WorldWideScience

Sample records for silencing induces nigrostriatal

  1. Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration.

    Science.gov (United States)

    Mor, Danielle E; Tsika, Elpida; Mazzulli, Joseph R; Gould, Neal S; Kim, Hanna; Daniels, Malcolm J; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L; Tan, Victor X; Kalb, Robert G; Caldwell, Kim A; Caldwell, Guy A; Wolfe, John H; Ischiropoulos, Harry

    2017-11-01

    Parkinson's disease (PD) is defined by the loss of dopaminergic neurons in the substantia nigra and the formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated both dopamine levels and α-synuclein expression. Nigrally targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine levels without damaging neurons in non-transgenic mice. In contrast, raising dopamine levels in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable Caenorhabditis elegans models, expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. These data suggest that a unique mechanism links two cardinal features of PD: dopaminergic cell death and α-synuclein aggregation.

  2. Protection of dichlorvos induced oxidative stress and nigrostriatal neuronal death by chronic Coenzyme Q10 pretreatment

    International Nuclear Information System (INIS)

    Binukumar, BK; Gupta, Nidhi; Bal, Amanjit; Gill, Kiran Dip

    2011-01-01

    Numerous epidemiological studies have shown an association between pesticide exposure and increased risk of developing Parkinson's diseases. Oxidative stress generated as a result of mitochondrial dysfunction has been implicated as an important factor in the etiology of Parkinson's disease. Previously, we reported that chronic dichlorvos exposure causes mitochondrial impairments and nigrostriatal neuronal death in rats. The present study was designed to test whether Coenzyme Q 10 (CoQ 10 ) administration has any neuroprotective effect against dichlorvos mediated nigrostriatal neuronal death, α-synuclein aggregation, and motor dysfunction. Male albino rats were administered dichlorvos by subcutaneous injection at a dose of 2.5 mg/kg body weight over a period of 12 weeks. Results obtained there after showed that dichlorvos exposure leads to enhanced mitochondrial ROS production, α-synuclein aggregation, decreased dopamine and its metabolite levels resulting in nigrostriatal neurodegeneration. Pretreatment by Coenzyme Q 10 (4.5 mg/kg ip for 12 weeks) to dichlorvos treated animals significantly attenuated the extent of nigrostriatal neuronal damage, in terms of decreased ROS production, increased dopamine and its metabolite levels, and restoration of motor dysfunction when compared to dichlorvos treated animals. Thus, the present study shows that Coenzyme Q 10 administration may attenuate dichlorvos induced nigrostriatal neurodegeneration, α-synuclein aggregation and motor dysfunction by virtue of its antioxidant action. - Highlights: → CoQ 10 administration attenuates dichlorvos induced nigrostriatal neurodegenaration. → CoQ 10 pre treatment leads to preservation of TH-IR neurons. → CoQ 10 may decrease oxidative damage and α-synuclin aggregation. → CoQ 10 treatment enhances motor function and protects rats from catalepsy.

  3. Role for excitatory amino acids in methamphetamine-induced nigrostriatal dopaminergic toxicity.

    Science.gov (United States)

    Sonsalla, P K; Nicklas, W J; Heikkila, R E

    1989-01-20

    The systemic administration of either methamphetamine or 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to experimental animals produces degenerative changes in nigrostriatal dopaminergic neurons or their axon terminals. This study was conducted to determine if excitatory amino acids, which appear to be involved in various neurodegenerative disorders, might also contribute to the dopaminergic neurotoxicity produced in mice by either methamphetamine or MPTP. MK-801, phencyclidine, and ketamine, noncompetitive antagonists of one subtype of excitatory amino acid receptor, the N-methyl-D-aspartate receptor, provided substantial protection against neurotoxicity produced by methamphetamine but not that produced by MPTP. These findings indicate that excitatory amino acids play an important role in the nigrostriatal dopaminergic damage induced by methamphetamine.

  4. Clinical Features Indicating Nigrostriatal Dopaminergic Degeneration in Drug-Induced Parkinsonism

    Directory of Open Access Journals (Sweden)

    Seung Ha Lee

    2017-01-01

    Full Text Available Objective Patients with drug-induced parkinsonism (DIP may have nigrostriatal dopaminergic degeneration. We studied the clinical features that may indicate nigrostriatal dopaminergic degeneration in patients with DIP. Methods Forty-one DIP patients were classified into normal and abnormal [18F] FP-CIT scan groups. Differences in 32 clinical features and drug withdrawal effects were studied. Results Twenty-eight patients had normal (Group I and 13 patients had abnormal (Group II scans. Eight patients of Group I, but none of Group II, had taken calcium channel blockers (p = 0.040. Three patients of Group I and six of Group II had hyposmia (p = 0.018. After drug withdrawal, Group I showed greater improvement in Unified Parkinson’s Disease Rating Scale total motor scores and subscores for bradykinesia and tremors than Group II. Only hyposmia was an independent factor associated with abnormal scans, but it had suboptimal sensitivity. Conclusion None of the clinical features were practical indicators of nigrostriatal dopaminergic degeneration in patients with DIP.

  5. Testosterone induces molecular changes in dopamine signaling pathway molecules in the adolescent male rat nigrostriatal pathway.

    Directory of Open Access Journals (Sweden)

    Tertia D Purves-Tyson

    Full Text Available Adolescent males have an increased risk of developing schizophrenia, implicating testosterone in the precipitation of dopamine-related psychopathology. Evidence from adult rodent brain indicates that testosterone can modulate nigrostriatal dopamine. However, studies are required to understand the role testosterone plays in maturation of dopamine pathways during adolescence and to elucidate the molecular mechanism(s by which testosterone exerts its effects. We hypothesized that molecular indices of dopamine neurotransmission [synthesis (tyrosine hydroxylase, breakdown (catechol-O-methyl transferase; monoamine oxygenase, transport [vesicular monoamine transporter (VMAT, dopamine transporter (DAT] and receptors (DRD1-D5] would be changed by testosterone or its metabolites, dihydrotestosterone and 17β-estradiol, in the nigrostriatal pathway of adolescent male rats. We found that testosterone and dihydrotestosterone increased DAT and VMAT mRNAs in the substantia nigra and that testosterone increased DAT protein at the region of the cell bodies, but not in target regions in the striatum. Dopamine receptor D2 mRNA was increased and D3 mRNA was decreased in substantia nigra and/or striatum by androgens. These data suggest that increased testosterone at adolescence may change dopamine responsivity of the nigrostriatal pathway by modulating, at a molecular level, the capacity of neurons to transport and respond to dopamine. Further, dopamine turnover was increased in the dorsal striatum following gonadectomy and this was prevented by testosterone replacement. Gene expression changes in the dopaminergic cell body region may serve to modulate both dendritic dopamine feedback inhibition and reuptake in the dopaminergic somatodendritic field as well as dopamine release and re-uptake dynamics at the presynaptic terminals in the striatum. These testosterone-induced changes of molecular indices of dopamine neurotransmission in males are primarily androgen

  6. Attenuation of methamphetamine-induced nigrostriatal dopaminergic neurotoxicity in mice by lipopolysaccharide pretreatment.

    Science.gov (United States)

    Lin, Yin Chiu; Kuo, Yu-Min; Liao, Pao-Chi; Cherng, Chianfang G; Su, Su-Wen; Yu, Lung

    2007-04-30

    Immunological activation has been proposed to play a role in methamphetamine-induced dopaminergic terminal damage. In this study, we examined the roles of lipopolysaccharide, a pro-inflammatory and inflammatory factor, treatment in modulating the methamphetamine-induced nigrostriatal dopamine neurotoxicity. Lipopolysaccharide pretreatment did not affect the basal body temperature or methamphetamine-elicited hyperthermia three days later. Such systemic lipopolysaccharide treatment mitigated methamphetamine-induced striatal dopamine and 3,4-dihydroxyphenylacetic acid depletions in a dose-dependent manner. As the most potent dose (1 mg/kg) of lipopolysaccharide was administered two weeks, one day before or after the methamphetamine dosing regimen, methamphetamine-induced striatal dopamine and 3,4-dihydroxyphenylacetic acid depletions remained unaltered. Moreover, systemic lipopolysaccharide pretreatment (1 mg/kg) attenuated local methamphetamine infusion-produced dopamine and 3,4-dihydroxyphenylacetic acid depletions in the striatum, indicating that the protective effect of lipopolysaccharide is less likely due to interrupted peripheral distribution or metabolism of methamphetamine. We concluded a critical time window for systemic lipopolysaccharide pretreatment in exerting effective protection against methamphetamine-induced nigrostriatal dopamine neurotoxicity.

  7. Minocycline Rescues from Zinc-Induced Nigrostriatal Dopaminergic Neurodegeneration: Biochemical and Molecular Interventions.

    Science.gov (United States)

    Kumar, Vinod; Singh, Brajesh Kumar; Chauhan, Amit Kumar; Singh, Deepali; Patel, Devendra Kumar; Singh, Chetna

    2016-07-01

    Accumulation of zinc (Zn) in dopaminergic neurons is implicated in Parkinson's disease (PD), and microglial activation plays a critical role in toxin-induced Parkinsonism. Oxidative stress is accused in Zn-induced dopaminergic neurodegeneration; however, its connection with microglial activation is still not known. This study was undertaken to elucidate the role and underlying mechanism of microglial activation in Zn-induced nigrostriatal dopaminergic neurodegeneration. Male Wistar rats were treated intraperitoneally with/without zinc sulphate (20 mg/kg) in the presence/absence of minocycline (30 mg/kg), a microglial activation inhibitor, for 2-12 weeks. While neurobehavioral and biochemical indexes of PD and number of dopaminergic neurons were reduced, the number of microglial cells was increased in the substantia nigra of the Zn-exposed animals. Similarly, Zn elevated lipid peroxidation (LPO) and activities of superoxide dismutase (SOD) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase; however, catalase activity was reduced. Besides, Zn increased an association of NADPH oxidase subunit p67(phox) with membrane, cytochrome c release from the mitochondria and cleavage of pro-caspase 3. Zn attenuated the expression of tyrosine hydroxylase (TH) and vesicular monoamine transporter-2 (VMAT-2) while augmented the expression of dopamine transporter (DAT) and heme oxygenase-1 (HO-1). Minocycline alleviated Zn-induced behavioural impairments, loss of TH-positive neurons, activated microglial cells and biochemical indexes and modulated the expression of studied genes/proteins towards normalcy. The results demonstrate that minocycline reduces the number of activated microglial cells and oxidative stress, which rescue from Zn-induced changes in the expression of monoamine transporter and nigrostriatal dopaminergic neurodegeneration.

  8. Running wheel exercise enhances recovery from nigrostriatal dopamine injury without inducing neuroprotection.

    Science.gov (United States)

    O'Dell, S J; Gross, N B; Fricks, A N; Casiano, B D; Nguyen, T B; Marshall, J F

    2007-02-09

    Forced use of the forelimb contralateral to a unilateral injection of the dopaminergic neurotoxin 6-hydroxydopamine can promote recovery of motor function in that limb and can significantly decrease damage to dopamine terminals. The present study was conducted to determine (1) whether a form of voluntary exercise, wheel running, would improve motor performance in rats with such lesions, and (2) whether any beneficial effects of wheel running are attributable to ameliorating the dopaminergic damage. In experiment 1, rats were allowed to run in exercise wheels or kept in home cages for 2 1/2 weeks, then given stereotaxic infusions of 6-hydroxydopamine into the left striatum. The rats were replaced into their original environments (wheels or home cages) for four additional weeks, and asymmetries in forelimb use were quantified at 3, 10, 17, and 24 days postoperatively. After killing, dopaminergic damage was assessed by both quantifying 3 beta-(4-iodophenyl)tropan-2 beta-carboxylic acid methyl ester ([(125)I]RTI-55) binding to striatal dopamine transporters and counting tyrosine hydroxylase-positive cells in the substantia nigra. Exercised 6-hydroxydopamine-infused rats showed improved motor outcomes relative to sedentary lesioned controls, effects that were most apparent at postoperative days 17 and 24. Despite this behavioral improvement, 6-hydroxydopamine-induced loss of striatal dopamine transporters and tyrosine hydroxylase-positive nigral cells in exercised and sedentary groups did not differ. Since prior studies suggested that forced limb use improves motor performance by sparing nigrostriatal dopaminergic neurons from 6-hydroxydopamine damage, experiment 2 used a combined regimen of forced plus voluntary wheel running. Again, we found that the motor performance of exercised rats improved more rapidly than that of sedentary controls, but that there were no differences between these groups in the damage produced by 6-hydroxydopamine. It appears that voluntary

  9. 9-Cis retinoic acid protects against methamphetamine-induced neurotoxicity in nigrostriatal dopamine neurons.

    Science.gov (United States)

    Reiner, David J; Yu, Seong-Jin; Shen, Hui; He, Yi; Bae, Eunkyung; Wang, Yun

    2014-04-01

    Methamphetamine (MA) is a drug of abuse as well as a dopaminergic neurotoxin. 9-Cis retinoic acid (9cRA), a biologically active derivative of vitamin A, has protective effects against damage caused by H(2)O(2) and oxygen-glucose deprivation in vitro as well as infarction and terminal deoxynucleotidyl transferase-mediated dNTP nick-end labeling (TUNEL) labeling in ischemic brain. The purpose of this study was to examine if there was a protective role for 9cRA against MA toxicity in nigrostriatal dopaminergic neurons. Primary dopaminergic neurons, prepared from rat embryonic ventral mesencephalic tissue, were treated with MA. High doses of MA decreased tyrosine hydroxylase (TH) immunoreactivity while increasing TUNEL labeling. These toxicities were significantly reduced by 9cRA. 9cRA also inhibited the export of Nur77 from nucleus to cytosol, a response that activates apoptosis. The interaction of 9cRA and MA in vivo was next examined in adult rats. 9cRA was delivered intracerebroventricularly; MA was given (5 mg/kg, 4×) one day later. Locomotor behavior was measured 2 days after surgery for a period of 48 h. High doses of MA significantly reduced locomotor activity and TH immunoreactivity in striatum. Administration of 9cRA antagonized these changes. Previous studies have shown that 9cRA can induce bone morphogenetic protein-7 (BMP7) expression and that administration of BMP7 attenuates MA toxicity. We demonstrated that MA treatment significantly reduced BMP7 mRNA expression in nigra. Noggin (a BMP antagonist) antagonized 9cRA-induced behavioral recovery and 9cRA-induced normalization of striatal TH levels. Our data suggest that 9cRA has a protective effect against MA-mediated neurodegeneration in dopaminergic neurons via upregulation of BMP.

  10. Attenuation of 6-hydroxydopamine-induced dopaminergic nigrostriatal lesions in superoxide dismutase transgenic mice

    International Nuclear Information System (INIS)

    Cadet, J.L.; Hirata, H.; Asanuma, M.

    1998-01-01

    6-Hydroxydopamine is a neurotoxin that produces degeneration of the nigrostriatal dopaminergic pathway in rodents. Its toxicity is thought to involve the generation of superoxide anion secondary to its autoxidation. To examine the effects of the overexpression of Cu,Zn-superoxide dismutase activity on 6-hydroxydopamine-induced dopaminergic neuronal damage, we have measured the effects of 6-hydroxydopamine on striatal and nigral dopamine transporters and nigral tyrosine hydroxylase-immunoreactive neurons in Cu,Zn-superoxide dismutase transgenic mice. Intracerebroventricular injection of 6-hydroxydopamine (50 μg) in non-transgenic mice produced reductions in the size of striatal area and an enlargement of the cerebral ventricle on both sides of the brains of mice killed two weeks after the injection. In addition, 6-hydroxydopamine caused marked decreases in striatal and nigral [ 125 I]RTI-121-labelled dopamine transporters not only on the injected side but also on the non-injected side of non-transgenic mice; this was associated with decreased cell number and size of tyrosine hydroxylase-immunoreactive dopamine neurons in the substantia nigra pars compacta on both sides in these mice. In contrast, superoxide dismutase transgenic mice were protected against these neurotoxic effects of 6-hydroxydopamine, with the homozygous transgenic mice showing almost complete protection.These results provide further support for a role of superoxide anion in the toxic effects of 6-hydroxydopamine. They also provide further evidence that reactive oxygen species may be the main determining factors in the neurodegenerative effects of catecholamines. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  11. Ibuprofen abates cypermethrin-induced expression of pro-inflammatory mediators and mitogen-activated protein kinases and averts the nigrostriatal dopaminergic neurodegeneration.

    Science.gov (United States)

    Singh, Ashish; Tripathi, Pratibha; Prakash, Om; Singh, Mahendra Pratap

    2016-12-01

    Cypermethrin induces oxidative stress, microglial activation, inflammation and apoptosis leading to Parkinsonism in rats. While ibuprofen, a non-steroidal anti-inflammatory drug, relieves from inflammation, its efficacy against cypermethrin-induced Parkinsonism has not yet been investigated. The study aimed to explore the protective role of ibuprofen in cypermethrin-induced Parkinsonism, an environmentally relevant model of Parkinson's disease (PD), along with its underlying mechanism. Animals were treated with/without cypermethrin in the presence/absence of ibuprofen. Behavioural, immunohistochemical and biochemical parameters of Parkinsonism and expression of pro-inflammatory and pro-apoptotic proteins along with mitogen-activated protein kinases (MAPKs) were determined. Ibuprofen resisted cypermethrin-induced behavioural impairments, striatal dopamine depletion, oxidative stress in the nigrostriatal tissues and loss of the nigral dopamine producing cells and increase in microglial activation along with atypical expression of pro-inflammatory and apoptotic proteins that include cyclooxygenase-2, tumour necrosis factor-α, MAPKs (c-Jun N-terminal kinase, p38 and extracellular signal-regulated kinase), B cell lymphoma 2-associated protein X, tumour suppressor protein p53, cytochrome c and caspase-3 in the nigrostriatal tissue. The results obtained thus demonstrate that ibuprofen lessens inflammation and regulates MAPKs expression thereby averts cypermethrin-induced Parkinsonism.

  12. Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

    Science.gov (United States)

    Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

  13. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

  14. Mucuna pruriens seed extract reduces oxidative stress in nigrostriatal tissue and improves neurobehavioral activity in paraquat-induced Parkinsonian mouse model.

    Science.gov (United States)

    Yadav, Satyndra Kumar; Prakash, Jay; Chouhan, Shikha; Singh, Surya Pratap

    2013-06-01

    Parkinson's disease (PD) is a neurodegenerative disease which causes rigidity, resting tremor and postural instability. Treatment for this disease is still under investigation. Mucuna pruriens (L.), is a traditional herbal medicine, used in India since 1500 B.C., as a neuroprotective agent. In this present study, we evaluated the therapeutic effects of aqueous extract of M. pruriens (Mp) seed in Parkinsonian mouse model developed by chronic exposure to paraquat (PQ). Results of our study revealed that the nigrostriatal portion of Parkinsonian mouse brain showed significantly increased levels of nitrite, malondialdehyde (MDA) and reduced levels of catalase compared to the control. In the Parkinsonian mice hanging time was decreased, whereas narrow beam walk time and foot printing errors were increased. Treatment with aqueous seed extract of Mp significantly increased the catalase activity and decreased the MDA and nitrite level, compared to untreated Parkinsonian mouse brain. Mp treatment also improved the behavioral abnormalities. It increased hanging time, whereas it decreased narrow beam walk time and foot printing error compared to untreated Parkinsonian mouse brain. Furthermore, we observed a significant reduction in tyrosine hydroxylase (TH) immunoreactivity in the substantia nigra (SN) and striatum region of the brain, after treatment with PQ which was considerably restored by the use of Mp seed extract. Our result suggested that Mp seed extract treatment significantly reduced the PQ induced neurotoxicity as evident by decrease in oxidative damage, physiological abnormalities and immunohistochemical changes in the Parkinsonian mouse. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  16. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  17. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  18. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  19. Protection of methamphetamine nigrostriatal toxicity by dietary selenium.

    Science.gov (United States)

    Kim, H C; Jhoo, W K; Choi, D Y; Im, D H; Shin, E J; Suh, J H; Floyd, R A; Bing, G

    1999-12-18

    Multiple dose administration of methamphetamine (MA) results in long-lasting toxic effects in the nigrostriatal dopaminergic system. These effects are considered to be primarily due to oxidative damage mediated by increased production of hydrogen peroxide or other reactive oxygen species in the dopaminergic system. The present study was designed to determine the protective effects of dietary antioxidant selenium on MA-induced neurotoxicity in the nigrostriatal dopaminergic system. Male C57BL/6J mice were fed either selenium-deficient (methamphetamine neurotoxicity and that this protection involves GPx-mediated antioxidant mechanisms. Even though Cu,Zn-SOD activity was significantly elevated by MA treatment, the role of this enzyme in MA-mediated neurotoxicity is not yet clear.

  20. Transgene-induced gene silencing is not affected by a change in ploidy level.

    Directory of Open Access Journals (Sweden)

    Daniela Pignatta

    Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

  1. Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

    DEFF Research Database (Denmark)

    Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

    2017-01-01

    Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

  2. Acrolein acts as a neurotoxin in the nigrostriatal dopaminergic system of rat: involvement of ?-synuclein aggregation and programmed cell death

    OpenAIRE

    Wang, Yi-Ting; Lin, Hui-Ching; Zhao, Wei-Zhong; Huang, Hui-Ju; Lo, Yu-Li; Wang, Hsiang-Tsui; Maan-Yuh Lin, Anya

    2017-01-01

    Clinical studies report significant increases in acrolein (an ?,?-unsaturated aldehyde) in the substantia nigra (SN) of patients with Parkinson?s disease (PD). In the present study, acrolein-induced neurotoxicity in the nigrostriatal dopaminergic system was investigated by local infusion of acrolein (15, 50, 150?nmoles/0.5??l) in the SN of Sprague-Dawley rats. Acrolein-induced neurodegeneration of nigrostriatal dopaminergic system was delineated by reductions in tyrosine hydroxylase (TH) leve...

  3. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  4. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  5. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  6. Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.

    Science.gov (United States)

    Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee

    2017-12-01

    Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  8. D-deprenyl protects nigrostriatal neurons against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced dopaminergic neurotoxicity.

    Science.gov (United States)

    Muralikrishnan, Dhanasekharan; Samantaray, Supriti; Mohanakumar, Kochupurackal P

    2003-10-01

    Selegiline (L-deprenyl) is believed to render protection against l-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-neurotoxicity to a significant extent via a free radical scavenging mechanism, which is independent of its ability to inhibit monoamine oxidase-B (MAO-B) in the brain. We investigated the hydroxyl radical (.OH) scavenging action and neuroprotective effect of D-deprenyl, its less active isomer, in MPTP-induced dopaminergic neurotoxicity in mice to test whether the chemical structure of the molecule or its biological effects contribute to this property. To achieve this goal we studied the effects of D-deprenyl on: (1).OH production in a Fenton reaction; (2) MPTP-induced.OH generation and dopamine (DA) depletion in vivo, employing a sensitive HPLC-electrochemical procedure; and (3) formation of MPP(+) in vivo in the striatum following systemic administration of MPTP, employing an HPLC-photodiode array detection system. D-deprenyl inhibited ferrous citrate-induced.OH in vitro (0.45 microM) and MPTP-induced.OH in vivo in substantia nigra (SN) and in the striatum (1.0 mg/kg, i.p.). D-deprenyl did not, but L-deprenyl (0.5 mg/kg dose) did significantly inhibit formation of MPP(+) in the striatum 90 min following systemic MPTP injection. It failed to affect MAO-B activity at 0.5 mg/kg in the striatum, but effectively blocked MPTP-induced striatal DA depletion. The potency of D-deprenyl to scavenge MPTP-induced.OH in vivo and to render protection against the dopaminergic neurotoxicity without affecting dopamine turnover, MAO-B activity, or formation of MPP(+) in the brain indicates a direct involvement of.OH in the neurotoxic action of MPTP and antioxidant effect in the neuroprotective action of deprenyl. Copyright 2003 Wiley-Liss, Inc.

  9. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana

    2015-10-09

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  10. H ferritin silencing induces protein misfolding in K562 cells: A Raman analysis

    KAUST Repository

    Zolea, Fabiana; Biamonte, Flavia; Candeloro, Patrizio; Di Sanzo, Maddalena; Cozzi, Anna; Di Vito, Anna; Quaresima, Barbara; Lobello, Nadia; Trecroci, Francesca; Di Fabrizio, Enzo M.; Levi, Sonia; Cuda, Giovanni; Costanzo, Francesco

    2015-01-01

    The redox state of the cell is involved in the regulation of many physiological functions as well as in the pathogenesis of several diseases, and is strictly dependent on the amount of iron in its catalytically active state. Alterations of iron homeostasis determine increased steady-state concentrations of Reactive Oxygen Species (ROS) that cause lipid peroxidation, DNA damage and altered protein folding. Ferritin keeps the intracellular iron in a non-toxic and readily available form and consequently plays a central role in iron and redox homeostasis. The protein is composed by 24 subunits of the H- and L-type, coded by two different genes, with structural and functional differences. The aim of this study was to shed light on the role of the single H ferritin subunit (FHC) in keeping the native correct protein three-dimensional structure. To this, we performed Raman spectroscopy on protein extracts from K562 cells subjected to FHC silencing. The results show a significant increase in the percentage of disordered structures content at a level comparable to that induced by H2O2 treatment in control cells. ROS inhibitor and iron chelator were able to revert protein misfolding. This integrated approach, involving Raman spectroscopy and targeted-gene silencing, indicates that an imbalance of the heavy-to-light chain ratio in the ferritin composition is able to induce severe but still reversible modifications in protein folding and uncovers new potential pathogenetic mechanisms associated to intracellular iron perturbation.

  11. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  12. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    Science.gov (United States)

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  14. Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.

  15. Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

    Science.gov (United States)

    Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

    2018-01-01

    Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

  16. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

    NARCIS (Netherlands)

    Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

    2010-01-01

    Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

  17. Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata

    DEFF Research Database (Denmark)

    Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie

    2008-01-01

    Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...

  18. Virus-induced gene silencing (VIGS) as a reverse genetic tool to study development of symbiotic root nodules

    DEFF Research Database (Denmark)

    Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens

    2008-01-01

    Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...

  19. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  20. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  1. Silencing MR-1 attenuates inflammatory damage in mice heart induced by AngII

    International Nuclear Information System (INIS)

    Dai, Wenjian; Chen, Haiyang; Jiang, Jiandong; Kong, Weijia; Wang, Yiguang

    2010-01-01

    Myofibrillogenesis regulator-1(MR-1) can aggravate cardiac hypertrophy induced by angiotensin(Ang) II in mice through activation of NF-κB signaling pathway, and nuclear transcription factor (NF)-κB and activator protein-1(AP-1) regulate inflammatory and immune responses by increasing the expression of specific inflammatory genes in various tissues including heart. Whether inhibition of MR-1 expression will attenuate AngII-induced inflammatory injury in mice heart has not been explored. Herein, we monitored the activation of NF-κB and AP-1, together with expression of pro-inflammatory of interleukin(IL)-6, tumor necrosis factor(TNF)-α, vascular-cell adhesion molecule (VCAM)-1, platelet endothelial cell adhesion molecule (PECAM), and inflammatory cell infiltration in heart of mice which are induced firstly by AngII (PBS),then received MR-1-siRNA or control-siRNA injecting. We found that the activation of NF-κB and AP-1 was inhibited significantly, together with the decreased expression of IL-6, TNF-α, VCAM-1, and PECAM in AngII-induced mice myocardium in MR-1-siRNA injection groups compared with control-siRNA injecting groups. However, the expression level of MR-1 was not an apparent change in PBS-infused groups than in unoperation groups, and MR-1-siRNA do not affect the expression of MR-1 in PBS-infused mice. Our findings suggest that silencing MR-1 protected mice myocardium against inflammatory injury induced by AngII by suppression of pro-inflammatory transcription factors NF-κB and AP-1 signaling pathway.

  2. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  3. Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

    Science.gov (United States)

    Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

    2012-12-11

    Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

  4. An Optimized Protocol to Increase Virus-Induced Gene Silencing Efficiency and Minimize Viral Symptoms in Petunia

    OpenAIRE

    Broderick, Shaun R.; Jones, Michelle L.

    2013-01-01

    Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...

  5. STAT6 silencing induces hepatocellular carcinoma-derived cell apoptosis and growth inhibition by decreasing the RANKL expression.

    Science.gov (United States)

    Qing, Tian; Yamin, Zhang; Guijie, Wang; Yan, Jin; Zhongyang, Shen

    2017-08-01

    Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC) patients. The objective of this study was to investigate the effects and mechanism of STAT6 in human HCC cells. We found that STAT6 silencing significantly inhibited HepG2 and Hep3B cell survival and proliferation. We observed that depletion of STAT6 increased HepG2 and Hep3B cell apoptosis by using a histone DNA ELISA detection kit. STAT6 silencing induced expression of apoptosis-associated genes Bax and caspase-3/7 and inhibited anti-apoptosis gene Bcl-2 levels. We also observed that STAT6 silencing downregulated the expression of receptor activator of NF-κB ligand (RANKL). Our results demonstrated that treatment with pcDNA3.1-RANKL abolished STAT6 depletion-induced HepG2 and Hep3B cell apoptosis and growth inhibition. Based on these findings, we believe that RANKL plays a major role in STAT6-induced HCC cell apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Behavioral, neurochemical, and electrophysiological changes in an early spontaneous mouse model of nigrostriatal degeneration.

    Science.gov (United States)

    Sgadò, Paola; Viaggi, Cristina; Pinna, Annalisa; Marrone, Cristina; Vaglini, Francesca; Pontis, Silvia; Mercuri, Nicola Biagio; Morelli, Micaela; Corsini, Giovanni Umberto

    2011-08-01

    In idiopathic Parkinson's disease, clinical symptoms do not emerge until consistent neurodegeneration has occurred. The late appearance of symptoms implies the existence of a relatively long preclinical period during which several disease-induced neurochemical changes take place to mask the existence of the disease and delay its clinical manifestations. The aim of this study was to examine the neurochemical, neurophysiological, and behavioral changes induced by the loss of nigrostriatal innervation in the En1+/-;En2-/- mouse, in the 10 months following degeneration, compared to En2 null mutant mice. Behavioral analysis (Pole-test, Beam-walking test, and Inverted grid test) and field potential recordings in the striatum indicated that loss of ~70% of nigrostriatal neurons produced no significant functional effects until 8 months of age, when En1+/-;En2-/- animals started to show frank motor deficits and electrophysiological alterations in corticostriatal plasticity. Similarly, alterations in dopamine homeostasis, dopamine turnover, and dopamine innervation were observed in aged animals compared to young En1+/-;En2-/- mice. These data suggests that in En1+/-;En2-/- mice nigrostriatal degeneration in the substantia nigra is functionally compensated.

  7. Diffusion tensor imaging of the nigrostriatal fibers in Parkinson's disease.

    Science.gov (United States)

    Zhang, Yu; Wu, I-Wei; Buckley, Shannon; Coffey, Christopher S; Foster, Eric; Mendick, Susan; Seibyl, John; Schuff, Norbert

    2015-08-01

    Parkinson's disease (PD) is histopathologically characterized by the loss of dopamine neurons in the substantia nigra pars compacta. The depletion of these neurons is thought to reduce the dopaminergic function of the nigrostriatal pathway, as well as the neural fibers that link the substantia nigra to the striatum (putamen and caudate), causing a dysregulation in striatal activity that ultimately leads to lack of movement control. Based on diffusion tensor imaging, visualizing this pathway and measuring alterations of the fiber integrity remain challenging. The objectives were to 1) develop a diffusion tensor tractography protocol for reliably tracking the nigrostriatal fibers on multicenter data; 2) test whether the integrities measured by diffusion tensor imaging of the nigrostriatal fibers are abnormal in PD; and 3) test whether abnormal integrities of the nigrostriatal fibers in PD patients are associated with the severity of motor disability and putaminal dopamine binding ratios. Diffusion tensor tractography was performed on 50 drug-naïve PD patients and 27 healthy control subjects from the international multicenter Parkinson's Progression Marker Initiative. Tractography consistently detected the nigrostriatal fibers, yielding reliable diffusion measures. Fractional anisotropy, along with radial and axial diffusivity of the nigrostriatal tract, showed systematic abnormalities in patients. In addition, variations in fractional anisotropy and radial diffusivity of the nigrostriatal tract were associated with the degree of motor deficits in PD patients. Taken together, the findings imply that the diffusion tensor imaging characteristic of the nigrostriatal tract is potentially an index for detecting and staging of early PD. © 2015 International Parkinson and Movement Disorder Society.

  8. Bypass of cell cycle arrest induced by transient DNMT1 post-transcriptional silencing triggers aneuploidy in human cells

    Directory of Open Access Journals (Sweden)

    Barra Viviana

    2012-02-01

    Full Text Available Abstract Background Aneuploidy has been acknowledged as a major source of genomic instability in cancer, and it is often considered the result of chromosome segregation errors including those caused by defects in genes controlling the mitotic spindle assembly, centrosome duplication and cell-cycle checkpoints. Aneuploidy and chromosomal instability has been also correlated with epigenetic alteration, however the molecular basis of this correlation is poorly understood. Results To address the functional connection existing between epigenetic changes and aneuploidy, we used RNA-interference to silence the DNMT1 gene, encoding for a highly conserved member of the DNA methyl-transferases. DNMT1 depletion slowed down proliferation of near-diploid human tumor cells (HCT116 and triggered G1 arrest in primary human fibroblasts (IMR90, by inducing p53 stabilization and, in turn, p21waf1 transactivation. Remarkably, p53 increase was not caused by DNA damage and was not observed after p14-ARF post-transcriptional silencing. Interestingly, DNMT1 silenced cells with p53 or p14-ARF depleted did not arrest in G1 but, instead, underwent DNA hypomethylation and became aneuploid. Conclusion Our results suggest that DNMT1 depletion triggers a p14ARF/p53 dependent cell cycle arrest to counteract the aneuploidy induced by changes in DNA methylation.

  9. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  10. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  11. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  12. Anatomical and electrophysiological changes in striatal TH interneurons after loss of the nigrostriatal dopaminergic pathway.

    Science.gov (United States)

    Ünal, Bengi; Shah, Fulva; Kothari, Janish; Tepper, James M

    2015-01-01

    Using transgenic mice that express enhanced green fluorescent protein (EGFP) under the control of the tyrosine hydroxylase (TH) promoter, we have previously shown that there are approximately 3,000 striatal EGFP-TH interneurons per hemisphere in mice. Here, we report that striatal TH-EGFP interneurons exhibit a small, transient but significant increase in number after unilateral destruction of the nigrostriatal dopaminergic pathway. The increase in cell number is accompanied by electrophysiological and morphological changes. The intrinsic electrophysiological properties of EGFP-TH interneurons ipsilateral to 6-OHDA lesion were similar to those originally reported in intact mice except for a significant reduction in the duration of a characteristic depolarization induced plateau potential. There was a significant change in the distribution of the four previously described electrophysiologically distinct subtypes of striatal TH interneurons. There was a concomitant increase in the frequency of both spontaneous excitatory and inhibitory post-synaptic currents, while their amplitudes did not change. Nigrostriatal lesions did not affect somatic size or dendritic length or branching, but resulted in an increase in the density of proximal dendritic spines and spine-like appendages in EGFP-TH interneurons. The changes indicate that electrophysiology properties and morphology of striatal EGFP-TH interneurons depend on endogenous levels of dopamine arising from the nigrostriatal pathway. Furthermore, these changes may serve to help compensate for the changes in activity of spiny projection neurons that occur following loss of the nigrostriatal innervation in experimental or in early idiopathic Parkinson's disease by increasing feedforward GABAergic inhibition exerted by these interneurons.

  13. SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

    Directory of Open Access Journals (Sweden)

    Fangfang Li

    2017-09-01

    Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

  14. CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

    DEFF Research Database (Denmark)

    Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

    2016-01-01

    repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

  15. Protocol: using virus-induced gene silencing to study the arbuscular mycorrhizal symbiosis in Pisum sativum

    DEFF Research Database (Denmark)

    Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth

    2010-01-01

    , the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....

  16. Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans

    OpenAIRE

    Takahashi, Megumi; Takagi, Shin

    2017-01-01

    Feeding, a vital behavior in animals, is modulated depending on internal and external factors. In the nematode Caenorhabditis elegans, the feeding organ called the pharynx ingests food by pumping driven by the pharyngeal muscles. Here we report that optical silencing of the body wall muscles, which drive the locomotory movement of worms, affects pumping. In worms expressing the Arch proton pump or the ACR2 anion channel in the body wall muscle cells, the pumping rate decreases after activatio...

  17. Silencing Dkk1 expression rescues dexamethasone-induced suppression of primary human osteoblast differentiation.

    LENUS (Irish Health Repository)

    Butler, Joseph S

    2010-09-01

    The Wnt\\/β-catenin pathway is a major signaling cascade in bone biology, playing a key role in bone development and remodeling. The objectives of this study were firstly, to determine the effects of dexamethasone exposure on Wnt\\/β-catenin signaling at an intracellular and transcriptional level, and secondly, to assess the phenotypic effects of silencing the Wnt antagonist, Dickkopf-1 (Dkk1) in the setting of dexamethasone exposure.

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  20. Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

    Science.gov (United States)

    Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

    2018-02-01

    Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

  1. Silencing p75NTR prevents proNGF-induced endothelial cell death and development of acellular capillaries in rat retina

    Directory of Open Access Journals (Sweden)

    Ahmed Y Shanab

    Full Text Available Accumulation of the nerve growth factor precursor (proNGF and its receptor p75NTR have been associated with several neurodegenerative diseases in both brain and retina. However, whether proNGF contributes to microvascular degeneration remain unexplored. This study seeks to investigate the mechanism by which proNGF/p75NTR induce endothelial cell (EC death and development of acellular capillaries, a surrogate marker of retinal ischemia. Stable overexpression of the cleavage-resistant proNGF and molecular silencing of p75NTR were utilized in human retinal EC and rat retinas in vivo. Stable overexpression of proNGF decreased NGF levels and induced retinal vascular cell death evident by 1.9-fold increase in acellular capillaries and activation of JNK and cleaved-PARP that were mitigated by p75NTRshRNA. In vitro, overexpression of proNGF did not alter TNF-α level, reduced NGF, however induced EC apoptosis evident by activation of JNK and p38 MAPK, cleaved-PARP. Silencing p75NTR using siRNA restored expression of NGF and TrkA activation and prevented EC apoptosis. Treatment of EC with human-mutant proNGF induced apoptosis that coincided with marked protein interaction and nuclear translocation of p75NTR and the neurotrophin receptor interacting factor. These effects were abolished by a selective p75NTR antagonist. Therefore, targeting p75NTR represents a potential therapeutic strategy for diseases associated with aberrant expression of proNGF.

  2. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  3. Protective effect of resveratrol against nigrostriatal pathway injury in striatum via JNK pathway.

    Science.gov (United States)

    Li, Dan; Liu, Nan; Zhao, Liang; Tong, Lei; Kawano, Hitoshi; Yan, Hong-Jing; Li, Hong-Peng

    2017-01-01

    Nigrostriatal pathway injury is one of the traumatic brain injury models that usually lead to neurological dysfunction or neuron necrosis. Resveratrol-induced benefits have recently been demonstrated in several models of neuronal degeneration diseases. However, the protective properties of resveratrol against neurodegeneration have not been explored definitely. Thus, we employ the nigrostriatal pathway injury model to mimic the insults on the brain. Resveratrol decreased the p-ERK expression and increased the p-JNK expression compared to the DMSO group, but not alter the p38 MAPK proteins around the lesion site by Western blot. Prior to the injury, mice were infused with resveratrol intracerebroventricularly with or without JNK-IN-8, a specific c-JNK pathway inhibitor for JNK1, JNK2 and JNK4. The study assessed modified improved neurological function score (mNSS) and beam/walking test, the level of inflammatory cytokines IL-1β, IL-6 and TNF-α, and striatal expression of Bax and Bcl-2 proteins associated with neuronal apoptosis. The results revealed that resveratrol exerted a neuroprotective effect as shown by the improved mNSS and beam latency, anti-inflammatory effects as indicated by the decreased level of IL-1β, TNF-α and IL-6. Furthermore, resveratrol up-regulated the protein expression of p-JNK and Bcl-2, down-regulated the expression of Bax and the number of Fluoro-Jade C (FJC) positive neurons. However, these advantages of resveratrol were abolished by JNK-IN-8 treatment. Overall, we demonstrated that resveratrol treatment attenuates the nigrostriatal pathway injury-induced neuronal apoptosis and inflammation via activation of c-JNK signaling. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Directory of Open Access Journals (Sweden)

    Huai-Juan Xiao

    2014-05-01

    Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.

  5. Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

    Science.gov (United States)

    Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

    2014-01-01

    Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

  6. Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

    Science.gov (United States)

    Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

    2013-05-01

    The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

  7. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  8. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  9. RUNX1-induced silencing of non-muscle myosin heavy chain IIB contributes to megakaryocyte polyploidization.

    Science.gov (United States)

    Lordier, Larissa; Bluteau, Dominique; Jalil, Abdelali; Legrand, Céline; Pan, Jiajia; Rameau, Philippe; Jouni, Dima; Bluteau, Olivier; Mercher, Thomas; Leon, Catherine; Gachet, Christian; Debili, Najet; Vainchenker, William; Raslova, Hana; Chang, Yunhua

    2012-03-06

    Megakaryocytes are unique mammalian cells that undergo polyploidization (endomitosis) during differentiation, leading to an increase in cell size and protein production that precedes platelet production. Recent evidence demonstrates that endomitosis is a consequence of a late failure in cytokinesis associated with a contractile ring defect. Here we show that the non-muscle myosin IIB heavy chain (MYH10) is expressed in immature megakaryocytes and specifically localizes in the contractile ring. MYH10 downmodulation by short hairpin RNA increases polyploidization by inhibiting the return of 4N cells to 2N, but other regulators, such as of the G1/S transition, might regulate further polyploidization of the 4N cells. Conversely, re-expression of MYH10 in the megakaryocytes prevents polyploidization and the transition of 2N to 4N cells. During polyploidization, MYH10 expression is repressed by the major megakaryocyte transcription factor RUNX1. Thus, RUNX1-mediated silencing of MYH10 is required for the switch from mitosis to endomitosis, linking polyploidization with megakaryocyte differentiation.

  10. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

    Science.gov (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

    2007-11-01

    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  11. The silence.

    Science.gov (United States)

    Millenson, Michael L

    2003-01-01

    Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

  12. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death.

    Science.gov (United States)

    Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi

    2015-11-01

    Resveratrol (3,5,4'-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  14. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes

    OpenAIRE

    Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.

    2016-01-01

    Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...

  15. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  16. Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

    2011-01-01

    Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

  17. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  18. Social isolation stress induces ATF-7 phosphorylation and impairs silencing of the 5-HT 5B receptor gene

    Science.gov (United States)

    Maekawa, Toshio; Kim, Seungjoon; Nakai, Daisuke; Makino, Chieko; Takagi, Tsuyoshi; Ogura, Hiroo; Yamada, Kazuyuki; Chatton, Bruno; Ishii, Shunsuke

    2010-01-01

    Many symptoms induced by isolation rearing of rodents may be relevant to neuropsychiatric disorders, including depression. However, identities of transcription factors that regulate gene expression in response to chronic social isolation stress remain elusive. The transcription factor ATF-7 is structurally related to ATF-2, which is activated by various stresses, including inflammatory cytokines. Here, we report that Atf-7-deficient mice exhibit abnormal behaviours and increased 5-HT receptor 5B (Htr5b) mRNA levels in the dorsal raphe nuclei. ATF-7 silences the transcription of Htr5B by directly binding to its 5′-regulatory region, and mediates histone H3-K9 trimethylation via interaction with the ESET histone methyltransferase. Isolation-reared wild-type (WT) mice exhibit abnormal behaviours that resemble those of Atf-7-deficient mice. Upon social isolation stress, ATF-7 in the dorsal raphe nucleus is phosphorylated via p38 and is released from the Htr5b promoter, leading to the upregulation of Htr5b. Thus, ATF-7 may have a critical role in gene expression induced by social isolation stress. PMID:19893493

  19. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    Science.gov (United States)

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death

    Energy Technology Data Exchange (ETDEWEB)

    Guida, Natascia [IRCSS SDN, Naples 80131 (Italy); Laudati, Giusy [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Anzilotti, Serenella [IRCSS SDN, Naples 80131 (Italy); Secondo, Agnese [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Montuori, Paolo [Department of Public Health, ‘Federico II’ University of Naples, Naples (Italy); Di Renzo, Gianfranco [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Canzoniero, Lorella M.T. [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy); Formisano, Luigi, E-mail: cformisa@unisannio.it [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy)

    2015-11-01

    Resveratrol (3,5,4′-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. - Highlights: • Resveratrol via SIRT1/c-Jun downregulates REST mRNA and protein in SH-SY5Y cells. • Non-dioxin-like (NDL) PCB-95 is cytotoxic to

  1. Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death

    International Nuclear Information System (INIS)

    Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M.T.; Formisano, Luigi

    2015-01-01

    Resveratrol (3,5,4′-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. - Highlights: • Resveratrol via SIRT1/c-Jun downregulates REST mRNA and protein in SH-SY5Y cells. • Non-dioxin-like (NDL) PCB-95 is cytotoxic to

  2. The Nigrostriatal Dopamine System and Methamphetamine: Roles for Excitoxicity and Environmental, Metabolic and Oxidative Stress

    National Research Council Canada - National Science Library

    Yamamoto, Bryan

    2002-01-01

    .... Similarly, the psychostimulant drug, methamphetamine also produces relatively selective damage to nigrostriatal dopamine neurons and is a widespread problem and drug of abuse throughout the U.S...

  3. The Nigrostriatal Dopamine System and Methamphetamine: Roles for Excitotoxicity and Environmental, Metabolic and Oxidative Stress

    National Research Council Canada - National Science Library

    Yamamoto, Bryan

    2005-01-01

    .... Similarly, the psychostimulant drug, methamphetamine also produces relatively selective damage to nigrostriatal dopamine neurons and is a widespread problem and drug of abuse throughout the U.S...

  4. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  5. Spliced leader RNA silencing (SLS - a programmed cell death pathway in Trypanosoma brucei that is induced upon ER stress

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2012-05-01

    Full Text Available Abstract Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite cycles between its insect (procyclic form and mammalian hosts (bloodstream form. Trypanosomes lack conventional transcription regulation, and their genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon, the spliced leader (SL is added to all mRNAs from a small RNA, the SL RNA. Trypanosomes lack the machinery for the unfolded protein response (UPR, which in other eukaryotes is induced under endoplasmic reticulum (ER stress. Trypanosomes respond to such stress by changing the stability of mRNAs, which are essential for coping with the stress. However, under severe ER stress that is induced by blocking translocation of proteins to the ER, treatment of cells with chemicals that induce misfolding in the ER, or extreme pH, trypanosomes elicit the spliced leader silencing (SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and tSNAP42, a specific SL RNA transcription factor, fails to bind to its cognate promoter. SLS leads to complete shut-off of trans-splicing. In this review, I discuss the UPR in mammals and compare it to the ER stress response in T. brucei leading to SLS. I summarize the evidence supporting the notion that SLS is a programmed cell death (PCD pathway that is utilized by the parasites to substitute for the apoptosis observed in higher eukaryotes under prolonged ER stress. I present the hypothesis that SLS evolved to expedite the death process, and rapidly remove from the population unfit parasites that, by elimination via SLS, cause minimal damage to the parasite population.

  6. Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

    Directory of Open Access Journals (Sweden)

    Caroline Claude

    Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

  7. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    Science.gov (United States)

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  8. Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic β-cells.

    Science.gov (United States)

    Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen

    2014-06-27

    Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  9. The microRNA effector RNA-induced silencing complex in hidradenitis suppurativa: a significant dysregulation within active inflammatory lesions.

    Science.gov (United States)

    Hessam, S; Sand, M; Skrygan, M; Bechara, Falk G

    2017-09-01

    Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic Component-1 (AGO1) and Component-2 (AGO2), metadherin, and staphylococcal nuclease and Tudor domain-containing-1 (SND1) in inflamed HS tissue compared to healthy and psoriatic controls by real-time reverse transcription polymerase chain reaction. Expression levels of all investigated components were significantly lower in lesional HS skin (n = 18) compared to healthy controls (n = 10). TRBP1, PACT, AGO1, AGO2, and SND1 expression levels were significantly down-regulated in lesional HS skin compared to healthy-appearing perilesional skin (n = 7). TRBP2 and SND1 expression levels were significantly lower in healthy-appearing perilesional skin compared to healthy controls. In lesional HS skin, expression levels of PACT, AGO1, and AGO2 were significantly lower compared to psoriatic skin (n = 10). In summary, our data showed that all investigated components of RISC are dysregulated in the skin of HS patients, providing support for the hypothesis that miRNAs may have a pathological role in the inflammatory pathogenesis of HS.

  10. Nek1 silencing slows down DNA repair and blocks DNA damage-induced cell cycle arrest.

    Science.gov (United States)

    Pelegrini, Alessandra Luíza; Moura, Dinara Jaqueline; Brenner, Bethânia Luise; Ledur, Pitia Flores; Maques, Gabriela Porto; Henriques, João Antônio Pegas; Saffi, Jenifer; Lenz, Guido

    2010-09-01

    Never in mitosis A (NIMA)-related kinases (Nek) are evolutionarily conserved proteins structurally related to the Aspergillus nidulans mitotic regulator NIMA. Nek1 is one of the 11 isoforms of the Neks identified in mammals. Different lines of evidence suggest the participation of Nek1 in response to DNA damage, which is also supported by the interaction of this kinase with proteins involved in DNA repair pathways and cell cycle regulation. In this report, we show that cells with Nek1 knockdown (KD) through stable RNA interference present a delay in DNA repair when treated with methyl-methanesulfonate (MMS), hydrogen peroxide (H(2)O(2)) and cisplatin (CPT). In particular, interstrand cross links induced by CPT take much longer to be resolved in Nek1 KD cells when compared to wild-type (WT) cells. In KD cells, phosphorylation of Chk1 in response to CPT was strongly reduced. While WT cells accumulate in G(2)/M after DNA damage with MMS and H(2)O(2), Nek1 KD cells do not arrest, suggesting that G(2)/M arrest induced by the DNA damage requires Nek1. Surprisingly, CPT-treated Nek1 KD cells arrest with a 4N DNA content similar to WT cells. This deregulation in cell cycle control in Nek1 KD cells leads to an increased sensitivity to genotoxic agents when compared to WT cells. These results suggest that Nek1 is involved in the beginning of the cellular response to genotoxic stress and plays an important role in preventing cell death induced by DNA damage.

  11. The TWEAK-Fn14 system: breaking the silence of cytokine-induced skeletal muscle wasting.

    Science.gov (United States)

    Bhatnagar, S; Kumar, A

    2012-01-01

    The occurrence of skeletal muscle atrophy, a devastating complication of a large number of disease states and inactivity/disuse conditions, provides a never ending quest to identify novel targets for its therapy. Proinflammatory cytokines are considered the mediators of muscle wasting in chronic diseases; however, their role in disuse atrophy has just begun to be elucidated. An inflammatory cytokine, tumor necrosis factor (TNF)- like weak inducer of apoptosis (TWEAK), has recently been identified as a potent inducer of skeletal muscle wasting. TWEAK activates various proteolytic pathways and stimulates the degradation of myofibril protein both in vitro and in vivo. Moreover, TWEAK mediates the loss of skeletal muscle mass and function in response to denervation, a model of disuse atrophy. Adult skeletal muscle express very low to minimal levels of TWEAK receptor, Fn14. Specific catabolic conditions such as denervation, immobilization, or unloading rapidly increase the expression of Fn14 in skeletal muscle which in turn stimulates the TWEAK activation of various catabolic pathways leading to muscle atrophy. In this article, we have discussed the emerging roles and the mechanisms of action of TWEAK-Fn14 system in skeletal muscle with particular reference to different models of muscle atrophy and injury and its potential to be used as a therapeutic target for prevention of muscle loss.

  12. Acute ethanol exposure inhibits silencing of cerebellar Golgi cell firing induced by granule cell axon input

    Directory of Open Access Journals (Sweden)

    Paolo eBotta

    2014-02-01

    Full Text Available Golgi cells (GoCs are specialized interneurons that provide inhibitory input to granule cells in the cerebellar cortex. GoCs are pacemaker neurons that spontaneously fire action potentials, triggering spontaneous inhibitory postsynaptic currents in granule cells and also contributing to the generation tonic GABAA receptor-mediated currents in granule cells. In turn, granule cell axons provide feedback glutamatergic input to GoCs. It has been shown that high frequency stimulation of granule cell axons induces a transient pause in GoC firing in a type 2-metabotropic glutamate receptor (mGluR2-dependent manner. Here, we investigated the effect ethanol on the pause of GoC firing induced by high frequency stimulation of granule cell axons. GoC electrophysiological recordings were performed in parasagittal cerebellar vermis slices from postnatal day 23 to 26 rats. Loose-patch cell-attached recordings revealed that ethanol (40 mM reversibly decreases the pause duration. An antagonist of mGluR2 reduced the pause duration but did not affect the effect of ethanol. Whole-cell voltage-clamp recordings showed that currents evoked by an mGluR2 agonist were not significantly affected by ethanol. Perforated-patch experiments in which hyperpolarizing and depolarizing currents were injected into GoCs demonstrated that there is an inverse relationship between spontaneous firing and pause duration. Slight inhibition of the Na+/K+ pump mimicked the effect of ethanol on pause duration. In conclusion, ethanol reduces the granule cell axon-mediated feedback mechanism by reducing the input responsiveness of GoCs. This would result in a transient increase of GABAA receptor-mediated inhibition of granule cells, limiting information flow at the input stage of the cerebellar cortex.

  13. Reduced TH expression and α-synuclein accumulation contribute towards nigrostriatal dysfunction in experimental hepatic encephalopathy.

    Science.gov (United States)

    Suárez, Isabel; Bodega, Guillermo; Rubio, Miguel; Fernández, Benjamín

    2017-01-01

    The present work examines α-synuclein expression in the nigrostriatal system of a rat chronic hepatic encephalopathy model induced by portacaval anastomosis (PCA). There is evidence that dopaminergic dysfunction in disease conditions is strongly associated with such expression. Possible relationships among dopaminergic neurons, astroglial cells and α-synuclein expression were sought. Brain tissue samples from rats at 1 and 6 months post-PCA, and controls, were analysed immunohistochemically using antibodies against tyrosine hydroxylase (TH), α-synuclein, glial fibrillary acidic protein (GFAP) and ubiquitin (Ub). In the control rats, TH immunoreactivity was detected in the neuronal cell bodies and processes in the substantia nigra pars compacta (SNc). A dense TH-positive network of neurons was also seen in the striatum. In the PCA-exposed rats, however, a reduction in TH-positive neurons was seen at both 1 and 6 months in the SNc, as well as a reduction in TH-positive fibres in the striatum. This was coincident with the appearance of α-synuclein-immunoreactive neurons in the SNc; some of the TH-positive neurons also showed α-synuclein immunoreactivity. In addition, α-synuclein accumulation was seen in the SNc and striatum at both 1 and 6 months post-PCA, whereas α-synuclein was only mildly expressed in the nigrostriatal pathway of the controls. Astrogliosis was also seen following PCA, as revealed by increased GFAP expression from 1 month to 6 months post-PCA in both the SN and striatum. The astroglial activation level in the SN paralleled the reduced neuronal expression of TH throughout PCA exposure. α-synuclein accumulation following PCA may induce dopaminergic dysfunction via the downregulation of TH, as well as astroglial activation.

  14. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  15. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  16. Virus-induced plasma membrane aquaporin PsPIP2;1 silencing inhibits plant water transport of Pisum sativum.

    Science.gov (United States)

    Song, Juanjuan; Ye, Guoliang; Qian, Zhengjiang; Ye, Qing

    2016-12-01

    Aquaporins (AQPs) are known to facilitate water transport across cell membranes, but the role of a single AQP in regulating plant water transport, particularly in plants other than Arabidopsis remains largely unexplored. In the present study, a virus-induced gene silencing (VIGS) technique was employed to suppress the expression of a specific plasma membrane aquaporin PsPIP2;1 of Pea plants (Pisum sativum), and subsequent effects of the gene suppression on root hydraulic conductivity (Lp r ), leaf hydraulic conductivity (K leaf ), root cell hydraulic conductivity (Lp rc ), and leaf cell hydraulic conductivity (Lp lc ) were investigated, using hydroponically grown Pea plants. Compared with control plants, VIGS-PsPIP2;1 plants displayed a significant suppression of PsPIP2;1 in both roots and leaves, while the expression of other four PIP isoforms (PsPIP1;1, PsPIP1;2, PsPIP2;2, and PsPIP2;3) that were simultaneously monitored were not altered. As a consequence, significant declines in water transport of VIGS-PsPIP2;1 plants were observed at both organ and cell levels, i.e., as compared to control plants, Lp r and K leaf were reduced by 29 %, and Lp rc and Lp lc were reduced by 20 and 29 %, respectively. Our results demonstrate that PsPIP2;1 alone contributes substantially to root and leaf water transport in Pea plants, and highlight VIGS a useful tool for investigating the role of a single AQP in regulating plant water transport.

  17. Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

    Science.gov (United States)

    Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

    2015-05-13

    MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

  18. BET inhibition silences expression of MYCN and BCL2 and induces cytotoxicity in neuroblastoma tumor models.

    Directory of Open Access Journals (Sweden)

    Anastasia Wyce

    Full Text Available BET family proteins are epigenetic regulators known to control expression of genes involved in cell growth and oncogenesis. Selective inhibitors of BET proteins exhibit potent anti-proliferative activity in a number of hematologic cancer models, in part through suppression of the MYC oncogene and downstream Myc-driven pathways. However, little is currently known about the activity of BET inhibitors in solid tumor models, and whether down-regulation of MYC family genes contributes to sensitivity. Here we provide evidence for potent BET inhibitor activity in neuroblastoma, a pediatric solid tumor associated with a high frequency of MYCN amplifications. We treated a panel of neuroblastoma cell lines with a novel small molecule inhibitor of BET proteins, GSK1324726A (I-BET726, and observed potent growth inhibition and cytotoxicity in most cell lines irrespective of MYCN copy number or expression level. Gene expression analyses in neuroblastoma cell lines suggest a role of BET inhibition in apoptosis, signaling, and N-Myc-driven pathways, including the direct suppression of BCL2 and MYCN. Reversal of MYCN or BCL2 suppression reduces the potency of I-BET726-induced cytotoxicity in a cell line-specific manner; however, neither factor fully accounts for I-BET726 sensitivity. Oral administration of I-BET726 to mouse xenograft models of human neuroblastoma results in tumor growth inhibition and down-regulation MYCN and BCL2 expression, suggesting a potential role for these genes in tumor growth. Taken together, our data highlight the potential of BET inhibitors as novel therapeutics for neuroblastoma, and suggest that sensitivity is driven by pleiotropic effects on cell growth and apoptotic pathways in a context-specific manner.

  19. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    Hubbard, Kyle; Catalano, Jennifer; Puri, Raj K; Gnatt, Averell

    2008-01-01

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  20. MK-801, but not drugs acting at strychnine-insensitive glycine receptors, attenuate methamphetamine nigrostriatal toxicity.

    Science.gov (United States)

    Layer, R T; Bland, L R; Skolnick, P

    1993-10-15

    Repeated administration of methamphetamine (METH) results in damage to nigrostriatal dopaminergic neurons. Both competitive N-methyl-D-aspartate (NMDA) receptor antagonists and use-dependent cation channel blockers attenuate METH-induced damage. The objectives of the present study were to examine whether comparable reductions in METH-induced damage could be obtained by compounds acting at strychnine-insensitive glycine receptors on the NMDA receptor complex. Four injections of METH (5 mg/kg i.p.) resulted in a approximately 70.9% depletion of striatal dopamine (DA) and approximately 62.7% depletion of dihydroxyphenylacetic acid (DOPAC) content, respectively. A significant protection against METH-induced DA and DOPAC depletion was afforded by the use-dependent channel blocker, MK-801. The competitive glycine antagonist 7-chlorokynurenic acid (7-Cl-KA), the low efficacy glycine partial agonist (+)-3-amino-1-hydroxy-2-pyrrolidone ((+)-HA-966), and the high efficacy partial glycine agonist 1-aminocyclopropane-carboxylic acid (ACPC) were ineffective against METH-induced toxicity despite their abilities to attenuate glutamate-induced neurotoxicity under both in vivo and in vitro conditions. These results indicate that glycinergic ligands do not possess the same broad neuroprotective spectrum as other classes of NMDA antagonists.

  1. The ubiquitin peptidase UCHL1 induces G0/G1 cell cycle arrest and apoptosis through stabilizing p53 and is frequently silenced in breast cancer.

    Directory of Open Access Journals (Sweden)

    Tingxiu Xiang

    Full Text Available Breast cancer (BrCa is a complex disease driven by aberrant gene alterations and environmental factors. Recent studies reveal that abnormal epigenetic gene regulation also plays an important role in its pathogenesis. Ubiquitin carboxyl- terminal esterase L1 (UCHL1 is a tumor suppressor silenced by promoter methylation in multiple cancers, but its role and alterations in breast tumorigenesis remain unclear.We found that UCHL1 was frequently downregulated or silenced in breast cancer cell lines and tumor tissues, but readily expressed in normal breast tissues and mammary epithelial cells. Promoter methylation of UCHL1 was detected in 9 of 10 breast cancer cell lines (90% and 53 of 66 (80% primary tumors, but rarely in normal breast tissues, which was statistically correlated with advanced clinical stage and progesterone receptor status. Pharmacologic demethylation reactivated UCHL1 expression along with concomitant promoter demethylation. Ectopic expression of UCHL1 significantly suppressed the colony formation and proliferation of breast tumor cells, through inducing G0/G1 cell cycle arrest and apoptosis. Subcellular localization study showed that UCHL1 increased cytoplasmic abundance of p53. We further found that UCHL1 induced p53 accumulation and reduced MDM2 protein level, and subsequently upregulated the expression of p21, as well as cleavage of caspase3 and PARP, but not in catalytic mutant UCHL1 C90S-expressed cells.UCHL1 exerts its tumor suppressive functions by inducing G0/G1cell cycle arrest and apoptosis in breast tumorigenesis, requiring its deubiquitinase activity. Its frequent silencing by promoter CpG methylation may serve as a potential tumor marker for breast cancer.

  2. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  3. A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

    Energy Technology Data Exchange (ETDEWEB)

    Ando, Hitoshi [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Natsume, Atsushi, E-mail: anatsume@med.nagoya-u.ac.jp [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Iwami, Kenichiro; Ohka, Fumiharu [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae [Department of Biomolecular Engineering, Tokyo Institute of Technology Graduate School of Bioscience and Biotechnology, Yokohama (Japan); Ito, Kengo [National Center for Geriatrics and Gerontology, Aichi (Japan); Saito, Kiyoshi [Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Sugita, Sachi; Hoshino, Tsuneyoshi [MICRON Inc.Medical Facilities Support Department, Aichi (Japan); Wakabayashi, Toshihiko [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan)

    2013-03-29

    Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas.

  4. A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

    International Nuclear Information System (INIS)

    Ando, Hitoshi; Natsume, Atsushi; Iwami, Kenichiro; Ohka, Fumiharu; Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae; Ito, Kengo; Saito, Kiyoshi; Sugita, Sachi; Hoshino, Tsuneyoshi; Wakabayashi, Toshihiko

    2013-01-01

    Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas

  5. Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

    Science.gov (United States)

    Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

    2016-05-31

    Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

  6. Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

    Science.gov (United States)

    Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

    2015-01-01

    Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

  7. Investigation of the therapeutic potential of N-acetyl cysteine and the tools used to define nigrostriatal degeneration in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Nouraei, Negin; Zarger, Lauren; Weilnau, Justin N.; Han, Jimin; Mason, Daniel M.; Leak, Rehana K., E-mail: leakr@duq.edu

    2016-04-01

    The glutathione precursor N-acetyl-L-cysteine (NAC) is currently being tested on Parkinson's patients for its neuroprotective properties. Our studies have shown that NAC can elicit protection in glutathione-independent manners in vitro. Thus, the goal of the present study was to establish an animal model of NAC-mediated protection in which to dissect the underlying mechanism. Mice were infused intrastriatally with the oxidative neurotoxicant 6-hydroxydopamine (6-OHDA; 4 μg) and administered NAC intraperitoneally (100 mg/kg). NAC-treated animals exhibited higher levels of the dopaminergic terminal marker tyrosine hydroxylase (TH) in the striatum 10d after 6-OHDA. As TH expression is subject to stress-induced modulation, we infused the tracer FluoroGold into the striatum to retrogradely label nigrostriatal projection neurons. As expected, nigral FluoroGold staining and cell counts of FluoroGold{sup +} profiles were both more sensitive measures of nigrostriatal degeneration than measurements relying on TH alone. However, NAC failed to protect dopaminergic neurons 3 weeks following 6-OHDA, an effect verified by four measures: striatal TH levels, nigral TH levels, nigral TH{sup +} cell counts, and nigral FluoroGold levels. Some degree of mild toxicity of FluoroGold and NAC was evident, suggesting that caution must be exercised when relying on FluoroGold as a neuron-counting tool and when designing experiments with long-term delivery of NAC—such as clinical trials on patients with chronic disorders. Finally, the strengths and limitations of the tools used to define nigrostriatal degeneration are discussed. - Highlights: • N-acetyl cysteine (NAC) was injected into animals infused with the toxicant 6-OHDA. • Retrograde tracing with FluoroGold was used to define nigrostriatal cell loss. • Infrared Odyssey imaging and cell counts were used to screen for nigral cell loss. • NAC protected transiently against 6-OHDA but this effect waned over time. • Mildly

  8. The Nigrostriatal Dopamine System and Methamphetamine: Roles for Excitotoxicity and Environment, Metabolic and Oxidative Stress

    National Research Council Canada - National Science Library

    Yamamoto, Bryan

    2001-01-01

    .... Similarly, the psychostimulant drug, methamphetamine also produces relatively selective damage to nigrostriatal dopamine neurons and is rapidly becoming a widespread problem and drug of abuse throughout the U.S...

  9. The Nigrostriatal Dopamine System and Methamphetamine: Roles for Excitotoxicity and Environment, Metabolic and Oxidative Stress

    National Research Council Canada - National Science Library

    Yamamoto, Bryan

    2000-01-01

    .... Similarly, the psycho stimulant drug, methamphetamine also produces relatively selective damage to nigrostriatal dopamine neurons and is rapidly becoming a widespread problem and drug of abuse throughout the U.S...

  10. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    Science.gov (United States)

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  11. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  12. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  13. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  14. TGF-β induces the expression of Nedd4 family-interacting protein 1 (Ndfip1) to silence IL-4 production during iTreg cell differentiation

    Science.gov (United States)

    Beal, Allison M.; Ramos-Hernández, Natalia; Riling, Chris R.; Nowelsky, Erin A.; Oliver, Paula M.

    2011-01-01

    Mice deficient for the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that these animals contain fewer inducible regulatory (iTreg) cells. In vitro, Ndfip1-deficient T cells express normal levels of the transcription factor Foxp3 during the first 48 hours of iTreg cell differentiation, however this cannot be sustained. Abortive Foxp3 expression is because Ndfip1–/– cells produce interleukin 4 (IL-4). We demonstrate that Ndfip1 is transiently unregulated during iTreg cell differentiation in a transforming growth factor-β (TGF-β) dependent manner. Once expressed Ndfip1 promotes Itch-mediated degradation of the transcription factor JunB, thus preventing IL-4 production. Based on these data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iTreg cell differentiation. PMID:22080920

  15. Epigenetic silencing of apoptosis-inducing gene expression can be efficiently overcome by combined SAHA and TRAIL treatment in uterine sarcoma cells.

    Directory of Open Access Journals (Sweden)

    Leopold F Fröhlich

    Full Text Available The lack of knowledge about molecular pathology of uterine sarcomas with a representation of 3-7% of all malignant uterine tumors prevents the establishment of effective therapy protocols. Here, we explored advanced therapeutic options to the previously discovered antitumorigenic effects of the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA by combined treatment with the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL/Apo-2L. In addition, we investigated the uterine sarcoma cell lines, MES-SA and ESS-1, regarding the underlying molecular mechanisms of SAHA and TRAIL-induced apoptosis and their resistance towards TRAIL. Compared to single SAHA or TRAIL treatment, the combination of SAHA with TRAIL led to complete cell death of both tumor cell lines after 24 to 48 hours. In contrast to single SAHA treatment, apoptosis occured faster and was more pronounced in ESS-1 cells than in MES-SA cells. Induction of SAHA- and TRAIL-induced apoptosis was accompanied by upregulation of the intrinsic apoptotic pathway via reduction of mitochondrial membrane potential, caspase-3, -6, and -7 activation, and PARP cleavage, but was also found to be partially caspase-independent. Apoptosis resistance was caused by reduced expression of caspase-8 and DR 4/TRAIL-R1 in ESS-1 and MES-SA cells, respectively, due to epigenetic silencing by DNA hypermethylation of gene promoter sequences. Treatment with the demethylating agent 5-Aza-2'-deoxycytidine or gene transfer therefore restored gene expression and increased the sensitivity of both cell lines against TRAIL-induced apoptosis. Our data provide evidence that deregulation of epigenetic silencing by histone acetylation and DNA hypermethylation might play a fundamental role in the origin of uterine sarcomas. Therefore, tumor growth might be efficiently overcome by a cytotoxic combinatorial treatment of HDAC inhibitors with TRAIL.

  16. Chernobyl silences

    International Nuclear Information System (INIS)

    Grandazzi, G.; Lemarchand, F.

    2006-01-01

    20 years after the Chernobyl nuclear power plant explosion, this book presents the sanitary and ecological actuality of the accident, with direct testimonies translated from russian. It is also a reflexion of women and political men, scientists, philosophers and artists on the changes induced by Chernobyl on the information dissemination and the future of the accident. (A.L.B.)

  17. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    International Nuclear Information System (INIS)

    Lv, Peng; Xue, Peng; Dong, Jian; Peng, Hui; Clewell, Rebecca; Wang, Aiping; Wang, Yue; Peng, Shuangqing; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation

  18. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Peng [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Xue, Peng; Dong, Jian [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Peng, Hui [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Clewell, Rebecca [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Wang, Aiping [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Yue [Institute for Medical Device Standardization Administration, National Institutes for Food and Drug Control, Beijing (China); Peng, Shuangqing [Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2013-11-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.

  19. Novel system uses probasin-based promoter, transcriptional silencers and amplification loop to induce high-level prostate expression

    Directory of Open Access Journals (Sweden)

    Yu Hong

    2007-02-01

    Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.

  20. Utilizing virus-induced gene silencing for the functional characterization of maize genes during infection with the fungal pathogen Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Doehlemann, Gunther

    2013-01-01

    While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.

  1. Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes.

    Science.gov (United States)

    Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C

    2016-01-01

    Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the

  2. Overexpression of parkin in rat nigrostriatal dopamine system protects against methamphetamine neurotoxicity

    Science.gov (United States)

    Liu, Bin; Traini, Roberta; Killinger, Bryan; Schneider, Bernard; Moszczynska, Anna

    2013-01-01

    Methamphetamine (METH) is a central nervous system psychostimulant with a high potential for abuse. At high doses, METH causes a selective degeneration of dopaminergic terminals in the striatum, sparing other striatal terminals and cell bodies. We previously detected a deficit in parkin after binge METH in rat striatal synaptosomes. Parkin is an ubiquitin-protein E3 ligase capable of protecting dopamine neurons from diverse cellular insults. Whether the deficit in parkin mediates the toxicity of METH and whether parkin can protect from toxicity of the drug is unknown. The present study investigated whether overexpression of parkin attenuates degeneration of striatal dopaminergic terminals exposed to binge METH. Parkin overexpression in rat nigrostriatal dopamine system was achieved by microinjection of adeno-associated viral transfer vector 2/6 encoding rat parkin (AAV2/6-parkin) into the substantia nigra pars compacta. The microinjections of AAV2/6-parkin dose-dependently increased parkin levels in both the substantia nigra pars compacta and striatum. The levels of dopamine synthesizing enzyme, tyrosine hydroxylase, remained at the control levels; therefore, tyrosine hydroxylase immunoreactivity was used as an index of dopaminergic terminal integrity. In METH-exposed rats, the increase in parkin levels attenuated METH-induced decreases in striatal tyrosine hydroxylase immunoreactivity in a dose-dependent manner, indicating that parkin can protect striatal dopaminergic terminals against METH neurotoxicity. PMID:23313192

  3. SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

    Energy Technology Data Exchange (ETDEWEB)

    Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

  4. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. JAK inhibition induces silencing of T Helper cytokine secretion and a profound reduction in T regulatory cells.

    Science.gov (United States)

    Keohane, Clodagh; Kordasti, Shahram; Seidl, Thomas; Perez Abellan, Pilar; Thomas, Nicholas S B; Harrison, Claire N; McLornan, Donal P; Mufti, Ghulam J

    2015-10-01

    CD4(+) T cells maintain cancer surveillance and immune tolerance. Chronic inflammation has been proposed as a driver of clonal evolution in myeloproliferative neoplasms (MPN), suggesting that T cells play an important role in their pathogenesis. Treatment with JAK inhibitors (JAKi) results in improvements in MPN-associated constitutional symptoms as well as reductions in splenomegaly. However, effects of JAKi on T cells in MPN are not well established and the baseline immune signature remains unclear. We investigated the frequency and function of CD4(+) T cell subsets in 50 MPN patients at baseline as well as during treatment with either ruxolitinib or fedratinib in a subset. We show that CD4(+)  CD127(low)  CD25(high)  FOXP3(+) T regulatory cells are reduced in MPN patients compared to healthy controls and that this decrease is even more pronounced following JAKi therapy. Moreover, we show that after 6 months of treatment the number of T helper (Th)-17 cells increased. We also describe a functional 'silencing' of T helper cells both in vivo and in vitro and a blockade of pro-inflammatory cytokines from these cells. This profound effect of JAKi on T cell function may underlay augmented rates of atypical infections that have been reported with use of these drugs. © 2015 John Wiley & Sons Ltd.

  6. Silencing hyperoxia-induced C/EBPα in neonatal mice improves lung architecture via enhanced proliferation of alveolar epithelial cells

    Science.gov (United States)

    Yang, Guang; Hinson, Maurice D.; Bordner, Jessica E.; Lin, Qing S.; Fernando, Amal P.; La, Ping; Wright, Clyde J.

    2011-01-01

    Postnatal lung development requires proliferation and differentiation of specific cell types at precise times to promote proper alveolar formation. Hyperoxic exposure can disrupt alveolarization by inhibiting cell growth; however, it is not fully understood how this is mediated. The transcription factor CCAAT/enhancer binding protein-α (C/EBPα) is highly expressed in the lung and plays a role in cell proliferation and differentiation in many tissues. After 72 h of hyperoxia, C/EBPα expression was significantly enhanced in the lungs of newborn mice. The increased C/EBPα protein was predominantly located in alveolar type II cells. Silencing of C/EBPα with a transpulmonary injection of C/EBPα small interfering RNA (siRNA) prior to hyperoxic exposure reduced expression of markers of type I cell and differentiation typically observed after hyperoxia but did not rescue the altered lung morphology at 72 h. Nevertheless, when C/EBPα hyperoxia-exposed siRNA-injected mice were allowed to recover for 2 wk in room air, lung epithelial cell proliferation was increased and lung morphology was restored compared with hyperoxia-exposed control siRNA-injected mice. These data suggest that C/EBPα is an important regulator of postnatal alveolar epithelial cell proliferation and differentiation during injury and repair. PMID:21571903

  7. Trichodiene Production in a Trichoderma harzianum erg1-Silenced Strain Provides Evidence of the Importance of the Sterol Biosynthetic Pathway in Inducing Plant Defense-Related Gene Expression.

    Science.gov (United States)

    Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S

    2015-11-01

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp.

  8. Galectin-3 silencing inhibits epirubicin-induced ATP binding cassette transporters and activates the mitochondrial apoptosis pathway via β-catenin/GSK-3β modulation in colorectal carcinoma.

    Directory of Open Access Journals (Sweden)

    Yung-Kuo Lee

    Full Text Available Multidrug resistance (MDR, an unfavorable factor compromising the treatment efficacy of anticancer drugs, involves the upregulation of ATP binding cassette (ABC transporters and induction of galectin-3 signaling. Galectin-3 plays an anti-apoptotic role in many cancer cells and regulates various pathways to activate MDR. Thus, the inhibition of galectin-3 has the potential to enhance the efficacy of the anticancer drug epirubicin. In this study, we examined the effects and mechanisms of silencing galectin-3 via RNA interference (RNAi on the β-catenin/GSK-3β pathway in human colon adenocarcinoma Caco-2 cells. Galectin-3 knockdown increased the intracellular accumulation of epirubicin in Caco-2 cells; suppressed the mRNA expression of galectin-3, β-catenin, cyclin D1, c-myc, P-glycoprotein (P-gp, MDR-associated protein (MRP 1, and MRP2; and downregulated the protein expression of P-gp, cyclin D1, galectin-3, β-catenin, c-Myc, and Bcl-2. Moreover, galectin-3 RNAi treatment significantly increased the mRNA level of GSK-3β, Bax, caspase-3, and caspase-9; remarkably increased the Bax-to-Bcl-2 ratio; and upregulated the GSK-3β and Bax protein expressions. Apoptosis was induced by galectin-3 RNAi and/or epirubicin as demonstrated by chromatin condensation, a higher sub-G1 phase proportion, and increased caspase-3 and caspase-9 activity, indicating an intrinsic/mitochondrial apoptosis pathway. Epirubicin-mediated resistance was effectively inhibited via galectin-3 RNAi treatment. However, these phenomena could be rescued after galectin-3 overexpression. We show for the first time that the silencing of galectin-3 sensitizes MDR cells to epirubicin by inhibiting ABC transporters and activating the mitochondrial pathway of apoptosis through modulation of the β-catenin/GSK-3β pathway in human colon cancer cells.

  9. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)

    2016-08-15

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  10. IFNγ Induces DNA Methylation-Silenced GPR109A Expression via pSTAT1/p300 and H3K18 Acetylation in Colon Cancer.

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin

    2015-07-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.

  11. IFNγ induces DNA methylation-silenced GPR109A expression via pSTAT1/p300 and H3K18 acetylation in colon cancer

    Science.gov (United States)

    Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin

    2015-01-01

    Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954

  12. UV-C-Induced alleviation of transcriptional gene silencing through plant–plant communication: Key roles of jasmonic acid and salicylic acid pathways

    International Nuclear Information System (INIS)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-01-01

    Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.

  13. Silencing of the glucocorticoid-induced leucine zipper improves the immunogenicity of clinical-grade dendritic cells

    DEFF Research Database (Denmark)

    Cathelin, Dominique; Met, Özcan; Svane, Inge Marie

    2013-01-01

    The maturation cocktail composed of interleukin (IL)-6, IL-1β, tumor necrosis factor-α and prostaglandin E2 is considered the "gold standard" for inducing the maturation of dendritic cells (DCs) for use in cancer immunotherapy. Nevertheless, although this maturation cocktail induces increased...

  14. TGF-β induces the expression of the adaptor Ndfip1 to silence IL-4 production during iTreg cell differentiation.

    Science.gov (United States)

    Beal, Allison M; Ramos-Hernández, Natalia; Riling, Chris R; Nowelsky, Erin A; Oliver, Paula M

    2011-11-13

    Mice deficient in the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that such mice had fewer inducible regulatory T cells (iT(reg) cells). In vitro, Ndfip1-deficient T cells expressed normal amounts of the transcription factor Foxp3 during the first 48 h of iT(reg) cell differentiation; however, this expression was not sustained. Abortive Foxp3 expression was caused by production of interleukin 4 (IL-4) by Ndfip1(-/-) cells. We found that Ndfip1 expression was transiently upregulated during iT(reg) cell differentiation in a manner dependent on transforming growth factor-β (TGF-β). Once expressed, Ndfip1 promoted degradation of the transcription factor JunB mediated by the E3 ubiquitin ligase Itch, thus preventing IL-4 production. On the basis of our data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iT(reg) cell differentiation.

  15. Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

    Science.gov (United States)

    Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

    2014-01-01

    SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

  16. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  17. Silencing Histone Deacetylase 7 Alleviates Transforming Growth Factor-β1-Induced Profibrotic Responses in Fibroblasts Derived from Peyronie’s Plaque

    Directory of Open Access Journals (Sweden)

    Dong Hyuk Kang

    2018-05-01

    Full Text Available Purpose: Epigenetic modifications, such as histone acetylation/deacetylation and DNA methylation, play a crucial role in the pathogenesis of inflammatory disorders and fibrotic diseases. The aim of this study was to study the differential gene expression of histone deacetylases (HDACs in fibroblasts isolated from plaque tissue of Peyronie’s disease (PD or normal tunica albuginea (TA and to examine the anti-fibrotic effect of small interfering RNA (siRNA-mediated silencing of HDAC7 in fibroblasts derived from human PD plaque. Materials and Methods: For differential gene expression study, we performed reverse-transcriptase polymerase chain reaction for HDAC isoforms (1–11 in fibroblasts isolated from PD plaque or normal TA. Fibroblasts isolated from PD plaque were pretreated with HDAC7 siRNA (100 pmol and then stimulated with transforming growth factor-β1 (TGF-β1, 10 ng/mL. Protein was extracted from treated fibroblasts for Western blotting. We also performed immunocytochemistry to detect the expression of extracellular matrix proteins and to examine the effect of HDAC2 siRNA on the TGF-β1-induced nuclear translocation of Smad2/3 and myofibroblastic differentiation. Results: The mRNA expression of HDAC2, 3, 4, 5, 7, 8, 10, and 11 was higher in fibroblasts isolated from PD plaque than in fibroblasts isolated from normal TA tissue. Knockdown of HDAC7 in PD fibroblasts inhibited TGF-β1-induced nuclear shuttle of Smad2 and Smad3, transdifferentiation of fibroblasts into myofibroblasts, and abrogated TGF-β1-induced production of extracellular matrix protein. Conclusions: These findings suggest that specific inhibition of HDAC7 with RNA interference may represent a promising epigenetic therapy for PD.

  18. Silencing of osteopontin promotes the radiosensitivity of breast cancer cells by reducing the expression of hypoxia inducible factor 1 and vascular endothelial growth factor

    Institute of Scientific and Technical Information of China (English)

    YANG Li; ZHAO Wei; ZUO Wen-shu; WEI Ling; SONG Xian-rang; WANG Xing-wu; ZHENG Gang; ZHENG Mei-zhu

    2012-01-01

    Background Osteopontin (OPN) is a secreted phosphoglycoprotein (SSP) that is overexpressed in a variety of tumors and was regarded as a molecular marker of tumors.In this study,we intended to demonstrate the role of OPN in human breast cancer cell line MDA-MB-231.Methods Recombinant plasmid expressing small interfering RNA (siRNA) specific to OPN mRNA was transfected into MDA-MB-231 cells to generate the stable transfected cell line MDA-MB-343,and the empty plasmid tansfected cells (MDA-MB-neg) or wildtype MDA-MB-231 cells were used as control cells respectively.Expression of OPN,hypoxia inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) proteins was analyzed by Western blotting analysis.The radiosensitivity of cells was determined by detecting cell apoptosis,cell proliferation and cell senescence.Results HIF-1 and VEGF proteins in MDA-MB-343 cells were significantly downregulated upon the efficient knockdown of OPN expression under either hypoxia or normoxia environment.Moreover,expression of OPN protein was upregualted upon hypoxic culture.Stable OPN-silencing also decreased cell invasion,increased cell apoptosis and cell senescence,as well as reduced clonogenic survival,resulting in increase radiation tolerance.Conclusions Suppression of OPN gene expression can enhance radiosensitivity and affect cell apoptosis in breast cancer cells.OPN seems to be an attractive target for the improvement of radiotherapy.

  19. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  20. Identification of Proteins Using iTRAQ and Virus-Induced Gene Silencing Reveals Three Bread Wheat Proteins Involved in the Response to Combined Osmotic-Cold Stress.

    Science.gov (United States)

    Zhang, Ning; Zhang, Lingran; Shi, Chaonan; Zhao, Lei; Cui, Dangqun; Chen, Feng

    2018-05-25

    Crops are often subjected to a combination of stresses in the field. To date, studies on the physiological and molecular responses of common wheat to a combination of osmotic and cold stresses, however, remain unknown. In this study, wheat seedlings exposed to osmotic-cold stress for 24 h showed inhibited growth, as well as increased lipid peroxidation, relative electrolyte leakage, and soluble sugar contents. iTRAQ-based quantitative proteome method was employed to determine the proteomic profiles of the roots and leaves of wheat seedlings exposed to osmotic-cold stress conditions. A total of 250 and 258 proteins with significantly altered abundance in the roots and leaves were identified, respectively, and the majority of these proteins displayed differential abundance, thereby revealing organ-specific differences in adaptation to osmotic-cold stress. Yeast two hybrid assay examined five pairs of stress/defense-related protein-protein interactions in the predicted protein interaction network. Furthermore, quantitative real-time PCR analysis indicated that abiotic stresses increased the expression of three candidate protein genes, i.e., TaGRP2, CDCP, and Wcor410c in wheat leaves. Virus-induced gene silencing indicated that three genes TaGRP2, CDCP, and Wcor410c were involved in modulating osmotic-cold stress in common wheat. Our study provides useful information for the elucidation of molecular and genetics bases of osmotic-cold combined stress in bread wheat.

  1. Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

    Science.gov (United States)

    Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

    2015-12-16

    MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

  2. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Science.gov (United States)

    Moser, Joanna J; Fritzler, Marvin J

    2010-10-18

    GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  3. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    2010-10-01

    Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  4. Evaluation of nigrostriatal damage and its change over weeks in a rat model of Parkinson's disease: small animal positron emission tomography studies with [11C]β-CFT

    International Nuclear Information System (INIS)

    Liu Limin; Wang Yong; Li Bo; Jia Jun; Sun Zuoli; Zhang Jinming; Tian Jiahe; Wang Xiaomin

    2009-01-01

    Introduction: The cardinal pathological feature of Parkinson's disease (PD) is progressive loss of dopaminergic neurons. Since dopamine transporter (DAT) is a protein located presynaptically on dopaminergic nerve terminals, radioligands that bind to these sites are promising radiopharmaceuticals for evaluation of the integrity of the dopamine system. This study using positron emission tomography (PET) tracers, [ 11 C]-2β-carbomethoxy-3β-(4-fluorophenyl)-tropane ([ 11 C]β-CFT, radioligand for DAT), was aimed at evaluating the degree of nigrostriatal damage and its change over weeks in a rat model of PD. Methods: The brains of these rats were unilaterally lesioned by mechanical transection of the nigrostriatal dopamine pathway at the medial forebrain bundle (MFB). Behavioral studies were carried out by apomorphine (APO) challenge prior to and 1, 2 and 4 weeks after MFB axotomy. Small animal PET scans were performed 2 days after the behavioral test. Immunohistochemistry was conducted 4 days after the last PET scan. Results: Compared with the contralateral intact side, a progressively decreased [ 11 C]β-CFT binding was observed on the lesioned side which correlated inversely with the APO-induced rotations. Postmortem immunohistochemical studies confirmed the loss of both striatal dopamine fibers and nigral neurons on the lesioned side. Conclusion: These findings not only demonstrate that the neuronal degeneration in this model is relatively slow, but also suggest [ 11 C]β-CFT is a sensitive marker to monitor the degree of nigrostriatal damage and its change over weeks. This marker can be used prospectively to study the progression of the disease, thereby making detection of early phases of PD possible.

  5. Silencing of cytosolic NADP+-dependent isocitrate dehydrogenase gene enhances ethanol-induced toxicity in HepG2 cells.

    Science.gov (United States)

    Yang, Eun Sun; Lee, Su-Min; Park, Jeen-Woo

    2010-07-01

    It has been shown that acute and chronic alcohol administrations increase the production of reactive oxygen species, lower cellular antioxidant levels and enhance oxidative stress in many tissues. We recently reported that cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) functions as an antioxidant enzyme by supplying NADPH to the cytosol. Upon exposure to ethanol, IDPc was susceptible to the loss of its enzyme activity in HepG2 cells. Transfection of HepG2 cells with an IDPc small interfering RNA noticeably downregulated IDPc and enhanced the cells' vulnerability to ethanol-induced cytotoxicity. Our results suggest that suppressing the expression of IDPc enhances ethanol-induced toxicity in HepG2 cells by further disruption of the cellular redox status.

  6. A Novel Combination RNAi toward Warburg Effect by Replacement with miR-145 and Silencing of PTBP1 Induces Apoptotic Cell Death in Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Tomoaki Takai

    2017-01-01

    Full Text Available Bladder cancer is one of the most difficult malignancies to control. We explored the use of a novel RNA-interference method for a driver oncogene regulating cancer specific energy metabolism by the combination treatment with a small interfering RNA (siRNA and a microRNA. After transfection of T24 and 253JB-V cells with miR-145 and/or siR-PTBP1, we examined the effects of cell growth and gene expression by performing the trypan blue dye exclusion test, Western blot, Hoechst 33342 staining, reverse transcription polymerase chain reaction (RT-PCR, and electron microscopy. The anti-cancer effects of xenograft model mice with miR-145 and/or siR-PTBP1 were then assessed. The combination treatment induced the deeper and longer growth inhibition and reduced the levels of both mRNA and protein expression of c-Myc and polypyrimidine tract-binding protein 1 (PTBP1 more than each single treatment. Notably, the combination treatment not only impaired the cancer specific energy metabolism by inhibiting c-Myc/PTBP1/PKMs axis but also inactivated MAPK/ERK and PI3K/AKT pathways examined in vitro and in vivo. Furthermore, the combination treatment induced apoptosis or autophagy; but, in some cells, apoptotic cell death was accompanied by autophagy, because the condensation of chromatin and many autophagosomes were coexistent. This combination treatment could be a novel RNA-interference strategy through the systemic silencing of the Warburg effect-promoting driver oncogene PTBP1 in bladder cancer cells.

  7. Silencing criticism in Mexico

    Directory of Open Access Journals (Sweden)

    Ximena Suárez

    2017-10-01

    Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

  8. Ombuds’ corner: Employee silence

    CERN Multimedia

    Vincent Vuillemin

    2013-01-01

    Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

  9. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  10. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  11. 123-I ioflupane (Datscan) presynaptic nigrostriatal imaging in patients with movement disorders

    International Nuclear Information System (INIS)

    Soriano Castrejon, Angel; Garcia Vicente, Ana Maria; Cortes Romera, Montserrat; Rodado Marina, Sonia; Poblete Garcia, Victor Manuel; Ruiz Solis, Sebastian Ruiz; Talavera Rubio, Maria del Prado; Vaamonde Cano, Julia

    2005-01-01

    123-I Ioflupane (Datscan) presynaptic imaging has been shown to have a significant utility in the assessment of patients with movement disorders 123 I Ioflupane SPECT is able to distinguish between Parkinson's disease (PD) and other forms of parkinsonism without degeneration of the nigrostriatal pathway, including a common movement disorder such as essential tremor, and to assess disease progression in PD and other neuro degenerative disorders involving the substantia nigra. (author)

  12. The interferon-induced antiviral protein PML (TRIM19) promotes the restriction and transcriptional silencing of lentiviruses in a context-specific, isoform-specific fashion.

    Science.gov (United States)

    Masroori, Nasser; Merindol, Natacha; Berthoux, Lionel

    2016-03-22

    The promyelocytic leukemia (PML) protein, a type I interferon (IFN-I)-induced gene product and a member of the tripartite motif (TRIM) family, modulates the transcriptional activity of viruses belonging to various families. Whether PML has an impact on the replication of HIV-1 has not been fully addressed, but recent studies point to its possible involvement in the restriction of HIV-1 in human cells and in the maintenance of transcriptional latency in human cell lines in which HIV-1 is constitutively repressed. We investigated further the restriction of HIV-1 and a related lentivirus, SIVmac, by PML in murine cells and in a lymphocytic human cell line. In particular, we studied the relevance of PML to IFN-I-mediated inhibition and the role of individual human isoforms. We demonstrate that both human PML (hPML) and murine PML (mPML) inhibit the early post-entry stages of the replication of HIV-1 and a related lentivirus, SIVmac. In addition, HIV-1 was transcriptionally silenced by mPML and by hPML isoforms I, II, IV and VI in MEFs. This PML-mediated transcriptional repression was attenuated in presence of the histone deacetylase inhibitor SAHA. In contrast, depletion of PML had no effect on HIV-1 gene expression in a human T cell line. PML was found to contribute to the inhibition of HIV-1 by IFN-I. Specifically, IFN-α and IFN-β treatments of MEFs enhanced the PML-dependent inhibition of HIV-1 early replication stages. We show that PML can inhibit HIV-1 and other lentiviruses as part of the IFN-I-mediated response. The restriction takes place at two distinct steps, i.e. reverse transcription and transcription, and in an isoform-specific, cellular context-specific fashion. Our results support a model in which PML activates innate immune antilentiviral effectors. These data are relevant to the development of latency reversal-inducing pharmacological agents, since PML was previously proposed as a pharmacological target for such inhibitors. This study also has

  13. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  14. Silêncios Silences

    Directory of Open Access Journals (Sweden)

    Luciano Marcondes Godoy

    1999-01-01

    Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

  15. Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

    Science.gov (United States)

    Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

    2015-06-01

    Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

  16. Memories Persist in Silence

    Directory of Open Access Journals (Sweden)

    Sandra Patricia Arenas Grisales

    2012-08-01

    Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

  17. Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth.

    Science.gov (United States)

    Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien

    2017-07-01

    The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

  18. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  19. Peripheral Inflammation Increases the Damage in Animal Models of Nigrostriatal Dopaminergic Neurodegeneration: Possible Implication in Parkinson's Disease Incidence

    Directory of Open Access Journals (Sweden)

    A. Machado

    2011-01-01

    Full Text Available Inflammatory processes described in Parkinson’s disease (PD and its animal models appear to be important in the progression of the pathogenesis, or even a triggering factor. Here we review that peripheral inflammation enhances the degeneration of the nigrostriatal dopaminergic system induced by different insults; different peripheral inflammations have been used, such as IL-1β and the ulcerative colitis model, as well as insults to the dopaminergic system such as 6-hydroxydopamine or lipopolysaccharide. In all cases, an increased loss of dopaminergic neurons was described; inflammation in the substantia nigra increased, displaying a great activation of microglia along with an increase in the production of cytokines such as IL-1β and TNF-α. Increased permeability or disruption of the BBB, with overexpression of the ICAM-1 adhesion molecule and infiltration of circulating monocytes into the substantia nigra, is also involved, since the depletion of circulating monocytes prevents the effects of peripheral inflammation. Data are reviewed in relation to epidemiological studies of PD.

  20. The Gift of Silence

    Science.gov (United States)

    Haskins, Cathleen

    2011-01-01

    Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

  1. Breaking the silence

    DEFF Research Database (Denmark)

    Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

    2012-01-01

    and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

  2. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  3. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  4. The nigrostriatal dopamine system of aging GFRα-1 heterozygous mice: neurochemistry, morphology and behavior

    Science.gov (United States)

    Zaman, Vandana; Boger, Heather A.; Granholm, Ann-Charlotte; Rohrer, Baerbel; Moore, Alfred; Buhusi, Mona; Gerhardt, Greg A.; Hoffer, Barry J.; Middaugh, Lawrence D.

    2009-01-01

    Given the established importance of glial cell line-derived neurotrophic factor (GDNF) in maintaining dopaminergic neurotransmitter systems, the nigrostriatal system and associated behaviors of mice with genetic reduction of its high-affinity receptor, GDNF receptor (GFR)α-1 (GFRα-1+/−), were compared with wild-type controls. Motor activity and the stimulatory effects of a dopamine (DA) D1 receptor agonist (SKF 82958) were assessed longitudinally at 8 and 18 months of age. Monoamine concentrations and dopaminergic nerve terminals in the striatum and the number of dopaminergic neurons in the substantia nigra (SN) were assessed. The results support the importance of GFRα-1 in maintaining normal function of the nigrostriatal dopaminergic system, with deficits being observed for GFRα-1+/− mice at both ages. Motor activity was lower and the stimulatory effects of the DA agonist were enhanced for the older GFRα-1+/− mice. DA in the striatum was reduced in the GFRα-1+/− mice at both ages, and tyrosine hydroxylase-positive cell numbers in the SN were reduced most substantially in the older GFRα-1+/− mice. The combined behavioral, pharmacological probe, neurochemical and morphological measures provide evidence of abnormalities in GFRα-1+/− mice that are indicative of an exacerbated aging-related decline in dopaminergic system function. The noted deficiencies, in turn, suggest that GFRα-1 is necessary for GDNF to maintain normal function of the nigrostriatal dopaminergic system. Although the precise mechanism(s) for the aging-related changes in the dopaminergic system remain to be established, the present study clearly establishes that genetic reductions in GFRα-1 can contribute to the degenerative changes observed in this system during the aging process. PMID:18973577

  5. The Silence of Michelangelo

    DEFF Research Database (Denmark)

    Foote, Jonathan

    2016-01-01

    In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

  6. Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

    Directory of Open Access Journals (Sweden)

    Rita Marta

    2014-10-01

    Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

  7. The Small GTP-Binding Protein Rhes Influences Nigrostriatal-Dependent Motor Behavior During Aging.

    Science.gov (United States)

    Pinna, Annalisa; Napolitano, Francesco; Pelosi, Barbara; Di Maio, Anna; Wardas, Jadwiga; Casu, Maria Antonietta; Costa, Giulia; Migliarini, Sara; Calabresi, Paolo; Pasqualetti, Massimo; Morelli, Micaela; Usiello, Alessandro

    2016-04-01

    Here we aimed to evaluate: (1) Rhes mRNA expression in mouse midbrain, (2) the effect of Rhes deletion on the number of dopamine neurons, (3) nigrostriatal-sensitive behavior during aging in knockout mice. Radioactive in situ hybridization was assessed in adult mice. The beam-walking test was executed in 3-, 6- and 12-month-old mice. Immunohistochemistry of midbrain tyrosine hydroxylase (TH)-positive neurons was performed in 6- and 12-month-old mice. Rhes mRNA is expressed in TH-positive neurons of SNpc and the ventral tegmental area. Moreover, lack of Rhes leads to roughly a 20% loss of nigral TH-positive neurons in both 6- and 12-month-old mutants, when compared with their age-matched controls. Finally, lack of Rhes triggers subtle alterations in motor performance and coordination during aging. Our findings indicate a fine-tuning role of Rhes in regulating the number of TH-positive neurons of the substantia nigra and nigrostriatal-sensitive motor behavior during aging. © 2016 International Parkinson and Movement Disorder Society.

  8. Association of body mass index and the depletion of nigrostriatal dopamine in Parkinson's disease.

    Science.gov (United States)

    Lee, Jae Jung; Oh, Jungsu S; Ham, Jee H; Lee, Dong H; Lee, Injoo; Sohn, Young H; Kim, Jae S; Lee, Phil Hyu

    2016-02-01

    Several antecedent studies had reported close relationship between low body weight and Parkinson's disease (PD). However, there have been few investigations about the role of body weight to nigrostriatal dopaminergic neurodegeneration. This study enrolled 398 de novo patients with PD whom underwent [18F] N-(3-Fluoropropyl)-2β-carbon ethoxy-3β-(4-iodophenyl) nortropane positron emission tomography scan and body mass index (BMI) measurement. The relationships between BMI and dopamine transporter (DAT) activity were analyzed using linear regression analysis. A multivariate analysis adjusted for age, gender, disease duration, smoking status, coffee and tea consumption, and residence area revealed that BMI remained independently and significantly associated with DAT activity in all striatal subregions. Moreover, multiple logistic regression analyses showed that BMI was a significant predictor for the lowest quartile of DAT activity in the anterior putamen, ventral striatum, caudate nucleus, and total striatum. The present findings suggest that a low BMI might be closely associated with low density of nigrostriatal dopaminergic neurons in PD, which could support the evidence for the role of low body weight to PD-related pathologies. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Directory of Open Access Journals (Sweden)

    Huijuan Zhang

    2016-08-01

    Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  10. Voice and silence in organizations

    Directory of Open Access Journals (Sweden)

    Moaşa, H.

    2011-01-01

    Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

  11. "Listening Silence" and Its Discursive Effects

    Science.gov (United States)

    Applebaum, Barbara

    2016-01-01

    While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

  12. Bodies, Spaces, Voices, Silences

    Directory of Open Access Journals (Sweden)

    Donatella Mazzoleni

    2013-07-01

    Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

  13. Organizational Silence in Sports Employees

    Science.gov (United States)

    Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

    2016-01-01

    Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

  14. Silence, an Eye of Knowledge

    Science.gov (United States)

    Aghamohammadi, Mehdi

    2017-01-01

    One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

  15. Silenced rice in both cytosolic ascorbate peroxidases displays pre-acclimation to cope with oxidative stress induced by 3-aminotriazole-inhibited catalase.

    Science.gov (United States)

    Bonifacio, Aurenivia; Carvalho, Fabrício E L; Martins, Marcio O; Lima Neto, Milton C; Cunha, Juliana R; Ribeiro, Carolina W; Margis-Pinheiro, Marcia; Silveira, Joaquim A G

    2016-08-20

    The maintenance of H2O2 homeostasis and signaling mechanisms in plant subcellular compartments is greatly dependent on cytosolic ascorbate peroxidases (APX1 and APX2) and peroxisomal catalase (CAT) activities. APX1/2 knockdown plants were utilized in this study to clarify the role of increased cytosolic H2O2 levels as a signal to trigger the antioxidant defense system against oxidative stress generated in peroxisomes after 3-aminotriazole-inhibited catalase (CAT). Before supplying 3-AT, silenced APX1/2 plants showed marked changes in their oxidative and antioxidant profiles in comparison to NT plants. After supplying 3-AT, APX1/2 plants triggered up-expression of genes belonging to APX (OsAPX7 and OsAPX8) and GPX families (OsGPX1, OsGPX2, OsGPX3 and OsGPX5), but to a lower extent than in NT plants. In addition, APX1/2 exhibited lower glycolate oxidase (GO) activity, higher CO2 assimilation, higher cellular integrity and higher oxidation of GSH, whereas the H2O2 and lipid peroxidation levels remained unchanged. This evidence indicates that redox pre-acclimation displayed by silenced rice contributed to coping with oxidative stress generated by 3-AT. We suggest that APX1/2 plants were able to trigger alternative oxidative and antioxidant mechanisms involving signaling by H2O2, allowing these plants to display effective physiological responses for protection against oxidative damage generated by 3-AT, compared to non-transformed plants. Copyright © 2016 Elsevier GmbH. All rights reserved.

  16. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  17. Chronic organic manganese administration in the rat does not damage dopaminergic nigrostriatal neurons.

    Science.gov (United States)

    Yong, V W; Perry, T L; Godolphin, W J; Jones, K A; Clavier, R M; Ito, M; Foulks, J G

    1986-01-01

    In an attempt to produce an animal model of Parkinson's disease, we injected rats repeatedly with high doses of methylcyclopentadienyl manganese tricarbonyl (MMT), a compound which has been reported to lower striatal dopamine content in mice. Chronic MMT administration for up to 5 months, even though it produced a substantial elevation in brain manganese content during the period of exposure, did not destroy dopaminergic nigrostriatal neurons. This was assessed by measurements of tyrosine hydroxylase activity and contents of dopamine and its metabolites in the striatum, and by histological examination of the substantia nigra. Our results differ from those of others who administered manganese chloride in drinking water to rats. This discrepancy is unlikely to be a consequence of differences in duration of exposure or route of administration. It could be due to our having used an organic rather than an inorganic manganese compound, or to a species difference in vulnerability to organic manganese between rats and mice.

  18. 5-HT1A receptor gene silencers Freud-1 and Freud-2 are differently expressed in the brain of rats with genetically determined high level of fear-induced aggression or its absence.

    Science.gov (United States)

    Kondaurova, Elena M; Ilchibaeva, Tatiana V; Tsybko, Anton S; Kozhemyakina, Rimma V; Popova, Nina K; Naumenko, Vladimir S

    2016-09-01

    Serotonin 5-HT1A receptor is known to play a crucial role in the mechanisms of genetically defined aggression. In its turn, 5-HT1A receptor functional state is under control of multiple factors. Among others, transcriptional factors Freud-1 and Freud-2 are known to be involved in the repression of 5-HT1A receptor gene expression. However, implication of these factors in the regulation of behavior is unclear. Here, we investigated the expression of 5-HT1A receptor and silencers Freud-1 and Freud-2 in the brain of rats selectively bred for 85 generations for either high level of fear-induced aggression or its absence. It was shown that Freud-1 and Freud-2 levels were different in aggressive and nonaggressive animals. Freud-1 protein level was decreased in the hippocampus, whereas Freud-2 protein level was increased in the frontal cortex of highly aggressive rats. There no differences in 5-HT1A receptor gene expression were found in the brains of highly aggressive and nonaggressive rats. However, 5-HT1A receptor protein level was decreased in the midbrain and increased in the hippocampus of highly aggressive rats. These data showed the involvement of Freud-1 and Freud-2 in the regulation of genetically defined fear-induced aggression. However, these silencers do not affect transcription of the 5-HT1A receptor gene in the investigated rats. Our data indicate the implication of posttranscriptional rather than transcriptional regulation of 5-HT1A receptor functional state in the mechanisms of genetically determined aggressive behavior. On the other hand, the implication of other transcriptional regulators for 5-HT1A receptor gene in the mechanisms of genetically defined aggression could be suggested. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Magnetic Resonance Imaging Features of the Nigrostriatal System: Biomarkers of Parkinson’s Disease Stages?

    Science.gov (United States)

    Hopes, Lucie; Grolez, Guillaume; Moreau, Caroline; Lopes, Renaud; Ryckewaert, Gilles; Carrière, Nicolas; Auger, Florent; Laloux, Charlotte; Petrault, Maud; Devedjian, Jean-Christophe; Bordet, Regis; Defebvre, Luc; Jissendi, Patrice; Delmaire, Christine; Devos, David

    2016-01-01

    Introduction Magnetic resonance imaging (MRI) can be used to identify biomarkers in Parkinson’s disease (PD); R2* values reflect iron content related to high levels of oxidative stress, whereas volume and/or shape changes reflect neuronal death. We sought to assess iron overload in the nigrostriatal system and characterize its relationship with focal and overall atrophy of the striatum in the pivotal stages of PD. Methods Twenty controls and 70 PD patients at different disease stages (untreated de novo patients, treated early-stage patients and advanced-stage patients with L-dopa-related motor complications) were included in the study. We determined the R2* values in the substantia nigra, putamen and caudate nucleus, together with striatal volume and shape analysis. We also measured R2* in an acute MPTP mouse model and in a longitudinal follow-up two years later in the early-stage PD patients. Results The R2* values in the substantia nigra, putamen and caudate nucleus were significantly higher in de novo PD patients than in controls. Early-stage patients displayed significantly higher R2* values in the substantia nigra (with changes in striatal shape), relative to de novo patients. Measurements after a two-year follow-up in early-stage patients and characterization of the acute MPTP mouse model confirmed that R2* changed rapidly with disease progression. Advanced-stage patients displayed significant atrophy of striatum, relative to earlier disease stages. Conclusion Each pivotal stage in PD appears to be characterized by putative nigrostriatal MRI biomarkers: iron overload at the de novo stage, striatal shape changes at early-stage disease and generalized striatal atrophy at advanced disease. PMID:27035571

  20. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  1. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  2. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  3. miRNA-431 Prevents Amyloid-β-Induced Synapse Loss in Neuronal Cell Culture Model of Alzheimer's Disease by Silencing Kremen1.

    Science.gov (United States)

    Ross, Sean P; Baker, Kelly E; Fisher, Amanda; Hoff, Lee; Pak, Elena S; Murashov, Alexander K

    2018-01-01

    Synapse loss is well regarded as the underlying cause for the progressive decline of memory function over the course of Alzheimer's disease (AD) development. Recent observations suggest that the accumulation of the Wnt antagonist Dickkopf-1 (Dkk1) in the AD brain plays a critical role in triggering synaptic degeneration. Mechanistically, Dkk1 cooperates with Kremen1 (Krm1), its transmembrane receptor, to block the Wnt/β-catenin signaling pathway. Here, we show that silencing Krm1 with miR-431 prevents amyloid-β-mediated synapse loss in cortico-hippocampal cultures isolated from triple transgenic 3xTg-AD mice. Exposure to AβDDL (an amyloid-β derived diffusive ligand) or Dkk1 reduced the number of pre- and post-synaptic puncta in primary neuronal cultures, while treatment with miR-431 prevented synapse loss. In addition, treatment with miR-431 also prevented neurite degeneration. Our findings demonstrate that miR-431 protects synapses and neurites from Aβ-toxicity in an AD cell culture model and may be a promising therapeutic target.

  4. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    Science.gov (United States)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Judicial review of administrative silence

    Directory of Open Access Journals (Sweden)

    Radošević Ratko S.

    2015-01-01

    Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

  6. Silence, an Eye of Knowledge

    Directory of Open Access Journals (Sweden)

    Mehdi Aghamohammadi

    2017-04-01

    Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

  7. Interaction between subclinical doses of the Parkinson's disease associated gene, α-synuclein, and the pesticide, rotenone, precipitates motor dysfunction and nigrostriatal neurodegeneration in rats.

    Science.gov (United States)

    Naughton, Carol; O'Toole, Daniel; Kirik, Deniz; Dowd, Eilís

    2017-01-01

    In most patients, Parkinson's disease is thought to emerge after a lifetime of exposure to, and interaction between, various genetic and environmental risk factors. One of the key genetic factors linked to this condition is α-synuclein, and the α-synuclein protein is pathologically associated with idiopathic cases. However, α-synuclein pathology is also present in presymptomatic, clinically "normal" individuals suggesting that environmental factors, such as Parkinson's disease-linked agricultural pesticides, may be required to precipitate Parkinson's disease in these individuals. In this context, the aim of this study was to assess the behavioural and neuropathological impact of exposing rats with a subclinical load of α-synuclein to subclinical doses of the organic pesticide, rotenone. Rats were randomly assigned to two groups for intra-nigral infusion of AAV 2/5- GFP or AAV 2/5 -α-synuclein. Post viral motor function was assessed at 8, 10 and 12 weeks in the Corridor, Stepping and Whisker tests of lateralised motor function. At week 12, animals were performance-matched to receive a subsequent intra-striatal challenge of the organic pesticide rotenone (or its vehicle) to yield four final groups (Control, Rotenone, AAV 2/5 -α-synuclein and Combined). Behavioural testing resumed one week after rotenone surgery and continued for 5 weeks. We found that, when administered alone, neither intra-nigral AAV-α-synuclein nor intra-striatal rotenone caused sufficient nigrostriatal neurodegeneration to induce a significant motor impairment in their own right. However, when these were administered sequentially to the same rats, the interaction between the two Parkinsonian challenges significantly exacerbated nigrostriatal neurodegeneration which precipitated a pronounced impairment in motor function. These results indicate that exposing rats with a subclinical α-synuclein-induced pathology to the pesticide, rotenone, profoundly exacerbates their Parkinsonian

  8. Lithium-induced neuroprotection in stroke involves increased miR-124 expression, reduced RE1-silencing transcription factor abundance and decreased protein deubiquitination by GSK3β inhibition-independent pathways.

    Science.gov (United States)

    Doeppner, Thorsten R; Kaltwasser, Britta; Sanchez-Mendoza, Eduardo H; Caglayan, Ahmet B; Bähr, Mathias; Hermann, Dirk M

    2017-03-01

    Lithium promotes acute poststroke neuronal survival, which includes mechanisms that are not limited to GSK3β inhibition. However, whether lithium induces long-term neuroprotection and enhanced brain remodeling is unclear. Therefore, mice were exposed to transient middle cerebral artery occlusion and lithium (1 mg/kg bolus followed by 2 mg/kg/day over up to 7 days) was intraperitoneally administered starting 0-9 h after reperfusion onset. Delivery of lithium no later than 6 h reduced infarct volume on day 2 and decreased brain edema, leukocyte infiltration, and microglial activation, as shown by histochemistry and flow cytometry. Lithium-induced neuroprotection persisted throughout the observation period of 56 days and was associated with enhanced neurological recovery. Poststroke angioneurogenesis and axonal plasticity were also enhanced by lithium. On the molecular level, lithium increased miR-124 expression, reduced RE1-silencing transcription factor abundance, and decreased protein deubiquitination in cultivated cortical neurons exposed to oxygen-glucose deprivation and in brains of mice exposed to cerebral ischemia. Notably, this effect was not mimicked by pharmacological GSK3β inhibition. This study for the first time provides efficacy data for lithium in the postacute ischemic phase, reporting a novel mechanism of action, i.e. increased miR-124 expression facilitating REST degradation by which lithium promotes postischemic neuroplasticity and angiogenesis.

  9. Effect of superficial radial nerve stimulation on the activity of nigro-striatal dopaminergic neurons in the cat: role of cutaneous sensory input

    Energy Technology Data Exchange (ETDEWEB)

    Nieoullon, A; Dusticier, N [Centre National de la Recherche Scientifique, 13 - Marseille (France). Inst. de Neurophysiologie et Psychophysiologie

    1982-01-01

    The release of /sup 3/H-dopamine (DA) continuously synthesized from /sup 3/H-thyrosine was measured in the caudate nucleus (CN) and in the substantia nigra (SN) in both sides of the brain during electrical stimulation of the superficial radial nerve in cats lightly anaesthetized with halothane. Use of appropriate electrophysiologically controlled stimulation led to selective activation of low threshold afferent fibers whereas high stimulation activated all cutaneous afferents. Results showed that low threshold fiber activation induced a decreased dopaminergic activity in CN contralateral to nerve stimulation and a concomitant increase in dopaminergic activity on the ipsilateral side. Stimulation of group I and threshold stimulation of group II afferent fibers induced changes in the release of /sup 3/H-DA mainly on the contralateral CN and SN and in the ipsilateral CN. High stimulation was followed by a general increase of the neurotransmitter release in the four structures. This shows that the nigro-striatal dopaminergic neurons are mainly-if not exclusively-controlled by cutaneous sensory inputs. This control, non-specific when high threshold cutaneous fibers are also activated. Such activations could contribute to reestablish sufficient release of DA when the dopaminergic function is impaired as in Parkinson's disease.

  10. Effect of superficial radial nerve stimulation on the activity of nigro-striatal dopaminergic neurons in the cat: role of cutaneous sensory input

    International Nuclear Information System (INIS)

    Nieoullon, A.; Dusticier, N.

    1982-01-01

    The release of 3 H-dopamine (DA) continuously synthesized from 3 H-thyrosine was measured in the caudate nucleus (CN) and in the substantia nigra (SN) in both sides of the brain during electrical stimulation of the superficial radial nerve in cats lightly anaesthetized with halothane. Use of appropriate electrophysiologically controlled stimulation led to selective activation of low threshold afferent fibers whereas high stimulation activated all cutaneous afferents. Results showed that low threshold fiber activation induced a decreased dopaminergic activity in CN contralateral to nerve stimulation and a concomitant increase in dopaminergic activity on the ipsilateral side. Stimulation of group I and threshold stimulation of group II afferent fibers induced changes in the release of 3 H-DA mainly on the contralateral CN and SN and in the ipsilateral CN. High stimulation was followed by a general increase of the neurotransmitter release in the four structures. This shows that the nigro-striatal dopaminergic neurons are mainly-if not exclusively-controlled by cutaneous sensory inputs. This control, non-specific when high threshold cutaneous fibers are also activated. Such activations could contribute to restablish sufficient release of DA when the dopaminergic function is impaired as in Parkinson's disease. (Author)

  11. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  12. 123-I ioflupane (Datscan® presynaptic nigrostriatal imaging in patients with movement disorders

    Directory of Open Access Journals (Sweden)

    Angel Soriano Castrejón

    2005-10-01

    Full Text Available 123-I Ioflupane (Datscan® presynaptic imaging has been shown to have a significant utility in the assessment of patients with movement disorders 123-I Ioflupane SPECT is able to distinguish between Parkinson’s disease (PD and other forms of parkinsonism without degeneration of the nigrostriatal pathway, including a common movement disorder such as essential tremor, and to assess disease progression in PD and other neurodegenerative disorders involving the substantia nigra.A imagem pré-sináptica através de 123-I Ioflupane (Datscan® tem mostrado um papel significante na avaliação de pacientes com distúrbios do movimento. 123-I Ioflupane SPECT é capaz de distinguir entre Mal de Parkinson (MP e outras formas de parkinsonismo sem degenerações da via nigroestriatal incluindo um distúrbio comum de movimento parecido com o tremor essencial e para medir a evolução da doença no Mal de Parkinson e outros distúrbios neurodegenerativos envolvendo a substantia nigra.

  13. Nigrostriatal interaction in the aging brain: new therapeutic target for Parkinson's disease.

    Science.gov (United States)

    Błaszczyk, Janusz W

    2017-01-01

    Parkinson's disease (PD) is a progressive neurodegenerative disorder of unclear etiology and pathogenesis. Research results gathered to date support the hypothesis that the motor symptoms of the disease result from the gradual loss of midbrain dopamine neurons residing in the substantia nigra pars compacta (SNpc). Recent discoveries, however, significantly expand this knowledge indicating that the primary source of the PD pathogenesis may be located both in the SNpc as well as in the GABAergic striatum. Newly discovered striatal neurogenesis - normally a lifelong process - determines the efficiency of nigrostriatal interaction. Deficient neurogenesis within the striatum followed by a decline in the GABAergic/dopaminergic interaction results in progressive disconnection of the dopaminergic input, which initiates a 'vicious circle' cascade of neuronal damage. Effects of both deficient striatal neurogenesis and age-related neurodegeneration within the striatum accumulate, resulting in a progressive decline in the control functions of the basal ganglia, loss of dopaminergic neurons, and occurrence of PD clinical symptoms. Functional and pharmacological control of these dynamic relationships may result in treatments that are more effective with fewer side-effects.

  14. The measurement of the nigrostriatal dopaminergic function and glucose metabolism in patients with movement disorders

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, Makoto; Ichiya, Yuichi; Kuwabara, Yasuo; Sasaki, Masayuki; Fukumura, Toshimitsu; Masuda, Kouji; Shima, Fumio; Kato, Motohiro [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine

    1992-12-01

    The nigrostriatal dopaminergic function and glucose metabolism were evaluated in 34 patients with various movement disorders by using positron emission tomography with [sup 18]F-Dopa and [sup 18]F-FDG respectively. The [sup 18]F-Dopa uptake in the striatum (the caudate head and the putamen) decreased in patients with Parkinson's disease but was relatively unaffected in the caudate. The cerebral glucose metabolism was normal in patients with Parkinson's disease. The [sup 18]F-Dopa uptake in the striatum also decreased in cases of atypical parkinsonism and in cases of progressive supranuclear palsy, but there was no difference in the uptake between the caudate and the putamen. The glucose metabolism decreased in the cerebral hemisphere including the striatum; this finding was also different from those of Parkinson's disease. A normal [sup 18]F-Dopa uptake in the striatum with a markedly decreased striatal glucose metabolism and a mildly decreased cortical glucose metabolism was observed in cases of Huntington's disease and Wilson's disease. The [sup 18]F-Dopa uptake in the striatum increased and the glucose metabolism was normal in cases of idiopathic dystonia. Various patterns of [sup 18]F-Dopa uptake and glucose metabolism were thus observed in the various movement disorders. These results suggest that the measurements of the [sup 18]F-Dopa uptake and the cerebral glucose metabolism would be useful for the evaluation of the striatal function in various movement disorders. (author).

  15. Nigrostriatal proteasome inhibition impairs dopamine neurotransmission and motor function in minipigs.

    Science.gov (United States)

    Lillethorup, Thea P; Glud, Andreas N; Alstrup, Aage K O; Mikkelsen, Trine W; Nielsen, Erik H; Zaer, Hamed; Doudet, Doris J; Brooks, David J; Sørensen, Jens Christian H; Orlowski, Dariusz; Landau, Anne M

    2018-05-01

    Parkinson's disease (PD) is characterized by degeneration of dopaminergic neurons in the substantia nigra leading to slowness and stiffness of limb movement with rest tremor. Using ubiquitin proteasome system inhibitors, rodent models have shown nigrostriatal degeneration and motor impairment. We translated this model to the Göttingen minipig by administering lactacystin into the medial forebrain bundle (MFB). Minipigs underwent positron emission tomography (PET) imaging with (+)-α-[ 11 C]dihydrotetrabenazine ([ 11 C]DTBZ), a marker of vesicular monoamine transporter 2 availability, at baseline and three weeks after the unilateral administration of 100 μg lactacystin into the MFB. Compared to their baseline values, minipigs injected with lactacystin showed on average a 36% decrease in ipsilateral striatal binding potential corresponding to impaired presynaptic dopamine terminals. Behaviourally, minipigs displayed asymmetrical motor disability with spontaneous rotations in one of the animals. Immunoreactivity for tyrosine hydroxylase (TH) and HLA-DR-positive microglia confirmed asymmetrical reduction in nigral TH-positive neurons with an inflammatory response in the lactacystin-injected minipigs. In conclusion, direct injection of lactacystin into the MFB of minipigs provides a model of PD with reduced dopamine neurotransmission, TH-positive neuron reduction, microglial activation and behavioural deficits. This large animal model could be useful in studies of symptomatic and neuroprotective therapies with translatability to human PD. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Posttranscriptional silencing of the lncRNA MALAT1 by miR-217 inhibits the epithelial–mesenchymal transition via enhancer of zeste homolog 2 in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Luo, Fei; Liu, Yi; Liu, Xinlu; Shi, Le; Lu, Xiaolin; Liu, Qizhan

    2015-01-01

    Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study investigated the effects of an miRNA (miR-217) on levels of an lncRNA (MALAT1) and examined the role of these factors in the epithelial–mesenchymal transition (EMT) induced by cigarette smoke extract (CSE) in human bronchial epithelial (HBE) cells. In these cells, CSE caused decreases of miR-217 levels and increases in lncRNA MALAT1 levels. Over-expression of miR-217 with a mimic attenuated the CSE-induced increase of MALAT1 levels, and reduction of miR-217 levels by an inhibitor enhanced expression of MALAT1. Moreover, the CSE-induced increase of MALAT1 expression was blocked by an miR-217 mimic, indicating that miR-217 negatively regulates MALAT1 expression. Knockdown of MALAT1 reversed CSE-induced increases of EZH2 (enhancer of zeste homolog 2) and H3K27me3 levels. In addition to the alteration from epithelial to spindle-like mesenchymal morphology, chronic exposure of HBE cells to CSE increased the levels of EZH2, H3K27me3, vimentin, and N-cadherin and decreased E-cadherin levels, effects that were reversed by MALAT1 siRNA or EZH2 siRNA. The results indicate that miR-217 regulation of EZH2/H3K27me3 via MALAT1 is involved in CSE-induced EMT and malignant transformation of HBE cells. The posttranscriptional silencing of MALAT1 by miR-217 provides a link, through EZH2, between ncRNAs and the EMT and establishes a mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure decreases miR-217 levels and increases MALAT1 levels. • miR-217 negatively regulates MALAT1 expression. • MALAT1, via EZH2, is involved in the EMT of CSE-transformed HBE cells.

  17. Cardiovascular, cerebrovascular, and respiratory changes induced by different types of music in musicians and non-musicians: the importance of silence.

    Science.gov (United States)

    Bernardi, L; Porta, C; Sleight, P

    2006-04-01

    To assess the potential clinical use, particularly in modulating stress, of changes in the cardiovascular and respiratory systems induced by music, specifically tempo, rhythm, melodic structure, pause, individual preference, habituation, order effect of presentation, and previous musical training. Measurement of cardiovascular and respiratory variables while patients listened to music. University research laboratory for the study of cardiorespiratory autonomic function. 12 practising musicians and 12 age matched controls. After a five minute baseline, presentation in random order of six different music styles (first for a two minute, then for a four minute track), with a randomly inserted two minute pause, in either sequence. Breathing rate, ventilation, carbon dioxide, RR interval, blood pressure, mid-cerebral artery flow velocity, and baroreflex. Ventilation, blood pressure, and heart rate increased and mid-cerebral artery flow velocity and baroreflex decreased with faster tempi and simpler rhythmic structures compared with baseline. No habituation effect was seen. The pause reduced heart rate, blood pressure, and minute ventilation, even below baseline. An order effect independent of style was evident for mid-cerebral artery flow velocity, indicating a progressive reduction with exposure to music, independent of style. Musicians had greater respiratory sensitivity to the music tempo than did non-musicians. Music induces an arousal effect, predominantly related to the tempo. Slow or meditative music can induce a relaxing effect; relaxation is particularly evident during a pause. Music, especially in trained subjects, may first concentrate attention during faster rhythms, then induce relaxation during pauses or slower rhythms.

  18. Transcriptional Silencing of Retroviral Vectors

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

    1996-01-01

    . Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

  19. Serotonin hyperinnervation and upregulated 5-HT2A receptor expression and motor-stimulating function in nigrostriatal dopamine-deficient Pitx3 mutant mice.

    Science.gov (United States)

    Li, Li; Qiu, Guozhen; Ding, Shengyuan; Zhou, Fu-Ming

    2013-01-23

    The striatum receives serotonin (5-hydroxytryptamine, 5-HT) innervation and expresses 5-HT2A receptors (5-HT2ARs) and other 5-HT receptors, raising the possibility that the striatal 5-HT system may undergo adaptive changes after chronic severe dopamine (DA) loss and contribute to the function and dysfunction of the striatum. Here we show that in transcription factor Pitx3 gene mutant mice with a selective, severe DA loss in the dorsal striatum mimicking the DA denervation in late Parkinson's disease (PD), both the 5-HT innervation and the 5-HT2AR mRNA expression were increased in the dorsal striatum. Functionally, while having no detectable motor effect in wild type mice, the 5-HT2R agonist 2,5-dimethoxy-4-iodoamphetamine increased both the baseline and l-dopa-induced normal ambulatory and dyskinetic movements in Pitx3 mutant mice, whereas the selective 5-HT2AR blocker volinanserin had the opposite effects. These results demonstrate that Pitx3 mutant mice are a convenient and valid mouse model to study the compensatory 5-HT upregulation following the loss of the nigrostriatal DA projection and that the upregulated 5-HT2AR function in the DA deficient dorsal striatum may enhance both normal and dyskinetic movements. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. MicroRNA-15b silencing inhibits IL-1β-induced extracellular matrix degradation by targeting SMAD3 in human nucleus pulposus cells.

    Science.gov (United States)

    Kang, Liang; Yang, Cao; Yin, Huipeng; Zhao, Kangcheng; Liu, Wei; Hua, Wenbin; Wang, Kun; Song, Yu; Tu, Ji; Li, Shuai; Luo, Rongjin; Zhang, Yukun

    2017-04-01

    To determine the role of microRNA-15b (miR-15b) in interleukin-1 beta (IL-1β)-induced extracellular matrix (ECM) degradation in the nucleus pulposus (NP). MiR-15b was up-regulated in degenerative NP tissues and in IL-1β-stimulated NP cells, as compared to the levels in normal controls (normal tissue specimens from patients with idiopathic scoliosis). Bioinformatics and luciferase activity analyses showed that mothers against decapentaplegic homolog 3 (SMAD3), a key mediator of the transforming growth factor-β signaling pathway, was directly targeted by miR-15b. Functional analysis demonstrated that miR-15b overexpression aggravated IL-1β-induced ECM degradation in NP cells, while miR-15b inhibition had the opposite effects. Prevention of IL-1β-induced NP ECM degeneration by the miR-15b inhibitor was attenuated by small-interfering-RNA-mediated knockdown of SMAD3. In addition, activation of MAP kinase and nuclear factor-κB up-regulated miR-15b expression and down-regulated SMAD3 expression in IL-1β-stimulated NP cells. MiR-15b contributes to ECM degradation in intervertebral disc degeneration (IDD) via targeting of SMAD3, thus providing a novel therapeutic target for IDD treatment.

  1. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  2. The measurement of the nigrostriatal dopaminergic function and glucose metabolism in patients with movement disorders

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, Makoto; Ichiya, Yuichi; Kuwabara, Yasuo; Sasaki, Masayuki; Fukumura, Toshimitsu; Masuda, Kouji; Shima, Fumio; Kato, Motohiro (Kyushu Univ., Fukuoka (Japan). Faculty of Medicine)

    1992-12-01

    The nigrostriatal dopaminergic function and glucose metabolism were evaluated in 34 patients with various movement disorders by using positron emission tomography with [sup 18]F-Dopa and [sup 18]F-FDG respectively. The [sup 18]F-Dopa uptake in the striatum (the caudate head and the putamen) decreased in patients with Parkinson's disease but was relatively unaffected in the caudate. The cerebral glucose metabolism was normal in patients with Parkinson's disease. The [sup 18]F-Dopa uptake in the striatum also decreased in cases of atypical parkinsonism and in cases of progressive supranuclear palsy, but there was no difference in the uptake between the caudate and the putamen. The glucose metabolism decreased in the cerebral hemisphere including the striatum; this finding was also different from those of Parkinson's disease. A normal [sup 18]F-Dopa uptake in the striatum with a markedly decreased striatal glucose metabolism and a mildly decreased cortical glucose metabolism was observed in cases of Huntington's disease and Wilson's disease. The [sup 18]F-Dopa uptake in the striatum increased and the glucose metabolism was normal in cases of idiopathic dystonia. Various patterns of [sup 18]F-Dopa uptake and glucose metabolism were thus observed in the various movement disorders. These results suggest that the measurements of the [sup 18]F-Dopa uptake and the cerebral glucose metabolism would be useful for the evaluation of the striatal function in various movement disorders. (author).

  3. Communicative Silences: Forms and Functions

    Science.gov (United States)

    Bruneau, Thomas J.

    1973-01-01

    The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

  4. SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

    Science.gov (United States)

    Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

    2011-01-01

    In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

  5. Breaching cultural silence: enhancing resilience among Ugandan ...

    African Journals Online (AJOL)

    Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

  6. Epigenetic silencing of V(DJ recombination is a major determinant for selective differentiation of mucosal-associated invariant t cells from induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Yutaka Saito

    Full Text Available Mucosal-associated invariant T cells (MAITs are innate-like T cells that play a pivotal role in the host defense against infectious diseases, and are also implicated in autoimmune diseases, metabolic diseases, and cancer. Recent studies have shown that induced pluripotent stem cells (iPSCs derived from MAITs selectively redifferentiate into MAITs without altering their antigen specificity. Such a selective differentiation is a prerequisite for the use of MAITs in cell therapy and/or regenerative medicine. However, the molecular mechanisms underlying this phenomenon remain unclear. Here, we performed methylome and transcriptome analyses of MAITs during the course of differentiation from iPSCs. Our multi-omics analyses revealed that recombination-activating genes (RAG1 and RAG2 and DNA nucleotidylexotransferase (DNTT were highly methylated with their expression being repressed throughout differentiation. Since these genes are essential for V(DJ recombination of the T cell receptor (TCR locus, this indicates that nascent MAITs are kept from further rearrangement that may alter their antigen specificity. Importantly, we found that the repression of RAGs was assured in two layers: one by the modulation of transcription factors for RAGs, and the other by DNA methylation at the RAG loci. Together, our study provides a possible explanation for the unaltered antigen specificity in the selective differentiation of MAITs from iPSCs.

  7. Within Silence: A Meditation

    Directory of Open Access Journals (Sweden)

    Valentin Y. Mudimbe

    2010-01-01

    Full Text Available In Haiti or Chile, pre-moral or morally induced, any suffering of what has a paradigm’s contradiction la contradicción is always remembered. A part of the living world is an inquiry for what is, as the measure of human. “By these hands,” an adieu, see you later. A word is given this way. It recognizes an erasure, death as gift, a gift to life. Jacques Derrida describes the intelligence of Christianity in structuring signs of transition and rituals between life and death. In remembering the Haitian earthquake, sanctions the coherence of beliefs, and reverential keys to interacting universes. One might entreat a sign, the authority of a modest code, the mache chache, this symbol of a never ending inscription in the circle of life. And all bones in one’s body rejoice.

  8. Host-Induced Silencing of Two Pharyngeal Gland Genes Conferred Transcriptional Alteration of Cell Wall-Modifying Enzymes of Meloidogyne incognita vis-à-vis Perturbed Nematode Infectivity in Eggplant.

    Science.gov (United States)

    Shivakumara, Tagginahalli N; Chaudhary, Sonam; Kamaraju, Divya; Dutta, Tushar K; Papolu, Pradeep K; Banakar, Prakash; Sreevathsa, Rohini; Singh, Bhupinder; Manjaiah, K M; Rao, Uma

    2017-01-01

    The complex parasitic strategy of Meloidogyne incognita appears to involve simultaneous expression of its pharyngeal gland-specific effector genes in order to colonize the host plants. Research reports related to effector crosstalk in phytonematodes for successful parasitism of the host tissue is yet underexplored. In view of this, we have used in planta effector screening approach to understand the possible interaction of pioneer genes ( msp-18 and msp-20 , putatively involved in late and early stage of M. incognita parasitism, respectively) with other unrelated effectors such as cell-wall modifying enzymes (CWMEs) in M. incognita . Host-induced gene silencing (HIGS) strategy was used to generate the transgenic eggplants expressing msp-18 and msp-20 , independently. Putative transformants were characterized via qRT-PCR and Southern hybridization assay. SiRNAs specific to msp-18 and msp - 20 were also detected in the transformants via Northern hybridization assay. Transgenic expression of the RNAi constructs of msp-18 and msp-20 genes resulted in 43.64-69.68% and 41.74-67.30% reduction in M. incognita multiplication encompassing 6 and 10 events, respectively. Additionally, transcriptional oscillation of CWMEs documented in the penetrating and developing nematodes suggested the possible interaction among CWMEs and pioneer genes. The rapid assimilation of plant-derived carbon by invading nematodes was also demonstrated using 14 C isotope probing approach. Our data suggests that HIGS of msp-18 and msp-20 , improves nematode resistance in eggplant by affecting the steady-state transcription level of CWME genes in invading nematodes, and safeguard the plant against nematode invasion at very early stage because nematodes may become the recipient of bioactive RNA species during the process of penetration into the plant root.

  9. Expression levels of the microRNA maturing microprocessor complex component DGCR8 and the RNA-induced silencing complex (RISC) components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in epithelial skin cancer.

    Science.gov (United States)

    Sand, Michael; Skrygan, Marina; Georgas, Dimitrios; Arenz, Christoph; Gambichler, Thilo; Sand, Daniel; Altmeyer, Peter; Bechara, Falk G

    2012-11-01

    The microprocessor complex mediates intranuclear biogenesis of precursor microRNAs from the primary microRNA transcript. Extranuclear, mature microRNAs are incorporated into the RNA-induced silencing complex (RISC) before interaction with complementary target mRNA leads to transcriptional repression or cleavage. In this study, we investigated the expression profiles of the microprocessor complex subunit DiGeorge syndrome critical region gene 8 (DGCR8) and the RISC components argonaute-1 (AGO1), argonaute-2 (AGO2), as well as double-stranded RNA-binding proteins PACT, TARBP1, and TARBP2 in epithelial skin cancer and its premalignant stage. Patients with premalignant actinic keratoses (AK, n = 6), basal cell carcinomas (BCC, n = 15), and squamous cell carcinomas (SCC, n = 7) were included in the study. Punch biopsies were harvested from the center of the tumors (lesional), from healthy skin sites (intraindividual controls), and from healthy skin sites in a healthy control group (n = 16; interindividual control). The DGCR8, AGO1, AGO2, PACT, TARBP1, and TARBP2 mRNA expression levels were detected by quantitative real-time reverse transcriptase polymerase chain reaction. The DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were significantly higher in the AK, BCC, and SCC groups than the healthy controls (P  0.05). This study indicates that major components of the miRNA pathway, such as the microprocessor complex and RISC, are dysregulated in epithelial skin cancer. Copyright © 2011 Wiley Periodicals, Inc.

  10. Protective Role of Hsp27 Protein Against Gamma Radiation-Induced Apoptosis and Radiosensitization Effects of Hsp27 Gene Silencing in Different Human Tumor Cells

    International Nuclear Information System (INIS)

    Aloy, Marie-Therese; Hadchity, Elie; Bionda, Clara; Diaz-Latoud, Chantal; Claude, Line; Rousson, Robert; Arrigo, Andre-Patrick; Rodriguez-Lafrasse, Claire

    2008-01-01

    Purpose: The ability of heat shock protein 27 (Hsp27) to protect cells from stressful stimuli and its increased levels in tumors resistant to anticancer therapeutics suggest that it may represent a target for sensitization to radiotherapy. In this study, we investigate the protective role of Hsp27 against radiation-induced apoptosis and the effect of its attenuation in highly expressing radioresistant cancer cell lines. Methods and Materials: We examined clonogenic death and the kinetics of apoptotic events in different tumor cell lines overexpressing or underexpressing Hsp27 protein irradiated with photons. The radiosensitive Jurkat cell line, which does not express Hsp27 constitutively or in response to γ-rays, was stably transfected with Hsp27 complementary DNA. Attenuation of Hsp27 expression was accomplished by antisense or RNAi (interfering RNA) strategies in SQ20B head-and-neck squamous carcinoma, PC3 prostate cancer, and U87 glioblastoma radioresistant cells. Results: We measured concentration-dependent protection against the cytotoxic effects of radiation in Jurkat-Hsp27 cells, which led to a 50% decrease in apoptotic cells at 48 hours in the highest expressing cells. Underlying mechanisms leading to radiation resistance involved a significant increase in glutathione levels associated with detoxification of reactive oxygen species, a delay in mitochondrial collapse, and caspase activation. Conversely, attenuation of Hsp27 in SQ20B cells, characterized by their resistance to apoptosis, sensitizes cells to irradiation. This was emphasized by increased apoptosis, decreased glutathione basal level, and clonogenic cell death. Sensitization to irradiation was confirmed in PC3 and U87 radioresistant cells. Conclusion: Hsp27 gene therapy offers a potential adjuvant to radiation-based therapy of resistant tumors

  11. GABAergic Control of Nigrostriatal and Mesolimbic Dopamine in the Rat Brain

    Directory of Open Access Journals (Sweden)

    Susanne Nikolaus

    2018-03-01

    Full Text Available Purpose: The present study assessed the effects of the GABAA receptor (R agonist muscimol (MUS, and the GABAAR antagonist bicuculline (BIC on neocortical and subcortical radioligand binding to dopamine D2/3Rs in relation to motor and exploratory behaviors in the rat.Methods: D2/3R binding was measured with small animal SPECT in baseline and after challenge with either 1 mg/kg MUS or 1 mg/kg BIC, using [123I]IBZM as radioligand. Motor/exploratory behaviors were assessed for 30 min in an open field prior to radioligand administration. Anatomical information was gained with a dedicated small animal MRI tomograph. Based on the Paxinos rat brain atlas, regions of interest were defined on SPECT-MRI overlays. Estimations of the binding potentials in baseline and after challenges were obtained by computing ratios of the specifically bound compartments to the cerebellar reference region.Results: After MUS, D2/3R binding was significantly reduced in caudateputamen, nucleus accumbens, thalamus, substania nigra/ventral tegmental area, and posterior hippocampus relative to baseline (0.005 ≤ p ≤ 0.012. In all these areas, except for the thalamus, D2/3R binding was negatively correlated with grooming in the first half and positively correlated with various motor/exploratory behaviors in the second half of the testing session. After BIC, D2/3R binding was significantly elevated in caudateputamen (p = 0.022 and thalamus (p = 0.047 relative to baseline. D2/3R binding in caudateputamen and thalamus was correlated negatively with sitting duration and sitting frequency and positively with motor/exploratory behaviors in the first half of the testing time.Conclusions: Findings indicate direct GABAergic control over nigrostriatal and mesolimbic dopamine levels in relation to behavioral action. This may be of relevance for neuropsychiatric conditions such as anxiety disorder and schizophrenia, which are characterized by both dopaminergic and GABAergic dysfunction.

  12. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  13. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  14. Silencing of microRNA-138-5p promotes IL-1β-induced cartilage degradation in human chondrocytes by targeting FOXC1: miR-138 promotes cartilage degradation.

    Science.gov (United States)

    Yuan, Y; Zhang, G Q; Chai, W; Ni, M; Xu, C; Chen, J Y

    2016-10-01

    . Y. Chen. Silencing of microRNA-138-5p promotes IL-1β-induced cartilage degradation in human chondrocytes by targeting FOXC1: miR-138 promotes cartilage degradation. Bone Joint Res 2016;5:523-530. DOI: 10.1302/2046-3758.510.BJR-2016-0074.R2. © 2016 Chen et al.

  15. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  16. Nigrostriatal and Mesolimbic D2/3 Receptor Expression in Parkinson's Disease Patients with Compulsive Reward-Driven Behaviors.

    Science.gov (United States)

    Stark, Adam J; Smith, Christopher T; Lin, Ya-Chen; Petersen, Kalen J; Trujillo, Paula; van Wouwe, Nelleke C; Kang, Hakmook; Donahue, Manus J; Kessler, Robert M; Zald, David H; Claassen, Daniel O

    2018-03-28

    The nigrostriatal and mesocorticolimbic dopamine networks regulate reward-driven behavior. Regional alterations to mesolimbic dopamine D 2/3 receptor expression are described in drug-seeking and addiction disorders. Parkinson's disease (PD) patients are frequently prescribed D 2 -like dopamine agonist (DAgonist) therapy for motor symptoms, yet a proportion develop clinically significant behavioral addictions characterized by impulsive and compulsive behaviors (ICBs). Until now, changes in D 2/3 receptor binding in both striatal and extrastriatal regions have not been concurrently quantified in this population. We identified 35 human PD patients (both male and female) receiving DAgonist therapy, with ( n = 17) and without ( n = 18) ICBs, matched for age, disease duration, disease severity, and dose of dopamine therapy. In the off-dopamine state, all completed PET imaging with [ 18 F]fallypride, a high affinity D 2 -like receptor ligand that can measure striatal and extrastriatal D 2/3 nondisplaceable binding potential (BP ND ). Striatal differences between ICB+/ICB- patients localized to the ventral striatum and putamen, where ICB+ subjects had reduced BP ND In this group, self-reported severity of ICB symptoms positively correlated with midbrain D 2/3 receptor BP ND Group differences in regional D 2/3 BP ND relationships were also notable: ICB+ (but not ICB-) patients expressed positive correlations between midbrain and caudate, putamen, globus pallidus, and amygdala BP ND s. These findings support the hypothesis that compulsive behaviors in PD are associated with reduced ventral and dorsal striatal D 2/3 expression, similar to changes in comparable behavioral disorders. The data also suggest that relatively preserved ventral midbrain dopaminergic projections throughout nigrostriatal and mesolimbic networks are characteristic of ICB+ patients, and may account for differential DAgonist therapeutic response. SIGNIFICANCE STATEMENT The biologic determinants of

  17. [E. M. Jellinek's silenced and silencing transgenerational story].

    Science.gov (United States)

    Kelemen, Gábor; Márk, Mónika

    2013-01-01

    Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

  18. Silence

    Science.gov (United States)

    Cogswell, J.

    2011-06-01

    On the occasion of the International Year of Astronomy, I was commissioned to create a mural for the University of Michigan Department of Astronomy, responding to an array of scientific images based on astronomical research, with special focus on the work of University of Michigan astronomers carried out within the building. My paper illustrates the development of this and several subsequent projects, explaining the implications for my artistic practice of entering into this conversation with astronomers and their work.

  19. Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

    Science.gov (United States)

    Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

    2016-11-01

    Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

  20. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  1. How Silent is the Right to Silence?

    Directory of Open Access Journals (Sweden)

    Katherine Biber

    2012-11-01

    Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

  2. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  3. Listen and the question of silence

    DEFF Research Database (Denmark)

    Doubinsky, Sebastien

    2018-01-01

    Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

  4. Epigenetic silencing of CYP24 in the tumor microenvironment

    Science.gov (United States)

    Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

    2010-01-01

    Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

  5. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2004-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  6. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2005-01-01

    ...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

  7. Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

    National Research Council Canada - National Science Library

    Issa, Jean-Pierre

    2006-01-01

    ...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

  8. Lycium barbarum Polysaccharide Promotes Nigrostriatal Dopamine Function by Modulating PTEN/AKT/mTOR Pathway in a Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) Murine Model of Parkinson's Disease.

    Science.gov (United States)

    Wang, Xiaohong; Pang, Lei; Zhang, Yanqing; Xu, Jiang; Ding, Dongyi; Yang, Tianli; Zhao, Qian; Wu, Fan; Li, Fei; Meng, Haiwei; Yu, Duonan

    2018-04-01

    To investigate the effects of Lycium barbarum polysaccharide (LBP) on pathological symptoms and behavioral deficits in a Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced Parkinson's disease (PD) mouse model. The therapeutic effects of LBP were monitored with an Open field test, a Rotarod test and a Morris water maze test. We also investigated the mechanisms with qRT-PCR and Western blotting analyses. After a relatively short-term LBP treatment, the total distance and walking time of PD mice significantly increased. The staying duration on the rod of PD mice increased in the Rotarod test. LBP can up-regulate levels of SOD2, CAT and GPX1 and inhibit the abnormal aggregation of α-synuclein induced by MPTP. LBP treatment can also up-regulate the phosphorylation of AKT and mTOR, and may play its protective role by activating the PTEN/AKT/mTOR signaling axis. These results suggest that LBP can effectively alleviate the degeneration in the nigrostriatal system induced by MPTP treatment. It may be a potential candidate for the treatment of Parkinson's disease.

  9. Methamphetamine-induced neurotoxicity linked to UPS dysfunction and autophagy related changes that can be modulated by PKCδ in dopaminergic neuronal cells

    Science.gov (United States)

    Lin, Mengshien; Shivalingappa, Prashanth Chandramani; Jin, Huajun; Ghosh, Anamitra; Anantharam, Vellareddy; Ali, Syed; Kanthasamy, Anumantha G.; Kanthasamy, Arthi

    2012-01-01

    A compromised protein degradation machinery has been implicated in methamphetamine (MA)-induced neurodegeneration. However, the signaling mechanisms that induce autophagy and UPS dysfunction are not well understood. The present study investigates the contributions of PKC delta (PKCδ) mediated signaling events in MA-induced autophagy, UPS dysfunction and cell death. Using an in vitro mesencephalic dopaminergic cell culture model, we demonstrate that MA-induced early induction of autophagy is associated with reduction in proteasomal function and concomitant dissipation of mitochondrial membrane potential (MMP), followed by significantly increased of PKCδ activation, caspase-3 activation, accumulation of ubiquitin positive aggregates and microtubule associated light chain-3 (LC3-II) levels. Interestingly, siRNA mediated knockdown of PKCδ or overexpression of cleavage resistant mutant of PKCδ dramatically reduced MA-induced autophagy, proteasomal function, and associated accumulation of ubiquitinated protein aggregates, which closely paralleled cell survival. Importantly, when autophagy was inhibited either pharmacologically (3-MA) or genetically (siRNA mediated silencing of LC3), the dopaminergic cells became sensitized to MA-induced apoptosis through caspase-3 activation. Conversely, overexpression of LC3 partially protected against MA-induced apoptotic cell death, suggesting a neuroprotective role for autophagy in MA-induced neurotoxicity. Notably, rat striatal tissue isolated from MA treated rats also exhibited elevated LC3-II, ubiquitinated protein levels, and PKCδ cleavage. Taken together, our data demonstrate that MA-induced autophagy serves as an adaptive strategy for inhibiting mitochondria mediated apoptotic cell death and degradation of aggregated proteins. Our results also suggest that the sustained activation of PKCδ leads to UPS dysfunction, resulting in the activation of caspase-3 mediated apoptotic cell death in the nigrostriatal dopaminergic

  10. Silence as a Response to Everyday Violence

    DEFF Research Database (Denmark)

    Gammeltoft, Tine

    2016-01-01

    Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

  11. FGF-2 deficiency does not influence FGF ligand and receptor expression during development of the nigrostriatal system.

    Science.gov (United States)

    Ratzka, Andreas; Baron, Olga; Grothe, Claudia

    2011-01-01

    Secreted proteins of the fibroblast growth factor (FGF) family play important roles during development of various organ systems. A detailed knowledge of their temporal and spatial expression profiles, especially of closely related FGF family members, are essential to further identification of specific functions in distinct tissues. In the central nervous system dopaminergic neurons of the substantia nigra and their axonal projections into the striatum progressively degenerate in Parkinson's disease. In contrast, FGF-2 deficient mice display increased numbers of dopaminergic neurons. In this study, we determined the expression profiles of all 22 FGF-ligands and 10 FGF-receptor isoforms, in order to clarify, if FGF-2 deficiency leads to compensatory up-regulation of other FGFs in the nigrostriatal system. Three tissues, ventral mesencephalon (VM), striatum (STR) and as reference tissue spinal cord (SC) of wild-type and FGF-2 deficient mice at four developmental stages E14.5, P0, P28, and adult were comparatively analyzed by quantitative RT-PCR. As no differences between the genotypes were observed, a compensatory up-regulation can be excluded. Moreover, this analysis revealed that the majority of FGF-ligands (18/22) and FGF-receptors (9/10) are expressed during normal development of the nigrostriatal system and identified dynamic changes for some family members. By comparing relative expression level changes to SC reference tissue, general alterations in all 3 tissues, such as increased expression of FGF-1, -2, -22, FgfR-2c, -3c and decreased expression of FGF-13 during postnatal development were identified. Further, specific changes affecting only one tissue, such as increased FGF-16 (STR) or decreased FGF-17 (VM) expression, or two tissues, such as decreased expression of FGF-8 (VM, STR) and FGF-15 (SC, VM) were found. Moreover, 3 developmentally down-regulated FGFs (FGF-8b, FGF-15, FGF-17a) were functionally characterized by plasmid-based over-expression in

  12. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  13. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  14. Public privacy: Reciprocity and Silence

    Directory of Open Access Journals (Sweden)

    Jenny Kennedy

    2014-10-01

    Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary socio­technical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mail­art project PostSecret and the anonymous zine 'You'.

  15. Durability of timber silencers at Wairakei geothermal steam field

    Energy Technology Data Exchange (ETDEWEB)

    Hedley, M E

    1979-02-01

    After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

  16. Titration and hysteresis in epigenetic chromatin silencing

    International Nuclear Information System (INIS)

    Dayarian, Adel; Sengupta, Anirvan M

    2013-01-01

    Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

  17. Electrophysiological and pharmacological evidence for the existence of distinct subpopulations of nigrostriatal dopaminergic neuron in the rat.

    Science.gov (United States)

    Shepard, P D; German, D C

    1988-11-01

    The electrophysiological and pharmacological properties of dopaminergic neurons were systematically examined throughout the anterior-posterior extent of the substantia nigra zona compacta in the rat. Cells were characterized in terms of their (1) firing pattern, (2) firing rate, (3) antidromic response properties, and (4) inhibition in firing rate following dopaminergic agonist administration. These properties were then related to the cell's position within one of four anterior-posterior segments of the nucleus. There were three types of neuronal discharge pattern encountered; irregular, burst and regular. Cells which exhibited different firing patterns exhibited different firing rates and anatomical locations within the substantia nigra zona compacta. All neurons were antidromically activated from the striatum, however, the burst- and regular-firing cells exhibited significantly faster estimated conduction velocities than irregular-firing cells. The irregular-firing cells were most sensitive to dopaminergic autoreceptor agonists whereas the burst-firing cells were most sensitive to an indirect-acting dopaminergic agonist. These experiments provide both electrophysiological and pharmacological evidence to indicate that nigrostriatal dopaminergic neurons are composed of distinct subpopulations which are characterized by their firing pattern.

  18. Iron Chelators and Antioxidants Regenerate Neuritic Tree and Nigrostriatal Fibers of MPP+/MPTP-Lesioned Dopaminergic Neurons.

    Directory of Open Access Journals (Sweden)

    Pabla Aguirre

    Full Text Available Neuronal death in Parkinson's disease (PD is often preceded by axodendritic tree retraction and loss of neuronal functionality. The presence of non-functional but live neurons opens therapeutic possibilities to recover functionality before clinical symptoms develop. Considering that iron accumulation and oxidative damage are conditions commonly found in PD, we tested the possible neuritogenic effects of iron chelators and antioxidant agents. We used three commercial chelators: DFO, deferiprone and 2.2'-dypyridyl, and three 8-hydroxyquinoline-based iron chelators: M30, 7MH and 7DH, and we evaluated their effects in vitro using a mesencephalic cell culture treated with the Parkinsonian toxin MPP+ and in vivo using the MPTP mouse model. All chelators tested promoted the emergence of new tyrosine hydroxylase (TH-positive processes, increased axodendritic tree length and protected cells against lipoperoxidation. Chelator treatment resulted in the generation of processes containing the presynaptic marker synaptophysin. The antioxidants N-acetylcysteine and dymetylthiourea also enhanced axodendritic tree recovery in vitro, an indication that reducing oxidative tone fosters neuritogenesis in MPP+-damaged neurons. Oral administration to mice of the M30 chelator for 14 days after MPTP treatment resulted in increased TH- and GIRK2-positive nigra cells and nigrostriatal fibers. Our results support a role for oral iron chelators as good candidates for the early treatment of PD, at stages of the disease where there is axodendritic tree retraction without neuronal death.

  19. Exon silencing by UAGG motifs in response to neuronal excitation.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-02-01

    Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

  20. The Nigrostriatal Dopamine System and Methamphetamine: Roles for Excitotoxicity and Environmental, Metabolic and Oxidative Stress

    Science.gov (United States)

    2005-07-01

    K. (1995) Methamphetamine -induced hyperthermia and dopaminergic neurotoxicity in mice: pharmacological profile of protective and nonprotective agents...glutamate receptors is protective against methamphetamine neurotoxicity . JNeurosci 22, 2135-2141. Beer R., Franz G., Srinivasan A., Hayes R. L., Pike B. R...1992) The neurotoxic effects of methamphetamine on 5-hydroxytryptamine and dopamine in brain: evidence for the protective effect of chlormethiazole

  1. Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

    Science.gov (United States)

    Kant, Ravi; Dasgupta, Indranil

    2017-07-01

    Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

  2. Calcium signalling silencing in atrial fibrillation.

    Science.gov (United States)

    Greiser, Maura

    2017-06-15

    Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  3. Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

    Directory of Open Access Journals (Sweden)

    Yixiang Han

    Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

  4. Metformin, besides exhibiting strong in vivo anti-inflammatory properties, increases mptp-induced damage to the nigrostriatal dopaminergic system

    International Nuclear Information System (INIS)

    Ismaiel, Afrah A.K.; Espinosa-Oliva, Ana M.; Santiago, Martiniano; García-Quintanilla, Albert; Oliva-Martín, María J.; Herrera, Antonio J.; Venero, José L.; Pablos, Rocío M. de

    2016-01-01

    Metformin is a widely used oral antidiabetic drug with known anti-inflammatory properties due to its action on AMPK protein. This drug has shown a protective effect on various tissues, including cortical neurons. The aim of this study was to determine the effect of metformin on the dopaminergic neurons of the substantia nigra of mice using the animal model of Parkinson's disease based on the injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, an inhibitor of the mitochondrial complex I. In vivo and in vitro experiments were used to study the activation of microglia and the damage of the dopaminergic neurons. Our results show that metformin reduced microglial activation measured both at cellular and molecular levels. Rather than protecting, metformin exacerbated dopaminergic damage in response to MPTP. Our data suggest that, contrary to other brain structures, metformin treatment could be deleterious for the dopaminergic system. Hence, metformin treatment may be considered as a risk factor for the development of Parkinson's disease. - Highlights: • Metformin treatment decreases microglial activation in the MPTP model of Parkinson's disease. • Metformin treatment increases the neurodegeneration in the MPTP model of Parkinson's disease, both in vivo and vitro. • Metformin treatment could be a risk factor for the development of Parkinson's disease.

  5. Metformin, besides exhibiting strong in vivo anti-inflammatory properties, increases mptp-induced damage to the nigrostriatal dopaminergic system

    Energy Technology Data Exchange (ETDEWEB)

    Ismaiel, Afrah A.K.; Espinosa-Oliva, Ana M.; Santiago, Martiniano; García-Quintanilla, Albert; Oliva-Martín, María J.; Herrera, Antonio J.; Venero, José L.; Pablos, Rocío M. de, E-mail: depablos@us.es

    2016-05-01

    Metformin is a widely used oral antidiabetic drug with known anti-inflammatory properties due to its action on AMPK protein. This drug has shown a protective effect on various tissues, including cortical neurons. The aim of this study was to determine the effect of metformin on the dopaminergic neurons of the substantia nigra of mice using the animal model of Parkinson's disease based on the injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, an inhibitor of the mitochondrial complex I. In vivo and in vitro experiments were used to study the activation of microglia and the damage of the dopaminergic neurons. Our results show that metformin reduced microglial activation measured both at cellular and molecular levels. Rather than protecting, metformin exacerbated dopaminergic damage in response to MPTP. Our data suggest that, contrary to other brain structures, metformin treatment could be deleterious for the dopaminergic system. Hence, metformin treatment may be considered as a risk factor for the development of Parkinson's disease. - Highlights: • Metformin treatment decreases microglial activation in the MPTP model of Parkinson's disease. • Metformin treatment increases the neurodegeneration in the MPTP model of Parkinson's disease, both in vivo and vitro. • Metformin treatment could be a risk factor for the development of Parkinson's disease.

  6. Berberine prevents nigrostriatal dopaminergic neuronal loss and suppresses hippocampal apoptosis in mice with Parkinson's disease.

    Science.gov (United States)

    Kim, Mia; Cho, Ki-Ho; Shin, Mal-Soon; Lee, Jae-Min; Cho, Han-Sam; Kim, Chang-Ju; Shin, Dong-Hoon; Yang, Hyeon Jeong

    2014-04-01

    Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by the selective loss of nigral dopaminergic neurons and a reduction in striatal dopaminergic fibers, which result in tremors, rigidity, bradykinesia and gait disturbance. In addition to motor dysfunction, dementia is a widely recognized symptom of patients with PD. Berberine, an isoquinoline alkaloid isolated from Berberis vulgaris L., is known to exert anxiolytic, analgesic, anti-inflammatory, antipsychotic, antidepressant and anti-amnesic effects. In the present study, we investigated the effects of berberine on short-term memory in relation to dopamine depletion and hippocampal neurogenesis using a mouse model of PD, induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine/probenecid (MPTP/P) treatment. Mice in the berberine-treated groups were orally administered berberine once a day for a total of 5 weeks. Our results revealed that the injection of MPTP/P induced dopaminergic neuronal death in the substantia nigra and fiber loss in the striatum. This resulted in impaired motor balance and coordination, as assessed by the beam walking test. We further demonstrated that MPTP/P-induced apoptosis in the hippocampus deteriorated short-term memory, as shown by the step-down avoidance task. By contrast, neurogenesis in the hippocampal dentate gyrus, which is a compensatory adaptive response to excessive apoptosis, was increased upon PD induction. However, treatment with berberine enhanced motor balance and coordination by preventing dopaminergic neuronal damage. Treatment with berberine also improved short-term memory by inhibiting apoptosis in the hippocampus. Berberine demonstrated maximal potency at 50 mg/kg. Based on these data, treatment with berberine may serve as a potential therapeutic strategy for the alleviation of memory impairment and motor dysfunction in patients with PD.

  7. Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

    2013-05-10

    Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

  8. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. Development of a gene silencing DNA vector derived from a broad host range geminivirus

    Directory of Open Access Journals (Sweden)

    Hancock Leandria C

    2009-07-01

    Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

  11. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Active compressor engine silencer reduces exhaust noise

    International Nuclear Information System (INIS)

    Denenberg, J.N.; Miller, S.K.; Jay, M.A.

    1994-01-01

    An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

  13. Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

    Science.gov (United States)

    Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

    2017-08-15

    Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

  14. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  15. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  16. Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

    Science.gov (United States)

    Suhor, Charles

    1991-01-01

    Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

  17. Histone Methylation and Epigenetic Silencing in Breast Cancer

    National Research Council Canada - National Science Library

    Simon, Jeffrey A; Lange, Carol A

    2008-01-01

    .... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

  18. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  19. Silence in the second language classroom

    CERN Document Server

    King, J

    2013-01-01

    Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

  20. Veiled Word(s) – Sacred Silence

    DEFF Research Database (Denmark)

    Isar, Nicoletta

    2014-01-01

    or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

  1. Mutuality, Self-Silencing, and Disordered Eating in College Women

    Science.gov (United States)

    Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

    2006-01-01

    The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

  2. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  3. After the Blackbird Whistles: Listening to Silence in Classrooms

    Science.gov (United States)

    Schultz, Katherine

    2010-01-01

    Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

  4. Choosing Silence for Equality in and through Schooling

    Science.gov (United States)

    Lees, Helen E.

    2016-01-01

    This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

  5. Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

    Science.gov (United States)

    Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

    2013-11-01

    Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

  6. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  7. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  8. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  9. Underground laboratories: Cosmic silence, loud science

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

    2010-01-01

    Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

  10. Silencing cinema: film censorship around the world

    OpenAIRE

    Biltereyst, Daniël; Vande Winkel, Roel

    2013-01-01

    Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

  11. Gas turbine exhaust system silencing design

    International Nuclear Information System (INIS)

    Ozgur, D.

    1991-01-01

    Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

  12. Morphological and metabolic changes in the nigro-striatal pathway of synthetic proteasome inhibitor (PSI-treated rats: a MRI and MRS study.

    Directory of Open Access Journals (Sweden)

    Stefano Delli Pizzi

    Full Text Available Systemic administration of a Synthetic Proteasome Inhibitor (PSI in rats has been described as able to provide a model of Parkinson's disease (PD, characterized by behavioral and biochemical modifications, including loss of dopaminergic neurons in the substantia nigra (SN, as assessed by post-mortem studies. With the present study we aimed to assess in-vivo by Magnetic Resonance (MR possible morphological and metabolic changes in the nigro-striatal pathway of PSI-treated rats. 10 animals were subcutaneously injected with PSI 6.0 mg/kg dissolved in DMSO 100%. Injections were made thrice weekly over the course of two weeks. 5 more animals injected with DMSO 100% with the same protocol served as controls. The animals underwent MR sessions before and at four weeks after the end of treatment with either PSI or vehicle. MR Imaging was performed to measure SN volume and Proton MR Spectroscopy ((1H-MRS was performed to measure metabolites changes at the striatum. Animals were also assessed for motor function at baseline and at 4 and 6 weeks after treatment. Dopamine and dopamine metabolite levels were measured in the striata at 6 weeks after treatment. PSI-treated animals showed volumetric reduction of the SN (p<0.02 at 4 weeks after treatment as compared to baseline. Immunofluorescence analysis confirmed MRI changes in SN showing a reduction of tyrosine hydroxylase expression as compared to neuron-specific enolase expression. A reduction of N-acetyl-aspartate/total creatine ratio (p = 0.05 and an increase of glutamate-glutamine-γ amminobutirrate/total creatine were found at spectroscopy (p = 0.03. At 6 weeks after treatment, PSI-treated rats also showed motor dysfunction compared to baseline (p = 0.02, accompanied by dopamine level reduction in the striatum (p = 0.02. Treatment with PSI produced morphological and metabolic modifications of the nigro-striatal pathway, accompanied by motor dysfunction. MR demonstrated to be a powerful mean to assess in

  13. Effect of ghrelin on the motor deficit caused by the ablation of nigrostriatal dopaminergic cells or the inhibition of striatal dopamine receptors.

    Science.gov (United States)

    Suda, Yukari; Kuzumaki, Naoko; Narita, Michiko; Hamada, Yusuke; Shibasaki, Masahiro; Tanaka, Kenichi; Tamura, Hideki; Kawamura, Takashi; Kondo, Takashige; Yamanaka, Akihiro; Narita, Minoru

    2018-02-19

    Ghrelin plays roles in a wide range of central functions by activating the growth hormone secretagogue receptor (GHSR). This receptor has recently been found in the substantia nigra (SN) to control dopamine (DA)-related physiological functions. The dysregulation of DA neurons in the SN pars compacta (SNc) and the consequent depletion of striatal DA are known to underlie the motor deficits observed in Parkinson's disease (PD). In the present study, we further investigated the role of the SN-ghrelin system in motor function under the stereotaxic injection of AAV-CMV-FLEX-diphtheria toxin A (DTA) into the SN of dopamine transporter (DAT)-Cre (DAT SN ::DTA) mice to expunge DA neurons of the SNc. First, we confirmed the dominant expression of GHSR1a, which is a functional GHSR, in tyrosine hydroxylase (TH)-positive DA neurons in the SNc of control mice. In DAT SN ::DTA mice, we clearly observed motor dysfunction using several behavioral tests. An immunohistochemical study revealed a dramatic loss of TH-positive DA neurons in the SNc and DAT-labeled axon terminals in the striatum, and an absence of mRNAs for TH and DAT in the SN of DAT SN ::DTA mice. The mRNA level of GHSR1a was drastically decreased in the SN of these mice. In normal mice, we also found the mRNA expression of GHSR1a within GABAergic neurons in the SN pars reticulata (SNr). Under these conditions, a single injection of ghrelin into the SN failed to improve the motor deficits caused by ablation of the nigrostriatal DA network using DAT SN ::DTA mice, whereas intra-SN injection of ghrelin suppressed the motor dysfunction caused by the administration of haloperidol, which is associated with the transient inhibition of DA transmission. These findings suggest that phasic activation of the SNc-ghrelin system could improve the dysregulation of nigrostriatal DA transmission related to the initial stage of PD, but not the motor deficits under the depletion of nigrostriatal DA. Although GHSRs are found in non

  14. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  15. Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

    Science.gov (United States)

    Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

    2016-12-01

    Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

  16. PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

    Science.gov (United States)

    Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

    2017-07-01

    Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  17. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  18. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  19. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  20. Protective Mechanisms of Nitrone Antioxidants in Kanic Acid Induced Neurodegeneration

    Science.gov (United States)

    2004-01-01

    Shin, E.J., Suh, J.H., Floyd, R.A., Bing, G. (1999) Protection of methamphetamine nigrostriatal toxicity by dietary selenium. Brain Res. 851:76-86...HC, and Bing, GY. (2004) Interleukin-10 protects against lipopolysaccharide-mediated neurotoxicity in substantia nigra Neurosci. Abstr. 29:677.18. 71...2004) Roles of the cyclooxygenase-2 and oxidative stress in the methamphetamine - induced neurotoxicity Neurosci. Abstr. 29:235.4.

  1. Small silencing RNAs: an expanding universe.

    Science.gov (United States)

    Ghildiyal, Megha; Zamore, Phillip D

    2009-02-01

    Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

  2. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  3. Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

    Science.gov (United States)

    Ussher, Jane M.; Perz, Janette

    2010-01-01

    This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

  4. Combining nitric oxide release with anti-inflammatory activity preserves nigrostriatal dopaminergic innervation and prevents motor impairment in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine model of Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Impagnatiello Francesco

    2010-11-01

    Full Text Available Abstract Background Current evidence suggests a role of neuroinflammation in the pathogenesis of Parkinson's disease (PD and in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP model of basal ganglia injury. Reportedly, nonsteroidal anti-inflammatory drugs (NSAIDs mitigate DAergic neurotoxicity in rodent models of PD. Consistent with these findings, epidemiological analysis indicated that certain NSAIDs may prevent or delay the progression of PD. However, a serious impediment of chronic NSAID therapy, particularly in the elderly, is gastric, renal and cardiac toxicity. Nitric oxide (NO-donating NSAIDs, have a safer profile while maintaining anti-inflammatory activity of parent compounds. We have investigated the oral activity of the NO-donating derivative of flurbiprofen, [2-fluoro-α-methyl (1,1'-biphenyl-4-acetic-4-(nitrooxybutyl ester], HCT1026 (30 mg kg-1 daily in rodent chow in mice exposed to the parkinsonian neurotoxin MPTP. Methods Ageing mice were fed with a control, flurbiprofen, or HCT1026 diet starting ten days before MPTP administration and continuing for all the experimental period. Striatal high affinity synaptosomial dopamine up-take, motor coordination assessed with the rotarod, tyrosine hydroxylase (TH- and dopamine transporter (DAT fiber staining, stereological cell counts, immunoblotting and gene expression analyses were used to assess MPTP-induced nigrostriatal DAergic toxicity and glial activation 1-40 days post-MPTP. Results HCT1026 was well tolerated and did not cause any measurable toxic effect, whereas flurbiprofen fed mice showed severe gastrointestinal side-effects. HCT1026 efficiently counteracted motor impairment and reversed MPTP-induced decreased synaptosomal [3H]dopamine uptake, TH- and DAT-stained fibers in striatum and TH+ neuron loss in subtantia nigra pars compacta (SNpc, as opposed to age-matched mice fed with a control diet. These effects were associated to a significant decrease in reactive

  5. Transcriptome and proteome analyses and the role of atypical calpain protein and autophagy in the spliced leader silencing pathway in Trypanosoma brucei.

    Science.gov (United States)

    Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit

    2016-10-01

    Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.

  6. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

    Science.gov (United States)

    Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

  7. Organizational Silence in Universities as the Predictor of Organizational Culture

    Directory of Open Access Journals (Sweden)

    Erkan YAMAN

    2014-04-01

    Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

  8. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  9. No-Big-Silence teeb klubituuri / Urmas Hännile

    Index Scriptorium Estoniae

    Hännile, Urmas

    2009-01-01

    Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

  10. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  11. Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

    Directory of Open Access Journals (Sweden)

    Howard Amanda

    2005-03-01

    Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

  12. Chinanteco children’s silences in different classroom situations

    Directory of Open Access Journals (Sweden)

    Valeria Rebolledo Angulo

    2016-01-01

    Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

  13. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    Science.gov (United States)

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  14. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

    Science.gov (United States)

    Foda, Bardees M.; Singh, Upinder

    2015-01-01

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

  15. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

    Science.gov (United States)

    Foda, Bardees M; Singh, Upinder

    2015-08-21

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  17. Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

    International Nuclear Information System (INIS)

    Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

    2014-01-01

    Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

  18. The ethics of silence: Does conflict of interest explain employee silence?

    Science.gov (United States)

    Anderson, James

    2018-03-01

    Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

  19. The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

    Directory of Open Access Journals (Sweden)

    Michael Gary Duncan

    2012-03-01

    Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

  20. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  1. MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

    Science.gov (United States)

    Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

    2014-01-01

    Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

  2. Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

    Directory of Open Access Journals (Sweden)

    Yan Liang

    2013-11-01

    Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

  3. Control of thermoacoustic instability with a drum-like silencer

    Science.gov (United States)

    Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

    2017-10-01

    Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

  4. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Silencing of poly(ADP-ribose) glycohydrolase sensitizes lung cancer cells to radiation through the abrogation of DNA damage checkpoint

    Energy Technology Data Exchange (ETDEWEB)

    Nakadate, Yusuke [Shien-Lab, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Department of Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585 (Japan); Kodera, Yasuo; Kitamura, Yuka [Shien-Lab, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Tachibana, Taro [Department of Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585 (Japan); Tamura, Tomohide [Division of Thoracic Oncology, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Koizumi, Fumiaki, E-mail: fkoizumi@ncc.go.jp [Division of Thoracic Oncology, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)

    2013-11-29

    Highlights: •Radiosensitization by PARG silencing was observed in multiple lung cancer cells. •PAR accumulation was enhanced by PARG silencing after DNA damage. •Radiation-induced G2/M arrest and checkpoint activation were impaired by PARG siRNA. -- Abstract: Poly(ADP-ribose) glycohydrolase (PARG) is a major enzyme that plays a role in the degradation of poly(ADP-ribose) (PAR). PARG deficiency reportedly sensitizes cells to the effects of radiation. In lung cancer, however, it has not been fully elucidated. Here, we investigated whether PARG siRNA contributes to an increased radiosensitivity using 8 lung cancer cell lines. Among them, the silencing of PARG induced a radiosensitizing effect in 5 cell lines. Radiation-induced G2/M arrest was largely suppressed by PARG siRNA in PC-14 and A427 cells, which exhibited significantly enhanced radiosensitivity in response to PARG knockdown. On the other hand, a similar effect was not observed in H520 cells, which did not exhibit a radiosensitizing effect. Consistent with a cell cycle analysis, radiation-induced checkpoint signals were not well activated in the PC-14 and A427 cells when treated with PARG siRNA. These results suggest that the increased sensitivity to radiation induced by PARG knockdown occurs through the abrogation of radiation-induced G2/M arrest and checkpoint activation in lung cancer cells. Our findings indicate that PARG could be a potential target for lung cancer treatments when used in combination with radiotherapy.

  6. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    OpenAIRE

    Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

  7. Gender differences in nigrostriatal dopaminergic innervation are present at young-to-middle but not at older age in normal adults.

    Science.gov (United States)

    Wong, Ka Kit; Müller, Martijn L T M; Kuwabara, Hiroto; Studenski, Stephanie A; Bohnen, Nicolaas I

    2012-01-01

    Gender differences in brain dopaminergic activity have been variably reported in the literature. We performed an evaluation for gender effects on striatal dopamine transporter (DAT) binding in a group of normal subjects. Community-dwelling adults (n = 85, 50F/35M, mean age 62.7 ± 16.2 SD, range 20-85) underwent DAT [(11)C]2-β-carbomethoxy-3β-(4-fluorophenyl) tropane (β-CFT) positron emission tomography (PET) imaging. Gender effects for DAT binding were compared using ANCOVA for two subgroups; young-to-middle aged adults and older adults, using an age threshold of 60 years. There were 54 subjects (24M/30F; mean age 72.9 ± 7.3) 60 years and older and 31 (11M/20F; mean age 45.0 ± 11.4) subjects younger than 60. Age-adjusted striatal DAT gender effects were present in the young-to-middle (F = 10.4, P = 0.003) but not in the elderly age group (F = 0.5, ns). Gender differences in nigrostriatal dopaminergic innervation are present, with higher levels of DAT binding in young-to-middle age women compared to men, but not present in the elderly. Published by Elsevier Ltd.

  8. Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

    Directory of Open Access Journals (Sweden)

    Pizzichini Daniele

    2007-03-01

    Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

  9. Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy

    Science.gov (United States)

    Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian

    2011-01-01

    A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179

  10. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  11. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  12. Engineering nanoparticles to silence bacterial communication

    Directory of Open Access Journals (Sweden)

    Kristen Publicover Miller

    2015-03-01

    Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.

  13. Breaking the Silence: Feminism and Post humanism

    Directory of Open Access Journals (Sweden)

    Debika Saha

    2015-10-01

    Full Text Available Postmodernism starts its journey by challenging the master narratives of metaphysics and philosophy. In this journey the narrative get replaced either by an emancipation from narratives that claim to possess eternal truth or by a turn to a kind of informative technology. But both the ways keep at their centre the process of “denaturing” or disassociating something of its natural qualities. This postmodernist turn has now taken a new form. The choice is not limited between the natural body and the culturally constructed body, but between different areas of bodily reconstruction bearing different social and cultural implications. As Spivak in her famous writing raises the question «Can the subaltern speak?» In fact, Spivak narrates how the marginalized, the less privileged depend upon the benevolence of the more privileged. To engage with the other means not only to talk, listen, learn or know about her but also to identify with her. There must be some ways for open dialogues that can diminish the effects of cultural dominance. The imperial silence should be broken.

  14. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  15. ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

    Directory of Open Access Journals (Sweden)

    Berta Bekti Retnawati

    2016-11-01

    Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

  16. The organisational silence of midwives and nurses: reasons and results.

    Science.gov (United States)

    Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

    2016-07-01

    The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

  17. Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

    Directory of Open Access Journals (Sweden)

    Đerić Gordana

    2007-01-01

    Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

  18. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  19. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  20. Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury

    DEFF Research Database (Denmark)

    Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela

    2018-01-01

    )-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...

  1. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  2. Differential alteration of the nigrostriatal dopaminergic system in Wilson's disease investigated with [123I]ss-CIT and high-resolution SPET

    International Nuclear Information System (INIS)

    Barthel, H.; Sorger, D.; Kluge, R.; Kuehn, H.-J.; Wagner, A.; Hermann, W.

    2001-01-01

    Wilson's disease (WD) is a copper deposition disorder which can result in a number of extrapyramidal motoric symptoms such as parkinsonism. Therefore, this study was carried out to investigate, for the first time, nigrostriatal dopaminergic function in WD in relation to different courses and severity of the disease. Using high-resolution single-photon emission tomography (SPET) after administration of 2ss-carbomethoxy-3ss-(4[ 123 I]iodophenyl)tropane ([ 123 I]ss-CIT), striatal dopamine transporters (DAT) were imaged in 43 WD patients and a control group of ten subjects. From the SPET images, specific [ 123 I]ss-CIT binding ratios were obtained for the caudate heads, putamina and entire corpus striatum. In addition, to evaluate a putative dissociation between the caudate and putaminal [ 123 I]ss-CIT binding ratios, the ratio between these binding ratios was calculated (CA/PU ratio). The SPET data were compared with clinical data on the course of the disease (CD), the severity of neurological symptoms and the degree of hepatic alteration. Whereas the specific regional [ 123 I]ss-CIT binding ratios in patients with asymptomatic/hepatic CD did not differ from those in the control group (e.g. striatal ratios: 13.4±3.0 vs 11.7±2.8), in patients with neurological CD the ratios were significantly reduced for all striatal substructures (P=0.003 after one-factor ANOVA). For the different subgroups a tendency was detected towards a stepwise decrease in the specific [ 123 I]ss-CIT binding ratios from pseudo-sclerosis CD (9.4±2.3), through pseudo-parkinsonian CD (9.1±2.1) to arrhythmic-hyperkinetic CD (8.5±1.6). However, these group differences reached significance only for the comparison with asymptomatic/hepatic CD (P=0.02). The CA/PU ratio was significantly higher in WD than in the control group (1.30±0.19 vs 1.11±0.08; P=0.003). Severity of neurological symptoms was significantly correlated with all specific regional [ 123 I]ss-CIT binding ratios (r=-0.49 to -0

  3. Atrazine is primarily responsible for the toxicity of long-term exposure to a combination of atrazine and inorganic arsenic in the nigrostriatal system of the albino rat.

    Science.gov (United States)

    Bardullas, Ulises; Giordano, Magda; Rodríguez, Verónica Mireya

    2013-01-01

    Chronic and simultaneous exposure to a variety of chemicals present in the environment is an unavoidable fact. However, given the complexity of studying chemical mixtures, most toxicological studies have focused on the effects of short-term exposure to single substances. The aim of this study was to evaluate the effects on the nigrostriatal system of the chronic, simultaneous exposure to two widely distributed substances that have been identified as potential dopaminergic system toxicants, inorganic arsenic (iAs) and atrazine (ATR). Six groups of rats were treated daily for one year with atrazine (10mg ATR/kg), inorganic arsenic (0.5 or 50mgiAs/L of drinking water), or a combination of ATR+0.5mgiAs/L or ATR+50mgiAs/L. The 50mgiAs/L group showed locomotor hypoactivity, while all treatments decreased motor coordination in contrast no effects of treatment were found on the place and response learning tasks. Regarding markers for liver and muscle damage, there were no differences between groups in creatine kinase (CK) or aspartate transaminase (AST) activities, while decreases in lactate dehydrogenase (LDH) levels were found in some exposed groups. The striatal DA content was significantly reduced in ATR, 0.5mgiAs/L, ATR+0.5mgiAs/L, and ATR+50mgiAs/L groups, in comparison to the control group. The number of mesencephalic tyrosine hydroxylase positive cells decreased in the ATR and ATR+0.5mgiAs/L groups compared to the control. In contrast, immunoreactivity to cytochrome oxidase was reduced compared to the control in all treated groups, except for the group treated with 0.5iAsmg alone. Our results indicate that ATR has deleterious effects on dopaminergic neurons and that the combination of ATR and iAs does not exacerbate these effects. © 2013 Elsevier Inc. All rights reserved.

  4. Silencing the Transcriptional Repressor, ZCT1, Illustrates the Tight Regulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Hairy Roots.

    Directory of Open Access Journals (Sweden)

    Noreen F Rizvi

    Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.

  5. Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

    Science.gov (United States)

    Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

    2015-10-02

    Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

    Directory of Open Access Journals (Sweden)

    Paul McVeigh

    2014-09-01

    Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

  7. Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

    Science.gov (United States)

    Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

    2018-06-01

    Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  8. Precedents and consequences of prosocial behaviors of voice and silence

    Directory of Open Access Journals (Sweden)

    Alicia Omar

    2015-09-01

    Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

  9. Extracellular Zn2+ Influx into Nigral Dopaminergic Neurons Plays a Key Role for Pathogenesis of 6-Hydroxydopamine-Induced Parkinson's Disease in Rats.

    Science.gov (United States)

    Tamano, Haruna; Nishio, Ryusuke; Morioka, Hiroki; Takeda, Atsushi

    2018-04-29

    Parkinson's disease (PD) is a progressive neurological disease characterized by a selective loss of nigrostriatal dopaminergic neurons. The exact cause of the neuronal loss remains unclear. Here, we report a unique mechanism of nigrostriatal dopaminergic neurodegeneration, in which extracellular Zn 2+ influx plays a key role for PD pathogenesis induced with 6-hydroxydopamine (6-OHDA) in rats. 6-OHDA rapidly increased intracellular Zn 2+ only in the substantia nigra pars compacta (SNpc) of brain slices and this increase was blocked in the presence of CaEDTA, an extracellular Zn 2+ chelator, and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), an α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor antagonist, indicating that 6-OHDA rapidly increases extracellular Zn 2+ influx via AMPA receptor activation in the SNpc. Extracellular Zn 2+ concentration was decreased under in vivo SNpc perfusion with 6-OHDA and this decrease was blocked by co-perfusion with CNQX, supporting 6-OHDA-induced Zn 2+ influx via AMPA receptor activation in the SNpc. Interestingly, both 6-OHDA-induced loss of nigrostriatal dopaminergic neurons and turning behavior to apomorphine were ameliorated by co-injection of intracellular Zn 2+ chelators, i.e., ZnAF-2DA and N,N,N',N'-Tetrakis(2-pyridylmethyl)ethylenediamine (TPEN). Co-injection of TPEN into the SNpc blocked 6-OHDA-induced increase in intracellular Zn 2+ but not in intracellular Ca 2+ . These results suggest that the rapid influx of extracellular Zn 2+ into dopaminergic neurons via AMPA receptor activation in the SNpc induces nigrostriatal dopaminergic neurodegeneration, resulting in 6-OHDA-induced PD in rats.

  10. Toward a science of silence: The consequences of leaving a memory unsaid

    DEFF Research Database (Denmark)

    Stone, Charles; Coman, Alin; Brown, Adam

    2012-01-01

    of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

  11. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  12. Silence about encounters with dying among healthcare professionals in a society that ‘de-tabooises’ death

    Directory of Open Access Journals (Sweden)

    Ellen Ramvi

    2017-09-01

    Full Text Available Background: Empirical studies on healthcare personnel indicate that professionals’ experiences with dying and death become silenced and unutterable within the healthcare service. Aim: To explore and interpret silence about encounters with death and dying among healthcare professionals in Norway. Method: The method used was theoretical exploration, using a psychosocial approach. Findings: This analysis reveals complex interrelations and two-way dynamics between subject-worlds, sociocultural and societal worlds when it comes to dealing with death and dying at work. A performance culture saturates these worlds, and may be implicated in silencing death within the healthcare institutions of the Norwegian welfare state. Conclusions: This article suggests that silence about death and dying among healthcare professionals is indicative of crucial emerging and unresolved tensions in the neoliberal episteme, accompanied and reinforced by the ineluctable basic conditions of life and intrapsychic defence against threats towards the self. Implications for practice: Silence about death and dying presents a serious challenge for dying patients and next of kin. Healthcare professionals should be enabled to acknowledge their thoughts and emotions about death in order to be able to support and contain patients and next of kin Learning activities such as peer support and supervision can help the processing of difficult psychological content and allow for emotional aspects of professionals’ work to be acknowledged and thought about in a way that encourages reflective and sound practice Clinical managers should address whether performance pressures induce shameful feelings in staff, who may believe that by providing appropriate levels of care they are compromising productivity. Shame in turn, may undermine professionals’ emotional wellbeing and ability to continue to provide attuned and adequate care for dying patients Creative approaches to facilitate

  13. Is our knowledge of voice and silence in organizations growing?

    DEFF Research Database (Denmark)

    Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

    2016-01-01

    This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

  14. RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

    Directory of Open Access Journals (Sweden)

    Fitnat Nazlı Sayğan

    2011-07-01

    Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

  15. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

    Science.gov (United States)

    Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

    2006-10-01

    Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

  16. The orphan nuclear receptor GCNF recruits DNA methyltransferase for Oct-3/4 silencing

    International Nuclear Information System (INIS)

    Sato, Noriko; Kondo, Mitsumasa; Arai, Ken-ichi

    2006-01-01

    Somatic DNA methylation patterns are determined in part by the de novo methylation that occurs after early embryonic demethylation. Oct-3/4, a pluripotency gene, is unmethylated in the blastocyst, but undergoes de novo methylation and silencing during gastrulation. Here we show that the transcriptional repressor GCNF recruits DNA methyltransferase to the Oct-3/4 promoter and facilitates its methylation. Although acetylation of histone H3 at lysine 9 (K9) and/or 14 (K14) and methylation of H3 at lysine 4 (K4) decrease during this period, as do Oct-3/4 transcript levels, H3K9 and H3K27 methylation levels remain constant, indicating that DNA methylation does not require repressive histone modifications. We found that GCNF interacts directly with Dnmt3 molecule(s) and verified that this interaction induces the methylation of the Oct-3/4 promoter. Our finding suggests a model in which differentiation-induced GCNF recruits de novo DNA methyltransferase and facilitates the silencing of a pluripotency gene

  17. Friction coefficient measurements of silencers on specialized duct tract

    Directory of Open Access Journals (Sweden)

    Sehnalek Stanislav

    2016-01-01

    Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

  18. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  19. Slug silencing inhibited perineural invasion through regulation of EMMPRIN expression in human salivary adenoid cystic carcinoma.

    Science.gov (United States)

    Wu, Baolei; Wei, Jianhua; Hu, Zhiqiang; Shan, Chun; Wang, Lei; Zhang, Chenping; Yang, Xi; Yang, Xinjie; Lei, Delin

    2016-02-01

    Salivary adenoid cystic carcinoma (SACC) is the most frequent salivary gland malignancy with a unique characteristic that has been named perineural invasion (PNI). EMMPRIN is a transmembrane glycoprotein that has been demonstrated to promote PNI in SACC. Slug, one of the most effective promoters of the epithelial-to-mesenchymal transition (EMT), has been found to be associated with PNI in SACC. The aim of the present study was to investigate the roles and relationships of Slug, EMMPRIN, and E-cadherin in the PNI process of SACC. The expression levels of Slug, EMMPRIN, and E-cadherin in 115 primary SACC cases were statistically analyzed by immunohistochemistry. Simultaneously, the SACC cell line SACC-83 was transfected with recombinant plasmids of silencing Slug (si-Slug) and/or silencing EMMPRIN (si-EMMPRIN). The functions of Slug and EMMPRIN in the EMT and PNI process were assessed by reverse transcription PCR (RT-PCR), western blotting, morphological observation, scratch test, migration assay, and in vitro perineural invasion assay. The immunohistochemical statistics revealed that the high expression of Slug and EMMPRIN and the low expression of E-cadherin were significantly associated with the PNI of SACC (P EMMPRIN expression (P EMMPRIN expression were both significantly negatively associated with E-cadherin expression (P EMMPRIN silencing both significantly inhibited EMMPRIN expression but promoted E-cadherin expression in SACC-83 cells (P EMMPRIN, or both induced cell morphology changes and inhibited tumor cell motility and PNI ability in SACC-83 cells (P EMMPRIN and then upregulating E-cadherin in the PNI process of SACC. The present study indicated that Slug and EMMPRIN are potential biomarkers and therapeutic targets for the diagnosis and treatment of PNI in human SACC.

  20. PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2

    Directory of Open Access Journals (Sweden)

    Jingyu YANG

    2013-03-01

    Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.

  1. In planta assays involving epigenetically silenced genes reveal inhibition of cytosine methylation by genistein

    Directory of Open Access Journals (Sweden)

    Arase Sachiko

    2012-03-01

    Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.

  2. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  3. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

  4. Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

    Directory of Open Access Journals (Sweden)

    Saeedeh Shafiee Nahrkhalaji

    2013-05-01

    Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

  5. Epigenetic Silencing of the Proapoptotic Gene BIM in Anaplastic Large Cell Lymphoma through an MeCP2/SIN3a Deacetylating Complex

    Directory of Open Access Journals (Sweden)

    Rocco Piazza

    2013-05-01

    Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.

  6. Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

    OpenAIRE

    Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

    2011-01-01

    Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

  7. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  8. Speaking of Silence: Comments from an Irish Studies Perspective

    DEFF Research Database (Denmark)

    McQuaid, Sara Dybris; Beville, Maria

    2012-01-01

    argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

  9. Breaking Classroom Silences: A View from Linguistic Ethnography

    Science.gov (United States)

    Rampton, Ben; Charalambous, Constadina

    2016-01-01

    This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

  10. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  11. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  12. Marie Nimier, au cœur du silence

    Directory of Open Access Journals (Sweden)

    Joëlle Papillon

    2012-01-01

    Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

  13. Identification of a maize chlorotic dwarf virus silencing suppressor protein

    Science.gov (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  14. Shame and Silence | Janz | South African Journal of Philosophy

    African Journals Online (AJOL)

    Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...

  15. Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing

    Science.gov (United States)

    Ullman, Jacqueline; Ferfolja, Tania

    2015-01-01

    National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…

  16. 47 CFR 80.304 - Watch requirement during silence periods.

    Science.gov (United States)

    2010-10-01

    ....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

  17. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  18. Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

    Directory of Open Access Journals (Sweden)

    Dawn Llewellyn

    2016-06-01

    Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

  19. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  20. Relationship between Organizational Mobbing and Silence Behavior among Teachers

    Science.gov (United States)

    Hüsrevsahi, Selda Polat

    2015-01-01

    This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

  1. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  2. Tacit Authorization : A Legal Solution for Administrative Silence

    NARCIS (Netherlands)

    Hoogstra, Nicole; de Graaf, K.J.

    2016-01-01

    This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

  3. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  4. Surface functionalisation of PLGA nanoparticles for gene silencing

    DEFF Research Database (Denmark)

    Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

    2010-01-01

    . In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

  5. The effects of thinking in silence on creativity and innovation

    NARCIS (Netherlands)

    de Vet, A.J.

    2007-01-01

    This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

  6. Resounding Silences : Subtle Norm Regulation in Everyday Interactions

    NARCIS (Netherlands)

    Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

    In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

  7. Breaking the Silence Surrounding Mental Health on Campus

    Science.gov (United States)

    Roper, Larry D.

    2013-01-01

    Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

  8. Strategic Silence as a Tool of Political Communication: A Reflection ...

    African Journals Online (AJOL)

    Politics is said to be a game of intrigues and part of that is the use of silence as a means of communication. This may sound strange as communication itself connotes the art of expression. However in politics, a political actor may chose to remain silent as a means of passing a message across to the public in a trouble ...

  9. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  10. Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

    Science.gov (United States)

    Lou, Yonggen; Baldwin, Ian T.

    2006-01-01

    Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

  11. Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

    Science.gov (United States)

    Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

    2016-10-01

    Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Néstor García

    2017-12-01

    Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

  13. Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma.

    Science.gov (United States)

    Tan, Xin-Yu; Chang, Shi; Liu, Wei; Tang, Hui-Huan

    2014-03-01

    To evaluate the expression of CXC motif chemokine receptor 4 (CXCR4) in the tissues of patients with hilar cholangiocarcinoma (hilar-CCA) and to investigate the cell proliferation and frequency of neural invasion (NI) influenced by RNAi-mediated CXCR4 silencing. An immunohistochemical technique was used to detect the expression of CXCR4 in 41 clinical tissues, including hilar-CCA, cholangitis, and normal bile duct tissues. The effects of small interference RNA (siRNA)-mediated CXCR4 silencing were detected in the hilar-CCA cell line QBC939. Cell proliferation was determined by MTT. Expression of CXCR4 was monitored by quantitative real time polymerase chain reaction and Western blot analysis. The NI ability of hilar-CCA cells was evaluated using a perineural cell and hilar-CCA cell coculture migration assay. The expression of CXCR4 was significantly induced in clinical hilar-CCA tissue. There was a positive correlation between the expression of CXCR4 and lymph node metastasis/NI in hilar-CCA patients (philar-CCA. CXCR4 is involved in the invasion and proliferation of human hilar-CCA cell line QBC939, indicating that CXCR4 could be a promising therapeutic target for hilar-CCA.

  14. Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Zhimin Zheng

    2015-05-01

    Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

  15. Silencing OsSLR1 enhances the resistance of rice to the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Zhang, Jin; Luo, Ting; Wang, Wanwan; Cao, Tiantian; Li, Ran; Lou, Yonggen

    2017-10-01

    DELLA proteins, negative regulators of the gibberellin (GA) pathway, play important roles in plant growth, development and pathogen resistance by regulating multiple phytohormone signals. Yet, whether and how they regulate plant herbivore resistance remain unknown. We found that the expression of the rice DELLA gene OsSLR1 was down-regulated by an infestation of female adults of the brown planthopper (BPH) Nilaparvata lugens. On one hand, OsSLR1 positively regulated BPH-induced levels of two mitogen-activated protein kinase and four WRKY transcripts, and of jasmonic acid, ethylene and H 2 O 2 . On the other hand, silencing OsSLR1 enhanced constitutive levels of defence-related compounds, phenolic acids, lignin and cellulose, as well as the resistance of rice to BPH in the laboratory and in the field. The increased resistance in rice with silencing of OsSLR1 is probably due to impaired JA and ethylene pathways, and, at least in part, to the increased lignin level and mechanical hardness of rice leaf sheaths. Our findings illustrate that OsSLR1, acting as an early negative regulator, plays an important role in regulating the resistance of rice to BPH by activating appropriate defence-related signalling pathways and compounds. Moreover, our data also provide new insights into relationships between plant growth and defence. © 2017 John Wiley & Sons Ltd.

  16. Silencing onion lachrymatory factor synthase causes a significant change in the sulfur secondary metabolite profile.

    Science.gov (United States)

    Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke

    2008-08-01

    Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.

  17. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  18. Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

    Science.gov (United States)

    Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

    2016-09-01

    We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

    2016-01-01

    ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

  20. Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

    2016-11-15

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

  1. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  2. Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

    2016-03-18

    Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

  3. An analysis of suppressing migratory effect on human urinary bladder cancer cell line by silencing of snail-1.

    Science.gov (United States)

    Salehi, Shima; Mansoori, Behzad; Mohammadi, Ali; Davoudian, Sadaf; Musavi Shenas, Seyed Mohammad Hossein; Shajari, Neda; Majidi, Jafar; Baradaran, Behzad

    2017-12-01

    Snail-1 actively participates in tumor progression, invasion, and migration. Targeting snail-1 expression can suppress the EMT process in cancer. The aim of this study was to investigate the effect of snail1 silencing on urinary bladder cancer. Quantitative RT-PCR was used to detect snail-1 and other related metastatic genes expression following siRNA knockdown in urinary bladder cancer EJ-138 cells. The protein level of snail1 was assessed by Western blot. MTT and TUNEL assays were assessed to understand if snail-1 had survival effects on EJ-138 cells. Scratch wound healing assay measured cell motility effects after snail1 suppression. The significant silencing of snail-1 reached 60pmol siRNA in a 48-h post-transfection. The result of scratch assay showed that snail-1 silencing significantly decreased Vimentin, MMPs, and CXCR4 expression; however, expression of E-cadherin was induced. The cell death assay indicated that snail-1 played the crucial role in bladder cancer survival rate. These results propose that snail-1 plays a major role in the progression and migration of urinary bladder cancer, and can be a potential therapeutic target for target therapy of invasive urinary bladder cancer. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    International Nuclear Information System (INIS)

    Godon, C.; Cordelieres, F.P.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Godon, C.; Giocanti, N.; Megnin-Chanet, F.; Hall, J.; Favaudon, V.; Cordelieres, F.P.; Cordelieres, F.P.; Biard, D.

    2008-01-01

    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, iso-genic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1(KD)) or XRCC1 (XRCC1(KD)). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These aggregates are presumed to hinder the recruitment of other effectors of the base excision repair (BER) pathway.PARP-1 silencing also prevented XRCC1-YFP recruitment but did not lengthen the lifetime of GFP-PCNA foci. Moreover, PARP-1(KD) and XRCC1(KD) cells in S phase completed SSBR as rapidly as controls, while SSBR was delayed in G1. Taken together, the data demonstrate that a PARP-1- and XRCC1-independent SSBR pathway operates when the short patch repair branch of the BER is deficient. Long patch repair is the likely mechanism, as GFP-PCNA recruitment at photo-damaged sites was normal in PARP-1(KD) cells. PARP-1 silencing elicited hyper-radiosensitivity, while radiosensitization by a PARP inhibitor reportedly occurs only in those cells treated in S phase. PARP-1 inhibition and deletion thus have different outcomes in terms of SSBR and radiosensitivity. (authors)

  5. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  6. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

    Science.gov (United States)

    Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

    2006-11-01

    Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

  9. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  10. Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

    Science.gov (United States)

    Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

    2015-06-01

    Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. The great silence science and philosophy of Fermi's paradox

    CERN Document Server

    Cirkovic, Milan M

    2018-01-01

    The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

  12. Optical silencing of C. elegans cells with arch proton pump.

    Directory of Open Access Journals (Sweden)

    Ayako Okazaki

    Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

  13. Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional

    OpenAIRE

    Retnawati, Berta Bekti

    2003-01-01

    There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...

  14. Hush… : The Dangers of Silence in Academic Libraries

    Directory of Open Access Journals (Sweden)

    Jessica Schomberg

    2017-04-01

    Full Text Available In Brief This article critiques the idea that civility rhetoric decreases workplace bullying or discrimination. We use Critical Discourse Analysis (CDA to do a rhetorical analysis of a campus-wide civility campaign in contrast with literature about civility in libraries. To combat discrimination and bullying, we need to be attentive to systemic power dynamics and to rhetoric designed to enforce compliance and conformity. We conclude with recommendations about how to raise our voices instead of silencing our peers.

  15. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  16. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    Science.gov (United States)

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  17. Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

    Science.gov (United States)

    Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

    2015-12-02

    Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. The Application of Coconut Fiber as Dissipative Silencer

    Science.gov (United States)

    Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

    2017-01-01

    Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

  19. Conifers have a unique small RNA silencing signature.

    Science.gov (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

    2008-08-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  20. Silencing Deafness: Displacing Disability in the Nineteenth Century

    Directory of Open Access Journals (Sweden)

    Esme Cleall

    2015-03-01

    Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.

  1. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  2. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  3. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  4. Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

    Science.gov (United States)

    Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

    2014-12-01

    Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

  5. Histone deacetylase mediated silencing of AMWAP expression contributes to cisplatin nephrotoxicity

    Science.gov (United States)

    Ranganathan, Punithavathi; Hamad, Rania; Mohamed, Riyaz; Jayakumar, Calpurnia; Muthusamy, Thangaraju; Ramesh, Ganesan

    2015-01-01

    Cisplatin-induced acute kidney injury is a serious problem in cancer patients during treatment of solid tumors. Currently, there are no therapies available to treat or prevent cisplatin nephrotoxicity. Since histone deacetylase (HDAC) inhibition augments cisplatin anti-tumor activity, we tested whether HDAC inhibitors can prevent cisplatin-induced nephrotoxicity and determined the underlying mechanism. Cisplatin up-regulated the expression of several HDACs in the kidney. Inhibition of HDAC with clinically used trichostatin A suppressed cisplatin-induced kidney injury, inflammation and epithelial cell apoptosis. Moreover, trichostatin A upregulated the novel anti-inflammatory protein, activated microglia/macrophage WAP domain protein (AMWAP), in epithelial cells which was enhanced with cisplatin treatment. Interestingly, HDAC1 and -2 specific inhibitors are sufficient to potently up-regulate AMWAP in epithelial cells. Administration of recombinant AMWAP or its epithelial cell-specific overexpression reduced cisplatin-induced kidney dysfunction. Moreover, AMWAP treatment suppressed epithelial cell apoptosis, and siRNA-based knockdown of AMWAP expression abolished trichostatin A-mediated suppression of epithelial cell apoptosis in vitro. Thus, HDAC-mediated silencing of AMWAP may contribute to cisplatin nephrotoxicity. Hence, HDAC1 and -2 specific inhibitors or AMWAP could be useful therapeutic agents for the prevention of cisplatin nephrotoxicity. PMID:26509586

  6. Silenced B-Cell Receptor Response To Autoantigen In A Poor-Prognostic Subset Of Chronic Lymphocytic Leukemia

    DEFF Research Database (Denmark)

    Bergh, Ann-Charlotte; Evaldsson, Chamilly; Pedersen, Lone Bredo

    2014-01-01

    Chronic lymphocytic leukemia B cells express auto/xeno antigen-reactive antibodies that bind to self-epitopes and resemble natural IgM antibodies in their repertoire. One of the antigenic structures recognized is oxidation-induced malonedialdehyde that is present on low-density lipoprotein......-cell receptor unresponsiveness to cognate self-antigen on its own in poor-prognostic subset #1 chronic lymphocytic leukemia, indicating that these cells proliferate by other mechanisms that may override B-cell receptor silencing brought about in a context of self-tolerance/anergy. These novel findings have...

  7. Dihydroartemisinin induces apoptosis preferentially via a Bim-mediated intrinsic pathway in hepatocarcinoma cells.

    Science.gov (United States)

    Qin, Guiqi; Zhao, ChuBiao; Zhang, Lili; Liu, Hongyu; Quan, Yingyao; Chai, Liuying; Wu, Shengnan; Wang, Xiaoping; Chen, Tongsheng

    2015-08-01

    This report is designed to dissect the detail molecular mechanism by which dihydroartemisinin (DHA), a derivative of artemisinin, induces apoptosis in human hepatocellular carcinoma (HCC) cells. DHA induced a loss of the mitochondrial transmemberane potential (ΔΨm), release of cytochrome c, activation of caspases, and externalization of phosphatidylserine indicative of apoptosis induction. Compared with the modest inhibitory effects of silencing Bax, silencing Bak largely prevented DHA-induced ΔΨm collapse and apoptosis though DHA induced a commensurable activation of Bax and Bak, demonstrating a key role of the Bak-mediated intrinsic apoptosis pathway. DHA did not induce Bid cleavage and translocation from cytoplasm to mitochondria and had little effects on the expressions of Puma and Noxa, but did increase Bim and Bak expressions and decrease Mcl-1 expression. Furthermore, the cytotoxicity of DHA was remarkably reduced by silencing Bim, and modestly but significantly reduced by silencing Puma or Noxa. Silencing Bim or Noxa preferentially reduced DHA-induced Bak activation, while silencing Puma preferentially reduced DHA-induced Bax activation, demonstrating that Bim and to a lesser extent Noxa act as upstream mediators to trigger the Bak-mediated intrinsic apoptosis pathway. In addition, silencing Mcl-1 enhanced DHA-induced Bak activation and apoptosis. Taken together, our data demonstrate a crucial role of Bim in preferentially regulating the Bak/Mcl-1 rheostat to mediate DHA-induced apoptosis in HCC cells.

  8. Silencing of the Mitogen-Activated Protein Kinases (MAPK) Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants.

    Science.gov (United States)

    Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena

    2018-01-01

    Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

  9. Silencing of the Mitogen-Activated Protein Kinases (MAPK Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants

    Directory of Open Access Journals (Sweden)

    Francis Onyilo

    2018-03-01

    Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

  10. Analysing the significance of silence in qualitative interviewing: questioning and shifting power relations

    DEFF Research Database (Denmark)

    Bengtsson, Tea Torbenfeldt; Fynbo, Lars

    2017-01-01

    In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....

  11. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  12. Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    International Nuclear Information System (INIS)

    Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

    2013-01-01

    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

  13. Silent God in a Wordy World. Silence in Ignatian Spirituality

    OpenAIRE

    García de Castro Valdés, S.J., José

    2016-01-01

    The Society of Jesus is an apostolic religious order involved in many different activities and missions. Jesuits live far away from monasteries and strict contemplative life. Nevertheless, one of the most well-known peculiarities of the Ignatian Spiritual Exercises is that a complete and absolute silence is required during the time of the retreat. Where and how should we place “silence” in the life of an Ignatian spiritual and mystical experience?

  14. Sibling violence silenced: rivalry, competition, wrestling, playing, roughhousing, benign.

    Science.gov (United States)

    Phillips, Debby A; Phillips, Kate H; Grupp, Kitty; Trigg, Lisa J

    2009-01-01

    In this article, sibling violence and the silence surrounding it is explicated through professional literature and research findings, exemplars from clinical practice, and statistics. Theoretical positions and discourse analysis have been used to help explain how regular broken bones, bruises, lacerations, and verbal humiliation can be minimized as normal sibling rivalry or roughhousing, which does not cause serious consequences. Nursing should be on the front lines of ending practices of violence. Recognizing sibling violence as such is part of this work and is a social justice issue.

  15. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  16. Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 show increased susceptibility to a group of fungal and oomycete pathogens.

    Science.gov (United States)

    Bultreys, Alain; Trombik, Tomasz; Drozak, Anna; Boutry, Marc

    2009-09-01

    SUMMARY The behaviour of Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 was investigated in response to fungal and oomycete infections. The importance of NpPDR1 in plant defence was demonstrated for two organs in which NpPDR1 is constitutively expressed: the roots and the petal epidermis. The roots of the plantlets of two lines silenced for NpPDR1 expression were clearly more sensitive than those of controls to the fungal pathogens Botrytis cinerea, Fusarium oxysporum sp., F. oxysporum f. sp. nicotianae, F. oxysporum f. sp. melonis and Rhizoctonia solani, as well as to the oomycete pathogen Phytophthora nicotianae race 0. The Ph gene-linked resistance of N. plumbaginifolia to P. nicotianae race 0 was totally ineffective in NpPDR1-silenced lines. In addition, the petals of the NpPDR1-silenced lines were spotted 15%-20% more rapidly by B. cinerea than were the controls. The rapid induction (after 2-4 days) of NpPDR1 expression in N. plumbaginifolia and N. tabacum mature leaves in response to pathogen presence was demonstrated for the first time with fungi and one oomycete: R. solani, F. oxysporum and P. nicotianae. With B. cinerea, such rapid expression was not observed in healthy mature leaves. NpPDR1 expression was not observed during latent infections of B. cinerea in N. plumbaginifolia and N. tabacum, but was induced when conditions facilitated B. cinerea development in leaves, such as leaf ageing or an initial root infection. This work demonstrates the increased sensitivity of NpPDR1-silenced N. plumbaginifolia plants to all of the fungal and oomycete pathogens investigated.

  17. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  18. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  19. Epigenetic silencing of serine protease HTRA1 drives polyploidy

    International Nuclear Information System (INIS)

    Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

    2016-01-01

    Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

  20. Sexuality and 'silence' among Khasi youth of Meghalaya, Northeast India.

    Science.gov (United States)

    War, Ryntihlin Jennifer; Albert, Sandra

    2013-01-01

    The importance of sex education has been well documented in the literature, but there exists a lack of research involving indigenous youth in India. This paper describes perceptions, knowledge and attitudes towards sex education, sexuality, pre-marital sex, rape and homosexuality among indigenous students from the matrilineal Khasi tribe attending a university in Meghalaya in northeast India. Qualitative and quantitative data were collected during and after reproductive health, sexuality and life skills courses. Despite the impression of sexual permissiveness of indigenous peoples that exists in India, students reported a societal silence on issues related to sexuality. Lack of appropriate words in the indigenous language potentially contributes to this silence. Although co-habitation is common and culturally acceptable, students disapproved of pre-marital sex. The influence of Christianisation was also perceived in the frequent reference to sin and guilt associated with masturbation, homosexuality, pre-marital sex and abortion. Students reported that the sex education received in school was 'childish' and inadequate for their adult needs. Many had unrealistic images of what constituted 'normal' sex and also blamed women for rape. The majority of indigenous students expressed the need for non-judgmental fora for discussions on sexual health and for sexuality education.

  1. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  2. Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

    Directory of Open Access Journals (Sweden)

    Marianna Feretzaki

    2016-03-01

    Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

  3. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  4. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

    2013-01-01

    .Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  5. RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

    NARCIS (Netherlands)

    Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

    2009-01-01

    RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

  6. Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

    African Journals Online (AJOL)

    To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

  7. Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

    Science.gov (United States)

    Shouse, Sarah H.; Nilsson, Johanna

    2011-01-01

    Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

  8. Giving Voice: Narrating silence, history and memory in André Brink ...

    African Journals Online (AJOL)

    This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...

  9. What does it take to break the silence in teams: Authentic leadership or proactive followership?

    NARCIS (Netherlands)

    Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua

    2017-01-01

    Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in

  10. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    International Nuclear Information System (INIS)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan; Yang, Zhihong; Huang, Yi; Bennett, Jason; Wang, Li

    2016-01-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  11. Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Yang, Zhihong [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); Huang, Yi [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Bennett, Jason [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Wang, Li, E-mail: li.wang@uconn.edu [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, CT 06520 (United States)

    2016-08-01

    It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

  12. The Silencing of RECK Gene is Associated with Promoter Hypermethylation and Poor Survival in Hepatocellular Carcinoma

    Science.gov (United States)

    Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin

    2012-01-01

    Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890

  13. An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

    Directory of Open Access Journals (Sweden)

    Cem KAHYA

    2015-06-01

    Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

  14. Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

    Directory of Open Access Journals (Sweden)

    Line Kikkenborg Christensen

    2018-02-01

    Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

  15. L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

    Directory of Open Access Journals (Sweden)

    José Luis Arráez Llobregat

    2015-11-01

    Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

  16. RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

    Science.gov (United States)

    Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

    2012-09-01

    The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

  17. TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

    Directory of Open Access Journals (Sweden)

    Liyang Chen

    2015-11-01

    Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

  18. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. High-Throughput Screening Using iPSC-Derived Neuronal Progenitors to Identify Compounds Counteracting Epigenetic Gene Silencing in Fragile X Syndrome.

    Science.gov (United States)

    Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda

    2015-10-01

    Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.

  20. The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

    Science.gov (United States)

    de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

    2015-11-01

    In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

  1. Renal-Specific Silencing of TNF (Tumor Necrosis Factor) Unmasks Salt-Dependent Increases in Blood Pressure via an NKCC2A (Na+-K+-2Cl- Cotransporter Isoform A)-Dependent Mechanism.

    Science.gov (United States)

    Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R

    2018-06-01

    We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.

  2. A Resonant Silence: For an Ethnographic History of Abortion

    Directory of Open Access Journals (Sweden)

    Flávia de Mattos Motta

    2008-05-01

    Full Text Available By using methods of the fields of History and Anthropology, this study investigated the practice of abortion in southern Brazil in the first half of the twentieth century. The examination of primary sources and interviews with elderly women intended to unveil a huge silence around this practice, which leaves very few historical sources to be investigated, and hides those memories. This text presents data collected by this survey and analyzes the diversity of representations over abortion and the ambiguities that this theme causes on the subjects involved. The practice of abortion must be understood as inserted into a context of power. The subjects operate from multiple sources of knowledge and within a morality network composed of contradictory elements.

  3. Postpartum Depression: How Childbirth Educators Can Help Break the Silence

    Science.gov (United States)

    Zauderer, Cheryl

    2009-01-01

    The voices of women suffering from postpartum depression are often silent. Women are reluctant to reveal to others that they are unhappy after the birth of their babies. Much has been written on possible causes, risk factors, and treatments for postpartum depression, but little has been done to investigate why women take so long to seek help. Early detection and treatment are key to a full recovery. Childbirth educators are in the position to offer anticipatory guidance on possible complications of the postpartum period, including postpartum depression. This article explores why women with postpartum depression choose to suffer in silence and suggests how childbirth educators can help new mothers find their voices. PMID:20190853

  4. Prognostic significance of aberrantly silenced ANPEP expression in prostate cancer

    DEFF Research Database (Denmark)

    Sørensen, Karina Dalsgaard; Abildgaard, Mette Opstrup; Haldrup, Christa

    2013-01-01

    Background:Novel biomarkers for prostate cancer (PC) are urgently needed. This study investigates the expression, epigenetic regulation, and prognostic potential of ANPEP in PC.Methods:Aminopeptidase N (APN; encoded by ANPEP) expression was analysed by immunohistochemistry using tissue microarrays...... in three hypermethylated prostate cell lines, suggesting epigenetic silencing. Negative APN immunoreactivity was significantly associated with short RFS and short CSS in the RP and CT cohort, respectively, independently of routine clinicopathological predictors. Combining APN with a known angiogenesis...... representing 267 radical prostatectomy (RP) and 111 conservatively treated (CT) PC patients. Clinical end points were recurrence-free survival (RFS) and cancer-specific survival (CSS), respectively. The ANPEP promoter methylation levels were determined by bisulphite sequencing or MethyLight analysis in 278...

  5. Hearing the Silence: Children’s Voices on Violence

    Directory of Open Access Journals (Sweden)

    Kathryn S. Collins

    2003-05-01

    Full Text Available Each year more than five million children in the United States are exposed to traumatizing events in their communities. This paper presents a discussion of multiple areas in violence and victimization research that needs to be continued as well as provides suggestions on how to un-silence child survivors through bridging the gaps between research and practice. It reviews the overarching problem of violence in the U.S. at the domestic and global levels and the effects of victimization. Suggestions on how to study possible mediators and moderators of victimization and individual and family adjustment, including: 1 The ecological perspective; 2 Court process and verdict; and 3Utilization of victim services, are explored. Finally, a rationale and examples of combining qualitative and quantitative methods in future research that uses children’s attributions of violence as a mediator are presented.

  6. Silencing of voices in a Swedish science classroom

    Science.gov (United States)

    Ramos de Robles, S. Lizette

    2018-03-01

    From a sociocultural perspective, I discuss data from a Swedish science classroom presented in María Gómez's article "Student Explanations of their Science Teachers' Assessments, Grading Practices, and How they learn Science". In this discussion, I focus on the need to change existing conceptions of assessment in the teaching and learning of science. Next, I talk about the importance of taking into consideration the dialectic between agency and passivity as filters in order to understand what student silence may signify in science classes as well as in relation to their perceptions of assessment. I conclude with the importance of the teacher's role in developing formative assessment, along with the challenges in developing assessments which transform science education into a relevant field of knowledge for both students and society at large.

  7. Revival of silenced echo and quantum memory for light

    Energy Technology Data Exchange (ETDEWEB)

    Damon, V; Bonarota, M; Louchet-Chauvet, A; Chaneliere, T; Le Gouet, J-L, E-mail: jean-louis.legouet@lac.u-psud.fr [Laboratoire Aime Cotton, CNRS-UPR 3321, Univ. Paris-Sud, Bat. 505, 91405 Orsay cedex (France)

    2011-09-15

    We propose an original quantum memory protocol. It belongs to the class of rephasing processes and is closely related to two-pulse photon echo. It is known that the strong population inversion produced by the rephasing pulse prevents the plain two-pulse photon echo from serving as a quantum memory scheme. Indeed, gain and spontaneous emission generate prohibitive noise. A second {pi}-pulse can be used to simultaneously reverse the atomic phase and bring the atoms back into the ground state. Then a secondary echo is radiated from a non-inverted medium, avoiding contamination by gain and spontaneous emission noise. However, one must kill the primary echo, in order to preserve all the information for the secondary signal. In the present work, spatial phase mismatching is used to silence the standard two-pulse echo. An experimental demonstration is presented.

  8. Dismantling the Silence: LGBTQ Aging Emerging From the Margins

    Science.gov (United States)

    Fredriksen-Goldsen, Karen I.

    2017-01-01

    Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. PMID:28053011

  9. Flexible tools for gene expression and silencing in tomato.

    Science.gov (United States)

    Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

    2009-12-01

    As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

  10. Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.

    Science.gov (United States)

    Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G

    2015-01-14

    In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.

  11. Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.

    Science.gov (United States)

    Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill

    2017-11-01

    Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.

  12. Dismantling the Silence: LGBTQ Aging Emerging From the Margins.

    Science.gov (United States)

    Fredriksen-Goldsen, Karen I

    2017-02-01

    Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

    Science.gov (United States)

    Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

    2016-10-01

    Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

    Science.gov (United States)

    Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

    2016-01-01

    The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

  15. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  16. Effects of discontinuing a high-fat diet on mitochondrial proteins and 6-hydroxydopamine-induced dopamine depletion in rats.

    Science.gov (United States)

    Ma, Delin; Shuler, Jeffrey M; Raider, Kayla D; Rogers, Robert S; Wheatley, Joshua L; Geiger, Paige C; Stanford, John A

    2015-07-10

    Diet-induced obesity can increase the risk for developing age-related neurodegenerative diseases including Parkinson's disease (PD). Increasing evidence suggests that mitochondrial and proteasomal mechanisms are involved in both insulin resistance and PD. The goal of this study was to determine whether diet intervention could influence mitochondrial or proteasomal protein expression and vulnerability to 6-Hydroxydopamine (6-OHDA)-induced nigrostriatal dopamine (DA) depletion in rats' nigrostriatal system. After a 3 month high-fat diet regimen, we switched one group of rats to a low-fat diet for 3 months (HF-LF group), while the other half continued with the high-fat diet (HF group). A chow group was included as a control. Three weeks after unilateral 6-OHDA lesions, HF rats had higher fasting insulin levels and higher Homeostasis model assessment of insulin resistance (HOMA-IR), indicating insulin resistance. HOMA-IR was significantly lower in HF-LF rats than HF rats, indicating that insulin resistance was reversed by switching to a low-fat diet. Compared to the Chow group, the HF group exhibited significantly greater DA depletion in the substantia nigra but not in the striatum. DA depletion did not differ between the HF-LF and HF group. Proteins related to mitochondrial function (such as AMPK, PGC-1α), and to proteasomal function (such as TCF11/Nrf1) were influenced by diet intervention, or by 6-OHDA lesion. Our findings suggest that switching to a low-fat diet reverses the effects of a high-fat diet on systemic insulin resistance, and mitochondrial and proteasomal function in the striatum. Conversely, they suggest that the effects of the high-fat diet on nigrostriatal vulnerability to 6-OHDA-induced DA depletion persist. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. BVES regulates EMT in human corneal and colon cancer cells and is silenced via promoter methylation in human colorectal carcinoma.

    Science.gov (United States)

    Williams, Christopher S; Zhang, Baolin; Smith, J Joshua; Jayagopal, Ashwath; Barrett, Caitlyn W; Pino, Christopher; Russ, Patricia; Presley, Sai H; Peng, DunFa; Rosenblatt, Daniel O; Haselton, Frederick R; Yang, Jin-Long; Washington, M Kay; Chen, Xi; Eschrich, Steven; Yeatman, Timothy J; El-Rifai, Wael; Beauchamp, R Daniel; Chang, Min S

    2011-10-01

    The acquisition of a mesenchymal phenotype is a critical step in the metastatic progression of epithelial carcinomas. Adherens junctions (AJs) are required for suppressing this epithelial-mesenchymal transition (EMT) but less is known about the role of tight junctions (TJs) in this process. Here, we investigated the functions of blood vessel epicardial substance (BVES, also known as POPDC1 and POP1), an integral membrane protein that regulates TJ formation. BVES was found to be underexpressed in all stages of human colorectal carcinoma (CRC) and in adenomatous polyps, indicating its suppression occurs early in transformation. Similarly, the majority of CRC cell lines tested exhibited decreased BVES expression and promoter DNA hypermethylation, a modification associated with transcriptional silencing. Treatment with a DNA-demethylating agent restored BVES expression in CRC cell lines, indicating that methylation represses BVES expression. Reexpression of BVES in CRC cell lines promoted an epithelial phenotype, featuring decreased proliferation, migration, invasion, and anchorage-independent growth; impaired growth of an orthotopic xenograft; and blocked metastasis. Conversely, interfering with BVES function by expressing a dominant-negative mutant in human corneal epithelial cells induced mesenchymal features. These biological outcomes were associated with changes in AJ and TJ composition and related signaling. Therefore, BVES prevents EMT, and its epigenetic silencing may be an important step in promoting EMT programs during colon carcinogenesis.

  18. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Directory of Open Access Journals (Sweden)

    Aaron J Saathoff

    Full Text Available Cinnamyl alcohol dehydrogenase (CAD catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  19. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Science.gov (United States)

    Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

    2011-01-27

    Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  20. Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

    Science.gov (United States)

    Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

    2017-01-10

    In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

  1. Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

    Science.gov (United States)

    Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

    2011-11-04

    The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

    Directory of Open Access Journals (Sweden)

    Krystyna Adamska

    2017-06-01

    Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

  3. The physics of chromatin silencing: Bi-stability and front propagation

    Science.gov (United States)

    Sedighi, Mohammad

    A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

  4. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  5. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  6. 5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

    Science.gov (United States)

    Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

    2017-08-01

    Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

  7. Proteinase 3 on apoptotic cells disrupts immune silencing in autoimmune vasculitis

    Science.gov (United States)

    Millet, Arnaud; Martin, Katherine R.; Bonnefoy, Francis; Saas, Philippe; Mocek, Julie; Alkan, Manal; Terrier, Benjamin; Kerstein, Anja; Tamassia, Nicola; Satyanarayanan, Senthil Kumaran; Ariel, Amiram; Ribeil, Jean-Antoine; Guillevin, Loïc; Cassatella, Marco A.; Mueller, Antje; Thieblemont, Nathalie; Lamprecht, Peter; Mouthon, Luc; Perruche, Sylvain; Witko-Sarsat, Véronique

    2015-01-01

    Granulomatosis with polyangiitis (GPA) is a systemic necrotizing vasculitis that is associated with granulomatous inflammation and the presence of anti-neutrophil cytoplasmic antibodies (ANCAs) directed against proteinase 3 (PR3). We previously determined that PR3 on the surface of apoptotic neutrophils interferes with induction of antiinflammatory mechanisms following phagocytosis of these cells by macrophages. Here, we demonstrate that enzymatically active membrane-associated PR3 on apoptotic cells triggered secretion of inflammatory cytokines, including granulocyte CSF (G-CSF) and chemokines. This response required the IL-1R1/MyD88 signaling pathway and was dependent on the synthesis of NO, as macrophages from animals lacking these pathways did not exhibit a PR3-associated proinflammatory response. The PR3-induced microenvironment facilitated recruitment of inflammatory cells, such as macrophages, plasmacytoid DCs (pDCs), and neutrophils, which were observed in close proximity within granulomatous lesions in the lungs of GPA patients. In different murine models of apoptotic cell injection, the PR3-induced microenvironment instructed pDC-driven Th9/Th2 cell generation. Concomitant injection of anti-PR3 ANCAs with PR3-expressing apoptotic cells induced a Th17 response, revealing a GPA-specific mechanism of immune polarization. Accordingly, circulating CD4+ T cells from GPA patients had a skewed distribution of Th9/Th2/Th17. These results reveal that PR3 disrupts immune silencing associated with clearance of apoptotic neutrophils and provide insight into how PR3 and PR3-targeting ANCAs promote GPA pathophysiology. PMID:26436651

  8. Driving in unheard silence: Disability and the politics of shutting up.

    Science.gov (United States)

    Lourens, Heidi

    2018-03-01

    The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

  9. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    International Nuclear Information System (INIS)

    Huang, Shang-Lang; Chao, Chuck C.-K.

    2015-01-01

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

  10. Inhibition of platelet activation by lachrymatory factor synthase (LFS)-silenced (tearless) onion juice.

    Science.gov (United States)

    Thomson, Susan J; Rippon, Paula; Butts, Chrissie; Olsen, Sarah; Shaw, Martin; Joyce, Nigel I; Eady, Colin C

    2013-11-06

    Onion and garlic are renowned for their roles as functional foods. The health benefits of garlic are attributed to di-2-propenyl thiosulfinate (allicin), a sulfur compound found in disrupted garlic but not found in disrupted onion. Recently, onions have been grown with repressed lachrymatory factor synthase (LFS) activity, which causes these onions to produce increased amounts of di-1-propenyl thiosulfinate, an isomer of allicin. This investigation into the key health attributes of LFS-silenced (tearless) onions demonstrates that they have some attributes more similar to garlic and that this is likely due to the production of novel thiosulfinate or metabolites. The key finding was that collagen-induced in vitro platelet aggregation was significantly reduced by tearless onion extract over normal onion extract. Thiosulfinate or derived compounds were shown not to be responsible for the observed changes in the inflammatory response of AGS (stomach adenocarcinoma) cells to tumor necrosis factor alpha (TNFα) when pretreated with model onion juices. A preliminary rat feeding trial indicated that the tearless onions may also play a key role in reducing weight gain.

  11. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

    2015-06-16

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

  12. Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

    Directory of Open Access Journals (Sweden)

    Amelia Peral Crespo

    2015-11-01

    Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

  13. Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

    Science.gov (United States)

    Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

    2012-10-05

    The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

    Science.gov (United States)

    Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

    2013-09-01

    An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

  15. Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

    Directory of Open Access Journals (Sweden)

    Johann Lavaud

    Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

  16. Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

    Science.gov (United States)

    Vugrinec, Sascha; Kroth, Peter G.

    2012-01-01

    Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

  17. Silence in liturgy as the space for the Holy Ghost’s activity

    Directory of Open Access Journals (Sweden)

    Adelajda Sielepin

    2006-06-01

    Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

  18. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  19. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-10-01

    Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  20. Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

    Directory of Open Access Journals (Sweden)

    Mustafa Emre Civelek

    2015-12-01

    Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

  1. Reticence in Silence. An Examination of Heidegger's Phenomenology of Language in Contributions to Philosophy

    Czech Academy of Sciences Publication Activity Database

    Nitsche, Martin

    2011-01-01

    Roč. 765, č. 1 (2011), s. 74-79 ISSN 1407-2157 Institutional research plan: CEZ:AV0Z90090514 Keywords : Heidegger * contributions to philosophy * phenomenology * language * reticence in silence Subject RIV: AA - Philosophy ; Religion

  2. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  3. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  4. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

    Directory of Open Access Journals (Sweden)

    Ma Changhui

    2009-01-01

    Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

  6. Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

    Directory of Open Access Journals (Sweden)

    Oliver A Zill

    Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

  7. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing</