the Response to Combined Osmotic-Cold Stress.

    Science.gov (United States)

    Zhang, Ning; Zhang, Lingran; Shi, Chaonan; Zhao, Lei; Cui, Dangqun; Chen, Feng

    2018-05-25

    Crops are often subjected to a combination of stresses in the field. To date, studies on the physiological and molecular responses of common wheat to a combination of osmotic and cold stresses, however, remain unknown. In this study, wheat seedlings exposed to osmotic-cold stress for 24 h showed inhibited growth, as well as increased lipid peroxidation, relative electrolyte leakage, and soluble sugar contents. iTRAQ-based quantitative proteome method was employed to determine the proteomic profiles of the roots and leaves of wheat seedlings exposed to osmotic-cold stress conditions. A total of 250 and 258 proteins with significantly altered abundance in the roots and leaves were identified, respectively, and the majority of these proteins displayed differential abundance, thereby revealing organ-specific differences in adaptation to osmotic-cold stress. Yeast two hybrid assay examined five pairs of stress/defense-related protein-protein interactions in the predicted protein interaction network. Furthermore, quantitative real-time PCR analysis indicated that abiotic stresses increased the expression of three candidate protein genes, i.e., TaGRP2, CDCP, and Wcor410c in wheat leaves. Virus-induced gene silencing indicated that three genes TaGRP2, CDCP, and Wcor410c were involved in modulating osmotic-cold stress in common wheat. Our study provides useful information for the elucidation of molecular and genetics bases of osmotic-cold combined stress in bread wheat.

  7. The Parkinson disease-related protein DJ-1 counteracts mitochondrial impairment induced by the tumour suppressor protein p53 by enhancing endoplasmic reticulum-mitochondria tethering.

    Science.gov (United States)

    Ottolini, Denis; Calì, Tito; Negro, Alessandro; Brini, Marisa

    2013-06-01

    DJ-1 was first identified as an oncogene. More recently, mutations in its gene have been found causative for autosomal recessive familial Parkinson disease. Numerous studies support the DJ-1 role in the protection against oxidative stress and maintenance of mitochondria structure; however, the mechanism of its protective function remains largely unknown. We investigated whether mitochondrial Ca(2+) homeostasis, a key parameter in cell physiology, could be a target for DJ-1 action. Here, we show that DJ-1 modulates mitochondrial Ca(2+) transients induced upon cell stimulation with an 1,4,5-inositol-tris-phosphate agonist by favouring the endoplasmic reticulum (ER)-mitochondria tethering. A reduction of DJ-1 levels results in mitochondria fragmentation and decreased mitochondrial Ca(2+) uptake in stimulated cells. To functionally couple these effects with the well-recognized cytoprotective role of DJ-1, we investigated its action in respect to the tumour suppressor p53. p53 overexpression in HeLa cells impairs their ability to accumulate Ca(2+) in the mitochondrial matrix, causes alteration of the mitochondrial morphology and reduces ER-mitochondria contact sites. Mitochondrial impairments are independent from Drp1 activation, since the co-expression of the dominant negative mutant of Drp1 failed to abolish them. DJ-1 overexpression prevents these alterations by re-establishing the ER-mitochondria tethering. Similarly, the co-expression of the pro-fusion protein Mitofusin 2 blocks the effects induced by p53 on mitochondria, confirming that the modulation of the ER-mitochondria contact sites is critical to mitochondria integrity. Thus, the impairment of ER-mitochondria communication, as a consequence of DJ-1 loss-of-function, may be detrimental for mitochondria-related processes and be at the basis of mitochondrial dysfunction observed in Parkinson disease.

  8. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  9. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  10. Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

    Science.gov (United States)

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

    2013-10-01

    Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

  11. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  12. A Rice gid1 Suppressor Mutant Reveals That Gibberellin Is Not Always Required for Interaction between Its Receptor, GID1, and DELLA Proteins[W][OA

    Science.gov (United States)

    Yamamoto, Yuko; Hirai, Takaaki; Yamamoto, Eiji; Kawamura, Mayuko; Sato, Tomomi; Kitano, Hidemi; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako

    2010-01-01

    To investigate gibberellin (GA) signaling using the rice (Oryza sativa) GA receptor GIBBERELLIN-INSENSITIVE DWARF1 (GID1) mutant gid1-8, we isolated a suppressor mutant, Suppressor of gid1-1 (Sgd-1). Sgd-1 is an intragenic mutant containing the original gid1-8 mutation (L45F) and an additional amino acid substitution (P99S) in the loop region. GID1P99S interacts with the rice DELLA protein SLENDER RICE1 (SLR1), even in the absence of GA. Substitution of the 99th Pro with other amino acids revealed that substitution with Ala (P99A) caused the highest level of GA-independent interaction. Physicochemical analysis using surface plasmon resonance revealed that GID1P99A has smaller Ka (association) and Kd (dissociation) values for GA4 than does wild-type GID1. This suggests that the GID1P99A lid is at least partially closed, resulting in both GA-independent and GA-hypersensitive interactions with SLR1. One of the three Arabidopsis thaliana GID1s, At GID1b, can also interact with DELLA proteins in the absence of GA, so we investigated whether GA-independent interaction of At GID1b depends on a mechanism similar to that of rice GID1P99A. Substitution of the loop region or a few amino acids of At GID1b with those of At GID1a diminished its GA-independent interaction with GAI while maintaining the GA-dependent interaction. Soybean (Glycine max) and Brassica napus also have GID1s similar to At GID1b, indicating that these unique GID1s occur in various dicots and may have important functions in these plants. PMID:21098733

  13. A rice gid1 suppressor mutant reveals that gibberellin is not always required for interaction between its receptor, GID1, and DELLA proteins.

    Science.gov (United States)

    Yamamoto, Yuko; Hirai, Takaaki; Yamamoto, Eiji; Kawamura, Mayuko; Sato, Tomomi; Kitano, Hidemi; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako

    2010-11-01

    To investigate gibberellin (GA) signaling using the rice (Oryza sativa) GA receptor GIBBERELLIN-INSENSITIVE DWARF1 (GID1) mutant gid1-8, we isolated a suppressor mutant, Suppressor of gid1-1 (Sgd-1). Sgd-1 is an intragenic mutant containing the original gid1-8 mutation (L45F) and an additional amino acid substitution (P99S) in the loop region. GID1(P99S) interacts with the rice DELLA protein SLENDER RICE1 (SLR1), even in the absence of GA. Substitution of the 99th Pro with other amino acids revealed that substitution with Ala (P99A) caused the highest level of GA-independent interaction. Physicochemical analysis using surface plasmon resonance revealed that GID1(P99A) has smaller K(a) (association) and K(d) (dissociation) values for GA(4) than does wild-type GID1. This suggests that the GID1(P99A) lid is at least partially closed, resulting in both GA-independent and GA-hypersensitive interactions with SLR1. One of the three Arabidopsis thaliana GID1s, At GID1b, can also interact with DELLA proteins in the absence of GA, so we investigated whether GA-independent interaction of At GID1b depends on a mechanism similar to that of rice GID1(P99A). Substitution of the loop region or a few amino acids of At GID1b with those of At GID1a diminished its GA-independent interaction with GAI while maintaining the GA-dependent interaction. Soybean (Glycine max) and Brassica napus also have GID1s similar to At GID1b, indicating that these unique GID1s occur in various dicots and may have important functions in these plants.

  14. Complexes between the LKB1 tumor suppressor, STRADα/β and MO25α/β are upstream kinases in the AMP-activated protein kinase cascade

    Directory of Open Access Journals (Sweden)

    Alessi Dario R

    2003-09-01

    Full Text Available Abstract Background The AMP-activated protein kinase (AMPK cascade is a sensor of cellular energy charge that acts as a 'metabolic master switch' and inhibits cell proliferation. Activation requires phosphorylation of Thr172 of AMPK within the activation loop by upstream kinases (AMPKKs that have not been identified. Recently, we identified three related protein kinases acting upstream of the yeast homolog of AMPK. Although they do not have obvious mammalian homologs, they are related to LKB1, a tumor suppressor that is mutated in the human Peutz-Jeghers cancer syndrome. We recently showed that LKB1 exists as a complex with two accessory subunits, STRADα/β and MO25α/β. Results We report the following observations. First, two AMPKK activities purified from rat liver contain LKB1, STRADα and MO25α, and can be immunoprecipitated using anti-LKB1 antibodies. Second, both endogenous and recombinant complexes of LKB1, STRADα/β and MO25α/β activate AMPK via phosphorylation of Thr172. Third, catalytically active LKB1, STRADα or STRADβ and MO25α or MO25β are required for full activity. Fourth, the AMPK-activating drugs AICA riboside and phenformin do not activate AMPK in HeLa cells (which lack LKB1, but activation can be restored by stably expressing wild-type, but not catalytically inactive, LKB1. Fifth, AICA riboside and phenformin fail to activate AMPK in immortalized fibroblasts from LKB1-knockout mouse embryos. Conclusions These results provide the first description of a physiological substrate for the LKB1 tumor suppressor and suggest that it functions as an upstream regulator of AMPK. Our findings indicate that the tumors in Peutz-Jeghers syndrome could result from deficient activation of AMPK as a consequence of LKB1 inactivation.

  15. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  16. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  17. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  18. Tumor suppressors: enhancers or suppressors of regeneration?

    Science.gov (United States)

    Pomerantz, Jason H.; Blau, Helen M.

    2013-01-01

    Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

  19. The metastasis suppressor KISS1 is an intrinsically disordered protein slightly more extended than a random coil.

    Science.gov (United States)

    Ibáñez de Opakua, Alain; Merino, Nekane; Villate, Maider; Cordeiro, Tiago N; Ormaza, Georgina; Sánchez-Carbayo, Marta; Diercks, Tammo; Bernadó, Pau; Blanco, Francisco J

    2017-01-01

    The metastasis suppressor KISS1 is reported to be involved in the progression of several solid neoplasias, making it a promising molecular target for controlling their metastasis. The KISS1 sequence contains an N-terminal secretion signal and several dibasic sequences that are proposed to be the proteolytic cleavage sites. We present the first structural characterization of KISS1 by circular dichroism, multi-angle light scattering, small angle X-Ray scattering and NMR spectroscopy. An analysis of the KISS1 backbone NMR chemical shifts does not reveal any preferential conformation and deviation from a random coil ensemble. The backbone 15N transverse relaxation times indicate a mildly reduced mobility for two regions that are rich in bulky residues. The small angle X-ray scattering curve of KISS1 is likewise consistent with a predominantly random coil ensemble, although an ensemble optimization analysis indicates some preference for more extended conformations possibly due to positive charge repulsion between the abundant basic residues. Our results support the hypothesis that KISS1 mostly samples a random coil conformational space, which is consistent with its high susceptibility to proteolysis and the generation of Kisspeptin fragments.

  20. A Tumor Suppressor Gene Product, Platelet-Derived Growth Factor Receptor-Like Protein Controls Chondrocyte Proliferation and Differentiation.

    Science.gov (United States)

    Kawata, Kazumi; Kubota, Satoshi; Eguchi, Takanori; Aoyama, Eriko; Moritani, Norifumi H; Oka, Morihiko; Kawaki, Harumi; Takigawa, Masaharu

    2017-11-01

    The platelet-derived growth factor receptor-like (PDGFRL) gene is regarded as a tumor suppressor gene. However, nothing is known about the molecular function of PDGFRL. In this study, we initially clarified its function in chondrocytes. Among all cell lines examined, the PDGFRL mRNA level was the highest in chondrocytic HCS-2/8 cells. Interestingly, the proliferation of chondrocytic HCS-2/8 cells was promoted by PDGFRL overexpression, whereas that of the breast cancer-derived MDA-MB-231 cells was inhibited. Of note, in PDGFRL-overexpressing HCS-2/8 cells, the expression of chondrocyte differentiation marker genes, SOX9, ACAN, COL2A1, COL10A1, and ALP, was decreased. Moreover, we confirmed the expression of PDGFRL mRNA in normal cartilage tissue and chondrocytes. Eventually, the expression of PDGFRL mRNA in condrocytes except in the case of hypertrophic chondrocytes was demonstrated in vivo and in vitro. These findings suggest that PDGFRL plays the different roles, depending upon cell types. Particularly, in chondrocytes, PDGFRL may play a new and important role which is distinct from the function previously reported. J. Cell. Biochem. 118: 4033-4044, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. The splicing mutant of the human tumor suppressor protein DFNA5 induces programmed cell death when expressed in the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Van Rossom, Sofie; Op de Beeck, Ken; Franssens, Vanessa; Swinnen, Erwin; Schepers, Anne; Ghillebert, Ruben; Caldara, Marina; Van Camp, Guy; Winderickx, Joris

    2012-01-01

    DFNA5 was first identified as a gene responsible for autosomal dominant deafness. Different mutations were found, but they all resulted in exon 8 skipping during splicing and premature termination of the protein. Later, it became clear that the protein also has a tumor suppression function and that it can induce apoptosis. Epigenetic silencing of the DFNA5 gene is associated with different types of cancers, including gastric and colorectal cancers as well as breast tumors. We introduced the wild-type and mutant DFNA5 allele in the yeast Saccharomyces cerevisiae. The expression of the wild-type protein was well tolerated by the yeast cells, although the protein was subject of degradation and often deposited in distinct foci when cells entered the diauxic shift. In contrast, cells had problems to cope with mutant DFNA5 and despite an apparent compensatory reduction in expression levels, the mutant protein still triggered a marked growth defect, which in part can be ascribed to its interaction with mitochondria. Consistently, cells with mutant DFNA5 displayed significantly increased levels of ROS and signs of programmed cell death. The latter occurred independently of the yeast caspase, Mca1, but involved the mitochondrial fission protein, Fis1, the voltage-dependent anion channel protein, Por1 and the mitochondrial adenine nucleotide translocators, Aac1 and Aac3. Recent data proposed DFNA5 toxicity to be associated to a globular domain encoded by exon 2–6. We confirmed these data by showing that expression of solely this domain confers a strong growth phenotype. In addition, we identified a point mutant in this domain that completely abrogated its cytotoxicity in yeast as well as human Human Embryonic Kidney 293T cells (HEK293T). Combined, our data underscore that the yeast system offers a valuable tool to further dissect the apoptotic properties of DFNA5.

  2. The splicing mutant of the human tumor suppressor protein DFNA5 induces programmed cell death when expressed in the yeast Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Van Rossom, Sofie [Department of Biology, Functional Biology, KU Leuven, Leuven-Heverlee (Belgium); Department of Biomedical Sciences, Center of Medical Genetics, University of Antwerp, Wilrijk-Antwerp (Belgium); Op de Beeck, Ken [Department of Biomedical Sciences, Center of Medical Genetics, University of Antwerp, Wilrijk-Antwerp (Belgium); Franssens, Vanessa; Swinnen, Erwin [Department of Biology, Functional Biology, KU Leuven, Leuven-Heverlee (Belgium); Schepers, Anne [Department of Biomedical Sciences, Center of Medical Genetics, University of Antwerp, Wilrijk-Antwerp (Belgium); Ghillebert, Ruben; Caldara, Marina [Department of Biology, Functional Biology, KU Leuven, Leuven-Heverlee (Belgium); Van Camp, Guy [Department of Biomedical Sciences, Center of Medical Genetics, University of Antwerp, Wilrijk-Antwerp (Belgium); Winderickx, Joris, E-mail: guy.vancamp@ua.ac.be, E-mail: joris.winderickx@bio.kuleuven.be [Department of Biology, Functional Biology, KU Leuven, Leuven-Heverlee (Belgium)

    2012-07-25

    DFNA5 was first identified as a gene responsible for autosomal dominant deafness. Different mutations were found, but they all resulted in exon 8 skipping during splicing and premature termination of the protein. Later, it became clear that the protein also has a tumor suppression function and that it can induce apoptosis. Epigenetic silencing of the DFNA5 gene is associated with different types of cancers, including gastric and colorectal cancers as well as breast tumors. We introduced the wild-type and mutant DFNA5 allele in the yeast Saccharomyces cerevisiae. The expression of the wild-type protein was well tolerated by the yeast cells, although the protein was subject of degradation and often deposited in distinct foci when cells entered the diauxic shift. In contrast, cells had problems to cope with mutant DFNA5 and despite an apparent compensatory reduction in expression levels, the mutant protein still triggered a marked growth defect, which in part can be ascribed to its interaction with mitochondria. Consistently, cells with mutant DFNA5 displayed significantly increased levels of ROS and signs of programmed cell death. The latter occurred independently of the yeast caspase, Mca1, but involved the mitochondrial fission protein, Fis1, the voltage-dependent anion channel protein, Por1 and the mitochondrial adenine nucleotide translocators, Aac1 and Aac3. Recent data proposed DFNA5 toxicity to be associated to a globular domain encoded by exon 2–6. We confirmed these data by showing that expression of solely this domain confers a strong growth phenotype. In addition, we identified a point mutant in this domain that completely abrogated its cytotoxicity in yeast as well as human Human Embryonic Kidney 293T cells (HEK293T). Combined, our data underscore that the yeast system offers a valuable tool to further dissect the apoptotic properties of DFNA5.

  3. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4) tumor suppressor gene in ovarian cancer

    International Nuclear Information System (INIS)

    Davis, Sally J; Choong, David YH; Ramakrishna, Manasa; Ryland, Georgina L; Campbell, Ian G; Gorringe, Kylie L

    2011-01-01

    MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort

  4. Hepatic acute-phase proteins control innate immune responses during infection by promoting myeloid-derived suppressor cell function

    NARCIS (Netherlands)

    Sander, L.E.; Sackett, S.D.; Dierssen, U.; Beraza, N.; Linke, R.; Müller, M.R.; Blander, J.M.; Tacke, F.; Trautwein, C.

    2010-01-01

    Acute-phase proteins (APPs) are an evolutionarily conserved family of proteins produced mainly in the liver in response to infection and inflammation. Despite vast pro- and antiinflammatory properties ascribed to individual APPs, their collective function during infections remains poorly defined.

  5. Hepatic acute phase proteins control innate immune responses during infection by promoting myeloid derived suppressor cell function

    NARCIS (Netherlands)

    Sander, Leif E.; Dutton Sackett, Sara; Dierssen, Uta; Beraza, Naiara; Linke, Reinhold P.; Muller, Michael; Magarian Blander, Julie; Tacke, Frank; Trautwein, Christian

    2010-01-01

    Acute phase proteins (APPs) are an evolutionarily conserved family of proteins produced mainly in the liver in response to infection and inflammation. Despite vast pro- and anti-inflammatory properties ascribed to individual APPs, their collective function during infections remains poorly defined.

  6. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  7. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  8. The milk protein α-casein functions as a tumor suppressor via activation of STAT1 signaling, effectively preventing breast cancer tumor growth and metastasis

    Science.gov (United States)

    Bonuccelli, Gloria; Castello-Cros, Remedios; Capozza, Franco; Martinez-Outschoorn, Ubaldo E.; Lin, Zhao; Tsirigos, Aristotelis; Xuanmao, Jiao; Whitaker-Menezes, Diana; Howell, Anthony; Lisanti, Michael P.; Sotgia, Federica

    2012-01-01

    Here, we identified the milk protein α-casein as a novel suppressor of tumor growth and metastasis. Briefly, Met-1 mammary tumor cells expressing α-casein showed a ~5-fold reduction in tumor growth and a near 10-fold decrease in experimental metastasis. To identify the molecular mechanism(s), we performed genome-wide transcriptional profiling. Interestingly, our results show that α-casein upregulates gene transcripts associated with interferon/STAT1 signaling and downregulates genes associated with “stemness.” These findings were validated by immunoblot and FACS analysis, which showed the upregulation and hyperactivation of STAT1 and a decrease in the number of CD44(+) “cancer stem cells.” These gene signatures were also able to predict clinical outcome in human breast cancer patients. Thus, we conclude that a lactation-based therapeutic strategy using recombinant α-casein would provide a more natural and non-toxic approach to the development of novel anticancer therapies. PMID:23047602

  9. Expression of ankyrin repeat and suppressor of cytokine signaling box protein 4 (Asb-4) in proopiomelanocortin neurons of the arcuate nucleus of mice produces a hyperphagic, lean phenotype.

    Science.gov (United States)

    Li, Ji-Yao; Chai, Biao-Xin; Zhang, Weizhen; Wang, Hui; Mulholland, Michael W

    2010-01-01

    Ankyrin repeat and suppressor of cytokine signaling box-containing protein 4 (Asb-4) is specifically expressed in the energy homeostasis-related brain areas and colocalizes with proopiomelanocortin (POMC) neurons of the arcuate nucleus (ARC). Injection of insulin into the third ventricle of the rat brain increased Asb-4 mRNA expression in the paraventricular nucleus but not in the ARC of the hypothalamus, whereas injection of leptin (ip) increased Asb-4 expression in both mouse paraventricular nucleus and ARC. A transgenic mouse in which Myc-tagged Asb-4 is specifically expressed in POMC neurons of the ARC was made and used to study the effects of Asb-4 on ingestive behavior and metabolic rate. Animals with overexpression of Asb-4 in POMC neurons demonstrated an increase in food intake. However, POMC-Asb-4 transgenic animals gained significantly less weight from 6-30 wk of age. The POMC-Asb-4 mice had reduced fat mass and increased lean mass and lower levels of blood leptin. The transgenic animals were resistant to high-fat diet-induced obesity. Transgenic mice had significantly higher rates of oxygen consumption and carbon dioxide production than wild-type mice during both light and dark periods. The locomotive activity of transgenic mice was increased. The overexpression of Asb-4 in POMC neurons increased POMC mRNA expression in the ARC. The transgenic animals had no observed effect on peripheral glucose metabolism and the activity of the autonomic nervous system. These results indicate that Asb-4 is a key regulatory protein in the central nervous system, involved in the control of feeding behavior and metabolic rate.

  10. Identification of a genetic interaction between the tumor suppressor EAF2 and the retinoblastoma protein (Rb) signaling pathway in C. elegans and prostate cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Liquan; Wang, Dan [Department of Urology, The University of Pittsburgh, 5200 Centre Avenue, Pittsburgh, PA 15216 (United States); Fisher, Alfred L., E-mail: fishera2@uthscsa.edu [Division of Geriatrics, Gerontology, and Palliative Medicine, Department of Medicine, UTHSCSA, San Antonio, TX 78229 (United States); Center for Healthy Aging, UTHSCSA, San Antonio, TX 78229 (United States); GRECC, STVAHCS, San Antonio, TX 78229 (United States); Wang, Zhou, E-mail: wangz2@upmc.edu [Department of Urology, The University of Pittsburgh, 5200 Centre Avenue, Pittsburgh, PA 15216 (United States); GRECC, STVAHCS, San Antonio, TX 78229 (United States)

    2014-05-02

    Highlights: • RNAi screen identified genetic enhancers for the C. elegans homolog of EAF2. • EAF2 and RBBP4 proteins physically bind to each other and alter transcription. • Overexpression of EAF2 and RBBP4 induces the cell death in prostate cancer cells. - Abstract: The tumor suppressor EAF2 is regulated by androgen signaling and associated with prostate cancer. While EAF2 and its partner ELL have been shown to be members of protein complexes involved in RNA polymerase II transcriptional elongation, the biologic roles for EAF2 especially with regards to the development of cancer remains poorly understood. We have previously identified the eaf-1 gene in Caenorhabditiselegans as the ortholog of EAF2, and shown that eaf-1 interacts with the ELL ortholog ell-1 to control development and fertility in worms. To identify genetic pathways that interact with eaf-1, we screened RNAi libraries consisting of transcription factors, phosphatases, and chromatin-modifying factors to identify genes which enhance the effects of eaf-1(tm3976) on fertility. From this screen, we identified lin-53, hmg-1.2, pha-4, ruvb-2 and set-6 as hits. LIN-53 is the C. elegans ortholog of human retinoblastoma binding protein 4/7 (RBBP 4/7), which binds to the retinoblastoma protein and inhibits the Ras signaling pathway. We find that lin-53 showed a synthetic interaction with eaf-1(tm3976) where knockdown of lin-53 in an eaf-1(tm3976) mutant resulted in sterile worms. This phenotype may be due to cell death as the treated worms contain degenerated embryos with increased expression of the ced-1:GFP cell death marker. Further we find that the interaction between eaf-1 and lin-53/RBBP4/7 also exists in vertebrates, which is reflected by the formation of a protein complex between EAF2 and RBBP4/7. Finally, overexpression of either human EAF2 or RBBP4 in LNCaP cells induced the cell death while knockdown of EAF2 in LNCaP enhanced cell proliferation, indicating an important role of EAF2 in

  11. Genetic modelling of PIM proteins in cancer: proviral tagging, cooperation with oncogenes, tumor suppressor genes and carcinogens.

    Directory of Open Access Journals (Sweden)

    Enara eAguirre

    2014-05-01

    Full Text Available The PIM proteins, which were initially discovered as proviral insertion sites in Moloney murine leukemia virus infection, are a family of highly homologous serine/threonine kinases that have been reported to be overexpressed in hematological malignancies and solid tumors. The PIM proteins have also been associated with metastasis and overall treatment responses and implicated in the regulation of apoptosis, metabolism, the cell cycle, and homing and migration, which makes these proteins interesting targets for anticancer drug discovery. The use of retroviral insertional mutagenesis and refined approaches such as complementation tagging has allowed the identification of myc, pim and a third group of genes (including bmi1 and gfi1 as complementing genes in lymphomagenesis. Moreover, mouse modeling of human cancer has provided an understanding of the molecular pathways that are involved in tumor initiation and progression at the physiological level. In particular, genetically modified mice have allowed researchers to further elucidate the role of each of the Pim isoforms in various tumor types. PIM kinases have been identified as weak oncogenes because experimental overexpression in lymphoid tissue, prostate and liver induces tumors at a relatively low incidence and with a long latency. However, very strong synergistic tumorigenicity between Pim1/2 and c-Myc and other oncogenes has been observed in lymphoid tissues. Mouse models have also been used to study whether the inhibition of specific PIM isoforms is required to prevent carcinogen-induced sarcomas, indicating that the absence of Pim2 and Pim3 greatly reduces sarcoma growth and bone invasion; the extent of this effect is similar to that observed in the absence of all 3 isoforms. This review will summarize some of the animal models that have been used to understand the isoform-specific contribution of PIM kinases to tumorigenesis.

  12. WISP3 (CCN6 Is a Secreted Tumor-Suppressor Protein that Modulates IGF Signaling in Inflammatory Breast Cancer

    Directory of Open Access Journals (Sweden)

    Celina G. Kleer

    2004-03-01

    Full Text Available Inflammatory breast cancer (IBC is the most lethal form of locally advanced breast cancer. We have found that WISP3 is lost in 80% of human IBC tumors and that it has growth- and angiogenesis-inhibitory functions in breast cancer in vitro and in vivo. WISP3 is a cysteine-rich, putatively secreted protein that belongs to the CCN family. It contains a signal peptide at the N-terminus and four highly conserved motifs. Here, for the first time, we investigate the function of WISP3 protein in relationship to its structural features. We found that WISP3 is secreted into the conditioned media and into the lumens of normal breast ducts. Once secreted, WISP3 was able to decrease, directly or through induction of other molecule(s, the IGF-1-induced activation of the IGF-IR, and two of its main downstream signaling molecules, IRS1 and ERK-1/2, in SUM149 IBC cells. Furthermore, WISP3 containing conditioned media decreased the growth rate of SUM149 cells. This work sheds light into the mechanism of WISP3 function by demonstrating that it is secreted and that, once in the extracellular media, it induces a series of molecular events that leads to modulation of IGF-IR signaling pathways and cellular growth in IBC cells.

  13. Foxa2, a novel protein partner of the tumour suppressor menin, is deregulated in mouse and human MEN1 glucagonomas.

    Science.gov (United States)

    Bonnavion, Rémy; Teinturier, Romain; Gherardi, Samuele; Leteurtre, Emmanuelle; Yu, Run; Cordier-Bussat, Martine; Du, Rui; Pattou, François; Vantyghem, Marie-Christine; Bertolino, Philippe; Lu, Jieli; Zhang, Chang Xian

    2017-05-01

    Foxa2, known as one of the pioneer factors, plays a crucial role in islet development and endocrine functions. Its expression and biological functions are regulated by various factors, including, in particular, insulin and glucagon. However, its expression and biological role in adult pancreatic α-cells remain elusive. In the current study, we showed that Foxa2 was overexpressed in islets from α-cell-specific Men1 mutant mice, at both the transcriptional level and the protein level. More importantly, immunostaining analyses showed its prominent nuclear accumulation, specifically in α-cells, at a very early stage after Men1 disruption. Similar nuclear FOXA2 expression was also detected in a substantial proportion (12/19) of human multiple endocrine neoplasia type 1 (MEN1) glucagonomas. Interestingly, our data revealed an interaction between Foxa2 and menin encoded by the Men1 gene. Furthermore, using several approaches, we demonstrated the relevance of this interaction in the regulation of two tested Foxa2 target genes, including the autoregulation of the Foxa2 promoter by Foxa2 itself. The current study establishes menin, a novel protein partner of Foxa2, as a regulator of Foxa2, the biological functions of which extend beyond the pancreatic endocrine cells. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  14. Functions of the APC tumor suppressor protein dependent and independent of canonical WNT signaling: implications for therapeutic targeting.

    Science.gov (United States)

    Hankey, William; Frankel, Wendy L; Groden, Joanna

    2018-03-01

    The acquisition of biallelic mutations in the APC gene is a rate-limiting step in the development of most colorectal cancers and occurs in the earliest lesions. APC encodes a 312-kDa protein that localizes to multiple subcellular compartments and performs diverse functions. APC participates in a cytoplasmic complex that promotes the destruction of the transcriptional licensing factor β-catenin; APC mutations that abolish this function trigger constitutive activation of the canonical WNT signaling pathway, a characteristic found in almost all colorectal cancers. By negatively regulating canonical WNT signaling, APC counteracts proliferation, promotes differentiation, facilitates apoptosis, and suppresses invasion and tumor progression. APC further antagonizes canonical WNT signaling by interacting with and counteracting β-catenin in the nucleus. APC also suppresses tumor initiation and progression in the colorectal epithelium through functions that are independent of canonical WNT signaling. APC regulates the mitotic spindle to facilitate proper chromosome segregation, localizes to the cell periphery and cell protrusions to establish cell polarity and appropriate directional migration, and inhibits DNA replication by interacting directly with DNA. Mutations in APC are often frameshifts, insertions, or deletions that introduce premature stop codons and lead to the production of truncated APC proteins that lack its normal functions and possess tumorigenic properties. Therapeutic approaches in development for the treatment of APC-deficient tumors are focused on the inhibition of canonical WNT signaling, especially through targets downstream of APC in the pathway, or on the restoration of wild-type APC expression.

  15. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  16. Induction of cell death by tospoviral protein NSs and the motif critical for cell death does not control RNA silencing suppression activity.

    Science.gov (United States)

    Singh, Ajeet; Permar, Vipin; Jain, R K; Goswami, Suneha; Kumar, Ranjeet Ranjan; Canto, Tomas; Palukaitis, Peter; Praveen, Shelly

    2017-08-01

    Groundnut bud necrosis virus induces necrotic symptoms in different hosts. Previous studies showed reactive oxygen species-mediated programmed cell death (PCD) resulted in necrotic symptoms. Transgenic expression of viral protein NSs mimics viral symptoms. Here, we showed a role for NSs in influencing oxidative burst in the cell, by analyzing H 2 O 2 accumulation, activities of antioxidant enzymes and expression levels of vacuolar processing enzymes, H 2 O 2 -responsive microRNA 319a.2 plus its possible target metacaspase-8. The role of NSs in PCD, was shown using two NSs mutants: one in the Trp/GH3 motif (a homologue of pro-apototic domain) (NSs S189R ) and the other in a non-Trp/GH3 motif (NSs L172R ). Tobacco rattle virus (TRV) expressing NSs S189R enhanced the PCD response, but not TRV-NSs L172R , while RNA silencing suppression activity was lost in TRV-NSs L172R , but not in TRV-NSs S189R . Therefore, we propose dual roles of NSs in RNA silencing suppression and induction of cell death, controlled by different motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Silencing the Odorant Binding Protein RferOBP1768 Reduces the Strong Preference of Palm Weevil for the Major Aggregation Pheromone Compound Ferrugineol

    Directory of Open Access Journals (Sweden)

    Binu Antony

    2018-03-01

    Full Text Available In insects, perception of the environment—food, mates, and prey—is mainly guided by chemical signals. The dynamic process of signal perception involves transport to odorant receptors (ORs by soluble secretory proteins, odorant binding proteins (OBPs, which form the first stage in the process of olfactory recognition and are analogous to lipocalin family proteins in vertebrates. Although OBPs involved in the transport of pheromones to ORs have been functionally identified in insects, there is to date no report for Coleoptera. Furthermore, there is a lack of information on olfactory perception and the molecular mechanism by which OBPs participate in the transport of aggregation pheromones. We focus on the red palm weevil (RPW Rhynchophorus ferrugineus, the most devastating quarantine pest of palm trees worldwide. In this work, we constructed libraries of all OBPs and selected antenna-specific and highly expressed OBPs for silencing through RNA interference. Aggregation pheromone compounds, 4-methyl-5-nonanol (ferrugineol and 4-methyl-5-nonanone (ferruginone, and a kairomone, ethyl acetate, were then sequentially presented to individual RPWs. The results showed that antenna-specific RferOBP1768 aids in the capture and transport of ferrugineol to ORs. Silencing of RferOBP1768, which is responsible for pheromone binding, significantly disrupted pheromone communication. Study of odorant perception in palm weevil is important because the availability of literature regarding the nature and role of olfactory signaling in this insect may reveal likely candidates representative of animal olfaction and, more generally, of molecular recognition. Knowledge of OBPs recognizing the specific pheromone ferrugineol will allow for designing biosensors for the detection of this key compound in weevil monitoring in date palm fields.

  18. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  19. Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

    Science.gov (United States)

    Bazot, Quentin; Paschos, Kostas; Allday, Martin J

    2018-04-01

    Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

  20. Activating transcription factor-3 (ATF3) functions as a tumor suppressor in colon cancer and is up-regulated upon heat-shock protein 90 (Hsp90) inhibition

    International Nuclear Information System (INIS)

    Hackl, Christina; Stoeltzing, Oliver; Lang, Sven A; Moser, Christian; Mori, Akira; Fichtner-Feigl, Stefan; Hellerbrand, Claus; Dietmeier, Wolfgang; Schlitt, Hans J; Geissler, Edward K

    2010-01-01

    Activating transcription factor-3 (ATF3) is involved in the complex process of cellular stress response. However, its exact role in cancer is discussed controversially because both tumor suppressive and oncogenic effects have been described. Here we followed-up on our previous observation that inhibition of Hsp90 may increase ATF3 expression and sought to determine the role of ATF3 in colon cancer. Regulation of ATF3 was determined in cancer cells using signaling inhibitors and a heat-shock protein-90 (Hsp90) antagonist. Human HCT116 cancer cells were stably transfected with an ATF3-shRNA or a luciferase-shRNA expression plasmid and alterations in cell motility were assessed in migration assays. The impact of ATF3 down-regulation on cancer growth and metastasis were investigated in a subcutaneous tumor model, a model of hepatic tumor growth and in a model of peritoneal carcinomatosis. Human colon cancer tissues were analyzed for ATF3 expression. The results show that therapeutic Hsp90 inhibition substantially up-regulates the expression of ATF3 in various cancer cells, including colon, gastric and pancreatic cancer. This effect was evident both in vitro and in vivo. RNAi mediated knock-down of ATF3 in HCT116 colon cancer cells significantly increased cancer cell migration in vitro. Moreover, in xenogenic mouse models, ATF3 knock-down promoted subcutaneous tumor growth and hepatic metastasis, as well as peritoneal carcinomatosis. Importantly, ATF3 expression was lower in human colon cancer specimens, as compared to corresponding normal surrounding tissues, suggesting that ATF3 may represent a down-regulated tumor suppressor in colon cancer. In conclusion, ATF3 down-regulation in colon cancer promotes tumor growth and metastasis. Considering that blocking Hsp90 induces ATF3 expression, Hsp90 inhibition may represent a valid strategy to treat metastatic colon cancer by up-regulating this anti-metastatic transcription factor

  1. Identification of BAG3 target proteins in anaplastic thyroid cancer cells by proteomic analysis.

    Science.gov (United States)

    Galdiero, Francesca; Bello, Anna Maria; Spina, Anna; Capiluongo, Anna; Liuu, Sophie; De Marco, Margot; Rosati, Alessandra; Capunzo, Mario; Napolitano, Maria; Vuttariello, Emilia; Monaco, Mario; Califano, Daniela; Turco, Maria Caterina; Chiappetta, Gennaro; Vinh, Joëlle; Chiappetta, Giovanni

    2018-01-30

    BAG3 protein is an apoptosis inhibitor and is highly expressed in Anaplastic Thyroid Cancer. We investigated the entire set of proteins modulated by BAG3 silencing in the human anaplastic thyroid 8505C cancer cells by using the Stable-Isotope Labeling by Amino acids in Cell culture strategy combined with mass spectrometry analysis. By this approach we identified 37 up-regulated and 54 down-regulated proteins in BAG3-silenced cells. Many of these proteins are reportedly involved in tumor progression, invasiveness and resistance to therapies. We focused our attention on an oncogenic protein, CAV1, and a tumor suppressor protein, SERPINB2, that had not previously been reported to be modulated by BAG3. Their expression levels in BAG3-silenced cells were confirmed by qRT-PCR and western blot analyses, disclosing two novel targets of BAG3 pro-tumor activity. We also examined the dataset of proteins obtained by the quantitative proteomics analysis using two tools, Downstream Effect Analysis and Upstream Regulator Analysis of the Ingenuity Pathways Analysis software. Our analyses confirm the association of the proteome profile observed in BAG3-silenced cells with an increase in cell survival and a decrease in cell proliferation and invasion, and highlight the possible involvement of four tumor suppressor miRNAs and TP53/63 proteins in BAG3 activity.

  2. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  3. Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Yu [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Zhan, Qian [The Center for Clinical Molecular Medical Detection, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xu, Hongying [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili; Li, Chen [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Xiao, Qian; Xiang, Shili; Hui, Tianli [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xiang, Tingxiu, E-mail: larissaxiang@163.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Ren, Guosheng, E-mail: rengs726@126.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)

    2016-06-10

    The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

  4. Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

    International Nuclear Information System (INIS)

    Fan, Yu; Zhan, Qian; Xu, Hongying; Li, Lili; Li, Chen; Xiao, Qian; Xiang, Shili; Hui, Tianli; Xiang, Tingxiu; Ren, Guosheng

    2016-01-01

    The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

  5. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  6. Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

    2017-09-01

    Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. Differentially expressed proteins in ER+ MCF7 and ER- MDA- MB-231 human breast cancer cells by RhoGDI-α silencing and overexpression.

    Science.gov (United States)

    Hooshmand, Somayeh; Ghaderi, Abbas; Yusoff, Khatijah; Thilakavathy, Karuppiah; Rosli, Rozita; Mojtahedi, Zahra

    2014-01-01

    The consequence of Rho GDP dissociation inhibitor alpha (RhoGDIα) activity on migration and invasion of estrogen receptor positive (ER+) and negative (ER-) breast cancer cells has not been studied using the proteomic approach. Changes in expression of RhoGDIα and other proteins interacting directly or indirectly with RhoGDIα in MCF7 and MDA-MB-231, with different metastatic potentials is of particular interest. ER+ MCF7 and ER- MDA-MB-231 cell lines were subjected to two-dimensional electrophoresis (2-DE) and spots of interest were identified by matrix-assisted laser desorption/ionization time of- flight/time- of-flight (MALDI-TOF/TOF) mass spectrometry (MS) analysis after downregulation of RhoGDIα using short interfering RNA (siRNA) and upregulated using GFP-tagged ORF clone of RhoGDIα. The results showed a total of 35 proteins that were either up- or down-regulated in these cells. Here we identifed 9 and 15 proteins differentially expressed with silencing of RhoGDIα in MCF-7 and the MDA-MB-231 cells, respectively. In addition, 10 proteins were differentially expressed in the upregulation of RhoGDIα in MCF7, while only one protein was identified in the upregulation of RhoGDIα in MDA-MB-231. Based on the biological functions of these proteins, the results revealed that proteins involved in cell migration are more strongly altered with RhoGDI-α activity. Although several of these proteins have been previously indicated in tumorigenesis and invasiveness of breast cancer cells, some ohave not been previously reported to be involved in breast cancer migration. Hence, these proteins may serve as useful candidate biomarkers for tumorigenesis and invasiveness of breast cancer cells. Future studies are needed to determine the mechanisms by which these proteins regulate cell migration. The combination of RhoGDIα with other potential biomarkers may be a more promising approach in the inhibition of breast cancer cell migration.

  8. Promoter hypermethylation of KLF4 inactivates its tumor suppressor function in cervical carcinogenesis.

    Directory of Open Access Journals (Sweden)

    Wen-Ting Yang

    Full Text Available OBJECTIVE: The KLF4 gene has been shown to be inactivated in cervical carcinogenesis as a tumor suppressor. However, the mechanism of KLF4 silencing in cervical carcinomas has not yet been identified. DNA methylation plays a key role in stable suppression of gene expression. METHODS: The methylation status of the KLF4 promoter CpG islands was analyzed by bisulfite sequencing (BSQ in tissues of normal cervix and cervical cancer. KLF4 gene expression was detected by RT-PCR, immunohistochemistry and western blot. KLF4 promoter methylation in cervical cancer cell line was determined by BSQ and methylation-specific polymerase chain reaction (MS-PCR. Cell proliferation ability was detected by cell growth curve and MTT assay. RESULTS: The methylated allele was found in 41.90% of 24 cervical cancer tissues but only in 11.11% of 11 normal cervix tissues (P<0.005. KLF4 mRNA levels were significantly reduced in cervical cancer tissues compared with normal cervix tissues (P<0.01 and KLF4 mRNA expression showed a significant negative correlation with the promoter hypermethylation (r = -0.486, P = 0.003. Cervical cancer cell lines also showed a significant negative correlation between KLF4 expression and hypermethylation. After treatment with the demethylating agent 5-Azacytidine (5-Aza, the expression of KLF4 in the cervical cancer cell lines at both mRNA and protein levels was drastically increased, the cell proliferation ability was inhibited and the chemosensitivity for cisplatin was significantly increased. CONCLUSION: KLF4 gene is inactivated by methylation-induced silencing mechanisms in a large subset of cervical carcinomas and KLF4 promoter hypermethylation inactivates the gene's function as a tumor suppressor in cervical carcinogenesis.

  9. Cul8/Rtt101 Forms a Variety of Protein Complexes That Regulate DNA Damage Response and Transcriptional Silencing*

    OpenAIRE

    Mimura, Satoru; Yamaguchi, Tsuyoshi; Ishii, Satoru; Noro, Emiko; Katsura, Tomoya; Obuse, Chikashi; Kamura, Takumi

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, has three cullin proteins, which act as platforms for Cullin-based E3 ubiquitin ligases. Genetic evidence indicates that Cul8, together with Mms1, Mms22, and Esc4, is involved in the repair of DNA damage that can occur during DNA replication. Cul8 is thought to form a complex with these proteins, but the composition and the function of Cul8-based E3 ubiquitin ligases remain largely uncharacterized. Herein, we report a comprehensive biochemical anal...

  10. APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.

    Directory of Open Access Journals (Sweden)

    Katia Marrocco

    Full Text Available Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized.In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed.Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.

  11. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  12. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    Science.gov (United States)

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  13. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  15. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  16. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  17. Measurand transient signal suppressor

    Science.gov (United States)

    Bozeman, Richard J., Jr. (Inventor)

    1994-01-01

    A transient signal suppressor for use in a controls system which is adapted to respond to a change in a physical parameter whenever it crosses a predetermined threshold value in a selected direction of increasing or decreasing values with respect to the threshold value and is sustained for a selected discrete time interval is presented. The suppressor includes a sensor transducer for sensing the physical parameter and generating an electrical input signal whenever the sensed physical parameter crosses the threshold level in the selected direction. A manually operated switch is provided for adapting the suppressor to produce an output drive signal whenever the physical parameter crosses the threshold value in the selected direction of increasing or decreasing values. A time delay circuit is selectively adjustable for suppressing the transducer input signal for a preselected one of a plurality of available discrete suppression time and producing an output signal only if the input signal is sustained for a time greater than the selected suppression time. An electronic gate is coupled to receive the transducer input signal and the timer output signal and produce an output drive signal for energizing a control relay whenever the transducer input is a non-transient signal which is sustained beyond the selected time interval.

  18. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  19. Suppressor of Cytokine Signaling (SOCS 5 utilises distinct domains for regulation of JAK1 and interaction with the adaptor protein Shc-1.

    Directory of Open Access Journals (Sweden)

    Edmond M Linossi

    Full Text Available Suppressor of Cytokine Signaling (SOCS5 is thought to act as a tumour suppressor through negative regulation of JAK/STAT and epidermal growth factor (EGF signaling. However, the mechanism/s by which SOCS5 acts on these two distinct pathways is unclear. We show for the first time that SOCS5 can interact directly with JAK via a unique, conserved region in its N-terminus, which we have termed the JAK interaction region (JIR. Co-expression of SOCS5 was able to specifically reduce JAK1 and JAK2 (but not JAK3 or TYK2 autophosphorylation and this function required both the conserved JIR and additional sequences within the long SOCS5 N-terminal region. We further demonstrate that SOCS5 can directly inhibit JAK1 kinase activity, although its mechanism of action appears distinct from that of SOCS1 and SOCS3. In addition, we identify phosphoTyr317 in Shc-1 as a high-affinity substrate for the SOCS5-SH2 domain and suggest that SOCS5 may negatively regulate EGF and growth factor-driven Shc-1 signaling by binding to this site. These findings suggest that different domains in SOCS5 contribute to two distinct mechanisms for regulation of cytokine and growth factor signaling.

  20. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  1. DA-Raf, a dominant-negative antagonist of the Ras-ERK pathway, is a putative tumor suppressor.

    Science.gov (United States)

    Kanno, Emiri; Kawasaki, Osamu; Takahashi, Kazuya; Takano, Kazunori; Endo, Takeshi

    2018-01-01

    Activating mutations of RAS genes, particularly KRAS, are detected with high frequency in human tumors. Mutated Ras proteins constitutively activate the ERK pathway (Raf-MEK-ERK phosphorylation cascade), leading to cellular transformation and tumorigenesis. DA-Raf1 (DA-Raf) is a splicing variant of A-Raf and contains the Ras-binding domain (RBD) but lacks the kinase domain. Accordingly, DA-Raf antagonizes the Ras-ERK pathway in a dominant-negative fashion and suppresses constitutively activated K-Ras-induced cellular transformation. Thus, we have addressed whether DA-Raf serves as a tumor suppressor of Ras-induced tumorigenesis. DA-Raf(R52Q), which is generated from a single nucleotide polymorphism (SNP) in the RBD, and DA-Raf(R52W), a mutant detected in a lung cancer, neither bound to active K-Ras nor interfered with the activation of the ERK pathway. They were incapable of suppressing activated K-Ras-induced cellular transformation and tumorigenesis in mice, in which K-Ras-transformed cells were transplanted. Furthermore, although DA-Raf was highly expressed in lung alveolar epithelial type 2 (AE2) cells, its expression was silenced in AE2-derived lung adenocarcinoma cell lines with oncogenic KRAS mutations. These results suggest that DA-Raf represents a tumor suppressor protein against Ras-induced tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

    Science.gov (United States)

    Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

    2014-12-01

    RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Julia Brun

    Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

  4. Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.

    Science.gov (United States)

    McCracken, Allen; Locke, John

    2016-08-01

    In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype.

  5. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  6. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  7. Silencing of the Mitogen-Activated Protein Kinases (MAPK) Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants.

    Science.gov (United States)

    Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena

    2018-01-01

    Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

  8. Silencing of the Mitogen-Activated Protein Kinases (MAPK Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants

    Directory of Open Access Journals (Sweden)

    Francis Onyilo

    2018-03-01

    Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

  9. The interferon-induced antiviral protein PML (TRIM19) promotes the restriction and transcriptional silencing of lentiviruses in a context-specific, isoform-specific fashion.

    Science.gov (United States)

    Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel

    2016-03-22

    The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has

  10. Suppressor Analysis of the Fusogenic Lambda Spanins.

    Science.gov (United States)

    Cahill, Jesse; Rajaure, Manoj; Holt, Ashley; Moreland, Russell; O'Leary, Chandler; Kulkarni, Aneesha; Sloan, Jordan; Young, Ry

    2017-07-15

    The final step of lysis in phage λ infections of Escherichia coli is mediated by the spanins Rz and Rz1. These proteins form a complex that bridges the cell envelope and that has been proposed to cause fusion of the inner and outer membranes. Accordingly, mutations that block spanin function are found within coiled-coil domains and the proline-rich region, motifs essential in other fusion systems. To gain insight into spanin function, pseudorevertant alleles that restored plaque formation for lysis-defective mutants of Rz and Rz1 were selected. Most second-site suppressors clustered within a coiled-coil domain of Rz near the outer leaflet of the cytoplasmic membrane and were not allele specific. Suppressors largely encoded polar insertions within the hydrophobic core of the coiled-coil interface. Such suppressor changes resulted in decreased proteolytic stability of the Rz double mutants in vivo Unlike the wild type, in which lysis occurs while the cells retain a rod shape, revertant alleles with second-site suppressor mutations supported lysis events that were preceded by spherical cell formation. This suggests that destabilization of the membrane-proximal coiled coil restores function for defective spanin alleles by increasing the conformational freedom of the complex at the cost of its normal, all-or-nothing functionality. IMPORTANCE Caudovirales encode cell envelope-spanning proteins called spanins, which are thought to fuse the inner and outer membranes during phage lysis. Recent genetic analysis identified the functional domains of the lambda spanins, which are similar to class I viral fusion proteins. While the pre- and postfusion structures of model fusion systems have been well characterized, the intermediate structure(s) formed during the fusion reaction remains elusive. Genetic analysis would be expected to identify functional connections between intermediates. Since most membrane fusion systems are not genetically tractable, only few such

  11. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  12. TYLCV-Is movement in planta does not require V2 protein

    Energy Technology Data Exchange (ETDEWEB)

    Hak, Hagit [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Levy, Yael; Chandran, Sam A.; Belausov, Eduard [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Loyter, Abraham [Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Lapidot, Moshe [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Gafni, Yedidya, E-mail: ygafni@volcani.agri.gov.il [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel)

    2015-03-15

    Tomato yellow leaf curl virus (TYLCV), a major tomato pathogen causing extensive crop losses, is a whitefly-transmitted geminivirus. V2 mutants of TYLCV-Is and related viruses tend to induce symptomless infection with attenuated viral DNA levels, while accumulating close to wild-type DNA levels in protoplasts, suggesting V2 as a movement protein. The discovery of plant-silencing mechanisms and viral silencing suppressors, V2 included, led us to reconsider V2's involvement in viral movement. We studied two mutant versions of the virus, one impaired in V2 silencing-suppression activity, and another carrying a non-translatable V2. While both mutant viruses spread in the infected plant to newly emerged leaves at the same rate as the wild-type virus, their DNA-accumulation levels were tenfold lower than in the wild-type virus. Thus, we suggest that the setback in virus proliferation, previously ascribed to a movement impediment, is due to lack of silencing-suppression activity. - Highlights: • TYLCV-Is V2 protein is localized in distinct microbodies throughout the cell cytoplasm, around the nucleus and in association with cytoplasmic strands but is not associated with the plasmodesmata. • Disruption of RNA-silencing suppression activity of TYLCV-Is V2 protein causes low titer of the virus in the infected plants. • The movement of TYLCV-Is in planta does not require a functional V2 protein.

  13. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  14. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  15. The Ras suppressor Rsu-1 binds to the LIM 5 domain of the adaptor protein PINCH1 and participates in adhesion-related functions

    International Nuclear Information System (INIS)

    Dougherty, Gerard W.; Chopp, Treasa; Qi Shengmei; Cutler, Mary Lou

    2005-01-01

    Rsu-1 is a highly conserved leucine rich repeat (LRR) protein that is expressed ubiquitously in mammalian cells. Rsu-1 was identified based on its ability to inhibit transformation by Ras, and previous studies demonstrated that ectopic expression of Rsu-1 inhibited anchorage-independent growth of Ras-transformed cells and human tumor cell lines. Using GAL4-based yeast two-hybrid screening, the LIM domain protein, PINCH1, was identified as the binding partner of Rsu-1. PINCH1 is an adaptor protein that localizes to focal adhesions and it has been implicated in the regulation of adhesion functions. Subdomain mapping in yeast revealed that Rsu-1 binds to the LIM 5 domain of PINCH1, a region not previously identified as a specific binding domain for any other protein. Additional testing demonstrated that PINCH2, which is highly homologous to PINCH1, except in the LIM 5 domain, does not interact with Rsu-1. Glutathione transferase fusion protein binding studies determined that the LRR region of Rsu-1 interacts with PINCH1. Transient expression studies using epitope-tagged Rsu-1 and PINCH1 revealed that Rsu-1 co-immunoprecipitated with PINCH1 and colocalized with vinculin at sites of focal adhesions in mammalian cells. In addition, endogenous P33 Rsu-1 from 293T cells co-immunoprecipitated with transiently expressed myc-tagged PINCH1. Furthermore, RNAi-induced reduction in Rsu-1 RNA and protein inhibited cell attachment, and while previous studies demonstrated that ectopic expression of Rsu-1 inhibited Jun kinase activation, the depletion of Rsu-1 resulted in activation of Jun and p38 stress kinases. These studies demonstrate that Rsu-1 interacts with PINCH1 in mammalian cells and functions, in part, by altering cell adhesion

  16. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

    Science.gov (United States)

    Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

    2015-03-01

    The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

  17. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  18. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  19. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  20. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  1. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  2. Expression of the calcium-binding proteins MRP8 and MRP14 in monocytes is regulated by a calcium-induced suppressor mechanism.

    OpenAIRE

    Roth, J; Goebeler, M; Wrocklage, V; van den Bos, C; Sorg, C

    1994-01-01

    MRP8 and MRP14 are two calcium-binding proteins of the S-100 family the expression of which is restricted to distinct stages of monocytic differentiation. Heteromeric MRP8/MRP14 complexes have been shown to represent their biologically active forms. However, it is not as yet clear whether biochemical modification of complexes, or regulation on the transcriptional level, are responsible for the control of MRP8/MRP14 expression. Employing Western-blot analysis and metabolic labelling we have de...

  3. Proinflammatory cytokines and bile acids upregulate ΔNp73 protein, an inhibitor of p53 and p73 tumor suppressors.

    Directory of Open Access Journals (Sweden)

    Elena Zaika

    Full Text Available Gastroesophageal reflux disease (GERD is the main etiological factor behind the recent rapid increase in the incidence of esophageal adenocarcinoma. During reflux, esophageal cells are exposed to bile at low pH resulting in cellular damage and inflammation, which are known to facilitate cancer development. In this study, we investigated the regulation of p73 isoform, ΔNp73α, in the reflux condition. Previous studies have reported that ΔNp73 exhibits anti-apoptotic and oncogenic properties through inhibition of p53 and p73 proteins. We found that direct exposure of esophageal cells to bile acids in an acidic environment alters the phosphorylation of ΔNp73, its subcellular localization and increases ΔNp73 protein levels. Upregulation of ΔNp73 was also observed in esophageal tissues collected from patients with GERD and Barrett's metaplasia, a precancerous lesion in the esophagus associated with gastric reflux. c-Abl, p38 MAPK, and IKK protein kinases were identified to interact in the regulation of ΔNp73. Their inhibition with chemotherapeutic agents and siRNA suppresses ΔNp73. We also found that pro-inflammatory cytokines, IL-1β and TNFα, are potent inducers of ΔNp73α, which further enhance the bile acids/acid effect. Combined, our studies provide evidence that gastroesophageal reflux alters the regulation of oncogenic ΔNp73 isoform that may facilitate tumorigenic transformation of esophageal metaplastic epithelium.

  4. Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

    Directory of Open Access Journals (Sweden)

    Laura Mejía-Teniente

    2015-11-01

    Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  5. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

    Science.gov (United States)

    Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

    2015-11-25

    Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  6. Saponin Inhibits Hepatitis C Virus Propagation by Up-regulating Suppressor of Cytokine Signaling 2

    Science.gov (United States)

    Kang, Sang-Min; Min, Saehong; Son, Kidong; Lee, Han Sol; Park, Eun Mee; Ngo, Huong T. T.; Tran, Huong T. L.; Lim, Yun-Sook; Hwang, Soon B.

    2012-01-01

    Saponins are a group of naturally occurring plant glycosides which possess a wide range of pharmacological properties, including anti-tumorigenic and antiviral activities. To investigate whether saponin has anti-hepatitis C virus (HCV) activity, we examined the effect of saponin on HCV replication. HCV replication was efficiently inhibited at a concentration of 10 µg/ml of saponin in cell culture grown HCV (HCVcc)-infected cells. Inhibitory effect of saponin on HCV replication was verified by quantitative real-time PCR, reporter assay, and immunoblot analysis. In addition, saponin potentiated IFN-α-induced anti-HCV activity. Moreover, saponin exerted antiviral activity even in IFN-α resistant mutant HCVcc-infected cells. To investigate how cellular genes were regulated by saponin, we performed microarray analysis using HCVcc-infected cells. We demonstrated that suppressor of cytokine signaling 2 (SOCS2) protein level was distinctively increased by saponin, which in turn resulted in inhibition of HCV replication. We further showed that silencing of SOCS2 resurrected HCV replication and overexpression of SOCS2 suppressed HCV replication. These data imply that saponin inhibits HCV replication via SOCS2 signaling pathway. These findings suggest that saponin may be a potent therapeutic agent for HCV patients. PMID:22745742

  7. miR-199a-3p displays tumor suppressor functions in papillary thyroid carcinoma.

    Science.gov (United States)

    Minna, Emanuela; Romeo, Paola; De Cecco, Loris; Dugo, Matteo; Cassinelli, Giuliana; Pilotti, Silvana; Degl'Innocenti, Debora; Lanzi, Cinzia; Casalini, Patrizia; Pierotti, Marco A; Greco, Angela; Borrello, Maria Grazia

    2014-05-15

    Thyroid cancer incidence is rapidly increasing. Papillary Thyroid Carcinoma (PTC), the most frequent hystotype, usually displays good prognosis, but no effective therapeutic options are available for the fraction of progressive PTC patients. BRAF and RET/PTC are the most frequent driving genetic lesions identified in PTC. We developed two complementary in vitro models based on RET/PTC1 oncogene, starting from the hypothesis that miRNAs modulated by a driving PTC-oncogene are likely to have a role in thyroid neoplastic processes. Through this strategy, we identified a panel of deregulated miRNAs. Among these we focused on miR-199a-3p and showed its under-expression in PTC specimens and cell lines. We demonstrated that miR-199a-3p restoration in PTC cells reduces MET and mTOR protein levels, impairs migration and proliferation and, more interesting, induces lethality through an unusual form of cell death similar to methuosis, caused by macropinocytosis dysregulation. Silencing MET or mTOR, both involved in survival pathways, does not recapitulate miR-199a-3p-induced cell lethality, thus suggesting that the cooperative regulation of multiple gene targets is necessary. Integrated analysis of miR-199a-3p targets unveils interesting networks including HGF and macropinocytosis pathways. Overall our results indicate miR-199a-3p as a tumor suppressor miRNA in PTC.

  8. Avian Reovirus Protein p17 Functions as a Nucleoporin Tpr Suppressor Leading to Activation of p53, p21 and PTEN and Inactivation of PI3K/AKT/mTOR and ERK Signaling Pathways.

    Directory of Open Access Journals (Sweden)

    Wei-Ru Huang

    Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.

  9. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  10. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  11. TGF-β induces the expression of Nedd4 family-interacting protein 1 (Ndfip1) to silence IL-4 production during iTreg cell differentiation

    Science.gov (United States)

    Beal, Allison M.; Ramos-Hernández, Natalia; Riling, Chris R.; Nowelsky, Erin A.; Oliver, Paula M.

    2011-01-01

    Mice deficient for the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that these animals contain fewer inducible regulatory (iTreg) cells. In vitro, Ndfip1-deficient T cells express normal levels of the transcription factor Foxp3 during the first 48 hours of iTreg cell differentiation, however this cannot be sustained. Abortive Foxp3 expression is because Ndfip1–/– cells produce interleukin 4 (IL-4). We demonstrate that Ndfip1 is transiently unregulated during iTreg cell differentiation in a transforming growth factor-β (TGF-β) dependent manner. Once expressed Ndfip1 promotes Itch-mediated degradation of the transcription factor JunB, thus preventing IL-4 production. Based on these data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iTreg cell differentiation. PMID:22080920

  12. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  13. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  15. Cell-cycle and suppressor proteins expression in uterine cervix in HIV/HPV co-infection: comparative study by tissue micro-array (TMA)

    International Nuclear Information System (INIS)

    Nicol, Alcina F; Pirmez, Claude; Pires, Andréa Rodrigues Cordovil; Souza, Simone R de; Nuovo, Gerard J; Grinsztejn, Beatriz; Tristão, Aparecida; Russomano, Fabio B; Velasque, Luciane; Silva, José R Lapa e

    2008-01-01

    The oncoproteins of human papillomavirus (HPVs) directly effect cell-cycle control. We hypothesize that regulatory and cell cycle protein expression might be additionally modified in the cervix of HIV/HPV co-infected women. We analyzed the expression of Rb, p27, VEGF and Elf-1 transcriptor factor by immunohistochemistry in 163 paraffin-embeded cervical samples using Tissue Micro-Array (TMA) and correlated this to HIV-1 and HPV infection. HIV/HPV co-infection was associated with a significant increase in expression (p < 0.001) of VEGF and p27 in both low and high grade CIN when compared to the cervices of women infected by HPV alone. Decreased Rb expression was evident with increased CIN grade in the cervices of women infected with HPV alone (p = 0.003 average of cells/mm 2 in CIN I: 17.9, CIN II/III: 4.8, and tumor 3.9). Rb expression increased 3-fold for both low and high grade CIN with HPV/HIV-1 co-infection compared to HPV infection alone but did not reach statistical significance. There was a significant increase in Elf-1 expression in HPV+/HIV- women with CIN II/III and tumor (average of cells/mm 2 in CIN I: 63.8; CIN II/III: 115.7 and tumor: 112.0, p = 0.005), in comparison to controls. Co-infection of HPV and HIV leads to significant increase in the VEGF and p27 expression when compared to HPV+/HIV-negative infection that could facilitate viral persistence and invasive tumor development

  16. Cell-cycle and suppressor proteins expression in uterine cervix in HIV/HPV co-infection: comparative study by tissue micro-array (TMA).

    Science.gov (United States)

    Nicol, Alcina F; Pires, Andréa Rodrigues Cordovil; de Souza, Simone R; Nuovo, Gerard J; Grinsztejn, Beatriz; Tristão, Aparecida; Russomano, Fabio B; Velasque, Luciane; Lapa e Silva, José R; Pirmez, Claude

    2008-10-07

    The oncoproteins of human papillomavirus (HPVs) directly effect cell-cycle control. We hypothesize that regulatory and cell cycle protein expression might be additionally modified in the cervix of HIV/HPV co-infected women. We analyzed the expression of Rb, p27, VEGF and Elf-1 transcriptor factor by immunohistochemistry in 163 paraffin-embeded cervical samples using Tissue Micro-Array (TMA) and correlated this to HIV-1 and HPV infection. HIV/HPV co-infection was associated with a significant increase in expression (p < 0.001) of VEGF and p27 in both low and high grade CIN when compared to the cervices of women infected by HPV alone. Decreased Rb expression was evident with increased CIN grade in the cervices of women infected with HPV alone (p = 0.003 average of cells/mm2 in CIN I: 17.9, CIN II/III: 4.8, and tumor 3.9). Rb expression increased 3-fold for both low and high grade CIN with HPV/HIV-1 co-infection compared to HPV infection alone but did not reach statistical significance. There was a significant increase in Elf-1 expression in HPV+/HIV- women with CIN II/III and tumor (average of cells/mm2 in CIN I: 63.8; CIN II/III: 115.7 and tumor: 112.0, p = 0.005), in comparison to controls. Co-infection of HPV and HIV leads to significant increase in the VEGF and p27 expression when compared to HPV+/HIV-negative infection that could facilitate viral persistence and invasive tumor development.

  17. Extracellular signal-regulated kinase 2 (ERK-2) mediated phosphorylation regulates nucleo-cytoplasmic shuttling and cell growth control of Ras-associated tumor suppressor protein, RASSF2

    International Nuclear Information System (INIS)

    Kumari, Gita; Mahalingam, S.

    2009-01-01

    Ras GTPase controls the normal cell growth through binding with an array of effector molecules, such as Raf and PI3-kinase in a GTP-dependent manner. RASSF2, a member of the Ras association domain family, is known to be involved in the suppression of cell growth and is frequently down-regulated in various tumor tissues by promoter hypermethylation. In the present study, we demonstrate that RASSF2 shuttles between nucleus and cytoplasm by a signal-mediated process and its export from the nucleus is sensitive to leptomycin B. Amino acids between 240 to 260 in the C-terminus of RASSF2 harbor a functional nuclear export signal (NES), which is necessary and sufficient for efficient export of RASSF2 from the nucleus. Substitution of conserved Ile254, Val257 and Leu259 within the minimal NES impaired RASSF2 export from the nucleus. In addition, wild type but not the nuclear export defective RASSF2 mutant interacts with export receptor, CRM-1 and exported from the nucleus. Surprisingly, we observed nucleolar localization for the nuclear export defective mutant suggesting the possibility that RASSF2 may localize in different cellular compartments transiently in a cell cycle dependent manner and the observed nuclear localization for wild type protein may be due to faster export kinetics from the nucleolus. Furthermore, our data suggest that RASSF2 is specifically phosphorylated by MAPK/ERK-2 and the inhibitors of MAPK pathway impair the phosphorylation and subsequently block the export of RASSF2 from the nucleus. These data clearly suggest that ERK-2 mediated phosphorylation plays an important role in regulating the nucleo-cytoplasmic shuttling of RASSF2. Interestingly, nuclear import defective mutant of RASSF2 failed to induce cell cycle arrest at G1/S phase and apoptosis suggesting that RASSF2 regulates cell growth in a nuclear localization dependent manner. Collectively, these data provided evidence for the first time that MAPK/ERK-2 mediated phosphorylation regulates

  18. Extracellular signal-regulated kinase 2 (ERK-2) mediated phosphorylation regulates nucleo-cytoplasmic shuttling and cell growth control of Ras-associated tumor suppressor protein, RASSF2

    Energy Technology Data Exchange (ETDEWEB)

    Kumari, Gita [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Mahalingam, S., E-mail: mahalingam@iitm.ac.in [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Department of Biotechnology, Laboratory of Molecular Virology and Cell Biology, Indian Institute of Technology-Madras, Chennai 600 036 (India)

    2009-10-01

    Ras GTPase controls the normal cell growth through binding with an array of effector molecules, such as Raf and PI3-kinase in a GTP-dependent manner. RASSF2, a member of the Ras association domain family, is known to be involved in the suppression of cell growth and is frequently down-regulated in various tumor tissues by promoter hypermethylation. In the present study, we demonstrate that RASSF2 shuttles between nucleus and cytoplasm by a signal-mediated process and its export from the nucleus is sensitive to leptomycin B. Amino acids between 240 to 260 in the C-terminus of RASSF2 harbor a functional nuclear export signal (NES), which is necessary and sufficient for efficient export of RASSF2 from the nucleus. Substitution of conserved Ile254, Val257 and Leu259 within the minimal NES impaired RASSF2 export from the nucleus. In addition, wild type but not the nuclear export defective RASSF2 mutant interacts with export receptor, CRM-1 and exported from the nucleus. Surprisingly, we observed nucleolar localization for the nuclear export defective mutant suggesting the possibility that RASSF2 may localize in different cellular compartments transiently in a cell cycle dependent manner and the observed nuclear localization for wild type protein may be due to faster export kinetics from the nucleolus. Furthermore, our data suggest that RASSF2 is specifically phosphorylated by MAPK/ERK-2 and the inhibitors of MAPK pathway impair the phosphorylation and subsequently block the export of RASSF2 from the nucleus. These data clearly suggest that ERK-2 mediated phosphorylation plays an important role in regulating the nucleo-cytoplasmic shuttling of RASSF2. Interestingly, nuclear import defective mutant of RASSF2 failed to induce cell cycle arrest at G1/S phase and apoptosis suggesting that RASSF2 regulates cell growth in a nuclear localization dependent manner. Collectively, these data provided evidence for the first time that MAPK/ERK-2 mediated phosphorylation regulates

  19. ADAMTS9 is Silenced by Epigenetic Disruption in Colorectal Cancer and Inhibits Cell Growth and Metastasis by Regulating Akt/p53 Signaling

    Directory of Open Access Journals (Sweden)

    Ling Chen

    2017-11-01

    Full Text Available Background/Aims: ADAMTS (disintegrin-like and metalloproteinase with thrombospondin motifs proteins are extracellular zinc metalloproteinases that play an important role in extracellular matrix assembly and degradation, connective tissue structuring, angiogenesis, and cell migration. Multiple studies suggest that ADAMTS proteins (e.g. ADAMTS9 can act as tumor suppressors. In gastric, esophageal, and nasopharyngeal carcinomas ADAMTS9 is frequently down-regulated by promoter methylation. Whether ADAMTS9 can function as a tumor suppressor gene (TSG in colorectal cancer is still unclear. Methods: We performed immunohistochemistry, RT-PCR, and qRT-PCR, to examine the expression of ADAMTS9 in colorectal cancer cell lines and primary colorectal cancer tissues. Methylation-specific PCR was also carried out to investigate the promoter methylation status of ADAMTS9. We also explored the functions of ADAMTS9 in colorectal cancer cell lines through in vitro experiments. Results: ADAMTS9 expression was down-requlated or silenced in 83.3% (5/6 of colorectal cancer cell lines, and frequently repressed in 65.6% (21/32 of colorectal cancer tissues. Down-regulation of ADAMTS9 was partially due to promoter methylation. Exogenous expression of ADAMTS9 in colorectal cancer cell lines inhibited cell proliferation and migration through the regulation of cell cycle and apoptosis. In addition, ADAMTS9 prevented the activation of Akt, and its downstream targets in colorectal cancer cell lines. Conclusion: Our findings suggest ADAMTS9 is a TSG in colorectal cancer.

  20. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  1. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  2. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  3. Inhibition of adipose triglyceride lipase (ATGL) by the putative tumor suppressor G0S2 or a small molecule inhibitor attenuates the growth of cancer cells.

    Science.gov (United States)

    Zagani, Rachid; El-Assaad, Wissal; Gamache, Isabelle; Teodoro, Jose G

    2015-09-29

    The G0/G1 switch gene 2 (G0S2) is methylated and silenced in a wide range of human cancers. The protein encoded by G0S2 is an endogenous inhibitor of lipid catabolism that directly binds adipose triglyceride lipase (ATGL). ATGL is the rate-limiting step in triglyceride metabolism. Although the G0S2 gene is silenced in cancer, the impact of ATGL in the growth and survival of cancer cells has never been addressed. Here we show that ectopic expression of G0S2 in non-small cell lung carcinomas (NSCL) inhibits triglyceride catabolism and results in lower cell growth. Similarly, knockdown of ATGL increased triglyceride levels, attenuated cell growth and promoted apoptosis. Conversely, knockdown of endogenous G0S2 enhanced the growth and invasiveness of cancer cells. G0S2 is strongly induced in acute promyelocytic leukemia (APL) cells in response to all trans retinoic acid (ATRA) and we show that inhibition of ATGL in these cells by G0S2 is required for efficacy of ATRA treatment. Our data uncover a novel tumor suppressor mechanism by which G0S2 directly inhibits activity of a key intracellular lipase. Our results suggest that elevated ATGL activity may be a general property of many cancer types and potentially represents a novel target for chemotherapy.

  4. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  5. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  6. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  7. The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate

    International Nuclear Information System (INIS)

    Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L

    2013-01-01

    Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress

  8. Structural and thermodynamic studies of the tobacco calmodulin-like rgs-CaM protein.

    Science.gov (United States)

    Makiyama, Rodrigo K; Fernandes, Carlos A H; Dreyer, Thiago R; Moda, Bruno S; Matioli, Fabio F; Fontes, Marcos R M; Maia, Ivan G

    2016-11-01

    The tobacco calmodulin-like protein rgs-CaM is involved in host defense against virus and is reported to possess an associated RNA silencing suppressor activity. Rgs-CaM is also believed to act as an antiviral factor by interacting and targeting viral silencing suppressors for autophagic degradation. Despite these functional data, calcium interplay in the modulation of rgs-CaM is still poorly understood. Here we show that rgs-CaM displays a prevalent alpha-helical conformation and possesses three functional Ca 2+ -binding sites. Using computational modeling and molecular dynamics simulation, we demonstrate that Ca 2+ binding to rgs-CaM triggers expansion of its tertiary structure with reorientation of alpha-helices within the EF-hands. This conformational change leads to the exposure of a large negatively charged region that may be implicated in the electrostatic interactions between rgs-CaM and viral suppressors. Moreover, the k d values obtained for Ca 2+ binding to the three functional sites are not within the affinity range of a typical Ca 2+ sensor. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Induction of specific suppressor T cells in vitro

    International Nuclear Information System (INIS)

    Eardley, D.D.; Gershon, R.K.

    1976-01-01

    We describe conditions for generating sheep red blood cell-specific suppressor T cells in Mishell-Dutton cultures. The production of specific suppressor cells is favored by increasing antigen dose in the initial culture but can be produced by transferring more cells when lower doses of antigen are used. Transfer of small numbers of cells cultured with low doses of antigen leads to a specific helper effect. Transfer of large numbers of educated cells leads to nonspecific suppression. Suppression can be effected by the effluent cells from nylon wool columns which do not make detectable PFC. A fraction of these cells become resistant to treatment with anti-T cell sera and complement after culture. The suppressor cells are radiation sensitive and must be able to synthesize protein to suppress. They take 2 to 3 days of education to reach maximum suppressive efficiency and will not suppress cultures if added 2 to 3 days after culture initiation. Their production is favored by the absence of mercaptoethanol, suggesting that the observed suppression is not ''too much help.'' The ability to generate specific suppressor cells in vitro should be of great benefit in determining the factors that regulate their appearance in vivo

  10. Silencing of Anticoagulant Protein C Evokes Low-Incident but Spontaneous Atherothrombosis in Apolipoprotein E-Deficient Mice-Brief Report

    NARCIS (Netherlands)

    Ouweneel, Amber B.; Heestermans, Marco; Verwilligen, Robin A. F.; Gijbels, Marion J. J.; Reitsma, Pieter H.; van Eck, Miranda; van Vlijmen, Bart J. M.

    2017-01-01

    Murine atherosclerosis models do not spontaneously develop atherothrombotic complications. We investigated whether disruption of natural anticoagulation allows preexisting atherosclerotic plaques to progress toward an atherothrombotic phenotype. On lowering of plasma protein C levels with small

  11. Rtt107/Esc4 binds silent chromatin and DNA repair proteins using different BRCT motifs

    Directory of Open Access Journals (Sweden)

    Jockusch Rebecca A

    2006-11-01

    Full Text Available Abstract Background By screening a plasmid library for proteins that could cause silencing when targeted to the HMR locus in Saccharomyces cerevisiae, we previously reported the identification of Rtt107/Esc4 based on its ability to establish silent chromatin. In this study we aimed to determine the mechanism of Rtt107/Esc4 targeted silencing and also learn more about its biological functions. Results Targeted silencing by Rtt107/Esc4 was dependent on the SIR genes, which encode obligatory structural and enzymatic components of yeast silent chromatin. Based on its sequence, Rtt107/Esc4 was predicted to contain six BRCT motifs. This motif, originally identified in the human breast tumor suppressor gene BRCA1, is a protein interaction domain. The targeted silencing activity of Rtt107/Esc4 resided within the C-terminal two BRCT motifs, and this region of the protein bound to Sir3 in two-hybrid tests. Deletion of RTT107/ESC4 caused sensitivity to the DNA damaging agent MMS as well as to hydroxyurea. A two-hybrid screen showed that the N-terminal BRCT motifs of Rtt107/Esc4 bound to Slx4, a protein previously shown to be involved in DNA repair and required for viability in a strain lacking the DNA helicase Sgs1. Like SLX genes, RTT107ESC4 interacted genetically with SGS1; esc4Δ sgs1Δ mutants were viable, but exhibited a slow-growth phenotype and also a synergistic DNA repair defect. Conclusion Rtt107/Esc4 binds to the silencing protein Sir3 and the DNA repair protein Slx4 via different BRCT motifs, thus providing a bridge linking silent chromatin to DNA repair enzymes.

  12. Lithium-induced neuroprotection in stroke involves increased miR-124 expression, reduced RE1-silencing transcription factor abundance and decreased protein deubiquitination by GSK3β inhibition-independent pathways.

    Science.gov (United States)

    Doeppner, Thorsten R; Kaltwasser, Britta; Sanchez-Mendoza, Eduardo H; Caglayan, Ahmet B; Bähr, Mathias; Hermann, Dirk M

    2017-03-01

    Lithium promotes acute poststroke neuronal survival, which includes mechanisms that are not limited to GSK3β inhibition. However, whether lithium induces long-term neuroprotection and enhanced brain remodeling is unclear. Therefore, mice were exposed to transient middle cerebral artery occlusion and lithium (1 mg/kg bolus followed by 2 mg/kg/day over up to 7 days) was intraperitoneally administered starting 0-9 h after reperfusion onset. Delivery of lithium no later than 6 h reduced infarct volume on day 2 and decreased brain edema, leukocyte infiltration, and microglial activation, as shown by histochemistry and flow cytometry. Lithium-induced neuroprotection persisted throughout the observation period of 56 days and was associated with enhanced neurological recovery. Poststroke angioneurogenesis and axonal plasticity were also enhanced by lithium. On the molecular level, lithium increased miR-124 expression, reduced RE1-silencing transcription factor abundance, and decreased protein deubiquitination in cultivated cortical neurons exposed to oxygen-glucose deprivation and in brains of mice exposed to cerebral ischemia. Notably, this effect was not mimicked by pharmacological GSK3β inhibition. This study for the first time provides efficacy data for lithium in the postacute ischemic phase, reporting a novel mechanism of action, i.e. increased miR-124 expression facilitating REST degradation by which lithium promotes postischemic neuroplasticity and angiogenesis.

  13. Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

    DEFF Research Database (Denmark)

    Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S

    2009-01-01

    Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

  14. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  15. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  16. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  17. Suppressor Effects of Coping Strategies on Resilience

    Science.gov (United States)

    Yoon, Jae ho; Lee, Ji hae; Lee, Chae Yeon; Cho, Minhee; Lee, Sang Min

    2014-01-01

    The purpose of the current study is to demonstrate a significant suppressor effect among coping strategies on resilience. Two different samples were used to replicate the suppressor effect. Participants in the first example were 391 adolescents (middle school students) in Korea, and participants in the second example were 282 young adults…

  18. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  19. Protective Role of Hsp27 Protein Against Gamma Radiation-Induced Apoptosis and Radiosensitization Effects of Hsp27 Gene Silencing in Different Human Tumor Cells

    International Nuclear Information System (INIS)

    Aloy, Marie-Therese; Hadchity, Elie; Bionda, Clara; Diaz-Latoud, Chantal; Claude, Line; Rousson, Robert; Arrigo, Andre-Patrick; Rodriguez-Lafrasse, Claire

    2008-01-01

    Purpose: The ability of heat shock protein 27 (Hsp27) to protect cells from stressful stimuli and its increased levels in tumors resistant to anticancer therapeutics suggest that it may represent a target for sensitization to radiotherapy. In this study, we investigate the protective role of Hsp27 against radiation-induced apoptosis and the effect of its attenuation in highly expressing radioresistant cancer cell lines. Methods and Materials: We examined clonogenic death and the kinetics of apoptotic events in different tumor cell lines overexpressing or underexpressing Hsp27 protein irradiated with photons. The radiosensitive Jurkat cell line, which does not express Hsp27 constitutively or in response to γ-rays, was stably transfected with Hsp27 complementary DNA. Attenuation of Hsp27 expression was accomplished by antisense or RNAi (interfering RNA) strategies in SQ20B head-and-neck squamous carcinoma, PC3 prostate cancer, and U87 glioblastoma radioresistant cells. Results: We measured concentration-dependent protection against the cytotoxic effects of radiation in Jurkat-Hsp27 cells, which led to a 50% decrease in apoptotic cells at 48 hours in the highest expressing cells. Underlying mechanisms leading to radiation resistance involved a significant increase in glutathione levels associated with detoxification of reactive oxygen species, a delay in mitochondrial collapse, and caspase activation. Conversely, attenuation of Hsp27 in SQ20B cells, characterized by their resistance to apoptosis, sensitizes cells to irradiation. This was emphasized by increased apoptosis, decreased glutathione basal level, and clonogenic cell death. Sensitization to irradiation was confirmed in PC3 and U87 radioresistant cells. Conclusion: Hsp27 gene therapy offers a potential adjuvant to radiation-based therapy of resistant tumors

  20. The ubiquitin peptidase UCHL1 induces G0/G1 cell cycle arrest and apoptosis through stabilizing p53 and is frequently silenced in breast cancer.

    Directory of Open Access Journals (Sweden)

    Tingxiu Xiang

    Full Text Available Breast cancer (BrCa is a complex disease driven by aberrant gene alterations and environmental factors. Recent studies reveal that abnormal epigenetic gene regulation also plays an important role in its pathogenesis. Ubiquitin carboxyl- terminal esterase L1 (UCHL1 is a tumor suppressor silenced by promoter methylation in multiple cancers, but its role and alterations in breast tumorigenesis remain unclear.We found that UCHL1 was frequently downregulated or silenced in breast cancer cell lines and tumor tissues, but readily expressed in normal breast tissues and mammary epithelial cells. Promoter methylation of UCHL1 was detected in 9 of 10 breast cancer cell lines (90% and 53 of 66 (80% primary tumors, but rarely in normal breast tissues, which was statistically correlated with advanced clinical stage and progesterone receptor status. Pharmacologic demethylation reactivated UCHL1 expression along with concomitant promoter demethylation. Ectopic expression of UCHL1 significantly suppressed the colony formation and proliferation of breast tumor cells, through inducing G0/G1 cell cycle arrest and apoptosis. Subcellular localization study showed that UCHL1 increased cytoplasmic abundance of p53. We further found that UCHL1 induced p53 accumulation and reduced MDM2 protein level, and subsequently upregulated the expression of p21, as well as cleavage of caspase3 and PARP, but not in catalytic mutant UCHL1 C90S-expressed cells.UCHL1 exerts its tumor suppressive functions by inducing G0/G1cell cycle arrest and apoptosis in breast tumorigenesis, requiring its deubiquitinase activity. Its frequent silencing by promoter CpG methylation may serve as a potential tumor marker for breast cancer.

  1. Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Xiaofeng [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Liu, Fei [Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Han, Ye [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Li, Pu [Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhi, Qiaoming, E-mail: strexboy@163.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhao, Hong, E-mail: zhaohong600@sina.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China)

    2014-07-25

    Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.

  2. Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

    International Nuclear Information System (INIS)

    Xue, Xiaofeng; Liu, Fei; Han, Ye; Li, Pu; Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting; Zhi, Qiaoming; Zhao, Hong

    2014-01-01

    Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer

  3. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  4. Suppressor cells in transplantation tolerance II. Maturation of suppressor cells in the bone marrow chimera

    International Nuclear Information System (INIS)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-01-01

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods

  5. Suppressor cells in transplantation tolerance. II. maturation of suppressor cells in the bone marrow chimera

    International Nuclear Information System (INIS)

    Tutschka, P.J.; Ki, P.F.; Beschorner, W.E.; Hess, A.D.; Santos, G.W.

    1981-01-01

    Histoincompatible bone marrow allografts were established in lethally irradiated rats. At various times after transplantation, the spleen cells were harvested, subjected to mixed lymphocyte cultures, and assayed for suppressor cells in vitro and in vivo by adoptive transfer studies. Alloantigen-nonspecific suppressor cells appeared in the chimera at 40 days after grafting, coinciding with the resolution of graft-versus-host disease (GVHD). At 250 days the nonspecific suppressor cells were replaced by suppressor cells specifically suppressing donor-versus-host alloantigen responses. At 720 days suppressor cells could no longer be identified by in vitro methods but were identified by in vivo adoptive transfer of transplantation tolerance. After injection of host-type antigen into chimeras, the suppressor cells could be again demonstrated by in vitro methods

  6. Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory

    International Nuclear Information System (INIS)

    Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei

    2015-01-01

    To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of

  7. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  8. Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism

    Science.gov (United States)

    Mandriota, Stefano J.; Valentijn, Linda J.; Lesne, Laurence; Betts, David R.; Marino, Denis; Boudal-Khoshbeen, Mary; London, Wendy B.; Rougemont, Anne-Laure; Attiyeh, Edward F.; Maris, John M.; Hogarty, Michael D.; Koster, Jan; Molenaar, Jan J.; Versteeg, Rogier

    2015-01-01

    Neuroblastoma, a childhood cancer with highly heterogeneous biology and clinical behavior, is characterized by genomic aberrations including amplification of MYCN. Hemizygous deletion of chromosome 11q is a well-established, independent marker of poor prognosis. While 11q22-q23 is the most frequently deleted region, the neuroblastoma tumor suppressor in this region remains to be identified. Chromosome bands 11q22-q23 contain ATM, a cell cycle checkpoint kinase and tumor suppressor playing a pivotal role in the DNA damage response. Here, we report that haploinsufficiency of ATM in neuroblastoma correlates with lower ATM expression, event-free survival, and overall survival. ATM loss occurs in high stage neuroblastoma without MYCN amplification. In SK-N-SH, CLB-Ga and GI-ME-N human neuroblastoma cells, stable ATM silencing promotes neuroblastoma progression in soft agar assays, and in subcutaneous xenografts in nude mice. This effect is dependent on the extent of ATM silencing and does not appear to involve MYCN. Our findings identify ATM as a potential haploinsufficient neuroblastoma tumor suppressor, whose inactivation mirrors the increased aggressiveness associated with 11q deletion in neuroblastoma. PMID:26053094

  9. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    International Nuclear Information System (INIS)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan; Yang, Zhihong; Huang, Yi; Bennett, Jason; Wang, Li

    2016-01-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  10. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Yang, Zhihong [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); Huang, Yi [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Bennett, Jason [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Wang, Li, E-mail: li.wang@uconn.edu [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, CT 06520 (United States)

    2016-08-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  11. Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

    Science.gov (United States)

    Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

    2012-01-01

    Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  13. An efficient tag derived from the common epitope of tospoviral NSs proteins for monitoring recombinant proteins expressed in both bacterial and plant systems.

    Science.gov (United States)

    Cheng, Hao-Wen; Chen, Kuan-Chun; Raja, Joseph A J; Li, Jian-Xian; Yeh, Shyi-Dong

    2013-04-15

    NSscon (23 aa), a common epitope in the gene silencing suppressor NSs proteins of the members of the Watermelon silver mottle virus (WSMoV) serogroup, was previously identified. In this investigation, we expressed different green fluorescent protein (GFP)-fused deletions of NSscon in bacteria and reacted with NSscon monoclonal antibody (MAb). Our results indicated that the core 9 amino acids, "(109)KFTMHNQIF(117)", denoted as "nss", retain the reactivity of NSscon. In bacterial pET system, four different recombinant proteins labeled with nss, either at N- or C-extremes, were readily detectable without position effects, with sensitivity superior to that for the polyhistidine-tag. When the nss-tagged Zucchini yellow mosaic virus (ZYMV) helper component-protease (HC-Pro) and WSMoV nucleocapsid protein were transiently expressed by agroinfiltration in tobacco, they were readily detectable and the tag's possible efficacy for gene silencing suppression was not noticed. Co-immunoprecipitation of nss-tagged and non-tagged proteins expressed from bacteria confirmed the interaction of potyviral HC-Pro and coat protein. Thus, we conclude that this novel nss sequence is highly valuable for tagging recombinant proteins in both bacterial and plant expression systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  15. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  16. The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

    Science.gov (United States)

    Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

    2005-07-01

    Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

  17. Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

    International Nuclear Information System (INIS)

    Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

    2009-01-01

    Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

  18. Inactivation of the Tumor Suppressor Genes Causing the Hereditary Syndromes Predisposing to Head and Neck Cancer via Promoter Hypermethylation in Sporadic Head and Neck Cancers

    OpenAIRE

    Smith, Ian M.; Mithani, Suhail K.; Mydlarz, Wojciech K.; Chang, Steven S.; Califano, Joseph A.

    2010-01-01

    Fanconi anemia (FA) and dyskeratosis congenita (DC) are rare inherited syndromes that cause head and neck squamous cell cancer (HNSCC). Prior studies of inherited forms of cancer have been extremely important in elucidating tumor suppressor genes inactivated in sporadic tumors. Here, we studied whether sporadic tumors have epigenetic silencing of the genes causing the inherited forms of HNSCC. Using bisulfite sequencing, we investigated the incidence of promoter hypermethylation of the 17 Fan...

  19. Modulation of immune response by alloactivated suppressor T cells

    International Nuclear Information System (INIS)

    Bernstein, A.; Sopori, M.L.; Gose, J.E.; Sondel, P.M.

    1979-01-01

    These studies show that there may be several different kinds of suppressor cells, each activated by different pathways and able to suppress different parts of the immune response either specifically or nonspecifically. As such, the physiology of one type of suppressor cell need not necessarily apply to that of another type of suppressor. Thus we emphasize the trap that the suppressor cell option provides: that is, virtually any previously inexplicable in vitro and in vivo immune phenomenon can always be adequately accounted for by evoking a suppressor mechanism, either by suppressing the response or suppressing the suppressor

  20. Insulin induces suppressor of cytokine signaling-3 tyrosine phosphorylation through janus-activated kinase

    NARCIS (Netherlands)

    Peraldi, P; Filloux, C; Emanuelli, B; Hilton, DJ; Van Obberghen, E

    2001-01-01

    Suppressor of cytokine signaling (SOCS) proteins were originally described as cytokine-induced molecules involved in negative feedback loops. We have shown that SOCS-3 is also a component of the insulin signaling network (1), Indeed, insulin leads to SOCS-3 expression in 3T3-L1 adipocytes. Once

  1. The Ras suppressor-1 (RSU-1 in cancer

    Directory of Open Access Journals (Sweden)

    Lefteris C Zacharia

    2017-04-01

    Full Text Available Primary tumors are seldom the cause of death for cancer patients as most patients die from metastatic disease. Thus, deciphering metastatic mechanisms and key molecules involved is of utmost importance for the improved survival of cancer patients. Metastasis is a complex process in which cancer cells dissociate from the original tumor and spread to distant sites of the body. During the metastatic process, cancer cells lose contact both with the extracellular matrix (ECM and the neighboring cells within the primary tumor, thus invading though surrounding tissues. Therefore, ECM, and ECM-related adhesion proteins play a critical role in the metastatic process. Ras suppressor-1 (RSU-1 was first identified as a suppressor of Ras-dependent oncogenic transformation and is localized to cell-ECM adhesions where it is known to interact with the pro-survival adhesion protein PINCH-1. Although the connection to cancer is obvious, little is known regarding its expression in various cancer types. This opinion piece is focusing on recent literature regarding the expression of RSU-1 in various cancer types and the possible molecular mechanism of its action, pointing towards questions that need still to be addressed in this research field.

  2. RASSF6; the Putative Tumor Suppressor of the RASSF Family

    Directory of Open Access Journals (Sweden)

    Hiroaki Iwasa

    2015-12-01

    Full Text Available Humans have 10 genes that belong to the Ras association (RA domain family (RASSF. Among them, RASSF7 to RASSF10 have the RA domain in the N-terminal region and are called the N-RASSF proteins. In contradistinction to them, RASSF1 to RASSF6 are referred to as the C-RASSF proteins. The C-RASSF proteins have the RA domain in the middle region and the Salvador/RASSF/Hippo domain in the C-terminal region. RASSF6 additionally harbors the PSD-95/Discs large/ZO-1 (PDZ-binding motif. Expression of RASSF6 is epigenetically suppressed in human cancers and is generally regarded as a tumor suppressor. RASSF6 induces caspase-dependent and -independent apoptosis. RASSF6 interacts with mammalian Ste20-like kinases (homologs of Drosophila Hippo and cross-talks with the Hippo pathway. RASSF6 binds MDM2 and regulates p53 expression. The interactions with Ras and Modulator of apoptosis 1 (MOAP1 are also suggested by heterologous protein-protein interaction experiments. RASSF6 regulates apoptosis and cell cycle through these protein-protein interactions, and is implicated in the NF-κB and JNK signaling pathways. We summarize our current knowledge about RASSF6 and discuss what common and different properties RASSF6 and the other C-RASSF proteins have.

  3. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  4. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  5. Statins augment the chemosensitivity of colorectal cancer cells inducing epigenetic reprogramming and reducing colorectal cancer cell 'stemness' via the bone morphogenetic protein pathway

    NARCIS (Netherlands)

    Kodach, L.L.; Jacobs, R.J.; Voorneveld, P.W.; Wildenberg, M.E.; Verspaget, H.W.; van Wezel, T.; Morreau, H.; Hommes, D.W.; Peppelenbosch, M.P.; van den Brink, G.R.; Hardwick, J.C.H.

    2011-01-01

    Promoter hypermethylation is an important and potentially reversible mechanism of tumour suppressor gene silencing in cancer. Compounds that demethylate tumour suppressor genes and induce differentiation of cancer cells, but do not have toxic side effects, would represent an exciting option in

  6. Genome Defense Mechanisms in Neurospora and Associated Specialized Proteins

    Directory of Open Access Journals (Sweden)

    Ranjan Tamuli

    2010-06-01

    Full Text Available Neurospora crassa, the filamentous fungus possesses widest array of genome defense mechanisms known to any eukaryotic organism, including a process called repeat-induced point mutation (RIP. RIP is a genome defense mechanism that hypermutates repetitive DNA sequences; analogous to genomic imprinting in mammals. As an impact of RIP, Neurospora possesses many fewer genes in multigene families than expected. A DNA methyltransferase homologue, RID was shown to be essential for RIP. Recently, a variant catalytic subunit of translesion DNA polymerase zeta (Pol zeta has been found to be essential for dominant RIP suppressor phenotype. Meiotic silencing and quelling are two other genome defense mechanisms in Neurospora, and proteins required for these two processes have been identified through genetic screens.

  7. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  8. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  9. Subpopulation of human helper and suppressor T lymphocytes

    International Nuclear Information System (INIS)

    Venkataraman, M.; Levin, R.D.; Westerman, M.P.

    1983-01-01

    Mitogen driven differentiation of normal human mononuclear cells is a well-established model for the study of antibody synthesis in man. In certain rare individuals who are clinically normal, unfractionated mononuclear cells or a mixture of purified B plus T lymphocytes differentiate into immunoglobulin producing cells in response to purified protein derivative of tuberculin (PPD) but not in response to pokeweed mitogen (PWM). To evaluate this observation we have irradiated T cells from such individuals to eliminate naturally occurring suppressor T cell activity and then added the irradiated T cells back to autologous B cells before culture. The B cells then responded to PWM. The original PPD responses of cells from these individuals were now significantly reduced. Although, there was no difference between PWM nonresponders and responders in the number of OKT-8 positive cells, elimination of OKT-8 positive cells in the PWM nonresponders with OKT-8 monoclonal antibody and complement resulted in a significantly increased response to PWM. This study indicates that there are suppressor T cells which specifically inhibit B cell response to PWM without affecting the PPD response. These results also show that the helper T cells involved in the PWM response are radioresistant and those involved in the PPD response are radiosensitive

  10. IFNγ Induces DNA Methylation-Silenced GPR109A Expression via pSTAT1/p300 and H3K18 Acetylation in Colon Cancer.

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin

    2015-07-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.

  11. IFNγ induces DNA methylation-silenced GPR109A expression via pSTAT1/p300 and H3K18 acetylation in colon cancer

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin

    2015-01-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954

  12. The physics of chromatin silencing: Bi-stability and front propagation

    Science.gov (United States)

    Sedighi, Mohammad

    A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

  13. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  14. An unusual characteristic "flower-like" pattern: flash suppressor burns.

    Science.gov (United States)

    Gurcan, Altun

    2012-04-01

    The case on contact shots from firearms with a flash suppressor is rare. When a rifle fitted with a flash suppressor is fired, the emerging soot-laden gas in the barrel escapes from the slits of the flash suppressor. If the shot is contact or near contact, the flash suppressor will produce a characteristic "flower-like" pattern of seared, blackened zones around the entrance. This paper presents the injury pattern of the flash suppressor in a 29-year-old man who committed suicide with a G3 automatic infantry rifle.

  15. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  16. The tumour suppressor SOX11 is associated with improved survival among high grade epithelial ovarian cancers and is regulated by reversible promoter methylation

    International Nuclear Information System (INIS)

    Sernbo, Sandra; Gustavsson, Elin; Brennan, Donal J; Gallagher, William M; Rexhepaj, Elton; Rydnert, Frida; Jirström, Karin; Borrebaeck, Carl AK; Ek, Sara

    2011-01-01

    The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. SOX11 expression and clinicopathological data was compared using χ 2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5'-Aza-2'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours

  17. The tumour suppressor SOX11 is associated with improved survival among high grade epithelial ovarian cancers and is regulated by reversible promoter methylation

    LENUS (Irish Health Repository)

    Sernbo, Sandra

    2011-09-24

    Abstract Background The neural transcription factor SOX11 has been described as a prognostic marker in epithelial ovarian cancers (EOC), however its role in individual histological subtypes and tumour grade requires further clarification. Furthermore, methylation-dependent silencing of SOX11 has been reported for B cell lymphomas and indicates that epigenetic drugs may be used to re-express this tumour suppressor, but information on SOX11 promoter methylation in EOC is still lacking. Methods SOX11 expression and clinicopathological data was compared using χ2 test in a cohort of 154 cases of primary invasive EOC. Kaplan-Meier analysis and the log rank test were applied to evaluate ovarian cancer-specific survival (OCSS) and overall survival (OS) in strata, according to SOX11 expression. Also, the methylation status of the SOX11 promoter was determined by sodium bisulfite sequencing and methylation specific PCR (MSP). Furthermore, the effect of ectopic overexpression of SOX11 on proliferation was studied through [3H]-thymidine incorporation. Results SOX11 expression was associated with an improved survival of patients with high grade EOC, although not independent of stage. Further analyses of EOC cell lines showed that SOX11 mRNA and protein were expressed in two of five cell lines, correlating with promoter methylation status. Demethylation was successfully performed using 5\\'-Aza-2\\'deoxycytidine (5-Aza-dC) resulting in SOX11 mRNA and protein expression in a previously negative EOC cell line. Furthermore, overexpression of SOX11 in EOC cell lines confirmed the growth regulatory role of SOX11. Conclusions SOX11 is a functionally associated protein in EOC with prognostic value for high-grade tumours. Re-expression of SOX11 in EOC indicates a potential use of epigenetic drugs to affect cellular growth in SOX11-negative tumours.

  18. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali; Tuttle, John Richard; Robertson, Dominique Niki; Haigler, Candace H.; Brown, Judith K.

    2010-01-01

    inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor

  19. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  20. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  1. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  2. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  3. Multielement suppressor nozzles for thrust augmentation systems.

    Science.gov (United States)

    Lawrence, R. L.; O'Keefe, J. V.; Tate, R. B.

    1972-01-01

    The noise reduction and nozzle performance characteristics of large-scale, high-aspect-ratio multielement nozzle arrays operated at low velocities were determined by test. The nozzles are selected for application to high-aspect-ratio augmentor suppressors to be used for augmentor wing airplanes. Significant improvements in noise characteristics for multielement nozzles over those of round or high-aspect-ratio slot nozzles are obtained. Elliptical noise patterns typical of slot nozzles are presented for high-aspect-ratio multielement nozzle arrays. Additional advantages are available in OASPL noise reduction from the element size and spacing. Augmentor-suppressor systems can be designed for maximum beam pattern directivity and frequency spectrum shaping advantages. Measurements of the nozzle wakes show a correlation with noise level data and frequency spectrum peaks. The noise and jet wake results are compared with existing prediction procedures based on empirical jet flow equations, Lighthill relationships, Strouhal number, and empirical shock-induced screech noise effects.

  4. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  5. Which Plant Proteins Are Involved in Antiviral Defense? Review on In Vivo and In Vitro Activities of Selected Plant Proteins against Viruses

    Directory of Open Access Journals (Sweden)

    Oskar Musidlak

    2017-11-01

    Full Text Available Plants have evolved a variety of defense mechanisms to tackle virus attack. Endogenous plant proteins can function as virus suppressors. Different types of proteins mediate defense responses against plant viruses. Pathogenesis-related (PR proteins are activated upon pathogen infections or in different stress situations and their production is one of many components in plant defense. Ribosome-inactivating proteins (RIPs suppress translation by enzymatically damaging ribosomes and they have been found to have antiviral activity. RNA-binding proteins (RBPs bind to target RNAs via specialized RNA-binding domain and can directly or indirectly function in plant defense system against RNA viruses. Proteins involved in silencing machinery, namely Dicer-like (DCL proteins, Argonaute (AGO proteins, and RNA-dependent RNA polymerases (RDRs confer innate antiviral defense in plants as they are able to degrade foreign RNA of viral origin. This review aims to provide a comprehensive and up-to-date picture of plant proteins participating in antiviral defense. As a result we discuss proteins conferring plant antiviral resistance and their potential future applications in different fields of life including agriculture and medicine.

  6. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  7. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  8. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  9. Thrombospondin-4 is a putative tumour-suppressor gene in colorectal cancer that exhibits age-related methylation

    International Nuclear Information System (INIS)

    Greco, Sonia A; Leggett, Barbara A; Whitehall, Vicki LJ; Chia, June; Inglis, Kelly J; Cozzi, Sarah-Jane; Ramsnes, Ingunn; Buttenshaw, Ronald L; Spring, Kevin J; Boyle, Glen M; Worthley, Daniel L

    2010-01-01

    Thrombospondin-4 (THBS4) is a member of the extracellular calcium-binding protein family and is involved in cell adhesion and migration. The aim of this study was to evaluate the potential role of deregulation of THBS4 expression in colorectal carcinogenesis. Of particular interest was the possible silencing of expression by methylation of the CpG island in the gene promoter. Fifty-five sporadic colorectal tumours stratified for the CpG Island Methylator Phenotype (CIMP) were studied. Immunohistochemical staining of THBS4 protein was assessed in normal and tumour specimens. Relative levels of THBS4 transcript expression in matched tumours and normal mucosa were also determined by quantitative RT-PCR. Colony forming ability was examined in 8 cell lines made to overexpress THBS4. Aberrant promoter hypermethylation was investigated as a possible mechanism of gene disruption using MethyLight. Methylation was also assessed in the normal colonic tissue of 99 patients, with samples biopsied from four regions along the length of the colon. THBS4 expression was significantly lower in tumour tissue than in matched normal tissue. Immunohistochemical examination demonstrated that THBS4 protein was generally absent from normal epithelial cells and tumours, but was occasionally expressed at low levels in the cytoplasm towards the luminal surface in vesicular structures. Forced THBS4 over-expression caused a 50-60% repression of tumour colony growth in all eight cell lines examined compared to control cell lines. Tumours exhibited significantly higher levels of methylation than matched normal mucosa, and THBS4 methylation correlated with the CpG island methylator phenotype. There was a trend towards decreased gene expression in tumours exhibiting high THBS4 methylation, but the correlation was not significant. THBS4 methylation was detectable in normal mucosal biopsies where it correlated with increasing patient age and negatively with the occurrence of adenomas elsewhere in the

  10. Thrombospondin-4 is a putative tumour-suppressor gene in colorectal cancer that exhibits age-related methylation

    Directory of Open Access Journals (Sweden)

    Greco Sonia A

    2010-09-01

    Full Text Available Abstract Background Thrombospondin-4 (THBS4 is a member of the extracellular calcium-binding protein family and is involved in cell adhesion and migration. The aim of this study was to evaluate the potential role of deregulation of THBS4 expression in colorectal carcinogenesis. Of particular interest was the possible silencing of expression by methylation of the CpG island in the gene promoter. Methods Fifty-five sporadic colorectal tumours stratified for the CpG Island Methylator Phenotype (CIMP were studied. Immunohistochemical staining of THBS4 protein was assessed in normal and tumour specimens. Relative levels of THBS4 transcript expression in matched tumours and normal mucosa were also determined by quantitative RT-PCR. Colony forming ability was examined in 8 cell lines made to overexpress THBS4. Aberrant promoter hypermethylation was investigated as a possible mechanism of gene disruption using MethyLight. Methylation was also assessed in the normal colonic tissue of 99 patients, with samples biopsied from four regions along the length of the colon. Results THBS4 expression was significantly lower in tumour tissue than in matched normal tissue. Immunohistochemical examination demonstrated that THBS4 protein was generally absent from normal epithelial cells and tumours, but was occasionally expressed at low levels in the cytoplasm towards the luminal surface in vesicular structures. Forced THBS4 over-expression caused a 50-60% repression of tumour colony growth in all eight cell lines examined compared to control cell lines. Tumours exhibited significantly higher levels of methylation than matched normal mucosa, and THBS4 methylation correlated with the CpG island methylator phenotype. There was a trend towards decreased gene expression in tumours exhibiting high THBS4 methylation, but the correlation was not significant. THBS4 methylation was detectable in normal mucosal biopsies where it correlated with increasing patient age and

  11. MicroRNA-103 Promotes Colorectal Cancer by Targeting Tumor Suppressor DICER and PTEN

    Directory of Open Access Journals (Sweden)

    Li Geng

    2014-05-01

    Full Text Available MicroRNAs (miRNAs are a class of small, noncoding RNAs that act as key regulators in various physiological and pathological processes. However, the regulatory mechanisms for miRNAs in colorectal cancer remain largely unknown. Here, we found that miR-103 is up-regulated in colorectal cancer and its overexpression is closely associated with tumor proliferation and migration. In addition, repressing the expression of miR-103 apparently inhibits colorectal cancer cell proliferation and migration in vitro and HCT-116 xenograft tumor growth in vivo. Subsequent software analysis and dual-luciferase reporter assay identified two tumor suppressor genes DICER and PTEN as direct targets of miR-103, and up-regulation of DICER and PTEN obtained similar results to that occurred in the silencing of miR-103. In addition, restoration of DICER and PTEN can inhibit miR-103-induced colorectal cancer cell proliferation and migration. Our data collectively demonstrate that miR-103 is an oncogene miRNA that promotes colorectal cancer proliferation and migration through down-regulation of the tumor suppressor genes DICER and PTEN. Thus, miR-103 may represent a new potential diagnostic and therapeutic target for colorectal cancer treatment.

  12. SFRP Tumour Suppressor Genes Are Potential Plasma-Based Epigenetic Biomarkers for Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Yuen Yee Cheng

    2017-01-01

    Full Text Available Malignant pleural mesothelioma (MPM is associated with asbestos exposure. Asbestos can induce chronic inflammation which in turn can lead to silencing of tumour suppressor genes. Wnt signaling pathway can be affected by chronic inflammation and is aberrantly activated in many cancers including colon and MPM. SFRP genes are antagonists of Wnt pathway, and SFRPs are potential tumour suppressors in colon, gastric, breast, ovarian, and lung cancers and mesothelioma. This study investigated the expression and DNA methylation of SFRP genes in MPM cells lines with and without demethylation treatment. Sixty-six patient FFPE samples were analysed and have showed methylation of SFRP2 (56% and SFRP5 (70% in MPM. SFRP2 and SFRP5 tumour-suppressive activity in eleven MPM lines was confirmed, and long-term asbestos exposure led to reduced expression of the SFRP1 and SFRP2 genes in the mesothelium (MeT-5A via epigenetic alterations. Finally, DNA methylation of SFRPs is detectable in MPM patient plasma samples, with methylated SFRP2 and SFRP5 showing a tendency towards greater abundance in patients. These data suggested that SFRP genes have tumour-suppresive activity in MPM and that methylated DNA from SFRP gene promoters has the potential to serve as a biomarker for MPM patient plasma.

  13. The Lack of the Essential LptC Protein in the Trans-Envelope Lipopolysaccharide Transport Machine Is Circumvented by Suppressor Mutations in LptF, an Inner Membrane Component of the Escherichia coli Transporter

    KAUST Repository

    Benedet, Mattia

    2016-08-16

    The lipopolysaccharide (LPS) transport (Lpt) system is responsible for transferring LPS from the periplasmic surface of the inner membrane (IM) to the outer leaflet of the outer membrane (OM), where it plays a crucial role in OM selective permeability. In E. coli seven essential proteins are assembled in an Lpt trans-envelope complex, which is conserved in gamma-Proteobacteria. LptBFG constitute the IMABC transporter, LptDE form the OM translocon for final LPS delivery, whereas LptC, an IM-anchored protein with a periplasmic domain, interacts with the IM ABC transporter, the periplasmic protein LptA, and LPS. Although essential, LptC can tolerate several mutations and its role in LPS transport is unclear. To get insights into the functional role of LptC in the Lpt machine we searched for viable mutants lacking LptC by applying a strong double selection for lptC deletion mutants. Genome sequencing of viable Delta lptC mutants revealed single amino acid substitutions at a unique position in the predicted large periplasmic domain of the IM component LptF (LptF(SupC)). In complementation tests, lptF(SupC) mutants suppress lethality of both Delta lptC and lptC conditional expressionmutants. Our data show that mutations in a specific residue of the predicted LptF periplasmic domain can compensate the lack of the essential protein LptC, implicate such LptF domain in the formation of the periplasmic bridge between the IM and OM complexes, and suggest that LptC may have evolved to improve the performance of an ancestral six-component Lpt machine.

  14. The Lack of the Essential LptC Protein in the Trans-Envelope Lipopolysaccharide Transport Machine Is Circumvented by Suppressor Mutations in LptF, an Inner Membrane Component of the Escherichia coli Transporter

    KAUST Repository

    Benedet, Mattia; Falchi, Federica A.; Puccio, Simone; Di Benedetto, Cristiano; Peano, Clelia; Polissi, Alessandra; Deho, Gianni

    2016-01-01

    The lipopolysaccharide (LPS) transport (Lpt) system is responsible for transferring LPS from the periplasmic surface of the inner membrane (IM) to the outer leaflet of the outer membrane (OM), where it plays a crucial role in OM selective permeability. In E. coli seven essential proteins are assembled in an Lpt trans-envelope complex, which is conserved in gamma-Proteobacteria. LptBFG constitute the IMABC transporter, LptDE form the OM translocon for final LPS delivery, whereas LptC, an IM-anchored protein with a periplasmic domain, interacts with the IM ABC transporter, the periplasmic protein LptA, and LPS. Although essential, LptC can tolerate several mutations and its role in LPS transport is unclear. To get insights into the functional role of LptC in the Lpt machine we searched for viable mutants lacking LptC by applying a strong double selection for lptC deletion mutants. Genome sequencing of viable Delta lptC mutants revealed single amino acid substitutions at a unique position in the predicted large periplasmic domain of the IM component LptF (LptF(SupC)). In complementation tests, lptF(SupC) mutants suppress lethality of both Delta lptC and lptC conditional expressionmutants. Our data show that mutations in a specific residue of the predicted LptF periplasmic domain can compensate the lack of the essential protein LptC, implicate such LptF domain in the formation of the periplasmic bridge between the IM and OM complexes, and suggest that LptC may have evolved to improve the performance of an ancestral six-component Lpt machine.

  15. Downregulation of a tumor suppressor RECK by hypoxia through recruitment of HDAC1 and HIF-1alpha to reverse HRE site in the promoter.

    Science.gov (United States)

    Lee, Kyung Ju; Lee, Kwang Youl; Lee, You Mie

    2010-05-01

    Reversion-inducing cysteine-rich protein with Kazal motifs (RECK) is a tumor suppressor and the suppression of RECK is induced by Ras or Her-2/neu oncogenes. However, regulation of RECK under hypoxic microenvironment is largely unknown. Here, we identified that hypoxia significantly downregulates RECK mRNA and protein expression using semiquantitative RT-PCR, real-time RT-PCR and western blot analysis. This repression was reversed by the HDAC inhibitor, trichostatin A (TSA) and HIF-1 inhibitor, YC-1. Hypoxia-induced downregulation of RECK was abolished by knockdown of HDAC1 and HIF-1alpha with respective small interfering RNAs (siRNAs), whereas overexpression of HDAC1 and HIF-1alpha suppressed RECK expression similar to the level under hypoxic conditions. Transfection of a deletion mutant of the second reverse HRE (rHRE2, -2345 to -2333) site of RECK promoter completely removed RECK suppression under hypoxia, indicating that the rHRE2 site is responsible for the inhibition of RECK. Chromatin immunoprecipitation and DNA affinity precipitation assays demonstrated that HDAC1 and HIF-1alpha were recruited to the rHRE2 region of RECK promoter under hypoxic conditions, but the treatment of TSA or YC-1 inhibited their binding to the rHRE2 site. Moreover, TSA and YC-1 inhibited hypoxia-induced cancer cell migration, invasion and MMPs secretion. Taken together, we can conclude that hypoxia induces RECK downregulation through the recruitment of HDAC1 and HIF-1alpha to the rHRE2 site in the promoter and the inhibition of hypoxic RECK silencing would be a therapeutic and preventive target for early tumorigenesis. Copyright 2010 Elsevier B.V. All rights reserved.

  16. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  17. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  18. Induction of suppressor cells in vitro by Candida albicans.

    Science.gov (United States)

    Cuff, C F; Rogers, C M; Lamb, B J; Rogers, T J

    1986-06-01

    Normal splenocytes cultured with Formalin-killed Candida albicans were shown to acquire significant suppressor cell activity in a period of 3 days. These cells were found to suppress both the phytohemagglutinin-induced mitogen response as well as the anti-sheep erythrocyte antibody response. Experiments were carried out to determine the nature of the suppressor cell population. Results showed that these cells were not susceptible to treatment with anti-Thy 1 antibody and complement. Panning experiments showed that the suppressor cells were not plastic-adherent or Mac-1 antigen-positive. The suppressor cells were, however, adherent to anti-mouse immunoglobulin (F(ab')2-fragment)-coated dishes. Additional experiments showed that the suppressor cell activity was susceptible to treatment with monoclonal anti-Lyb 2.1 antibody and complement. These results suggest that the suppressor cell induced in vitro by Candida is a member of the B-lymphocyte lineage.

  19. Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

    Science.gov (United States)

    Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

    2000-01-01

    The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

  20. Adenovirus E4 open reading frame 4-induced dephosphorylation inhibits E1A activation of the E2 promoter and E2F-1-mediated transactivation independently of the retinoblastoma tumor suppressor protein

    DEFF Research Database (Denmark)

    Mannervik, M; Fan, S; Ström, A C

    1999-01-01

    of the viral E4 open reading frame 4 (E4-ORF4) protein. This effect does not to require the retinoblastoma protein that previously has been shown to regulate E2F activity. The inhibitory activity of E4-ORF4 appears to be specific because E4-ORF4 had little effect on, for example, E4-ORF6/7 transactivation......Previous studies have shown that the cell cycle-regulated E2F transcription factor is subjected to both positive and negative control by phosphorylation. Here we show that in transient transfection experiments, adenovirus E1A activation of the viral E2 promoter is abrogated by coexpression...... of the E2 promoter. We further show that the repressive effect of E4-ORF4 on E2 transcription works mainly through the E2F DNA-binding sites in the E2 promoter. In agreement with this, we find that E4-ORF4 inhibits E2F-1/DP-1-mediated transactivation. We also show that E4-ORF4 inhibits E2 mRNA expression...

  1. Transducer of ERBB2.1 (TOB1) as a Tumor Suppressor: A Mechanistic Perspective.

    Science.gov (United States)

    Lee, Hun Seok; Kundu, Juthika; Kim, Ryong Nam; Shin, Young Kee

    2015-12-15

    Transducer of ERBB2.1 (TOB1) is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK) expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT) signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX) protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4) and phosphatase and tensin homolog-10 (PTEN), and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  2. Transducer of ERBB2.1 (TOB1 as a Tumor Suppressor: A Mechanistic Perspective

    Directory of Open Access Journals (Sweden)

    Hun Seok Lee

    2015-12-01

    Full Text Available Transducer of ERBB2.1 (TOB1 is a tumor-suppressor protein, which functions as a negative regulator of the receptor tyrosine-kinase ERBB2. As most of the other tumor suppressor proteins, TOB1 is inactivated in many human cancers. Homozygous deletion of TOB1 in mice is reported to be responsible for cancer development in the lung, liver, and lymph node, whereas the ectopic overexpression of TOB1 shows anti-proliferation, and a decrease in the migration and invasion abilities on cancer cells. Biochemical studies revealed that the anti-proliferative activity of TOB1 involves mRNA deadenylation and is associated with the reduction of both cyclin D1 and cyclin-dependent kinase (CDK expressions and the induction of CDK inhibitors. Moreover, TOB1 interacts with an oncogenic signaling mediator, β-catenin, and inhibits β-catenin-regulated gene transcription. TOB1 antagonizes the v-akt murine thymoma viral oncogene (AKT signaling and induces cancer cell apoptosis by activating BCL2-associated X (BAX protein and inhibiting the BCL-2 and BCL-XL expressions. The tumor-specific overexpression of TOB1 results in the activation of other tumor suppressor proteins, such as mothers against decapentaplegic homolog 4 (SMAD4 and phosphatase and tensin homolog-10 (PTEN, and blocks tumor progression. TOB1-overexpressing cancer cells have limited potential of growing as xenograft tumors in nude mice upon subcutaneous implantation. This review addresses the molecular basis of TOB1 tumor suppressor function with special emphasis on its regulation of intracellular signaling pathways.

  3. History of myeloid-derived suppressor cells.

    Science.gov (United States)

    Talmadge, James E; Gabrilovich, Dmitry I

    2013-10-01

    Tumour-induced granulocytic hyperplasia is associated with tumour vasculogenesis and escape from immunity via T cell suppression. Initially, these myeloid cells were identified as granulocytes or monocytes; however, recent studies have revealed that this hyperplasia is associated with populations of multipotent progenitor cells that have been identified as myeloid-derived suppressor cells (MDSCs). The study of MDSCs has provided a wealth of information regarding tumour pathobiology, has extended our understanding of neoplastic progression and has modified our approaches to immune adjuvant therapy. In this Timeline article, we discuss the history of MDSCs, their influence on tumour progression and metastasis, and the crosstalk between tumour cells, MDSCs and the host macroenvironment.

  4. Purification of SOCS (Suppressor of Cytokine Signaling) SH2 Domains for Structural and Functional Studies.

    Science.gov (United States)

    Liau, Nicholas P D; Laktyushin, Artem; Babon, Jeffrey J

    2017-01-01

    Src Homology 2 (SH2) domains are protein domains which have a high binding affinity for specific amino acid sequences containing a phosphorylated tyrosine residue. The Suppressors of Cytokine Signaling (SOCS) proteins use an SH2 domain to bind to components of certain cytokine signaling pathways to downregulate the signaling cascade. The recombinantly produced SH2 domains of various SOCS proteins have been used to undertake structural and functional studies elucidating the method of how such targeting occurs. Here, we describe the protocol for the recombinant production and purification of SOCS SH2 domains, with an emphasis on SOCS3.

  5. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  6. Cell size checkpoint control by the retinoblastoma tumor suppressor pathway.

    Science.gov (United States)

    Fang, Su-Chiung; de los Reyes, Chris; Umen, James G

    2006-10-13

    Size control is essential for all proliferating cells, and is thought to be regulated by checkpoints that couple cell size to cell cycle progression. The aberrant cell-size phenotypes caused by mutations in the retinoblastoma (RB) tumor suppressor pathway are consistent with a role in size checkpoint control, but indirect effects on size caused by altered cell cycle kinetics are difficult to rule out. The multiple fission cell cycle of the unicellular alga Chlamydomonas reinhardtii uncouples growth from division, allowing direct assessment of the relationship between size phenotypes and checkpoint function. Mutations in the C. reinhardtii RB homolog encoded by MAT3 cause supernumerous cell divisions and small cells, suggesting a role for MAT3 in size control. We identified suppressors of an mat3 null allele that had recessive mutations in DP1 or dominant mutations in E2F1, loci encoding homologs of a heterodimeric transcription factor that is targeted by RB-related proteins. Significantly, we determined that the dp1 and e2f1 phenotypes were caused by defects in size checkpoint control and were not due to a lengthened cell cycle. Despite their cell division defects, mat3, dp1, and e2f1 mutants showed almost no changes in periodic transcription of genes induced during S phase and mitosis, many of which are conserved targets of the RB pathway. Conversely, we found that regulation of cell size was unaffected when S phase and mitotic transcription were inhibited. Our data provide direct evidence that the RB pathway mediates cell size checkpoint control and suggest that such control is not directly coupled to the magnitude of periodic cell cycle transcription.

  7. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  8. An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

    Directory of Open Access Journals (Sweden)

    Amanda Ackley

    2013-01-01

    Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

  9. The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

    DEFF Research Database (Denmark)

    Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

    2002-01-01

    Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

  10. Durability of timber silencers at Wairakei geothermal steam field

    Energy Technology Data Exchange (ETDEWEB)

    Hedley, M E

    1979-02-01

    After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

  11. Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

    2017-05-01

    Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The von Hippel-Lindau tumor suppressor regulates programmed cell death 5-mediated degradation of Mdm2

    NARCIS (Netherlands)

    Essers, P B; Klasson, T D; Pereboom, T C; Mans, D A; Nicastro, M; Boldt, K; Giles, R H; MacInnes, A W

    2015-01-01

    Functional loss of the von Hippel-Lindau (VHL) tumor suppressor protein (pVHL), which is part of an E3-ubiquitin ligase complex, initiates most inherited and sporadic clear-cell renal cell carcinomas (ccRCC). Genetic inactivation of the TP53 gene in ccRCC is rare, suggesting that an alternate

  13. Biological evidence that SOCS-2 can act either as an enhancer or suppressor of growth hormone signaling

    DEFF Research Database (Denmark)

    Greenhalgh, Christopher J; Metcalf, Donald; Thaus, Anne L

    2002-01-01

    Suppressor of cytokine signaling (SOCS)-2 is a member of a family of intracellular proteins implicated in the negative regulation of cytokine signaling. The generation of SOCS-2-deficient mice, which grow to one and a half times the size of their wild-type littermates, suggests that SOCS-2 may at...

  14. Inhibitor of differentiation 4 (Id4) is a potential tumor suppressor in prostate cancer

    International Nuclear Information System (INIS)

    Carey, Jason PW; Asirvatham, Ananthi J; Galm, Oliver; Ghogomu, Tandeih A; Chaudhary, Jaideep

    2009-01-01

    Inhibitor of differentiation 4 (Id4), a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH) transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP) analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS), expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR), p21, p27 and p53 expression in DU145 cells. The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously silenced tumor suppressors

  15. Inhibitor of differentiation 4 (Id4 is a potential tumor suppressor in prostate cancer

    Directory of Open Access Journals (Sweden)

    Carey Jason PW

    2009-06-01

    silenced tumor suppressors.

  16. Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

    Science.gov (United States)

    Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

    2004-02-01

    The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

  17. Myeloid-derived suppressor activity is mediated by monocytic lineages maintained by continuous inhibition of extrinsic and intrinsic death pathways.

    Science.gov (United States)

    Haverkamp, Jessica M; Smith, Amber M; Weinlich, Ricardo; Dillon, Christopher P; Qualls, Joseph E; Neale, Geoffrey; Koss, Brian; Kim, Young; Bronte, Vincenzo; Herold, Marco J; Green, Douglas R; Opferman, Joseph T; Murray, Peter J

    2014-12-18

    Nonresolving inflammation expands a heterogeneous population of myeloid suppressor cells capable of inhibiting T cell function. This heterogeneity has confounded the functional dissection of individual myeloid subpopulations and presents an obstacle for antitumor immunity and immunotherapy. Using genetic manipulation of cell death pathways, we found the monocytic suppressor-cell subset, but not the granulocytic subset, requires continuous c-FLIP expression to prevent caspase-8-dependent, RIPK3-independent cell death. Development of the granulocyte subset requires MCL-1-mediated control of the intrinsic mitochondrial death pathway. Monocytic suppressors tolerate the absence of MCL-1 provided cytokines increase expression of the MCL-1-related protein A1. Monocytic suppressors mediate T cell suppression, whereas their granulocytic counterparts lack suppressive function. The loss of the granulocytic subset via conditional MCL-1 deletion did not alter tumor incidence implicating the monocytic compartment as the functionally immunosuppressive subset in vivo. Thus, death pathway modulation defines the development, survival, and function of myeloid suppressor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  19. Exon silencing by UAGG motifs in response to neuronal excitation.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-02-01

    Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

  20. Tumor Suppressor Function of CYLD in Nonmelanoma Skin Cancer

    Directory of Open Access Journals (Sweden)

    K. C. Masoumi

    2011-01-01

    Full Text Available Ubiquitin and ubiquitin-related proteins posttranslationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to nonmelanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

  1. Melanoma Suppressor Functions of the Carcinoma Oncogene FOXQ1

    Directory of Open Access Journals (Sweden)

    Archis Bagati

    2017-09-01

    Full Text Available Lineage-specific regulation of tumor progression by the same transcription factor is understudied. We find that levels of the FOXQ1 transcription factor, an oncogene in carcinomas, are decreased during melanoma progression. Moreover, in contrast to carcinomas, FOXQ1 suppresses epithelial-to-mesenchymal transition, invasion, and metastasis in melanoma cells. We find that these lineage-specific functions of FOXQ1 largely depend on its ability to activate (in carcinomas or repress (in melanoma transcription of the N-cadherin gene (CDH2. We demonstrate that FOXQ1 interacts with nuclear β-catenin and TLE proteins, and the β-catenin/TLE ratio, which is higher in carcinoma than melanoma cells, determines the effect of FOXQ1 on CDH2 transcription. Accordingly, other FOXQ1-dependent phenotypes can be manipulated by altering nuclear β-catenin or TLE proteins levels. Our data identify FOXQ1 as a melanoma suppressor and establish a mechanism underlying its inverse lineage-specific transcriptional regulation of transformed phenotypes.

  2. Tumor Suppressor Function of CYLD in Non melanoma Skin Cancer

    International Nuclear Information System (INIS)

    Masoumi, K. C.; Hallgren, G. S.; Massoumi, R.

    2011-01-01

    Ubiquitin and ubiquitin-related proteins post translationally modify substrates, and thereby alter the functions of their targets. The ubiquitination process is involved in various physiological responses, and dysregulation of components of the ubiquitin system has been linked to many diseases including skin cancer. The ubiquitin pathways activated among skin cancers are highly diverse and may reflect the various characteristics of the cancer type. Basal cell carcinoma and squamous cell carcinoma, the most common types of human skin cancer, are instances where the involvement of the deubiquitination enzyme CYLD has been recently highlighted. In basal cell carcinoma, the tumor suppressor protein CYLD is repressed at the transcriptional levels through hedgehog signaling pathway. Downregulation of CYLD in basal cell carcinoma was also shown to interfere with TrkC expression and signaling, thereby promoting cancer progression. By contrast, the level of CYLD is unchanged in squamous cell carcinoma, instead, catalytic inactivation of CYLD in the skin has been linked to the development of squamous cell carcinoma. This paper will focus on the current knowledge that links CYLD to non melanoma skin cancers and will explore recent insights regarding CYLD regulation of NF-κB and hedgehog signaling during the development and progression of these types of human tumors.

  3. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  4. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  5. Fusion protein of tapasin and hepatitis B core antigen 18‑27 enhances T helper cell type 1/2 cytokine ratio and antiviral immunity by inhibiting suppressors of cytokine signaling family members 1/3 in hepatitis B virus transgenic mice.

    Science.gov (United States)

    Tang, Yuyan; Chen, Xiaohua; Zhang, Yi; Tang, Zhenghao; Zhuo, Meng; Li, Dan; Wang, Peng; Zang, Guoqing; Yu, Yongsheng

    2014-04-01

    Persistent hepatitis B virus (HBV) infection is characterized by a weak adaptive immune response, which is considered to be due to an imbalance of T helper cell types 1 and 2 (Th1/Th2). Suppressors of cytokine signaling (SOCS) family members, particularly SOCS1 and SOCS3, have been demonstrated to be important in the regulation of T cell differentiation. Previous studies by our group showed that the expressed and purified fusion protein of cytoplasmic transduction peptide (CTP) and HBV core antigen 18‑27 (HBcAg18‑27)‑tapasin was able to enter the cytoplasm of bone marrow‑derived dendritic cells (BMDCs), promoting the maturation of BMDCs and efficiently enhancing T cell immune responses in vitro. In the present study, HBcAg‑specific immune responses induced by CTP‑HBcAg18‑27‑tapasin in HBV were assessed in transgenic mice, and SOCS1 and SOCS3 were identified as negative regulators of this response. The Th1/Th2 cytokine ratio was analyzed by ELISA. The expression of T cell‑specific T‑box transcription factor (T‑bet) and GATA‑binding protein 3 (GATA‑3), SOCS1 and SOCS3 were detected by real‑time quantitative polymerase chain reaction and western blot analysis. The results demonstrated that CTP‑HBcAg18‑27‑tapasin significantly increased the Th1/Th2 cytokine ratio in HBV transgenic mice. CTP‑HBcAg18‑27‑tapasin immunization more efficiently suppressed the expression of serum hepatitis B surface antigen (HBsAg), HBV DNA as well as liver HBsAg and HBcAg in HBV transgenic mice. Furthermore, CTP‑HBcAg18‑27‑tapasin promotes T‑bet but reduces GATA‑3 expression. In addition, the expression of SOCS1 and SOCS3 was significantly downregulated in the CTP‑HBcAg18‑27‑tapasin group compared with the control groups. In conclusion, the present study demonstrated that CTP‑HBcAg18‑27‑tapasin enhanced the Th1/Th2 cytokine ratio and antiviral immunity by suppressing SOCS1/3 in HBV transgenic mice.

  6. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  7. RNAi silenced Dd-grp94 (Dictyostelium discoideum glucose-regulated protein 94 kDa) cell lines in Dictyostelium exhibit marked reduction in growth rate and delay in development.

    Science.gov (United States)

    Baviskar, Sandhya N; Shields, Malcolm S

    2010-01-01

    Glucose-regulated 94 kDa protein (Grp94) is a resident of the endoplasmic reticulum (ER) of multicellular eukaryotes. It is a constitutively expressed protein that is overexpressed in certain abnormal conditions of the cell such as depletion of glucose and calcium, and low oxygen and pH. The protein is also implicated in diseased conditions like cancer and Alzheimer's disease. In this study, the consequences of downregulation of Grp94 were investigated at both unicellular and multicellular stages of Dictyostelium discoideum. Previous studies have shown the expression of Dd-Grp94 (Dictyostelium discoideum glucose-regulated 94 kDa protein) in wild-type cells varies during development, and overexpression of Dd-Grp94 leads to abnormal cell shape and inhibition of development (i.e., formation of fruiting bodies). Grp94 is a known calcium binding protein and an efficient calcium buffer. Therefore, in the present study we hypothesized that downregulation of Dd-Grp94 protein would affect Dictyostelium cell structure, growth, and development. We found that Dd-grp94 RNAi recombinants exhibited reduced growth rate, cell size, and a subtle change in cell motility compared to the parental cells. The recombinants also exhibited a delay in development and small fruiting bodies. These results establish that Dd-grp94 plays a crucial role in determining normal cell structure, growth and differentiation.

  8. The PTPN14 Tumor Suppressor Is a Degradation Target of Human Papillomavirus E7.

    Science.gov (United States)

    Szalmás, Anita; Tomaić, Vjekoslav; Basukala, Om; Massimi, Paola; Mittal, Suruchi; Kónya, József; Banks, Lawrence

    2017-04-01

    Activation of signaling pathways ensuring cell growth is essential for the proliferative competence of human papillomavirus (HPV)-infected cells. Tyrosine kinases and phosphatases are key regulators of cellular growth control pathways. A recently identified potential cellular target of HPV E7 is the cytoplasmic protein tyrosine phosphatase PTPN14, which is a potential tumor suppressor and is linked to the control of the Hippo and Wnt/beta-catenin signaling pathways. In this study, we show that the E7 proteins of both high-risk and low-risk mucosal HPV types can interact with PTPN14. This interaction is independent of retinoblastoma protein (pRb) and involves residues in the carboxy-terminal region of E7. We also show that high-risk E7 induces proteasome-mediated degradation of PTPN14 in cells derived from cervical tumors. This degradation appears to be independent of cullin-1 or cullin-2 but most likely involves the UBR4/p600 ubiquitin ligase. The degree to which E7 downregulates PTPN14 would suggest that this interaction is important for the viral life cycle and potentially also for the development of malignancy. In support of this we find that overexpression of PTPN14 decreases the ability of HPV-16 E7 to cooperate with activated EJ-ras in primary cell transformation assays. IMPORTANCE This study links HPV E7 to the deregulation of protein tyrosine phosphatase signaling pathways. PTPN14 is classified as a potential tumor suppressor protein, and here we show that it is very susceptible to HPV E7-induced proteasome-mediated degradation. Intriguingly, this appears to use a mechanism that is different from that employed by E7 to target pRb. Therefore, this study has important implications for our understanding of the molecular basis for E7 function and also sheds important light on the potential role of PTPN14 as a tumor suppressor. Copyright © 2017 American Society for Microbiology.

  9. Off and back-on again: a tumor suppressor's tale.

    Science.gov (United States)

    Acosta, Jonuelle; Wang, Walter; Feldser, David M

    2018-06-01

    Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.

  10. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  11. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  12. Active compressor engine silencer reduces exhaust noise

    International Nuclear Information System (INIS)

    Denenberg, J.N.; Miller, S.K.; Jay, M.A.

    1994-01-01

    An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

  13. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  14. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  15. A novel proapoptotic gene PANO encodes a post-translational modulator of the tumor suppressor p14ARF

    Energy Technology Data Exchange (ETDEWEB)

    Watari, Akihiro; Li, Yang; Higashiyama, Shinji; Yutsudo, Masuo, E-mail: yutsudo@biken.osaka-u.ac.jp

    2012-02-01

    The protein p14ARF is a known tumor suppressor protein controlling cell proliferation and survival, which mainly localizes in nucleoli. However, the regulatory mechanisms that govern its activity or expression remain unclear. Here, we report that a novel proapoptotic nucleolar protein, PANO, modulates the expression and activity of p14ARF in HeLa cells. Overexpression of PANO enhances the stability of p14ARF protein by protecting it from degradation, resulting in an increase in p14ARF expression levels. Overexpression of PANO also induces apoptosis under low serum conditions. This effect is dependent on the nucleolar localization of PANO and inhibited by knocking-down p14ARF. Alternatively, PANO siRNA treated cells exhibit a reduction in p14ARF protein levels. In addition, ectopic expression of PANO suppresses the tumorigenicity of HeLa cells in nude mice. These results indicate that PANO is a new apoptosis-inducing gene by modulating the tumor suppressor protein, p14ARF, and may itself be a new candidate tumor suppressor gene.

  16. Infrared suppressor effect on T63 turboshaft engine performance

    Science.gov (United States)

    Bailey, E. E.; Civinskas, K. C.; Walker, C. L.

    1978-01-01

    Tests were conducted to determine if there are performance penalties associated with the installation of infrared (IR) suppressors on the T63-A-700 turboshaft engine. The testing was done in a sea-level, static test cell. The same engine (A-E402808 B) was run with the standard OH-58 aircraft exhaust stacks and with the ejector-type IR suppressors in order to make a valid comparison. Repeatability of the test results for the two configurations was verified by rerunning the conditions over a period of days. Test results showed no measurable difference in performance between the standard exhaust stacks and the IR suppressors.

  17. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. Potential of lactic acid bacteria as suppressors of wine allergies

    Directory of Open Access Journals (Sweden)

    Yıldırım Hatice Kalkan

    2017-01-01

    Full Text Available Allergens causes some symptoms as all asthma, allergic conjunctivitis, and allergic rhinitis. These symptoms are seen twice as many in women than in men. The major wine allergens reported in wines are endochitinase 4A and lipid-transfer protein (LTP. This review deal with possibilities of using lactic acid bacteria as suppressors of wine allergies. Phenolic compounds present in wines have not only antioxidant properties causing radical scavenging but also some special properties reported in many in vitro studies as regulating functions in inflammatory cells as mast cells. So what is the role of lactic acid bacteria in these cases? Lactic acid bacteria are used during malolactic fermentation step of wine production with purpose of malic acid reduction. During this bioconversion complex phenolic compounds could be hydrolysed by bacterial enzymes to their aglycone forms. Obtained aglycons could pass through the intestinal epithelium of human and allowed reduction of IgE antibody production by affecting Th1/ Th2 ratio. Considering different contents and quantities of phenols in different grape varieties and consequently in different wines more studies are required in order to determine which lactic acid bacteria and strains could be effective in suppressing wine allergens.

  19. SIRT3: Oncogene and Tumor Suppressor in Cancer

    Directory of Open Access Journals (Sweden)

    Margalida Torrens-Mas

    2017-07-01

    Full Text Available Sirtuin 3 (SIRT3, the major deacetylase in mitochondria, plays a crucial role in modulating oxygen reactive species (ROS and limiting the oxidative damage in cellular components. SIRT3 targets different enzymes which regulate mitochondrial metabolism and participate in ROS detoxification, such as the complexes of the respiratory chain, the isocitrate dehydrogenase, or the manganese superoxide dismutase. Thus, SIRT3 activity is essential in maintaining mitochondria homeostasis and has recently received great attention, as it is considered a fidelity protein for mitochondrial function. In some types of cancer, SIRT3 functions as a tumoral promoter, since it keeps ROS levels under a certain threshold compatible with cell viability and proliferation. On the contrary, other studies describe SIRT3 as a tumoral suppressor, as SIRT3 could trigger cell death under stress conditions. Thus, SIRT3 could have a dual role in cancer. In this regard, modulation of SIRT3 activity could be a new target to develop more personalized therapies against cancer.

  20. Myeloid-derived suppressor cells in breast cancer.

    Science.gov (United States)

    Markowitz, Joseph; Wesolowski, Robert; Papenfuss, Tracey; Brooks, Taylor R; Carson, William E

    2013-07-01

    Myeloid-derived suppressor cells (MDSCs) are a population of immature myeloid cells defined by their suppressive actions on immune cells such as T cells, dendritic cells, and natural killer cells. MDSCs typically are positive for the markers CD33 and CD11b but express low levels of HLADR in humans. In mice, MDSCs are typically positive for both CD11b and Gr1. These cells exert their suppressive activity on the immune system via the production of reactive oxygen species, arginase, and cytokines. These factors subsequently inhibit the activity of multiple protein targets such as the T cell receptor, STAT1, and indoleamine-pyrrole 2,3-dioxygenase. The numbers of MDSCs tend to increase with cancer burden while inhibiting MDSCs improves disease outcome in murine models. MDSCs also inhibit immune cancer therapeutics. In light of the poor prognosis of metastatic breast cancer in women and the correlation of increasing levels of MDSCs with increasing disease burden, the purposes of this review are to (1) discuss why MDSCs may be important in breast cancer, (2) describe model systems used to study MDSCs in vitro and in vivo, (3) discuss mechanisms involved in MDSC induction/function in breast cancer, and (4) present pre-clinical and clinical studies that explore modulation of the MDSC-immune system interaction in breast cancer. MDSCs inhibit the host immune response in breast cancer patients and diminishing MDSC actions may improve therapeutic outcomes.

  1. Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

    Science.gov (United States)

    Suhor, Charles

    1991-01-01

    Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

  2. Expression of Cucumber mosaic virus suppressor 2b alters FWA methylation and its siRNA accumulation in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Sadia Hamera

    2016-11-01

    Full Text Available The Cucumber mosaic virus (CMV suppressor 2b co-localizes with AGO4 in cytoplasmic and nuclear fractions of Arabidopsis thaliana. Biochemical fractionation of A. thaliana cellular extracts revealed that 2b and AGO4 coexist in multiple size exclusions. 2b transgenic A. thaliana exhibited an enhanced accumulation of 24nt siRNAs from flowering wageningen (FWA and other heterochromatic loci. These plants also exhibited hypo-methylation of an endogenous- as well as transgene-FWA promoter at non-CG sites. In corroboration, both transgenic 2b and CMV infection affected the regulation of transposons which mimics the ago4 phenotype. In conclusion, 2b perturbs plant defense by interfering with AGO4-regulated transcriptional gene silencing.

  3. Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.

    Science.gov (United States)

    Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H

    2009-09-01

    Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.

  4. Silence in the second language classroom

    CERN Document Server

    King, J

    2013-01-01

    Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

  5. Veiled Word(s) – Sacred Silence

    DEFF Research Database (Denmark)

    Isar, Nicoletta

    2014-01-01

    or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

  6. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao; Xiong, Liming

    2010-01-01

    root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results

  7. Mutuality, Self-Silencing, and Disordered Eating in College Women

    Science.gov (United States)

    Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

    2006-01-01

    The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

  8. After the Blackbird Whistles: Listening to Silence in Classrooms

    Science.gov (United States)

    Schultz, Katherine

    2010-01-01

    Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

  9. Choosing Silence for Equality in and through Schooling

    Science.gov (United States)

    Lees, Helen E.

    2016-01-01

    This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

  10. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  11. Epigenetic silencing of serine protease HTRA1 drives polyploidy

    International Nuclear Information System (INIS)

    Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

    2016-01-01

    Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

  12. About hidden influence of predictor variables: Suppressor and mediator variables

    Directory of Open Access Journals (Sweden)

    Milovanović Boško

    2013-01-01

    Full Text Available In this paper procedure for researching hidden influence of predictor variables in regression models and depicting suppressor variables and mediator variables is shown. It is also shown that detection of suppressor variables and mediator variables could provide refined information about the research problem. As an example for applying this procedure, relation between Atlantic atmospheric centers and air temperature and precipitation amount in Serbia is chosen. [Projekat Ministarstva nauke Republike Srbije, br. 47007

  13. Tumor Suppressor RARRES1 Regulates DLG2, PP2A, VCP, EB1, and Ankrd26

    Directory of Open Access Journals (Sweden)

    Ziad J. Sahab, Michael D. Hall, Lihua Zhang, Amrita K. Cheema, Stephen W. Byers

    2010-01-01

    Full Text Available Retinoic Acid Receptor Responder (RARRES1 initially identified as a novel retinoic acid receptor regulated gene in the skin is a putative tumor suppressor of unknown function. RARRES1 was knocked down in immortalized human prostatic epithelial cell line PWR-1E cells and differential protein expression was identified using differential in-gel electrophoresis (DIGE followed by matrix-assisted laser desorption ionization (MALDI mass spectrometry and western Blot analysis excluding highly abundant proteins routinely identified in almost all proteomics projects. Knock-down of RARRES1: 1- down-regulates PP2A, an enzyme involved in the negative regulation of the growth hormone-stimulated signal transduction pathways; 2- down-regulates Valosin-containing protein causing impaired autophagy; 3- up-regulates the tumor suppressor disks large 2; 4- up-regulates Ankrd26 that belongs to the POTE family of genes that are highly expressed in cancer patients with poor outcome; and 5- down-regulates EB1, a protein that is involved in spindle dynamics and chromosome alignment during mitosis.

  14. Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

    Science.gov (United States)

    Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

    2018-02-01

    Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  16. Potential role of TRIM3 as a novel tumour suppressor in colorectal cancer (CRC) development.

    Science.gov (United States)

    Piao, Mei-Yu; Cao, Hai-Long; He, Na-Na; Xu, Meng-Que; Dong, Wen-Xiao; Wang, Wei-Qiang; Wang, Bang-Mao; Zhou, Bing

    2016-01-01

    Colorectal cancer (CRC) is the third leading cause of cancer-related mortality in the United States. Recent cancer genome-sequencing efforts and complementary functional studies have led to the identification of a collection of candidate 'driver' genes involved in CRC tumorigenesis. Tripartite motif (TRIM3) is recently identified as a tumour suppressor in glioblastoma but this tumour-suppressive function has not been investigated in CRC. In this study, we investigated the potential role of TRIM3 as a tumour suppressor in CRC development by manipulating the expression of TRIM3 in two authentic CRC cell lines, HCT116 and DLD1, followed by various functional assays, including cell proliferation, colony formation, scratch wound healing, soft agar, and invasion assays. Xenograft experiment was performed to examine in vivo tumour-suppressive properties of TRIM3. Small-interfering RNA (siRNA) mediated knockdown of TRIM3 conferred growth advantage in CRC cells. In contrast, overexpression of TRIM3 affected cell survival, cell migration, anchorage independent growth and invasive potential in CRC cells. In addition, TRIM3 was found to be down-regulated in human colon cancer tissues compared with matched normal colon tissues. Overexpression of TRIM3 significantly inhibited tumour growth in vivo using xenograft mouse models. Mechanistic investigation revealed that TRIM3 can regulate p53 protein level through its stabilisation. TRIM3 functions as a tumour suppressor in CRC progression. This tumour-suppressive function is exerted partially through regulation of p53 protein. Therefore, this protein may represent a novel therapeutic target for prevention or intervention of CRC.

  17. Human cord blood suppressor T lymphocytes. II. Characterization of inducer of suppressor cells

    International Nuclear Information System (INIS)

    Cheng, H.; Delespesse, G.

    1986-01-01

    Previously, we reported an antigen nonspecific inducer of T suppressor cell factor (TisF) produced by cord blood mononuclear cells (MNC) in 48-hr, two-way mixed lymphocyte cultures (MLC). The target of this factor was a radiosensitive, T4+ (T8-) adult suppressor T cell subset. The cellular origin of this TisF was examined in the present study. IgG production by pokeweed mitogen (PWM)-stimulated adult MNC was used as an assay for TisF activity. It was found that TisF-producing cells formed rosettes with sheep erythrocytes (E+) and were independent of adherent cells (AC) in the production of TisF. They were resistant to irradiation (2500 rads) and phenotypic characterization with T cell reactive monoclonal antibodies indicated that they resided in the T8- (T4+) population. Furthermore, both TQ1- and TQ1+ cells were required for the production of TisF activity and such activity could not be reconstituted by supernatants from TQ1- MLC and TQ1+ MLC. These results indicate that the production of TisF is dependent upon interactions between radioresistant E+, T8-, TQ1- and radioresistant E+, T8-, TQ1+ cells

  18. The chromatin remodelling factor BRG1 is a novel binding partner of the tumor suppressor p16INK4a

    Directory of Open Access Journals (Sweden)

    Mann Graham J

    2009-01-01

    Full Text Available Abstract Background CDKN2A/p16INK4a is frequently altered in human cancers and it is the most important melanoma susceptibility gene identified to date. p16INK4a inhibits pRb phosphorylation and induces cell cycle arrest, which is considered its main tumour suppressor function. Nevertheless, additional activities may contribute to the tumour suppressor role of p16INK4a and could help explain its specific association with melanoma predisposition. To identify such functions we conducted a yeast-two-hybrid screen for novel p16INK4a binding partners. Results We now report that p16INK4a interacts with the chromatin remodelling factor BRG1. We investigated the cooperative roles of p16INK4a and BRG1 using a panel of cell lines and a melanoma cell model with inducible p16INK4a expression and BRG1 silencing. We found evidence that BRG1 is not required for p16INK4a-induced cell cycle inhibition and propose that the p16INK4a-BRG1 complex regulates BRG1 chromatin remodelling activity. Importantly, we found frequent loss of BRG1 expression in primary and metastatic melanomas, implicating this novel p16INK4a binding partner as an important tumour suppressor in melanoma. Conclusion This data adds to the increasing evidence implicating the SWI/SNF chromatin remodelling complex in tumour development and the association of p16INK4a with chromatin remodelling highlights potentially new functions that may be important in melanoma predisposition and chemoresistance.

  19. Boosted expression of the SARS-CoV nucleocapsid protein in tobacco and its immunogenicity in mice.

    Science.gov (United States)

    Zheng, Nuoyan; Xia, Ran; Yang, Cuiping; Yin, Bojiao; Li, Yin; Duan, Chengguo; Liang, Liming; Guo, Huishan; Xie, Qi

    2009-08-06

    Vaccines produced in plant systems are safe and economical; however, the extensive application of plant-based vaccines is mainly hindered by low expression levels of heterologous proteins in plant systems. Here, we demonstrated that the post-transcriptional gene silencing suppressor p19 protein from tomato bushy stunt virus substantially enhanced the transient expression of recombinant SARS-CoV nucleocapsid (rN) protein in Nicotiana benthamiana. The rN protein in the agrobacteria-infiltrated plant leaf accumulated up to a concentration of 79 microg per g fresh leaf weight at 3 days post infiltration. BALB/c mice were intraperitoneally vaccinated with pre-treated plant extract emulsified in Freund's adjuvant. The rN protein-specific IgG in the mouse sera attained a titer about 1:1,800 following three doses of immunization, which suggested effective B-cell maturation and differentiation in mice. Antibodies of the subclasses IgG1 and IgG2a were abundantly present in the mouse sera. During vaccination of rN protein, the expression of IFN-gamma and IL-10 was evidently up-regulated in splenocytes at different time points, while the expression of IL-2 and IL-4 was not. Up to now, this is the first study that plant-expressed recombinant SARS-CoV N protein can induce strong humoral and cellular responses in mice.

  20. Repression of Akt3 gene transcription by the tumor suppressor RIZ1

    OpenAIRE

    Liu, Qingnan; Qu, Xiaotian; Xie, Xiaolei; He, Pei; Huang, Shi

    2018-01-01

    RIZ1 has been studied as a tumor suppressor and may play a role in metabolic diseases related to the Western style diet, such as cancer and obesity. The Akt pathway is known to play a role in both cancer and obesity, and a link between Akt and RIZ1 has also been found. To better understand the role of RIZ1 in obesity and cancer, we investigated how RIZ1 regulates the expression of Akt3. We found that overexpression of RIZ1 in HEK293 cells reduced the expression of Akt3 protein. Luciferase rep...

  1. Long-range epigenetic silencing of chromosome 5q31 protocadherins is involved in early and late stages of colorectal tumorigenesis through modulation of oncogenic pathways

    DEFF Research Database (Denmark)

    Dallosso, A R; Øster, Bodil; Greenhough, A

    2012-01-01

    Loss of tumour suppressor gene function can occur as a result of epigenetic silencing of large chromosomal regions, referred to as long-range epigenetic silencing (LRES), and genome-wide analyses have revealed that LRES is present in many cancer types. Here we utilize Illumina Beadchip methylation...... array analysis to identify LRES across 800 kb of chromosome 5q31 in colorectal adenomas and carcinomas (n=34) relative to normal colonic epithelial DNA (n=6). This region encompasses 53 individual protocadherin (PCDH) genes divided among three gene clusters. Hypermethylation within these gene clusters......–polymerase chain reaction showed that PCDHGC3 is the highest expressed PCDH in normal colonic epithelium, and that there was a strong reciprocal relationship between PCDHGC3 methylation and expression in carcinomas (R=−0.84). PCDH LRES patterns are reflected in colorectal tumour cell lines; adenoma cell lines...

  2. The APC tumor suppressor is required for epithelial cell polarization and three-dimensional morphogenesis

    Science.gov (United States)

    Lesko, Alyssa C.; Goss, Kathleen H.; Yang, Frank F.; Schwertner, Adam; Hulur, Imge; Onel, Kenan; Prosperi, Jenifer R.

    2015-01-01

    The Adenomatous Polyposis Coli (APC) tumor suppressor has been previously implicated in the control of apical-basal polarity; yet, the consequence of APC loss-of-function in epithelial polarization and morphogenesis has not been characterized. To test the hypothesis that APC is required for the establishment of normal epithelial polarity and morphogenesis programs, we generated APC-knockdown epithelial cell lines. APC depletion resulted in loss of polarity and multi-layering on permeable supports, and enlarged, filled spheroids with disrupted polarity in 3D culture. Importantly, these effects of APC knockdown were independent of Wnt/β-catenin signaling, but were rescued with either full-length or a carboxy (c)-terminal segment of APC. Moreover, we identified a gene expression signature associated with APC knockdown that points to several candidates known to regulate cell-cell and cell-matrix communication. Analysis of epithelial tissues from mice and humans carrying heterozygous APC mutations further support the importance of APC as a regulator of epithelial behavior and tissue architecture. These data also suggest that the initiation of epithelial-derived tumors as a result of APC mutation or gene silencing may be driven by loss of polarity and dysmorphogenesis. PMID:25578398

  3. The Regulation of Tumor Suppressor p63 by the Ubiquitin-Proteasome System

    Directory of Open Access Journals (Sweden)

    Stephen R. Armstrong

    2016-12-01

    Full Text Available The protein p63 has been identified as a homolog of the tumor suppressor protein p53 and is capable of inducing apoptosis, cell cycle arrest, or senescence. p63 has at least six isoforms, which can be divided into two major groups: the TAp63 variants that contain the N-terminal transactivation domain and the ΔNp63 variants that lack the N-terminal transactivation domain. The TAp63 variants are generally considered to be tumor suppressors involved in activating apoptosis and suppressing metastasis. ΔNp63 variants cannot induce apoptosis but can act as dominant negative inhibitors to block the function of TAp53, TAp73, and TAp63. p63 is rarely mutated in human tumors and is predominately regulated at the post-translational level by phosphorylation and ubiquitination. This review focuses primarily on regulation of p63 by the ubiquitin E-3 ligase family of enzymes via ubiquitination and proteasome-mediated degradation, and introduces a new key regulator of the p63 protein.

  4. Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B.

    Science.gov (United States)

    Angelo, Ana Luiza Dias; Cavalcante, Lourianne Nascimento; Abe-Sandes, Kiyoko; Machado, Taísa Bonfim; Lemaire, Denise Carneiro; Malta, Fernanda; Pinho, João Renato; Lyra, Luiz Guilherme Costa; Lyra, Andre Castro

    2013-10-01

    Suppressor of cytokine signaling 3, myxovirus resistance protein and osteopontin gene polymorphisms may influence the therapeutic response in patients with chronic hepatitis C, and an association with IL28 might increase the power to predict sustained virologic response. Our aims were to evaluate the association between myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 gene polymorphisms in combination with IL28B and to assess the therapy response in hepatitis C patients treated with pegylated-interferon plus ribavirin. Myxovirus resistance protein, osteopontin, suppressor of cytokine signaling 3 and IL28B polymorphisms were analyzed by PCR-restriction fragment length polymorphism, direct sequencing and real-time PCR. Ancestry was determined using genetic markers. We analyzed 181 individuals, including 52 who were sustained virologic responders. The protective genotype frequencies among the sustained virologic response group were as follows: the G/G suppressor of cytokine signaling 3 (rs4969170) (62.2%); T/T osteopontin (rs2853744) (60%); T/T osteopontin (rs11730582) (64.3%); and the G/T myxovirus resistance protein (rs2071430) genotype (54%). The patients who had ≥3 of the protective genotypes from the myxovirus resistance protein, the suppressor of cytokine signaling 3 and osteopontin had a greater than 90% probability of achieving a sustained response (pC/C IL28B genotype was present in 58.8% of the subjects in this group. The sustained virological response rates increased to 85.7% and 91.7% by analyzing C/C IL28B with the T/T osteopontin genotype at rs11730582 and the G/G suppressor of cytokine signaling 3 genotype, respectively. Genetic ancestry analysis revealed an admixed population. Hepatitis C genotype 1 patients who were responders to interferon-based therapy had a high frequency of multiple protective polymorphisms in the myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 genes. The combined

  5. Polycomb proteins control proliferation and transformation independently of cell cycle checkpoints by regulating DNA replication

    DEFF Research Database (Denmark)

    Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora

    2014-01-01

    The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...

  6. Structural investigation of nucleophosmin interaction with the tumor suppressor Fbw7γ.

    Science.gov (United States)

    Di Matteo, A; Franceschini, M; Paiardini, A; Grottesi, A; Chiarella, S; Rocchio, S; Di Natale, C; Marasco, D; Vitagliano, L; Travaglini-Allocatelli, C; Federici, L

    2017-09-18

    Nucleophosmin (NPM1) is a multifunctional nucleolar protein implicated in ribogenesis, centrosome duplication, cell cycle control, regulation of DNA repair and apoptotic response to stress stimuli. The majority of these functions are played through the interactions with a variety of protein partners. NPM1 is frequently overexpressed in solid tumors of different histological origin. Furthermore NPM1 is the most frequently mutated protein in acute myeloid leukemia (AML) patients. Mutations map to the C-terminal domain and lead to the aberrant and stable localization of the protein in the cytoplasm of leukemic blasts. Among NPM1 protein partners, a pivotal role is played by the tumor suppressor Fbw7γ, an E3-ubiquitin ligase that degrades oncoproteins like c-MYC, cyclin E, Notch and c-jun. In AML with NPM1 mutations, Fbw7γ is degraded following its abnormal cytosolic delocalization by mutated NPM1. This mechanism also applies to other tumor suppressors and it has been suggested that it may play a key role in leukemogenesis. Here we analyse the interaction between NPM1 and Fbw7γ, by identifying the protein surfaces implicated in recognition and key aminoacids involved. Based on the results of computational methods, we propose a structural model for the interaction, which is substantiated by experimental findings on several site-directed mutants. We also extend the analysis to two other NPM1 partners (HIV Tat and CENP-W) and conclude that NPM1 uses the same molecular surface as a platform for recognizing different protein partners. We suggest that this region of NPM1 may be targeted for cancer treatment.

  7. Underground laboratories: Cosmic silence, loud science

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

    2010-01-01

    Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

  8. Silencing cinema: film censorship around the world

    OpenAIRE

    Biltereyst, Daniël; Vande Winkel, Roel

    2013-01-01

    Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

  9. Gas turbine exhaust system silencing design

    International Nuclear Information System (INIS)

    Ozgur, D.

    1991-01-01

    Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

  10. RET is a potential tumor suppressor gene in colorectal cancer

    Science.gov (United States)

    Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.

    2012-01-01

    Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117

  11. Demonstration of helicase activity in the nonstructural protein, NSs, of the negative-sense RNA virus, groundnut bud necrosis virus.

    Science.gov (United States)

    Bhushan, Lokesh; Abraham, Ambily; Choudhury, Nirupam Roy; Rana, Vipin Singh; Mukherjee, Sunil Kumar; Savithri, Handanahal Subbarao

    2015-04-01

    The nonstructural protein NSs, encoded by the S RNA of groundnut bud necrosis virus (GBNV) (genus Tospovirus, family Bunyaviridae) has earlier been shown to possess nucleic-acid-stimulated NTPase and 5' α phosphatase activity. ATP hydrolysis is an essential function of a true helicase. Therefore, NSs was tested for DNA helicase activity. The results demonstrated that GBNV NSs possesses bidirectional DNA helicase activity. An alanine mutation in the Walker A motif (K189A rNSs) decreased DNA helicase activity substantially, whereas a mutation in the Walker B motif resulted in a marginal decrease in this activity. The parallel loss of the helicase and ATPase activity in the K189A mutant confirms that NSs acts as a non-canonical DNA helicase. Furthermore, both the wild-type and K189A NSs could function as RNA silencing suppressors, demonstrating that the suppressor activity of NSs is independent of its helicase or ATPase activity. This is the first report of a true helicase from a negative-sense RNA virus.

  12. A Novel Role of Dickkopf-Related Protein 3 in Macropinocytosis in Human Bladder Cancer T24 Cells

    Directory of Open Access Journals (Sweden)

    Nonoka Tsujimura

    2016-11-01

    Full Text Available Dickkopf-related protein 3 (Dkk-3 is a potential tumor suppressor reported in various cancer entities. However, we found that Dkk-3 was exceptionally upregulated in bladder cancer T24 cells. To validate the biological role of Dkk-3 other than a tumor suppressor, we examined the function of Dkk-3 in T24 cells. Gene silencing of Dkk-3 inhibited cell growth through inducing G0/G1 cell-cycle arrest. Furthermore, Dkk-3 knock-down caused macropinocytosis accompanied by autophagy, which were canceled in part by their inhibitors 5-(N-ethyl-N-isopropyl amiloride (EIPA and 3-methyladenine (3-MA. The macropinocytosis was induced by the Dkk-3 knock-down when there were sufficient extracellular nutrients. On the other hand, when the nutritional condition was poor, the autophagy was mainly induced by the Dkk-3 knock-down. These data indicated that Dkk-3 has a role in modulating macropinocytotic and autophagic pathways, a distinct function other than a Wnt antagonist.

  13. A Novel Role of Dickkopf-Related Protein 3 in Macropinocytosis in Human Bladder Cancer T24 Cells

    Science.gov (United States)

    Tsujimura, Nonoka; Yamada, Nami O.; Kuranaga, Yuki; Kumazaki, Minami; Shinohara, Haruka; Taniguchi, Kohei; Akao, Yukihiro

    2016-01-01

    Dickkopf-related protein 3 (Dkk-3) is a potential tumor suppressor reported in various cancer entities. However, we found that Dkk-3 was exceptionally upregulated in bladder cancer T24 cells. To validate the biological role of Dkk-3 other than a tumor suppressor, we examined the function of Dkk-3 in T24 cells. Gene silencing of Dkk-3 inhibited cell growth through inducing G0/G1 cell-cycle arrest. Furthermore, Dkk-3 knock-down caused macropinocytosis accompanied by autophagy, which were canceled in part by their inhibitors 5-(N-ethyl-N-isopropyl) amiloride (EIPA) and 3-methyladenine (3-MA). The macropinocytosis was induced by the Dkk-3 knock-down when there were sufficient extracellular nutrients. On the other hand, when the nutritional condition was poor, the autophagy was mainly induced by the Dkk-3 knock-down. These data indicated that Dkk-3 has a role in modulating macropinocytotic and autophagic pathways, a distinct function other than a Wnt antagonist. PMID:27827955

  14. E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

    Science.gov (United States)

    Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

    2010-06-01

    Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

  15. A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

    Science.gov (United States)

    Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

  16. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  17. LIFEGUARD proteins support plant colonization by biotrophic powdery mildew fungi.

    Science.gov (United States)

    Weis, Corina; Hückelhoven, Ralph; Eichmann, Ruth

    2013-09-01

    Pathogenic microbes manipulate eukaryotic cells during invasion and target plant proteins to achieve host susceptibility. BAX INHIBITOR-1 (BI-1) is an endoplasmic reticulum-resident cell death suppressor in plants and animals and is required for full susceptibility of barley to the barley powdery mildew fungus Blumeria graminis f.sp. hordei. LIFEGUARD (LFG) proteins resemble BI-1 proteins in terms of predicted membrane topology and cell-death-inhibiting function in metazoans, but display clear sequence-specific distinctions. This work shows that barley (Hordeum vulgare L.) and Arabidopsis thaliana genomes harbour five LFG genes, HvLFGa-HvLFGe and AtLFG1-AtLFG5, whose functions are largely uncharacterized. As observed for HvBI-1, single-cell overexpression of HvLFGa supports penetration success of B. graminis f.sp. hordei into barley epidermal cells, while transient-induced gene silencing restricts it. In penetrated barley epidermal cells, a green fluorescent protein-tagged HvLFGa protein accumulates at the site of fungal entry, around fungal haustoria and in endosomal or vacuolar membranes. The data further suggest a role of LFG proteins in plant-powdery mildew interactions in both monocot and dicot plants, because stable overexpression or knockdown of AtLFG1 or AtLFG2 also support or delay development of the powdery mildew fungus Erysiphe cruciferarum on the respective Arabidopsis mutants. Together, this work has identified new modulators of plant-powdery mildew interactions, and the data further support functional similarities between BI-1 and LFG proteins beyond cell death regulation.

  18. The Quest for the 1p36 Tumor Suppressor

    Science.gov (United States)

    Bagchi, Anindya; Mills, Alea A.

    2010-01-01

    Genomic analyses of late-stage human cancers have uncovered deletions encompassing 1p36, thereby providing an extensive body of literature supporting the idea that a potent tumor suppressor resides in this interval. Although a number of genes have been proposed as 1p36 candidate tumor suppressors, convincing evidence that their encoded products protect from cancer has been scanty. A recent functional study identified CHD5 as a novel tumor suppressor mapping to 1p36. Here we discuss evidence supporting CHD5’s tumor suppressive role. Together, these findings suggest that strategies designed to enhance CHD5 activity could provide novel approaches for treating a broad range of human malignancies. PMID:18413720

  19. [Contact shot from infantry weapons with a flash-suppressor].

    Science.gov (United States)

    Perdekamp, Markus Grosse; Braunwarth, Roland; Schmidt, Ulrike; Schmidt, Wolfgang; Pollak, Stefan

    2003-01-01

    The number of reports on contact shots from firearms with a flash suppressor attached to the muzzle is small. On the basis of a case report (suicidal shot to the forehead with a Kalschnikow AKMS 47 assault rifle) the morphological peculiarities (characteristics soot pattern, relatively small powder cavity and only minor skin tears in the presence of a bony support) are presented and the conclusions to be drawn from the findings regarding the flash-suppressor, the shot distance, the angle of the shot and the way of holding the weapon are discussed.

  20. Suppressors of DnaAATP imposed overinitiation in Escherichia coli

    DEFF Research Database (Denmark)

    Charbon, Godefroid; Riber, Leise; Cohen, Malene

    2011-01-01

    Chromosome replication in Escherichia coli is limited by the supply of DnaA associated with ATP. Cells deficient in RIDA (Regulatory Inactivation of DnaA) due to a deletion of the hda gene accumulate suppressor mutations (hsm) to counteract the overinitiation caused by an elevated DnaAATP level....... Eight spontaneous hda suppressor mutations were identified by whole-genome sequencing, and three of these were analysed further. Two mutations (hsm-2 and hsm-4) mapped in the dnaA gene and led to a reduced ability to initiate replication from oriC. One mutation (hsm-1) mapped to the seqA promoter...

  1. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  2. The antagonistic effect of Banana bunchy top virus multifunctional protein B4 against Fusarium oxysporum.

    Science.gov (United States)

    Zhuang, Jun; Coates, Christopher J; Mao, Qianzhuo; Wu, Zujian; Xie, Lianhui

    2016-06-01

    The viral-induced banana bunchy top disease and the fungal-induced banana blight are two major causes of concern for industrial scale production of bananas. Banana blight is particularly troublesome, affecting ∼80% of crops worldwide. Strict guidelines and protocols are in place in order to ameliorate the effects of this devastating disease, yet little success has been achieved. From the data presented here, we have found that Banana bunchy top virus (BBTV)-infected bananas are more resistant to Fusarium oxysporum f. sp. cubense (Foc). BBTV appears to be antagonistic towards Foc, thus improving the survivability of plants against blight. The BBTV suppressor of RNA silencing, namely protein B4, displays fungicidal properties in vitro. Furthermore, transgenic tomatoes expressing green fluorescent protein (GFP)-tagged protein B4 demonstrate enhanced resistance to F. oxysporum f. sp. lycopersici (Fol). Differential gene expression analysis indicates that increased numbers of photogenesis-related gene transcripts are present in dark-green leaves of B4-GFP-modified tomato plants relative to those found in WT plants. Conversely, the transcript abundance of immunity-related genes is substantially lower in transgenic tomatoes compared with WT plants, suggesting that plant defences may be influenced by protein B4. This viral-fungal interaction provides new insights into microbial community dynamics within a single host and has potential commercial value for the breeding of transgenic resistance to Fusarium-related blight/wilt. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  3. Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.

    Science.gov (United States)

    Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill

    2017-11-01

    Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.

  4. A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

    Directory of Open Access Journals (Sweden)

    Pengfei Ding

    2015-06-01

    Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

  5. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  6. Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

    Science.gov (United States)

    Ussher, Jane M.; Perz, Janette

    2010-01-01

    This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

  7. The tumor suppressor gene Trp53 protects the mouse lens against posterior subcapsular cataracts and the BMP receptor Acvr1 acts as a tumor suppressor in the lens

    Directory of Open Access Journals (Sweden)

    Luke A. Wiley

    2011-07-01

    We previously found that lenses lacking the Acvr1 gene, which encodes a bone morphogenetic protein (BMP receptor, had abnormal proliferation and cell death in epithelial and cortical fiber cells. We tested whether the tumor suppressor protein p53 (encoded by Trp53 affected this phenotype. Acvr1 conditional knockout (Acvr1CKO mouse fiber cells had increased numbers of nuclei that stained for p53 phosphorylated on serine 15, an indicator of p53 stabilization and activation. Deletion of Trp53 rescued the Acvr1CKO cell death phenotype in embryos and reduced Acvr1-dependent apoptosis in postnatal lenses. However, deletion of Trp53 alone increased the number of fiber cells that failed to withdraw from the cell cycle. Trp53CKO and Acvr1;Trp53DCKO (double conditional knockout, but not Acvr1CKO, lenses developed abnormal collections of cells at the posterior of the lens that resembled posterior subcapsular cataracts. Cells from human posterior subcapsular cataracts had morphological and molecular characteristics similar to the cells at the posterior of mouse lenses lacking Trp53. In Trp53CKO lenses, cells in the posterior plaques did not proliferate but, in Acvr1;Trp53DCKO lenses, many cells in the posterior plaques continued to proliferate, eventually forming vascularized tumor-like masses at the posterior of the lens. We conclude that p53 protects the lens against posterior subcapsular cataract formation by suppressing the proliferation of fiber cells and promoting the death of any fiber cells that enter the cell cycle. Acvr1 acts as a tumor suppressor in the lens. Enhancing p53 function in the lens could contribute to the prevention of steroid- and radiation-induced posterior subcapsular cataracts.

  8. Histone methylation-mediated silencing of miR-139 enhances invasion of non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Watanabe, Kousuke; Amano, Yosuke; Ishikawa, Rie; Sunohara, Mitsuhiro; Kage, Hidenori; Ichinose, Junji; Sano, Atsushi; Nakajima, Jun; Fukayama, Masashi; Yatomi, Yutaka; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

    2015-01-01

    MicroRNA expression is frequently altered in human cancers, and some microRNAs act as oncogenes or tumor suppressors. MiR-139-5p (denoted thereafter as miR-139) has recently been reported to function as a tumor suppressor in several types of human cancer (hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer), but its function in non-small-cell lung cancer (NSCLC) and the mechanism of its suppression have not been studied in detail. MiR-139 was suppressed frequently in primary NSCLCs. MiR-139 is located within the intron of PDE2A and its expression was significantly correlated with the expression of PDE2A. A chromatin immunoprecipitation assay revealed that miR-139 was epigenetically silenced by histone H3 lysine 27 trimethylation (H3K27me3) of its host gene PDE2A and this process was independent of promoter DNA methylation. Pharmacological inhibition of both histone methylation and deacetylation-induced miR-139 with its host gene PDE2A. Ectopic expression of miR-139 in lung cancer cell lines did not affect the proliferation nor the migration but significantly suppressed the invasion through the extracellular matrix. In primary NSCLCs, decreased expression of miR-139 was significantly associated with distant lymph node metastasis and histological invasiveness (lymphatic invasion and vascular invasion) on both univariate and multivariate analyses. Collectively, these results suggest that H3K27me3-mediated silencing of miR-139 enhances an invasive and metastatic phenotype of NSCLC

  9. Epigenetic silencing of ADAMTS18 promotes cell migration and invasion of breast cancer through AKT and NF-κB signaling.

    Science.gov (United States)

    Xu, Hongying; Xiao, Qian; Fan, Yu; Xiang, Tingxiu; Li, Chen; Li, Chunhong; Li, Shuman; Hui, Tianli; Zhang, Lu; Li, Hongzhong; Li, Lili; Ren, Guosheng

    2017-06-01

    ADAMTS18 dysregulation plays an important role in many disease processes including cancer. We previously found ADAMTS18 as frequently methylated tumor suppressor gene (TSG) for multiple carcinomas, however, its biological functions and underlying molecular mechanisms in breast carcinogenesis remain unknown. Here, we found that ADAMTS18 was silenced or downregulated in breast cancer cell lines. ADAMTS18 was reduced in primary breast tumor tissues as compared with their adjacent noncancer tissues. ADAMTS18 promoter methylation was detected in 70.8% of tumor tissues by methylation-specific PCR, but none of the normal tissues. Demethylation treatment restored ADAMTS18 expression in silenced breast cell lines. Ectopic expression of ADAMTS18 in breast tumor cells resulted in inhibition of cell migration and invasion. Nude mouse model further confirmed that ADAMTS18 suppressed breast cancer metastasis in vivo. Further mechanistic studies showed that ADAMTS18 suppressed epithelial-mesenchymal transition (EMT), further inhibited migration and invasion of breast cancer cells. ADAMT18 deregulated AKT and NF-κB signaling, through inhibiting phosphorylation levels of AKT and p65. Thus, ADAMTS18 as an antimetastatic tumor suppressor antagonizes AKT and NF-κB signaling in breast tumorigenesis. Its methylation could be a potential tumor biomarker for breast cancer. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  10. Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

    International Nuclear Information System (INIS)

    Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

    2002-01-01

    Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

  11. Organizational Silence in Universities as the Predictor of Organizational Culture

    Directory of Open Access Journals (Sweden)

    Erkan YAMAN

    2014-04-01

    Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

  12. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. PPARγ induces growth inhibition and apoptosis through upregulation of insulin-like growth factor-binding protein-3 in gastric cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, S.Y. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Biomedical Research Institute, School of Medicine, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Kim, M.S.; Lee, M.K. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Kim, J.S.; Yi, H.K. [Department of Biochemistry, School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of); Nam, S.Y. [Department of Alternative Therapy, Jeonju University, Jeonju (Korea, Republic of); Lee, D.Y.; Hwang, P.H. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Biomedical Research Institute, School of Medicine, Chonbuk National University Hospital, Jeonju (Korea, Republic of)

    2015-01-13

    Peroxisome proliferator activator receptor-gamma (PPARγ) is a ligand-activated transcriptional factor involved in the carcinogenesis of various cancers. Insulin-like growth factor-binding protein-3 (IGFBP-3) is a tumor suppressor gene that has anti-apoptotic activity. The purpose of this study was to investigate the anticancer mechanism of PPARγ with respect to IGFBP-3. PPARγ was overexpressed in SNU-668 gastric cancer cells using an adenovirus gene transfer system. The cells in which PPARγ was overexpressed exhibited growth inhibition, induction of apoptosis, and a significant increase in IGFBP-3 expression. We investigated the underlying molecular mechanisms of PPARγ in SNU-668 cells using an IGFBP-3 promoter/luciferase reporter system. Luciferase activity was increased up to 15-fold in PPARγ transfected cells, suggesting that PPARγ may directly interact with IGFBP-3 promoter to induce its expression. Deletion analysis of the IGFBP-3 promoter showed that luciferase activity was markedly reduced in cells without putative p53-binding sites (-Δ1755, -Δ1795). This suggests that the critical PPARγ-response region is located within the p53-binding region of the IGFBP-3 promoter. We further demonstrated an increase in PPARγ-induced luciferase activity even in cells treated with siRNA to silence p53 expression. Taken together, these data suggest that PPARγ exhibits its anticancer effect by increasing IGFBP-3 expression, and that IGFBP-3 is a significant tumor suppressor.

  14. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali

    2010-12-01

    A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

  15. Early Involvement of Death-Associated Protein Kinase Promoter Hypermethylation in the Carcinogenesis of Barrett's Esophageal Adenocarcinoma and Its Association with Clinical Progression

    Directory of Open Access Journals (Sweden)

    Doerthe Kuester

    2007-03-01

    Full Text Available Esophageal Barrett's adenocarcinoma (BA develops through a multistage process, which is associated with the transcriptional silencing of tumor-suppressor genes by promoter CpG island hypermethylation. In this study, we explored the promoter hypermethylation and protein expression of proapoptotic deathassociated protein kinase (DAPK during the multistep Barrett's carcinogenesis cascade. Early BA and paired samples of premalignant lesions of 61 patients were analyzed by methylation-specific polymerase chain reaction and immunohistochemistry. For the association of clinicopathological markers and protein expression, an immunohistochemical tissue microarray analysis of 66 additional BAs of advanced tumor stages was performed. Hypermethylation of DAPK promoter was detected in 20% of normal mucosa, 50% of Barrett's metaplasia, 53% of dysplasia, and 60% of adenocarcinomas, and resulted in a marked decrease in DAPK protein expression (P < .01. The loss of DAPK protein was significantly associated with advanced depth of tumor invasion and advanced tumor stages (P < .001. Moreover, the severity of reflux esophagitis correlated significantly with the hypermethylation rate of the DAPK promoter (P < .003. Thus, we consider DAPK inactivation by promoter hypermethylation as an early event in Barrett's carcinogenesis and suggest that a decreased protein expression of DAPK likely plays a role in the development and progression of BA.

  16. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    Science.gov (United States)

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  17. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  18. Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.

    1995-12-01

    Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

  19. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  20. No-Big-Silence teeb klubituuri / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

  1. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  2. Functional Analysis of In-frame Indel ARID1A Mutations Reveals New Regulatory Mechanisms of Its Tumor Suppressor Functions

    Directory of Open Access Journals (Sweden)

    Bin Guan

    2012-10-01

    Full Text Available AT-rich interactive domain 1A (ARID1A has emerged as a new tumor suppressor in which frequent somatic mutations have been identified in several types of human cancers. Although most ARID1A somatic mutations are frame-shift or nonsense mutations that contribute to mRNA decay and loss of protein expression, 5% of ARID1A mutations are in-frame insertions or deletions (indels that involve only a small stretch of peptides. Naturally occurring in-frame indel mutations provide unique and useful models to explore the biology and regulatory role of ARID1A. In this study, we analyzed indel mutations identified in gynecological cancers to determine how these mutations affect the tumor suppressor function of ARID1A. Our results demonstrate that all in-frame mutants analyzed lost their ability to inhibit cellular proliferation or activate transcription of CDKN1A, which encodes p21, a downstream effector of ARID1A. We also showed that ARID1A is a nucleocytoplasmic protein whose stability depends on its subcellular localization. Nuclear ARID1A is less stable than cytoplasmic ARID1A because ARID1A is rapidly degraded by the ubiquitin-proteasome system in the nucleus. In-frame deletions affecting the consensus nuclear export signal reduce steady-state protein levels of ARID1A. This defect in nuclear exportation leads to nuclear retention and subsequent degradation. Our findings delineate a mechanism underlying the regulation of ARID1A subcellular distribution and protein stability and suggest that targeting the nuclear ubiquitin-proteasome system can increase the amount of the ARID1A protein in the nucleus and restore its tumor suppressor functions.

  3. The tumor suppressor Rb and its related Rbl2 genes are regulated by Utx histone demethylase

    Energy Technology Data Exchange (ETDEWEB)

    Terashima, Minoru; Ishimura, Akihiko; Yoshida, Masakazu [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan); Suzuki, Yutaka; Sugano, Sumio [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561, Chiba (Japan); Suzuki, Takeshi, E-mail: suzuki-t@staff.kanazawa-u.ac.jp [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan)

    2010-08-20

    Research highlights: {yields} Utx increases expression of Rb and Rbl2 genes through its demethylase activity. {yields} Utx changes histone H3 methylation on the Rb and Rbl2 promoters. {yields} Utx induces decreased cell proliferation of mammalian primary cells. -- Abstract: Utx is a candidate tumor suppressor gene that encodes histone H3 lysine 27 (H3K27) demethylase. In this study, we found that ectopic expression of Utx enhanced the expression of retinoblastoma tumor suppressor gene Rb and its related gene Rbl2. This activation was dependent on the demethylase activity of Utx, and was suggested to contribute to the decreased cell proliferation induced by Utx. A chromatin immunoprecipitation assay showed that over-expressed Utx was associated with the promoter regions of Rb and Rbl2 resulting in the removal of repressive H3K27 tri-methylation and the increase in active H3K4 tri-methylation. Furthermore, siRNA-mediated knockdown of Utx revealed the recruitment of endogenous Utx protein on the promoters of Rb and Rbl2 genes. These results indicate that Rb and Rbl2 are downstream target genes of Utx and may play important roles in Utx-mediated cell growth control.

  4. KF-1 ubiquitin ligase: an anxiety suppressor

    Directory of Open Access Journals (Sweden)

    Tamotsu Hashimoto-Gotoh

    2009-05-01

    Full Text Available Anxiety is an instinct that may have developed to promote adaptive survival by evading unnecessary danger. However, excessive anxiety is disruptive and can be a basic disorder of other psychiatric diseases such as depression. The KF-1, a ubiquitin ligase located to the endoplasmic reticulum (ER, may prevent excessive anxiety; kf-1−/− mice exhibit selectively elevated anxiety-like behavior against light or heights. Thus, KF-1 may degrade some target proteins, responsible for promoting anxiety, through the ER-associated degradation pathway, similar to Parkin in Parkinson's disease (PD. Parkin, another ER-ubiquitin ligase, prevents the degeneration of dopaminergic neurons by degrading the target proteins responsible for PD. Molecular phylogenetic studies have revealed that the prototype of kf-1 appeared in the very early phase of animal evolution but was lost, unlike parkin, in the lineage leading up to Drosophila. Therefore, kf-1−/− mice, be a powerful tool for elucidating the molecular mechanisms involved in emotional regulation, and for screening novel anxiolytic/antidepressant compounds.

  5. Chinanteco children’s silences in different classroom situations

    Directory of Open Access Journals (Sweden)

    Valeria Rebolledo Angulo

    2016-01-01

    Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

  6. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  7. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

  8. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-02-04

    microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

  9. An unusual characteristic “flower-like” pattern: flash suppressor burns

    OpenAIRE

    Gurcan, Altun

    2012-01-01

    The case on contact shots from firearms with a flash suppressor is rare. When a rifle fitted with a flash suppressor is fired, the emerging soot-laden gas in the barrel escapes from the slits of the flash suppressor. If the shot is contact or near contact, the flash suppressor will produce a characteristic “flower-like” pattern of seared, blackened zones around the entrance. This paper presents the injury pattern of the flash suppressor in a 29-year-old man who committed suicide with a G3 aut...

  10. An unusual characteristic “flower-like” pattern: flash suppressor burns

    Science.gov (United States)

    Gurcan, Altun

    2012-01-01

    The case on contact shots from firearms with a flash suppressor is rare. When a rifle fitted with a flash suppressor is fired, the emerging soot-laden gas in the barrel escapes from the slits of the flash suppressor. If the shot is contact or near contact, the flash suppressor will produce a characteristic “flower-like” pattern of seared, blackened zones around the entrance. This paper presents the injury pattern of the flash suppressor in a 29-year-old man who committed suicide with a G3 automatic infantry rifle. PMID:23935280

  11. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  12. Insight into the tumor suppressor function of CBP through the viral oncoprotein tax.

    Science.gov (United States)

    Van Orden, K; Nyborg, J K

    2000-01-01

    CREB binding protein (CBP) is a cellular coactivator protein that regulates essentially all known pathways of gene expression. The transcriptional coactivator properties of CBP are utilized by at least 25 different transcription factors representing nearly all known classes of DNA binding proteins. Once bound to their target genes, these transcription factors are believed to tether CBP to the promoter, leading to activated transcription. CBP functions to stimulate transcription through direct recruitment of the general transcription machinery as well as acetylation of both histone and transcription factor substrates. Recent observations indicate that a critical dosage of CBP is required for normal development and tumor suppression, and that perturbations in CBP concentrations may disrupt cellular homeostasis. Furthermore, there is accumulating evidence that CBP deregulation plays a direct role in hematopoietic malignancies. However, the molecular events linking CBP deregulation and malignant transformation are unclear. Further insight into the function of CBP, and its role as a tumor suppressor, can be gained through recent studies of the human T-cell leukemia virus, type I (HTLV-I) Tax oncoprotein. Tax is known to utilize CBP to stimulate transcription from the viral promoter. However, recent data suggest that as a consequence of the Tax-CBP interaction, many cellular transcription factor pathways may be deregulated. Tax disruption of CBP function may play a key role in transformation of the HTLV-I-infected cell. Thus, Tax derailment of CBP may lend important information about the tumor suppressor properties of CBP and serve as a model for the role of CBP in hematopoietic malignancies.

  13. The ethics of silence: Does conflict of interest explain employee silence?

    Science.gov (United States)

    Anderson, James

    2018-03-01

    Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

  14. The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

    Directory of Open Access Journals (Sweden)

    Michael Gary Duncan

    2012-03-01

    Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

  15. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  16. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  17. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells

    International Nuclear Information System (INIS)

    Hung, C.-F.; Cheng, T.-L.; Wu, R.-H.; Teng, C.-F.; Chang, W.-T.

    2006-01-01

    RNA interference (RNAi) is an extremely powerful and widely used gene silencing approach for reverse functional genomics and molecular therapeutics. In mammals, the conserved poly(ADP-ribose) polymerase 2 (PARP-2)/RNase P bidirectional control promoter simultaneously expresses both the PARP-2 protein and RNase P RNA by RNA polymerase II- and III-dependent mechanisms, respectively. To explore this unique bidirectional control system in RNAi-mediated gene silencing strategy, we have constructed two novel bidirectional expression vectors, pbiHsH1 and pbiMmH1, which contained the PARP-2/RNase P bidirectional control promoters from human and mouse, for simultaneous expression of both the protein-coding genes and short hairpin RNAs. Analyses of the dual transcriptional activities indicated that these two bidirectional expression vectors could not only express enhanced green fluorescent protein as a functional reporter but also simultaneously transcribe shLuc for inhibiting the firefly luciferase expression. In addition, to extend its utility for the establishment of inherited stable clones, we have also reconstructed this bidirectional expression system with the blasticidin S deaminase gene, an effective dominant drug resistance selectable marker, and examined both the selection and inhibition efficiencies in drug resistance and gene expression. Moreover, we have further demonstrated that this bidirectional expression system could efficiently co-regulate the functionally important genes, such as overexpression of tumor suppressor protein p53 and inhibition of anti-apoptotic protein Bcl-2 at the same time. In summary, the bidirectional expression vectors, pbiHsH1 and pbiMmH1, should provide a simple, convenient, and efficient novel tool for manipulating the gene function in mammalian cells

  18. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  19. Molecular biology III - Oncogenes and tumor suppressor genes

    International Nuclear Information System (INIS)

    Giaccia, Amato J.

    1996-01-01

    Purpose: The purpose of this course is to introduce to radiation oncologists the basic concepts of tumorigenesis, building on the information that will be presented in the first and second part of this series of lectures. Objective: Our objective is to increase the current understanding of radiation oncologists with the process of tumorigenesis, especially focusing on genes that are altered in many tumor types that are potential candidates for novel molecular strategies. As strategies to treat cancer of cancer are becoming more sophisticated, it will be important for both the practitioner and academician to develop a basic understanding of the function of cancer 'genes'. This will be the third in a series of refresher courses that are meant to address recent advances in Cancer Biology in a way that both clinicians without previous knowledge of molecular biology or experienced researchers will find interesting. The lecture will begin with a basic overview of tumorigenesis; methods of detecting chromosome/DNA alterations, approaches used to isolate oncogenes and tumor suppressor genes, and their role in cell killing by apoptosis. Special attention will be given to oncogenes and tumor suppressor genes that are modulated by ionizing radiation and the tumor microenvironment. We will relate the biology of oncogenes and tumor suppressor genes to basic aspects of radiation biology that would be important in clinical practice. Finally, we will review recent studies on the prognostic significance of p53 mutations and apoptosis in tumor specimens. The main point of this lecture is to relate both researcher and clinician what are the therapeutic ramifications of oncogene and tumor suppressor gene mutations found in human neoptasia

  20. Control of thermoacoustic instability with a drum-like silencer

    Science.gov (United States)

    Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

    2017-10-01

    Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

  1. BDNF: An Oncogene or Tumor Suppressor?

    Science.gov (United States)

    Radin, Daniel P; Patel, Parth

    2017-08-01

    Neurotrophins are a family of growth factors that are vital to the proper development of the central nervous system. Their effects on cells are governed by the expression and activation of the tyrosine kinase receptors TrkA, TrkB and TrkC. TrkB has been immensely implicated in mediating neuronal migration, development and differentiation. It has also been shown to protect several neuronal cell types from an array of cytotoxic stressors after activation by its conjugate ligand brain-derived neurotrophic factor (BDNF). Over the past two decades, it has been shown that TrkB and BDNF are up-regulated in many types of cancers, conferring aggressive phenotypes underpinned by their resistance to several standard chemotherapeutic agents. This resistance to chemotherapy is modulated by the downstream targets of the TrkB receptor which include the well-characterized PI3K /Akt growth pathway, a hallmark of uncontrolled cancer cell growth and proliferation. Pre-clinical efforts to develop inhibitors of this receptor are promising, and such inhibitors also seem to sensitize cancer cells to standard chemotherapies. However, new evidence suggests that BDNF overexpression in the hypothalamus has immunoaugmenting properties, eliciting an increased anti-tumor immune response and reducing the activity of several proteins that would normally confer resistance to chemotherapeutic agents. In the current work, we provide a global analysis of the physiological consequences of TrkB receptor activation in vitro and discuss the dynamic consequences of TrkB activation in vivo. Finally, we propose a clinically-feasible option for increasing BDNF expression in the hypothalamus to more readily utilize the oncolytic effects of BDNF. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  2. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  3. Tyrosine phosphorylation of WW proteins

    Science.gov (United States)

    Reuven, Nina; Shanzer, Matan

    2015-01-01

    A number of key regulatory proteins contain one or two copies of the WW domain known to mediate protein–protein interaction via proline-rich motifs, such as PPxY. The Hippo pathway components take advantage of this module to transduce tumor suppressor signaling. It is becoming evident that tyrosine phosphorylation is a critical regulator of the WW proteins. Here, we review the current knowledge on the involved tyrosine kinases and their roles in regulating the WW proteins. PMID:25627656

  4. High mobility group A1 protein modulates autophagy in cancer cells.

    Science.gov (United States)

    Conte, Andrea; Paladino, Simona; Bianco, Gaia; Fasano, Dominga; Gerlini, Raffaele; Tornincasa, Mara; Renna, Maurizio; Fusco, Alfredo; Tramontano, Donatella; Pierantoni, Giovanna Maria

    2017-11-01

    High Mobility Group A1 (HMGA1) is an architectural chromatin protein whose overexpression is a feature of malignant neoplasias with a causal role in cancer initiation and progression. HMGA1 promotes tumor growth by several mechanisms, including increase of cell proliferation and survival, impairment of DNA repair and induction of chromosome instability. Autophagy is a self-degradative process that, by providing energy sources and removing damaged organelles and misfolded proteins, allows cell survival under stress conditions. On the other hand, hyper-activated autophagy can lead to non-apoptotic programmed cell death. Autophagy deregulation is a common feature of cancer cells in which has a complex role, showing either an oncogenic or tumor suppressor activity, depending on cellular context and tumor stage. Here, we report that depletion of HMGA1 perturbs autophagy by different mechanisms. HMGA1-knockdown increases autophagosome formation by constraining the activity of the mTOR pathway, a major regulator of autophagy, and transcriptionally upregulating the autophagy-initiating kinase Unc-51-like kinase 1 (ULK1). Consistently, functional experiments demonstrate that HMGA1 binds ULK1 promoter region and negatively regulates its transcription. On the other hand, the increase in autophagosomes is not associated to a proportionate increase in their maturation. Overall, the effects of HMGA1 depletion on autophagy are associated to a decrease in cell proliferation and ultimately impact on cancer cells viability. Importantly, silencing of ULK1 prevents the effects of HMGA1-knockdown on cellular proliferation, viability and autophagic activity, highlighting how these effects are, at least in part, mediated by ULK1. Interestingly, this phenomenon is not restricted to skin cancer cells, as similar results have been observed also in HeLa cells silenced for HMGA1. Taken together, these results clearly indicate HMGA1 as a key regulator of the autophagic pathway in cancer cells

  5. Gene trapping identifies a putative tumor suppressor and a new inducer of cell migration

    International Nuclear Information System (INIS)

    Guardiola-Serrano, Francisca; Haendeler, Judith; Lukosz, Margarete; Sturm, Karsten; Melchner, Harald von; Altschmied, Joachim

    2008-01-01

    Tumor necrosis factor alpha (TNFα) is a pleiotropic cytokine involved in apoptotic cell death, cellular proliferation, differentiation, inflammation, and tumorigenesis. In tumors it is secreted by tumor associated macrophages and can have both pro- and anti-tumorigenic effects. To identify genes regulated by TNFα, we performed a gene trap screen in the mammary carcinoma cell line MCF-7 and recovered 64 unique, TNFα-induced gene trap integration sites. Among these were the genes coding for the zinc finger protein ZC3H10 and for the transcription factor grainyhead-like 3 (GRHL3). In line with the dual effects of TNFα on tumorigenesis, we found that ZC3H10 inhibits anchorage independent growth in soft agar suggesting a tumor suppressor function, whereas GRHL3 strongly stimulated the migration of endothelial cells which is consistent with an angiogenic, pro-tumorigenic function

  6. Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

    International Nuclear Information System (INIS)

    Liu Xiaoqun; Qiao Tiankui

    2014-01-01

    Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

  7. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  8. Classification of suppressor additives based on synergistic and antagonistic ensemble effects

    Energy Technology Data Exchange (ETDEWEB)

    Broekmann, P., E-mail: peter.broekmann@iac.unibe.ch [BASF SE, Global Business Unit Electronic Materials, 67056 Ludwigshafen (Germany); Department of Chemistry and Biochemistry, University of Bern, Bern (Switzerland); Fluegel, A.; Emnet, C.; Arnold, M.; Roeger-Goepfert, C.; Wagner, A. [BASF SE, Global Business Unit Electronic Materials, 67056 Ludwigshafen (Germany); Hai, N.T.M. [Department of Chemistry and Biochemistry, University of Bern, Bern (Switzerland); Mayer, D. [BASF SE, Global Business Unit Electronic Materials, 67056 Ludwigshafen (Germany)

    2011-05-01

    Highlights: > Three fundamental types of suppressor additives for copper electroplating could be identified by means of potential transient measurements. > These suppressor additives differ in their synergistic and antagonistic interplay with anions that are chemisorbed on the metallic copper surface during electrodeposition. > In addition these suppressor chemistries reveal different barrier properties with respect to cupric ions and plating additives (Cl, SPS). - Abstract: Three fundamental types of suppressor additives for copper electroplating could be identified by means of potential transient measurements. These suppressor additives differ in their synergistic and antagonistic interplay with anions that are chemisorbed on the metallic copper surface during electrodeposition. In addition these suppressor chemistries reveal different barrier properties with respect to cupric ions and plating additives (Cl, SPS). While the type-I suppressor selectively forms efficient barriers for copper inter-diffusion on chloride-terminated electrode surfaces we identified a type-II suppressor that interacts non-selectively with any kind of anions chemisorbed on copper (chloride, sulfate, sulfonate). Type-I suppressors are vital for the superconformal copper growth mode in Damascene processing and show an antagonistic interaction with SPS (Bis-Sodium-Sulfopropyl-Disulfide) which involves the deactivation of this suppressor chemistry. This suppressor deactivation is rationalized in terms of compositional changes in the layer of the chemisorbed anions due to the competition of chloride and MPS (Mercaptopropane Sulfonic Acid) for adsorption sites on the metallic copper surface. MPS is the product of the dissociative SPS adsorption within the preexisting chloride matrix on the copper surface. The non-selectivity in the adsorption behavior of the type-II suppressor is rationalized in terms of anion/cation pairing effects of the poly-cationic suppressor and the anion-modified copper

  9. Expression of arf tumor suppressor in spermatogonia facilitates meiotic progression in male germ cells.

    Directory of Open Access Journals (Sweden)

    Michelle L Churchman

    2011-07-01

    Full Text Available The mammalian Cdkn2a (Ink4a-Arf locus encodes two tumor suppressor proteins (p16(Ink4a and p19(Arf that respectively enforce the anti-proliferative functions of the retinoblastoma protein (Rb and the p53 transcription factor in response to oncogenic stress. Although p19(Arf is not normally detected in tissues of young adult mice, a notable exception occurs in the male germ line, where Arf is expressed in spermatogonia, but not in meiotic spermatocytes arising from them. Unlike other contexts in which the induction of Arf potently inhibits cell proliferation, expression of p19(Arf in spermatogonia does not interfere with mitotic cell division. Instead, inactivation of Arf triggers germ cell-autonomous, p53-dependent apoptosis of primary spermatocytes in late meiotic prophase, resulting in reduced sperm production. Arf deficiency also causes premature, elevated, and persistent accumulation of the phosphorylated histone variant H2AX, reduces numbers of chromosome-associated complexes of Rad51 and Dmc1 recombinases during meiotic prophase, and yields incompletely synapsed autosomes during pachynema. Inactivation of Ink4a increases the fraction of spermatogonia in S-phase and restores sperm numbers in Ink4a-Arf doubly deficient mice but does not abrogate γ-H2AX accumulation in spermatocytes or p53-dependent apoptosis resulting from Arf inactivation. Thus, as opposed to its canonical role as a tumor suppressor in inducing p53-dependent senescence or apoptosis, Arf expression in spermatogonia instead initiates a salutary feed-forward program that prevents p53-dependent apoptosis, contributing to the survival of meiotic male germ cells.

  10. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  11. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  12. A New Component of the Nasonia Sex Determining Cascade Is Maternally Silenced and Regulates Transformer Expression

    Science.gov (United States)

    Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis

    2013-01-01

    Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455

  13. Optimization and utilization of Agrobacterium-mediated transient protein production in Nicotiana.

    Science.gov (United States)

    Shamloul, Moneim; Trusa, Jason; Mett, Vadim; Yusibov, Vidadi

    2014-04-19

    Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short period of time. However, this technology is only just beginning to be applied to large-scale production as many technological obstacles to scale up are now being overcome. Here, we demonstrate a simple and reproducible method for industrial-scale transient protein production based on vacuum infiltration of Nicotiana plants with Agrobacteria carrying launch vectors. Optimization of Agrobacterium cultivation in AB medium allows direct dilution of the bacterial culture in Milli-Q water, simplifying the infiltration process. Among three tested species of Nicotiana, N. excelsiana (N. benthamiana × N. excelsior) was selected as the most promising host due to the ease of infiltration, high level of reporter protein production, and about two-fold higher biomass production under controlled environmental conditions. Induction of Agrobacterium harboring pBID4-GFP (Tobacco mosaic virus-based) using chemicals such as acetosyringone and monosaccharide had no effect on the protein production level. Infiltrating plant under 50 to 100 mbar for 30 or 60 sec resulted in about 95% infiltration of plant leaf tissues. Infiltration with Agrobacterium laboratory strain GV3101 showed the highest protein production compared to Agrobacteria laboratory strains LBA4404 and C58C1 and wild-type Agrobacteria strains at6, at10, at77 and A4. Co-expression of a viral RNA silencing suppressor, p23 or p19, in N. benthamiana resulted in earlier accumulation and increased production (15-25%) of target protein (influenza virus hemagglutinin).

  14. Silencing by H-NS potentiated the evolution of Salmonella.

    Directory of Open Access Journals (Sweden)

    Sabrina S Ali

    2014-11-01

    Full Text Available The bacterial H-NS protein silences expression from sequences with higher AT-content than the host genome and is believed to buffer the fitness consequences associated with foreign gene acquisition. Loss of H-NS results in severe growth defects in Salmonella, but the underlying reasons were unclear. An experimental evolution approach was employed to determine which secondary mutations could compensate for the loss of H-NS in Salmonella. Six independently derived S. Typhimurium hns mutant strains were serially passaged for 300 generations prior to whole genome sequencing. Growth rates of all lineages dramatically improved during the course of the experiment. Each of the hns mutant lineages acquired missense mutations in the gene encoding the H-NS paralog StpA encoding a poorly understood H-NS paralog, while 5 of the mutant lineages acquired deletions in the genes encoding the Salmonella Pathogenicity Island-1 (SPI-1 Type 3 secretion system critical to invoke inflammation. We further demonstrate that SPI-1 misregulation is a primary contributor to the decreased fitness in Salmonella hns mutants. Three of the lineages acquired additional loss of function mutations in the PhoPQ virulence regulatory system. Similarly passaged wild type Salmonella lineages did not acquire these mutations. The stpA missense mutations arose in the oligomerization domain and generated proteins that could compensate for the loss of H-NS to varying degrees. StpA variants most able to functionally substitute for H-NS displayed altered DNA binding and oligomerization properties that resembled those of H-NS. These findings indicate that H-NS was central to the evolution of the Salmonellae by buffering the negative fitness consequences caused by the secretion system that is the defining characteristic of the species.

  15. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  16. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  17. Breaking the Silence: Feminism and Post humanism

    Directory of Open Access Journals (Sweden)

    Debika Saha

    2015-10-01

    Full Text Available Postmodernism starts its journey by challenging the master narratives of metaphysics and philosophy. In this journey the narrative get replaced either by an emancipation from