Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

Energy Technology Data Exchange (ETDEWEB)

Lv, Peng [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Xue, Peng; Dong, Jian [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Peng, Hui [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Clewell, Rebecca [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Wang, Aiping [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Yue [Institute for Medical Device Standardization Administration, National Institutes for Food and Drug Control, Beijing (China); Peng, Shuangqing [Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

2013-11-01

Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

Science.gov (United States)

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

Directory of Open Access Journals (Sweden)

Alison E Ringel

Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.

Directory of Open Access Journals (Sweden)

Ana Neves-Costa

2009-12-01

Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.

Silencing onion lachrymatory factor synthase causes a significant change in the sulfur secondary metabolite profile.

Science.gov (United States)

Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke

2008-08-01

Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

Directory of Open Access Journals (Sweden)

Rita Marta

2014-10-01

Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

Science.gov (United States)

Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

2004-02-01

The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading

Energy Technology Data Exchange (ETDEWEB)

Shan, Chun-Min; Wang, Jiyong; Xu, Ke; Chen, Huijie; Yue, Jia-Xing; Andrews, Stuart; Moresco, James J.; Yates, John R.; Nagy, Peter L.; Tong, Liang; Jia, Songtao

2016-09-20

Histone lysine-to-methionine (K-to-M) mutations are associated with multiple cancers, and they function in a dominant fashion to block the methylation of corresponding lysines on wild type histones. However, their mechanisms of function are controversial. Here we show that in fission yeast, introducing the K9M mutation into one of the three histone H3 genes dominantly blocks H3K9 methylation on wild type H3 across the genome. In addition, H3K9M enhances the interaction of histone H3 tail with the H3K9 methyltransferase Clr4 in a SAM (S-adenosyl-methionine)-dependent manner, and Clr4 is trapped at nucleation sites to prevent its spreading and the formation of large heterochromatin domains. We further determined the crystal structure of an H3K9M peptide in complex with human H3K9 methyltransferase G9a and SAM, which reveales that the methionine side chain had enhanced van der Waals interactions with G9a. Therefore, our results provide a detailed mechanism by which H3K9M regulates H3K9 methylation.

Weakly Compatible Mappings along with $CLR_{S}$ property in Fuzzy Metric Spaces

Directory of Open Access Journals (Sweden)

Saurabh Manro

2013-11-01

Full Text Available The aim of this work is to use newly introduced property, which is so called common limit in the range $(CLR_{S}$ for four self-mappings, and prove some theorems which satisfy this property. Moreover, we establish some new existence of a common fixed point theorem for generalized contractive mappings in fuzzy metric spaces by using this new property and give some examples to support our results. Ours results does not require condition of closeness of range and so our theorems generalize, unify, and extend many results in literature. Our results improve and extend the results of Cho et al. [4], Pathak et al. [20] and Imdad et. al. [10] besides several known results.

ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

Directory of Open Access Journals (Sweden)

Paolo Kunderfranco

2010-05-01

Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

Science.gov (United States)

Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

2015-12-02

Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

Directory of Open Access Journals (Sweden)

Subhasis Banerjee

2001-01-01

Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

Directory of Open Access Journals (Sweden)

Julia Brun

Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

Ombuds’ corner: Employee silence

CERN Multimedia

Vincent Vuillemin

2013-01-01

Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

Directory of Open Access Journals (Sweden)

Yixiang Han

Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

Toward a science of silence: The consequences of leaving a memory unsaid

DEFF Research Database (Denmark)

Stone, Charles; Coman, Alin; Brown, Adam

2012-01-01

of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

Silence multiple

DEFF Research Database (Denmark)

Søndergaard, Katia Dupret

The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

An empirical analysis on influencing factors on organizational silence and its relationship with employee’s organizational commitment

Directory of Open Access Journals (Sweden)

Belal Panahi

2012-04-01

Full Text Available Today, there is no doubt that in many organizations, many employees refuse to provide their opinions and comments about the organizational problems. In fact, in many organizations there is a created climate, which often makes employees feel their opinion is not valued. This phenomenon is examined as an organizational silence that by identifying the factors affecting on it we can effectively take steps to eliminate barriers to commenting staff in organizations. In this regard, this paper presents an empirical work conducted on data obtained from 260 employees Payame Noor University of East Azerbaijan Province. These data are analyzed by SPSS software and regression and path analysis tests. The results showed that there is a significant relationship between silence climate dimensions and employee organizational commitment with silence behavior employee. In addition, there is a positive correlation between higher management attitudes and supervisor’s attitudes with workers silent behavior. We have also observed that there is a negative correlation between communication opportunities and organizational commitment with employee silence behavior of employees.

Silêncios Silences

Directory of Open Access Journals (Sweden)

Luciano Marcondes Godoy

1999-01-01

Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.

Science.gov (United States)

Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee

2017-12-01

Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.

The impact of organizational culture on employees’ organizational silence In Shiraz University of Medical Sciences

Directory of Open Access Journals (Sweden)

Ebrahim Parcham

2017-01-01

Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced

Inhibition of platelet activation by lachrymatory factor synthase (LFS)-silenced (tearless) onion juice.

Science.gov (United States)

Thomson, Susan J; Rippon, Paula; Butts, Chrissie; Olsen, Sarah; Shaw, Martin; Joyce, Nigel I; Eady, Colin C

2013-11-06

Onion and garlic are renowned for their roles as functional foods. The health benefits of garlic are attributed to di-2-propenyl thiosulfinate (allicin), a sulfur compound found in disrupted garlic but not found in disrupted onion. Recently, onions have been grown with repressed lachrymatory factor synthase (LFS) activity, which causes these onions to produce increased amounts of di-1-propenyl thiosulfinate, an isomer of allicin. This investigation into the key health attributes of LFS-silenced (tearless) onions demonstrates that they have some attributes more similar to garlic and that this is likely due to the production of novel thiosulfinate or metabolites. The key finding was that collagen-induced in vitro platelet aggregation was significantly reduced by tearless onion extract over normal onion extract. Thiosulfinate or derived compounds were shown not to be responsible for the observed changes in the inflammatory response of AGS (stomach adenocarcinoma) cells to tumor necrosis factor alpha (TNFα) when pretreated with model onion juices. A preliminary rat feeding trial indicated that the tearless onions may also play a key role in reducing weight gain.

Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

Directory of Open Access Journals (Sweden)

Yan Liang

2013-11-01

Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

Durability of timber silencers at Wairakei geothermal steam field

Energy Technology Data Exchange (ETDEWEB)

Hedley, M E

1979-02-01

After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

Science.gov (United States)

Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2010-06-01

Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

DEFF Research Database (Denmark)

Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

2002-01-01

Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

Science.gov (United States)

Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

2007-11-01

The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

Performative Silences

DEFF Research Database (Denmark)

Dupret, Katia

2018-01-01

static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

Directory of Open Access Journals (Sweden)

Berta Bekti Retnawati

2016-11-01

Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

"Listening Silence" and Its Discursive Effects

Science.gov (United States)

Applebaum, Barbara

2016-01-01

While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

Science.gov (United States)

Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

2016-01-01

Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

Designing and Manufacturing a Noise Controlling Silencer for the Cooling Tower Pump of Sarcheshmeh Copper Power Station

Directory of Open Access Journals (Sweden)

Sajad Zare

2017-08-01

Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

Science.gov (United States)

Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

2012-11-07

CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

The organisational silence of midwives and nurses: reasons and results.

Science.gov (United States)

Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

2016-07-01

The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

Directory of Open Access Journals (Sweden)

Krystyna Adamska

2017-06-01

Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory

International Nuclear Information System (INIS)

Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei

2015-01-01

To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

Science.gov (United States)

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

Science.gov (United States)

Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

2018-07-01

Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

Science.gov (United States)

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Titration and hysteresis in epigenetic chromatin silencing

International Nuclear Information System (INIS)

Dayarian, Adel; Sengupta, Anirvan M

2013-01-01

Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

Directory of Open Access Journals (Sweden)

You Mie Lee

Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

dKDM2 couples histone H2A ubiquitylation to histone H3 demethylation during Polycomb group silencing

NARCIS (Netherlands)

A. Lagarou (Anna); A.B. Mohd Sarip; Y.M. Moshkin (Yuri); G.E. Chalkley (Gillian); K. Bezstarosti (Karel); J.A.A. Demmers (Jeroen); C.P. Verrijzer (Peter)

2008-01-01

textabstractTranscription regulation involves enzyme-mediated changes in chromatin structure. Here, we describe a novel mode of histone crosstalk during gene silencing, in which histone H2A monoubiquitylation is coupled to the removal of histone H3 Lys 36 dimethylation (H3K36me2). This pathway was

Voice and silence in organizations

Directory of Open Access Journals (Sweden)

Moaşa, H.

2011-01-01

Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

Directory of Open Access Journals (Sweden)

Fitnat Nazlı Sayğan

2011-07-01

Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Transcriptome and proteome analyses and the role of atypical calpain protein and autophagy in the spliced leader silencing pathway in Trypanosoma brucei.

Science.gov (United States)

Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit

2016-10-01

Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Silence, an Eye of Knowledge

Directory of Open Access Journals (Sweden)

Mehdi Aghamohammadi

2017-04-01

Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

Science.gov (United States)

Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

2018-06-15

The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

Science.gov (United States)

Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

2016-10-13

PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2

Directory of Open Access Journals (Sweden)

Jingyu YANG

2013-03-01

Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Analysis of Combined Cycle Power Plants with Chemical Looping Reforming of Natural Gas and Pre-Combustion CO2 Capture

Directory of Open Access Journals (Sweden)

Shareq Mohd Nazir

2018-01-01

Full Text Available In this paper, a gas-fired combined cycle power plant subjected to a pre-combustion CO2 capture method has been analysed under different design conditions and different heat integration options. The power plant configuration includes the chemical looping reforming (CLR of natural gas (NG, water gas shift (WGS process, CO2 capture and compression, and a hydrogen fuelled combined cycle to produce power. The process is denoted as a CLR-CC process. One of the main parameters that affects the performance of the process is the pressure for the CLR. The process is analysed at different design pressures for the CLR, i.e., 5, 10, 15, 18, 25 and 30 bar. It is observed that the net electrical efficiency increases with an increase in the design pressure in the CLR. Secondly, the type of steam generated from the cooling of process streams also effects the net electrical efficiency of the process. Out of the five different cases including the base case presented in this study, it is observed that the net electrical efficiency of CLR-CCs can be improved to 46.5% (lower heating value of NG basis by producing high-pressure steam through heat recovery from the pre-combustion process streams and sending it to the Heat Recovery Steam Generator in the power plant.

Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

Science.gov (United States)

Bibby, Chris; Hodgson, Murray

2017-01-01

The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

The silence.

Science.gov (United States)

Millenson, Michael L

2003-01-01

Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

Identification and gene-silencing of a putative odorant receptor transcription factor in Varroa destructor: possible role in olfaction.

Science.gov (United States)

Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V

2016-04-01

The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.

Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

Science.gov (United States)

Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

2006-12-20

MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

How Silent is the Right to Silence?

Directory of Open Access Journals (Sweden)

Katherine Biber

2012-11-01

Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

International Nuclear Information System (INIS)

Xue, Xiaofeng; Liu, Fei; Han, Ye; Li, Pu; Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting; Zhi, Qiaoming; Zhao, Hong

2014-01-01

Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer

Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

Energy Technology Data Exchange (ETDEWEB)

Xue, Xiaofeng [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Liu, Fei [Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Han, Ye [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Li, Pu [Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhi, Qiaoming, E-mail: strexboy@163.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhao, Hong, E-mail: zhaohong600@sina.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China)

2014-07-25

Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.

Judicial review of administrative silence

Directory of Open Access Journals (Sweden)

Radošević Ratko S.

2015-01-01

Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

Directory of Open Access Journals (Sweden)

Jiexiong Feng

Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

Directory of Open Access Journals (Sweden)

Stella Marie Reamon-Buettner

Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

Science.gov (United States)

Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

2016-10-01

Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

ABCE1 is a highly conserved RNA silencing suppressor.

Directory of Open Access Journals (Sweden)

Kairi Kärblane

Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

Science.gov (United States)

Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

2017-01-01

Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

Epigenetic Silencing of the Proapoptotic Gene BIM in Anaplastic Large Cell Lymphoma through an MeCP2/SIN3a Deacetylating Complex

Directory of Open Access Journals (Sweden)

Rocco Piazza

2013-05-01

Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.

[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

Science.gov (United States)

Yu, Yanping; Zhang, Song; Kong, Weijia

2010-09-01

To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

Science.gov (United States)

Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

2014-12-01

The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

Breaching cultural silence: enhancing resilience among Ugandan ...

African Journals Online (AJOL)

Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

Lactobacillus acidophilus CL1285, Lactobacillus casei LBC80R, and Lactobacillus rhamnosus CLR2 (Bio-K+): Characterization, Manufacture, Mechanisms of Action, and Quality Control of a Specific Probiotic Combination for Primary Prevention of Clostridium difficile Infection.

Science.gov (United States)

Auclair, Julie; Frappier, Martin; Millette, Mathieu

2015-05-15

A specific probiotic formulation composed of Lactobacillus acidophilus CL1285, Lactobacillus casei LBC80R, and Lactobacillus rhamnosus CLR2 (Bio-K+) has been marketed in North America since 1996. The strains and the commercial products have been evaluated for safety, identity, gastrointestinal survival, and stability throughout shelf life. The capacity of both the fermented beverages and the capsules to reduce incidences of antibiotic-associated diarrhea and Clostridium difficile infection (CDI) has been demonstrated in human clinical trials. Individual strains and the finished products have shown antimicrobial activity against C. difficile and toxin A/B neutralization capacity in vitro. The use of this specific probiotic formulation as part of a bundle of preventive measures to control CDI in healthcare settings is discussed. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Organizational Silence in Sports Employees

Science.gov (United States)

Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

2016-01-01

Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

Characterization of the single transmembrane domain of human receptor activity-modifying protein 3 in adrenomedullin receptor internalization

International Nuclear Information System (INIS)

Kuwasako, Kenji; Kitamura, Kazuo; Nagata, Sayaka; Nozaki, Naomi; Kato, Johji

2012-01-01

Highlights: ► RAMP3 mediates CLR internalization much less effectively than does RAMP2. ► The RAMP3 TMD participates in the negative regulation of CLR/RAMP3 internalization. ► A new strategy of promoting internalization and resensitization of the receptor was found. -- Abstract: Two receptor activity-modifying proteins (RAMP2 and RAMP3) enable calcitonin receptor-like receptor (CLR) to function as two heterodimeric receptors (CLR/RAMP2 and CLR/RAMP3) for adrenomedullin (AM), a potent cardiovascular protective peptide. Following AM stimulation, both receptors undergo rapid internalization through a clathrin-dependent pathway, after which CLR/RAMP3, but not CLR/RAMP2, can be recycled to the cell surface for resensitization. However, human (h)RAMP3 mediates CLR internalization much less efficiently than does hRAMP2. Therefore, the molecular basis of the single transmembrane domain (TMD) and the intracellular domain of hRAMP3 during AM receptor internalization was investigated by transiently transfecting various RAMP chimeras and mutants into HEK-293 cells stably expressing hCLR. Flow cytometric analysis revealed that substituting the RAMP3 TMD with that of RAMP2 markedly enhanced AM-induced internalization of CLR. However, this replacement did not enhance the cell surface expression of CLR, [ 125 I]AM binding affinity or AM-induced cAMP response. More detailed analyses showed that substituting the Thr 130 –Val 131 sequence in the RAMP3 TMD with the corresponding sequence (Ile 157 –Pro 158 ) from RAMP2 significantly enhanced AM-mediated CLR internalization. In contrast, substituting the RAMP3 target sequence with Ala 130 –Ala 131 did not significantly affect CLR internalization. Thus, the RAMP3 TMD participates in the negative regulation of CLR/RAMP3 internalization, and the aforementioned introduction of the Ile–Pro sequence into the RAMP3 TMD may be a strategy for promoting receptor internalization/resensitization.

Epigenetic regulation of the transcription factor Foxa2 directs differential elafin expression in melanocytes and melanoma cells

Energy Technology Data Exchange (ETDEWEB)

Yu, Kyung Sook [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Jo, Ji Yoon; Kim, Su Jin [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology, Daejeon 305-333 (Korea, Republic of); Lee, Yangsoon [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Bae, Jong Hwan [NeoPharm Co. Ltd., Daejeon 305-510 (Korea, Republic of); Chung, Young-Hwa [Department of Cogno-Mechatronics Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan 609-736 (Korea, Republic of); Koh, Sang Seok, E-mail: sskoh@kribb.re.kr [Therapeutic Antibody Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-806 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology, Daejeon 305-333 (Korea, Republic of)

2011-04-29

Highlights: {yields} Elafin expression is epigenetically silenced in human melanoma cells. {yields} Foxa2 expression in melanoma cells is silenced by promoter hypermethylation. {yields} Foxa2 directs activation of the elafin promoter in vivo. {yields} Foxa2 expression induces apoptosis of melanoma cells via elafin re-expression. -- Abstract: Elafin, a serine protease inhibitor, induces the intrinsic apoptotic pathway in human melanoma cells, where its expression is transcriptionally silenced. However, it remains unknown how the elafin gene is repressed in melanoma cells. We here demonstrate that elafin expression is modulated via epigenetically regulated expression of the transcription factor Foxa2. Treatment of melanoma cells with a DNA methyltransferase inhibitor induced elafin expression, which was specifically responsible for reduced proliferation and increased apoptosis. Suppression of Foxa2 transcription, mediated by DNA hypermethylation in its promoter region, was released in melanoma cells upon treatment with the demethylating agent. Luciferase reporter assays indicated that the Foxa2 binding site in the elafin promoter was critical for the activation of the promoter. Chromatin immunoprecipitation assays further showed that Foxa2 bound to the elafin promoter in vivo. Analyses of melanoma cells with varied levels of Foxa2 revealed a correlated expression between Foxa2 and elafin and the ability of Foxa2 to induce apoptosis. Our results collectively suggest that, in melanoma cells, Foxa2 expression is silenced and therefore elafin is maintained unexpressed to facilitate cell proliferation in the disease melanoma.

Silence, an Eye of Knowledge

Science.gov (United States)

Aghamohammadi, Mehdi

2017-01-01

One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

2013-05-10

Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

Chinanteco children’s silences in different classroom situations

Directory of Open Access Journals (Sweden)

Valeria Rebolledo Angulo

2016-01-01

Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum.

Science.gov (United States)

Li, Zhonghai; Yao, Guangshan; Wu, Ruimei; Gao, Liwei; Kan, Qinbiao; Liu, Meng; Yang, Piao; Liu, Guodong; Qin, Yuqi; Song, Xin; Zhong, Yaohua; Fang, Xu; Qu, Yinbo

2015-09-01

Filamentous fungus Penicillium oxalicum produces diverse lignocellulolytic enzymes, which are regulated by the combinations of many transcription factors. Here, a single-gene disruptant library for 470 transcription factors was constructed and systematically screened for cellulase production. Twenty transcription factors (including ClrB, CreA, XlnR, Ace1, AmyR, and 15 unknown proteins) were identified to play putative roles in the activation or repression of cellulase synthesis. Most of these regulators have not been characterized in any fungi before. We identified the ClrB, CreA, XlnR, and AmyR transcription factors as critical dose-dependent regulators of cellulase expression, the core regulons of which were identified by analyzing several transcriptomes and/or secretomes. Synergistic and additive modes of combinatorial control of each cellulase gene by these regulatory factors were achieved, and cellulase expression was fine-tuned in a proper and controlled manner. With one of these targets, the expression of the major intracellular β-glucosidase Bgl2 was found to be dependent on ClrB. The Bgl2-deficient background resulted in a substantial gene activation by ClrB and proved to be closely correlated with the relief of repression mediated by CreA and AmyR during cellulase induction. Our results also signify that probing the synergistic and dose-controlled regulation mechanisms of cellulolytic regulators and using it for reconstruction of expression regulation network (RERN) may be a promising strategy for cellulolytic fungi to develop enzyme hyper-producers. Based on our data, ClrB was identified as focal point for the synergistic activation regulation of cellulase expression by integrating cellulolytic regulators and their target genes, which refined our understanding of transcriptional-regulatory network as a "seesaw model" in which the coordinated regulation of cellulolytic genes is established by counteracting activators and repressors.

ZBED6, a novel transcription factor derived from a domesticated DNA transposon regulates IGF2 expression and muscle growth

DEFF Research Database (Denmark)

Markljung, Ellen; Jiang, Lin; Jaffe, Jacob D

2009-01-01

and find that the protein, named ZBED6, is previously unknown, specific for placental mammals, and derived from an exapted DNA transposon. Silencing of Zbed6 in mouse C2C12 myoblasts affected Igf2 expression, cell proliferation, wound healing, and myotube formation. Chromatin immunoprecipitation (Ch......, including development and transcriptional regulation. The phenotypic effects in mutant pigs and ZBED6-silenced C2C12 myoblasts, the extreme sequence conservation, its nucleolar localization, the broad tissue distribution, and the many target genes with essential biological functions suggest that ZBED6...... is an important transcription factor in placental mammals, affecting development, cell proliferation, and growth....

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

Excavating silences and tensions of agency|passivity in science education reform

Science.gov (United States)

Rivera Maulucci, Maria S.

2010-12-01

I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.

Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

Science.gov (United States)

Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans

OpenAIRE

Takahashi, Megumi; Takagi, Shin

2017-01-01

Feeding, a vital behavior in animals, is modulated depending on internal and external factors. In the nematode Caenorhabditis elegans, the feeding organ called the pharynx ingests food by pumping driven by the pharyngeal muscles. Here we report that optical silencing of the body wall muscles, which drive the locomotory movement of worms, affects pumping. In worms expressing the Arch proton pump or the ACR2 anion channel in the body wall muscle cells, the pumping rate decreases after activatio...

Gene silencing of indoleamine 2,3-dioxygenase 2 in melanoma cells induces apoptosis through the suppression of NAD+ and inhibits in vivo tumor growth.

Science.gov (United States)

Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping

2016-05-31

Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.

Choosing Silence for Equality in and through Schooling

Science.gov (United States)

Lees, Helen E.

2016-01-01

This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

Science.gov (United States)

Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

2014-01-01

Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional

OpenAIRE

Retnawati, Berta Bekti

2003-01-01

There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...

Silencing of the Mitogen-Activated Protein Kinases (MAPK) Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants.

Science.gov (United States)

Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena

2018-01-01

Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

Silencing of the Mitogen-Activated Protein Kinases (MAPK Fus3 and Slt2 in Pseudocercospora fijiensis Reduces Growth and Virulence on Host Plants

Directory of Open Access Journals (Sweden)

Francis Onyilo

2018-03-01

Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.

siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

Science.gov (United States)

Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

2008-09-18

Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

International Nuclear Information System (INIS)

Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

2002-01-01

Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

[E. M. Jellinek's silenced and silencing transgenerational story].

Science.gov (United States)

Kelemen, Gábor; Márk, Mónika

2013-01-01

Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

Directory of Open Access Journals (Sweden)

Đerić Gordana

2007-01-01

Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Two distinct mechanisms silence chinmo in Drosophila neuroblasts and neuroepithelial cells to limit their self-renewal.

Science.gov (United States)

Dillard, Caroline; Narbonne-Reveau, Karine; Foppolo, Sophie; Lanet, Elodie; Maurange, Cédric

2018-01-25

Whether common principles regulate the self-renewing potential of neural stem cells (NSCs) throughout the developing central nervous system is still unclear. In the Drosophila ventral nerve cord and central brain, asymmetrically dividing NSCs, called neuroblasts (NBs), progress through a series of sequentially expressed transcription factors that limits self-renewal by silencing a genetic module involving the transcription factor Chinmo. Here, we find that Chinmo also promotes neuroepithelium growth in the optic lobe during early larval stages by boosting symmetric self-renewing divisions while preventing differentiation. Neuroepithelium differentiation in late larvae requires the transcriptional silencing of chinmo by ecdysone, the main steroid hormone, therefore allowing coordination of neural stem cell self-renewal with organismal growth. In contrast, chinmo silencing in NBs is post-transcriptional and does not require ecdysone. Thus, during Drosophila development, humoral cues or tissue-intrinsic temporal specification programs respectively limit self-renewal in different types of neural progenitors through the transcriptional and post-transcriptional regulation of the same transcription factor. © 2018. Published by The Company of Biologists Ltd.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

Listen and the question of silence

DEFF Research Database (Denmark)

Doubinsky, Sebastien

2018-01-01

Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

The ethics of silence: Does conflict of interest explain employee silence?

Science.gov (United States)

Anderson, James

2018-03-01

Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

Silence as a Response to Everyday Violence

DEFF Research Database (Denmark)

Gammeltoft, Tine

2016-01-01

Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

Science.gov (United States)

Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

2013-01-01

Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

A New Component of the Nasonia Sex Determining Cascade Is Maternally Silenced and Regulates Transformer Expression

Science.gov (United States)

Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis

2013-01-01

Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.

Science.gov (United States)

Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L

2018-02-01

Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Effect of Circular RNA UBAP2 Silencing on Proliferation and Invasion of Human Lung Cancer A549 Cells and Its Mechanism

Directory of Open Access Journals (Sweden)

Yujing YIN

2017-12-01

Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.

Mutuality, Self-Silencing, and Disordered Eating in College Women

Science.gov (United States)

Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

2006-01-01

The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

Precedents and consequences of prosocial behaviors of voice and silence

Directory of Open Access Journals (Sweden)

Alicia Omar

2015-09-01

Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

Directory of Open Access Journals (Sweden)

Liu X

2016-04-01

Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

After the Blackbird Whistles: Listening to Silence in Classrooms

Science.gov (United States)

Schultz, Katherine

2010-01-01

Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

Memories Persist in Silence

Directory of Open Access Journals (Sweden)

Sandra Patricia Arenas Grisales

2012-08-01

Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Organizational Silence in Universities as the Predictor of Organizational Culture

Directory of Open Access Journals (Sweden)

Erkan YAMAN

2014-04-01

Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

Science.gov (United States)

Ussher, Jane M.; Perz, Janette

2010-01-01

This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

The physics of chromatin silencing: Bi-stability and front propagation

Science.gov (United States)

Sedighi, Mohammad

A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

The effects of sedative music, arousal music, and silence on electrocardiography signals.

Science.gov (United States)

Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid

2011-01-01

Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

Science.gov (United States)

Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

2016-01-01

ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

Science.gov (United States)

Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

2016-11-15

Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

Control of thermoacoustic instability with a drum-like silencer

Science.gov (United States)

Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

2017-10-01

Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

LHX6, An Independent Prognostic Factor, Inhibits Lung Adenocarcinoma Progression through Transcriptional Silencing of β-catenin.

Science.gov (United States)

Yang, Juntang; Han, Fei; Liu, Wenbin; Zhang, Mingqian; Huang, Yongsheng; Hao, Xianglin; Jiang, Xiao; Yin, Li; Chen, Hongqiang; Cao, Jia; Zhang, Huidong; Liu, Jinyi

2017-01-01

Introduction: Our previous study identified LIM homeobox domain 6 (LHX6) as a frequently epigenetically silenced tumor-suppressor gene in lung cancer. However, its clinical value has never been evaluated, and the in-depth anti-tumor mechanism remains unclear. Methods: Public database was used for lung cancer, lung adenocarcinoma and lung squamous carcinoma patients and tissue microarray data was used for lung adenocarcinoma patients to study prognostic outcome of LHX6 expression by Kaplan-Meier and Cox-regression analysis. In vitro proliferation, metastasis and in vivo nude mice model were used to evaluate the anti-tumor effect of LHX6 on lung adenocarcinoma cell lines. The mechanisms were explored using western blot, TOP/FOP flash assays and luciferase reporter assays. LHX6 expression and clinical stages data were collected from The Cancer Genome Atlas database (TCGA). Results: Expression of LHX6 was found to be a favorable independent prognostic factor for overall survival (OS) of total lung adenocarcinoma patients (P=0.014) and patients with negative lymph nodes status (P=0.014) but not related the prognostic outcome of lung squamous cell carcinoma patients. The expression status of LHX6 significantly correlated to histological grade (P<0.01), tumor size (P=0.026), lymph node status (P=0.039) and clinical stages (P<0.01) of lung adenocarcinoma patients. Functionally, LHX6 inhibited the proliferation and metastasis of lung adenocarcinoma cells in vitro and in vivo . Furthermore, LHX6 suppressed the Wnt/β-catenin pathway through transcriptionally silencing the expression of β-catenin, and the promoter region (-1161 bp to +27 bp) was crucial for its inhibitory activity. Conclusions: Our data indicate that the expression of LHX6 may serve as a favorable prognostic biomarker for lung adenocarcinoma patients and provide a novel mechanism of LHX6 involving in the tumorigenesis of lung adenocarcinoma.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

No-Big-Silence teeb klubituuri / Urmas Hännile

Index Scriptorium Estoniae

Hännile, Urmas

2009-01-01

Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

Excavating Silences and Tensions of Agency|Passivity in Science Education Reform

Science.gov (United States)

Rivera Maulucci, Maria S.

2010-01-01

I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve…

Breaking the silence

DEFF Research Database (Denmark)

Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

2012-01-01

and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Directory of Open Access Journals (Sweden)

Michelle F. Valentine

2017-05-01

Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Science.gov (United States)

Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

2017-01-01

Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

A conversation analysis of the function of silence in writing conferences

Directory of Open Access Journals (Sweden)

Milad Mirzaee

2016-07-01

Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Trends in lumber processing in the Western United States. Part II: Overrun and lumber recovery factors.

Science.gov (United States)

Charles E. Keegan; Todd A. Morgan; Keith A. Blatner; Jean M. Daniels

2010-01-01

This article describes trends in three measures of lumber recovery for sawmills in the western United States: lumber overrun (LO), lumber recovery factor (LRF), and cubic lumber recovery (CLR). All states and regions showed increased LO during the last three decades. Oregon and Montana had the highest LO at 107 and 100 percent, respectively. Alaska had the lowest LO at...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2004-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2005-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2006-01-01

...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

Silencing of Atp2b1 increases blood pressure through vasoconstriction.

Science.gov (United States)

Shin, Young-Bin; Lim, Ji Eun; Ji, Su-Min; Lee, Hyeon-Ju; Park, So-Yon; Hong, Kyung-Won; Lim, Mihwa; McCarthy, Mark I; Lee, Young-Ho; Oh, Bermseok

2013-08-01

Recent genome-wide association studies (GWASs) have identified 30 genetic loci that regulate blood pressure, increasing our understanding of the cause of hypertension. However, it has been difficult to define the causative genes at these loci due to a lack of functional analyses. In this study, we aimed to validate the candidate gene ATP2B1 in 12q21, variants near which have the strongest association with blood pressure in Asians and Europeans. ATP2B1 functions as a calcium pump to fine-tune calcium concentrations - necessary for repolarization following muscular contractions. We silenced Atp2b1 using an siRNA complex, injected into mouse tail veins. In treated mice, blood pressure rose and the mesenteric arteries increased in wall : lumen ratio. Moreover, the arteries showed enhanced myogenic responses to pressure, and contractile responses to phenylephrine increased compared with the control, suggesting that blood pressure is regulated by ATP2B1 through the contraction and dilation of the vessel, likely by controlling calcium concentrations in the resting state. These results support that ATP2B1 is the causative gene in the blood pressure-associated 12q21 locus and demonstrate that ATP2B1 expression in the vessel influences blood pressure.

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

Science.gov (United States)

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-11-04

The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

Hip fracture risk assessment: artificial neural network outperforms conditional logistic regression in an age- and sex-matched case control study.

Science.gov (United States)

Tseng, Wo-Jan; Hung, Li-Wei; Shieh, Jiann-Shing; Abbod, Maysam F; Lin, Jinn

2013-07-15

Osteoporotic hip fractures with a significant morbidity and excess mortality among the elderly have imposed huge health and economic burdens on societies worldwide. In this age- and sex-matched case control study, we examined the risk factors of hip fractures and assessed the fracture risk by conditional logistic regression (CLR) and ensemble artificial neural network (ANN). The performances of these two classifiers were compared. The study population consisted of 217 pairs (149 women and 68 men) of fractures and controls with an age older than 60 years. All the participants were interviewed with the same standardized questionnaire including questions on 66 risk factors in 12 categories. Univariate CLR analysis was initially conducted to examine the unadjusted odds ratio of all potential risk factors. The significant risk factors were then tested by multivariate analyses. For fracture risk assessment, the participants were randomly divided into modeling and testing datasets for 10-fold cross validation analyses. The predicting models built by CLR and ANN in modeling datasets were applied to testing datasets for generalization study. The performances, including discrimination and calibration, were compared with non-parametric Wilcoxon tests. In univariate CLR analyses, 16 variables achieved significant level, and six of them remained significant in multivariate analyses, including low T score, low BMI, low MMSE score, milk intake, walking difficulty, and significant fall at home. For discrimination, ANN outperformed CLR in both 16- and 6-variable analyses in modeling and testing datasets (p?hip fracture are more personal than environmental. With adequate model construction, ANN may outperform CLR in both discrimination and calibration. ANN seems to have not been developed to its full potential and efforts should be made to improve its performance.

The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

Directory of Open Access Journals (Sweden)

Ling Yang

2013-01-01

Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati

Index Scriptorium Estoniae

2000-01-01

Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"

MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R

International Nuclear Information System (INIS)

Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun

2016-01-01

Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

Silencing of the transcription factor STAT3 sensitizes lung cancer cells to DNA damaging drugs, but not to TNFα- and NK cytotoxicity

Energy Technology Data Exchange (ETDEWEB)

Kulesza, Dorota W. [Laboratory of Transcription Regulation, Department of Cell Biology, The Nencki Institute of Experimental Biology, Warsaw (Poland); Postgraduate School of Molecular Medicine, Warsaw Medical University, Warsaw (Poland); Carré, Thibault; Chouaib, Salem [Unité INSERM U753, Institut de Cancérologie Gustave Roussy, Villejuif Cedex (France); Kaminska, Bozena, E-mail: bozenakk@nencki.gov.pl [Laboratory of Transcription Regulation, Department of Cell Biology, The Nencki Institute of Experimental Biology, Warsaw (Poland)

2013-02-15

Transcription factor STAT3 (Signal Transducers and Activators of Transcription 3) is persistently active in human tumors and may contribute to tumor progression. Inhibition of STAT3 expression/activity could be a good strategy to modulate tumor cell survival and responses to cancer chemotherapeutics or immune cytotoxicity. We silenced STAT3 expression in human A549 lung cancer cells to elucidate its role in cell survival and resistance to chemotherapeutics, TNFα and natural killer (NK)-mediated cytotoxicity. We demonstrate that STAT3 is not essential for basal survival and proliferation of A549 cancer cells. Stable silencing of STAT3 expression sensitized A549 cells to DNA damaging chemotherapeutics doxorubicin and cisplatin in a p53-independent manner. Sensitization to DNA damage-inducing chemotherapeutics could be due to down-regulation of the Bcl-xL expression in STAT3 depleted cells. In contrast, knockdown of STAT3 in cancer cells did not modulate responses to TNFα and NK-mediated cytotoxicity. We found that STAT3 depletion increased the NFκB activity likely providing the compensatory, pro-survival signal. The treatment with TNFα, but not doxorubicin, enhanced this effect. We conclude that STAT3 is not crucial for the control of basal cell proliferation and survival of lung carcinoma cells but modulates susceptibility to DNA damaging chemotherapeutics by regulation of intrinsic pro-survival pathways. - Highlights: ► STAT3 silencing is negligent for basal lung cancer cell viability and proliferation. ► STAT3 depletion sensitizes lung cancer cells to DNA damaging chemotherapeutics. ► STAT3 depletion has no effect on susceptibility to extrinsic apoptosis inducers. ► Increased pro-survival NFκB activity may compensate for STAT3 depletion.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

DEFF Research Database (Denmark)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

2016-01-01

/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

Science.gov (United States)

Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

2014-09-01

BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

Directory of Open Access Journals (Sweden)

Pengfei Ding

2015-06-01

Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Directory of Open Access Journals (Sweden)

Pizzichini Daniele

2007-03-01

Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

Silencing criticism in Mexico

Directory of Open Access Journals (Sweden)

Ximena Suárez

2017-10-01

Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

Epigenetic switch from posttranscriptional to transcriptional silencing is correlated with promoter hypermethylation

Czech Academy of Sciences Publication Activity Database

Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš

2003-01-01

Roč. 133, č. 3 (2003), s. 1240-1250 ISSN 0032-0889 R&D Projects: GA ČR GA521/01/0037; GA ČR GP521/01/P042 Institutional research plan: CEZ:AV0Z5004920 Keywords : tobacco * gene silencing * transgenic plant Subject RIV: BO - Biophysics Impact factor: 5.634, year: 2003

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

Directory of Open Access Journals (Sweden)

Kevin J Paik

Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Flexible tools for gene expression and silencing in tomato.

Science.gov (United States)

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

INDIRECT COMMUNICATION AND FACE-SAVING FACTOR: FROM THEORY TO PRACTICE

Directory of Open Access Journals (Sweden)

ROZINA GUNTA

2015-01-01

Full Text Available The paper analyses silence as a non-linguistic resource for conveying indirect communicative acts. Applied linguists assert that the use of silence for communicative purposes might be determined by several categories of factors, the face-saving factor being one of them. So far, much research has been done to determine how the speakers of different languages use silence; however, only limited research on silence as a strategy for face saving can be identified. Thus, the current investigation was undertaken to explore the relationship between the face-saving factor and non-verbal communication where silence as a strategy for indirect interaction was applied. Within this framework, the study dealt with the analysis of silence as a workable strategy that is often adopted in non-native speakers’ communication in English. With this purpose, four focus groups of non-native speakers (NNSs of English in Latvia were selected. The investigation was approached from the perspective of qualitative research, and it applied a case study as the research method. The study has acquired two types of findings. First, when the target language is applied for interactional purposes, NNSs of the English language are influenced by cognitive and pragma-social factors. Second, when NNSs adopt both aspects of language, i.e., verbal and non-verbal, for interaction, the strategy depends on numerous factors, silence being one of them. The study has demonstrated that silence is often applied to communicate information indirectly, and it is frequently used as a face-saving strategy in interaction in the target language. The use of silence as a communicative strategy depends on numerous factors in different non-native language users’ settings and varies according to the focus of interactional purposes.

Silencing the Transcriptional Repressor, ZCT1, Illustrates the Tight Regulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Hairy Roots.

Directory of Open Access Journals (Sweden)

Noreen F Rizvi

Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Silencing of NRF2 Reduces the Expression of ALDH1A1 and ALDH3A1 and Sensitizes to 5-FU in Pancreatic Cancer Cells

Directory of Open Access Journals (Sweden)

Hong-Quan Duong

2017-07-01

Full Text Available Pancreatic cancer remains an intractable cancer with a poor five-year survival rate, which requires new therapeutic modalities based on the biology of pancreatic oncogenesis. Nuclear factor E2 related factor-2 (NRF2, a key cytoprotective nuclear transcription factor, regulates antioxidant production, reduction, detoxification and drug efflux proteins. It also plays an essential role in cell homeostasis, cell proliferation and resistance to chemotherapy. We aimed to evaluate the possibility that modulation of NRF2 expression could be effective in the treatment of pancreatic cancer cells. We investigated whether the depletion of NRF2 by using small interfering RNAs (siRNAs is effective in the expression of biomarkers of pancreatic cancer stemness such as aldehyde dehydrogenase 1 family, member A1 (ALDH1A1 and aldehyde dehydrogenase 3 family, member A1 (ALDH3A1. NRF2 knockdown markedly reduced the expression of NRF2 and glutamate-cysteine ligase catalytic subunit (GCLC in cell lines established from pancreatic cancers. NRF2 silencing also decreased the ALDH1A1 and ALDH3A1 expression. Furthermore, this NRF2 depletion enhanced the antiproliferative effects of the chemotherapeutic agent, 5-fluorouracil (5-FU in pancreatic cancer cells.

Isonicotinamide Enhances Sir2 Protein-mediated Silencing and Longevity in Yeast by Raising Intracellular NAD+ Concentration*

Science.gov (United States)

McClure, Julie M.; Wierman, Margaret B.; Maqani, Nazif; Smith, Jeffrey S.

2012-01-01

Sirtuins are an evolutionarily conserved family of NAD+-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD+ concentration through the combined action of NAD+ biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD+ precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD+ salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD+ concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD+. The INAM-induced increase in NAD+ was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD+ salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD+. We also provide evidence suggesting that INAM influences the expression of multiple NAD+ biosynthesis and salvage pathways to promote homeostasis during stationary phase. PMID:22539348

Isonicotinamide enhances Sir2 protein-mediated silencing and longevity in yeast by raising intracellular NAD+ concentration.

Science.gov (United States)

McClure, Julie M; Wierman, Margaret B; Maqani, Nazif; Smith, Jeffrey S

2012-06-15

Sirtuins are an evolutionarily conserved family of NAD(+)-dependent protein deacetylases that function in the regulation of gene transcription, cellular metabolism, and aging. Their activity requires the maintenance of an adequate intracellular NAD(+) concentration through the combined action of NAD(+) biosynthesis and salvage pathways. Nicotinamide (NAM) is a key NAD(+) precursor that is also a byproduct and feedback inhibitor of the deacetylation reaction. In Saccharomyces cerevisiae, the nicotinamidase Pnc1 converts NAM to nicotinic acid (NA), which is then used as a substrate by the NAD(+) salvage pathway enzyme NA phosphoribosyltransferase (Npt1). Isonicotinamide (INAM) is an isostere of NAM that stimulates yeast Sir2 deacetylase activity in vitro by alleviating the NAM inhibition. In this study, we determined that INAM stimulates Sir2 through an additional mechanism in vivo, which involves elevation of the intracellular NAD(+) concentration. INAM enhanced normal silencing at the rDNA locus but only partially suppressed the silencing defects of an npt1Δ mutant. Yeast cells grown in media lacking NA had a short replicative life span, which was extended by INAM in a SIR2-dependent manner and correlated with increased NAD(+). The INAM-induced increase in NAD(+) was strongly dependent on Pnc1 and Npt1, suggesting that INAM increases flux through the NAD(+) salvage pathway. Part of this effect was mediated by the NR salvage pathways, which generate NAM as a product and require Pnc1 to produce NAD(+). We also provide evidence suggesting that INAM influences the expression of multiple NAD(+) biosynthesis and salvage pathways to promote homeostasis during stationary phase.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Tailored antiplatelet therapy can overcome clopidogrel and aspirin resistance - The BOchum CLopidogrel and Aspirin Plan (BOCLA-Plan to improve antiplatelet therapy

Directory of Open Access Journals (Sweden)

Pepinghege Fenena

2011-01-01

Full Text Available Abstract Background Dual antiplatelet therapy using acetylsalicylic acid (ASA, aspirin and clopidogrel is of great importance following coronary stenting. However, the variable platelet inhibitory effectiveness compromises the antithrombotic advantages provided by dual antiplatelet therapy. The aim of this single-center prospective study was to reduce the low response incidence of dual antiplatelet therapy with ASA and clopidogrel according to a prespecified therapy algorithm. Methods Platelet function testing using whole blood aggregometry (Chronolog 590 was performed 48 hours following coronary stenting (for either acute coronary syndromes or stable coronary artery disease on 504 patients. The antiplatelet therapy included a loading dose of 600 mg clopidogrel and 500 mg ASA, followed by 75 mg clopidogrel and 100 mg ASA once daily. Clopidogrel low responders (CLR: >5 ohm; adenosine diphosphate (ADP 5 μM and/or ASA low responders (ALR: >0 ohm; arachidonic acid 10 μM were treated according to a structured therapy plan: in the case of CLR, the maintenance + dose was doubled (repeated loading dose followed by 150 mg daily, and when still ineffective ticlopidine or prasugrel, if available and not contraindicated, were used. ALR was treated by increasing the dose to 300 mg in a first step or to 500 mg ASA when the first modification did not take effect sufficiently. In addition, ADP receptor antagonist 2-methylthioadenosine 5'-monophosphate triethylammonium salt (MeSAMP testing and ASA incubation were performed to rule out either a platelet ADP-receptor defect or an ASA pharmacokinetic resistance. Results Of the total cohort of 504 patients, we detected 30.8% clopidogrel low-responders and 19.4% aspirin low-responders. For ALR, with a dose adjustment of 300 mg ASA daily, 94.6% of ALR were effectively treated and the residual 5.4% by administration of daily dosages of 500 mg ASA. This means that after modification of the ASA maintenance dose, all

Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

Directory of Open Access Journals (Sweden)

Hanoch Goldshmidt

2010-01-01

Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β-Cell Damage

Directory of Open Access Journals (Sweden)

Jingqi Fu

2015-01-01

Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

Directory of Open Access Journals (Sweden)

Dawn Llewellyn

2016-06-01

Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

Bodies, Spaces, Voices, Silences

Directory of Open Access Journals (Sweden)

Donatella Mazzoleni

2013-07-01

Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

Science.gov (United States)

Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

2015-03-01

The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

Relationships between Organizational Climate and Organizational Silence with Psychological Empowerment of Employees in Hospitals Affiliated with Birjand University of Medical Sciences; 2015

Directory of Open Access Journals (Sweden)

Parviz Aghaie Borzabad

2015-10-01

Full Text Available Background and Aim: Identifying factors associated with employees empowerment of their working centers can promote organizational performance of hospitals. The current study aimed at investigating the relationship of both organizational climate and organizational silence with psychological empowerment in the public hospitals affiliated with Birjand University of Medical Sciences (BUMS. Materials and Methods: This cross-sectional and correlational study was carried out in 2015. Using a stratified randomized sampling, 400 employees were selected from the public. hospitals affiliated with BUMS.  Data collection tools were. three self-administered questionnaires including organizational climate, organizational silence, and psychological empowerment. . Validity and reliability of the questionnaires were verified using experts judgment and Cronbach alpha coefficients more than 0.7, respectively. Data analysis was done by means of SPSS (V: 18 software using one sample t test, independent t test, Pearson correlation coefficient, and one-way ANOVA. The cut-off point of 70%.of Likert-type scale (3.5 was considered as an acceptable mean for each variable. Results: The mean organizational climate and organizational silence was 2.45 and 3.18, respectively which did not correspond with an acceptable mean (P<0.05. Although the mean psychological construct which was 3.6 had an acceptable value, mean of the two other sub-variables i.e. “trust to others” and “self-determination” were 3.2±0.83 and 3.42±0.67, respectively; and they were not at an acceptable level (P<0.05. It is observed that both organizational climate and organizational silence were positively correlated to psychological empowerment with 0.6 and 0.58 coefficients, respectively (P<0.05. Conclusion:  It is suggested that the hospitals administrators should promote the psychological empowerment of their employees  through improving organizational climate and decreasing organizational

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

Statin therapy exacerbates alcohol-induced constriction of cerebral arteries via modulation of ethanol-induced BK channel inhibition in vascular smooth muscle.

Science.gov (United States)

Simakova, Maria N; Bisen, Shivantika; Dopico, Alex M; Bukiya, Anna N

2017-12-01

Statins constitute the most commonly prescribed drugs to decrease cholesterol (CLR). CLR is an important modulator of alcohol-induced cerebral artery constriction (AICAC). Using rats on a high CLR diet (2% CLR) we set to determine whether atorvastatin administration (10mg/kg daily for 18-23weeks) modified AICAC. Middle cerebral arteries were pressurized in vitro at 60mmHg and AICAC was evoked by 50mM ethanol, that is within the range of blood alcohol detected in humans following moderate-to-heavy drinking. AICAC was evident in high CLR+atorvastatin group but not in high CLR diet+placebo. Statin exacerbation of AICAC persisted in de-endothelialized arteries, and was blunted by CLR enrichment in vitro. Fluorescence imaging of filipin-stained arteries showed that atorvastatin decreased vascular smooth muscle (VSM) CLR when compared to placebo, this difference being reduced by CLR enrichment in vitro. Voltage- and calcium-gated potassium channels of large conductance (BK) are known VSM targets of ethanol, with their beta1 subunit being necessary for ethanol-induced channel inhibition and resulting AICAC. Ethanol-induced BK inhibition in excised membrane patches from freshly isolated myocytes was exacerbated in the high CLR diet+atorvastatin group when compared to high CLR diet+placebo. Unexpectedly, atorvastatin decreased the amount and function of BK beta1 subunit as documented by immunofluorescence imaging and functional patch-clamp studies. Atorvastatin exacerbation of ethanol-induced BK inhibition disappeared upon artery CLR enrichment in vitro. Our study demonstrates for the first time statin's ability to exacerbate the vascular effect of a widely consumed drug of abuse, this exacerbation being driven by statin modulation of ethanol-induced BK channel inhibition in the VSM via CLR-mediated mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

Inhibitory effects of two G protein-coupled receptor kinases on the cell surface expression and signaling of the human adrenomedullin receptor

International Nuclear Information System (INIS)

Kuwasako, Kenji; Sekiguchi, Toshio; Nagata, Sayaka; Jiang, Danfeng; Hayashi, Hidetaka; Murakami, Manabu; Hattori, Yuichi; Kitamura, Kazuo; Kato, Johji

2016-01-01

Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM_1 receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM_1 receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM_1 receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific ["1"2"5I]AM binding and AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β_2-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM_1 receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

Role of DNA methylation and epigenetic silencing of HAND2 in endometrial cancer development.

Directory of Open Access Journals (Sweden)

Allison Jones

2013-11-01

Full Text Available Endometrial cancer incidence is continuing to rise in the wake of the current ageing and obesity epidemics. Much of the risk for endometrial cancer development is influenced by the environment and lifestyle. Accumulating evidence suggests that the epigenome serves as the interface between the genome and the environment and that hypermethylation of stem cell polycomb group target genes is an epigenetic hallmark of cancer. The objective of this study was to determine the functional role of epigenetic factors in endometrial cancer development.Epigenome-wide methylation analysis of >27,000 CpG sites in endometrial cancer tissue samples (n = 64 and control samples (n = 23 revealed that HAND2 (a gene encoding a transcription factor expressed in the endometrial stroma is one of the most commonly hypermethylated and silenced genes in endometrial cancer. A novel integrative epigenome-transcriptome-interactome analysis further revealed that HAND2 is the hub of the most highly ranked differential methylation hotspot in endometrial cancer. These findings were validated using candidate gene methylation analysis in multiple clinical sample sets of tissue samples from a total of 272 additional women. Increased HAND2 methylation was a feature of premalignant endometrial lesions and was seen to parallel a decrease in RNA and protein levels. Furthermore, women with high endometrial HAND2 methylation in their premalignant lesions were less likely to respond to progesterone treatment. HAND2 methylation analysis of endometrial secretions collected using high vaginal swabs taken from women with postmenopausal bleeding specifically identified those patients with early stage endometrial cancer with both high sensitivity and high specificity (receiver operating characteristics area under the curve = 0.91 for stage 1A and 0.97 for higher than stage 1A. Finally, mice harbouring a Hand2 knock-out specifically in their endometrium were shown to develop

Linguistic and Psychological Perspectives on Prolonged Periods of Silence in Dual-Language Learners

Science.gov (United States)

Le Pichon, Emmanuelle; de Jonge, Maretha

2016-01-01

In this paper, we present an examination of the literature on prolonged periods of silence in children from the perspective of two different scientific fields. The aim is to call attention to the inherent complexity of the factors that may be involved in the etiology of mutistic behavior during child development. Medical and linguistic literature…

5-HT1A receptor gene silencers Freud-1 and Freud-2 are differently expressed in the brain of rats with genetically determined high level of fear-induced aggression or its absence.

Science.gov (United States)

Kondaurova, Elena M; Ilchibaeva, Tatiana V; Tsybko, Anton S; Kozhemyakina, Rimma V; Popova, Nina K; Naumenko, Vladimir S

2016-09-01

Serotonin 5-HT1A receptor is known to play a crucial role in the mechanisms of genetically defined aggression. In its turn, 5-HT1A receptor functional state is under control of multiple factors. Among others, transcriptional factors Freud-1 and Freud-2 are known to be involved in the repression of 5-HT1A receptor gene expression. However, implication of these factors in the regulation of behavior is unclear. Here, we investigated the expression of 5-HT1A receptor and silencers Freud-1 and Freud-2 in the brain of rats selectively bred for 85 generations for either high level of fear-induced aggression or its absence. It was shown that Freud-1 and Freud-2 levels were different in aggressive and nonaggressive animals. Freud-1 protein level was decreased in the hippocampus, whereas Freud-2 protein level was increased in the frontal cortex of highly aggressive rats. There no differences in 5-HT1A receptor gene expression were found in the brains of highly aggressive and nonaggressive rats. However, 5-HT1A receptor protein level was decreased in the midbrain and increased in the hippocampus of highly aggressive rats. These data showed the involvement of Freud-1 and Freud-2 in the regulation of genetically defined fear-induced aggression. However, these silencers do not affect transcription of the 5-HT1A receptor gene in the investigated rats. Our data indicate the implication of posttranscriptional rather than transcriptional regulation of 5-HT1A receptor functional state in the mechanisms of genetically determined aggressive behavior. On the other hand, the implication of other transcriptional regulators for 5-HT1A receptor gene in the mechanisms of genetically defined aggression could be suggested. Copyright © 2016 Elsevier B.V. All rights reserved.

Inhibitory effects of two G protein-coupled receptor kinases on the cell surface expression and signaling of the human adrenomedullin receptor

Energy Technology Data Exchange (ETDEWEB)

Kuwasako, Kenji, E-mail: kuwasako@med.miyazaki-u.ac.jp [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan); Sekiguchi, Toshio [Noto Marine Laboratory, Division of Marine Environmental Studies, Institute of Nature and Environmental Technology, Kanazawa University, Ishikawa, 927-0553 (Japan); Nagata, Sayaka [Division of Circulatory and Body Fluid Regulation, Faculty of Medicine, University of Miyazaki, Miyazaki, 889-1692 (Japan); Jiang, Danfeng; Hayashi, Hidetaka [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan); Murakami, Manabu [Department of Pharmacology, Hirosaki University, Graduate School of Medicine, Hirosaki, 036-8562 (Japan); Hattori, Yuichi [Department of Molecular and Medical Pharmacology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama, 930-0194 (Japan); Kitamura, Kazuo [Division of Circulatory and Body Fluid Regulation, Faculty of Medicine, University of Miyazaki, Miyazaki, 889-1692 (Japan); Kato, Johji [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan)

2016-02-19

Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM{sub 1} receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM{sub 1} receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM{sub 1} receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific [{sup 125}I]AM binding and AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β{sub 2}-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM{sub 1} receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.

Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

Directory of Open Access Journals (Sweden)

Tasleem Arif

2014-01-01

Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

Directory of Open Access Journals (Sweden)

Michael Gary Duncan

2012-03-01

Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

Science.gov (United States)

Suhor, Charles

1991-01-01

Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Beyond Silence: A Randomized, Parallel-Group Trial Exploring the Impact of Workplace Mental Health Literacy Training with Healthcare Employees.

Science.gov (United States)

Moll, Sandra E; Patten, Scott; Stuart, Heather; MacDermid, Joy C; Kirsh, Bonnie

2018-01-01

This study sought to evaluate whether a contact-based workplace education program was more effective than standard mental health literacy training in promoting early intervention and support for healthcare employees with mental health issues. A parallel-group, randomised trial was conducted with employees in 2 multi-site Ontario hospitals with the evaluators blinded to the groups. Participants were randomly assigned to 1 of 2 group-based education programs: Beyond Silence (comprising 6 in-person, 2-h sessions plus 5 online sessions co-led by employees who personally experienced mental health issues) or Mental Health First Aid (a standardised 2-day training program led by a trained facilitator). Participants completed baseline, post-group, and 3-mo follow-up surveys to explore perceived changes in mental health knowledge, stigmatized beliefs, and help-seeking/help-outreach behaviours. An intent-to-treat analysis was completed with 192 participants. Differences were assessed using multi-level mixed models accounting for site, group, and repeated measurement. Neither program led to significant increases in help-seeking or help-outreach behaviours. Both programs increased mental health literacy, improved attitudes towards seeking treatment, and decreased stigmatized beliefs, with sustained changes in stigmatized beliefs more prominent in the Beyond Silence group. Beyond Silence, a new contact-based education program customised for healthcare workers was not superior to standard mental health literacy training in improving mental health help-seeking or help-outreach behaviours in the workplace. The only difference was a reduction in stigmatized beliefs over time. Additional research is needed to explore the factors that lead to behaviour change.

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

OpenAIRE

Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

2011-01-01

Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

Marie Nimier, au cœur du silence

Directory of Open Access Journals (Sweden)

Joëlle Papillon

2012-01-01

Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

Identification of the TaBTF3 gene in wheat (Triticum aestivum L.) and the effect of its silencing on wheat chloroplast, mitochondria and mesophyll cell development.

Science.gov (United States)

Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai

2012-10-05

The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.

Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

Czech Academy of Sciences Publication Activity Database

Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

2011-01-01

Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

Science.gov (United States)

Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

2017-07-11

Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

Directory of Open Access Journals (Sweden)

Alessandro Di Tullio

2017-07-01

Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

Polymorphisms in the mitochondrial ribosome recycling factor EF-G2mt/MEF2 compromise cell respiratory function and increase atorvastatin toxicity.

Directory of Open Access Journals (Sweden)

Sylvie Callegari

Full Text Available Mitochondrial translation, essential for synthesis of the electron transport chain complexes in the mitochondria, is governed by nuclear encoded genes. Polymorphisms within these genes are increasingly being implicated in disease and may also trigger adverse drug reactions. Statins, a class of HMG-CoA reductase inhibitors used to treat hypercholesterolemia, are among the most widely prescribed drugs in the world. However, a significant proportion of users suffer side effects of varying severity that commonly affect skeletal muscle. The mitochondria are one of the molecular targets of statins, and these drugs have been known to uncover otherwise silent mitochondrial mutations. Based on yeast genetic studies, we identify the mitochondrial translation factor MEF2 as a mediator of atorvastatin toxicity. The human ortholog of MEF2 is the Elongation Factor Gene (EF-G 2, which has previously been shown to play a specific role in mitochondrial ribosome recycling. Using small interfering RNA (siRNA silencing of expression in human cell lines, we demonstrate that the EF-G2mt gene is required for cell growth on galactose medium, signifying an essential role for this gene in aerobic respiration. Furthermore, EF-G2mt silenced cell lines have increased susceptibility to cell death in the presence of atorvastatin. Using yeast as a model, conserved amino acid variants, which arise from non-synonymous single nucleotide polymorphisms (SNPs in the EF-G2mt gene, were generated in the yeast MEF2 gene. Although these mutations do not produce an obvious growth phenotype, three mutations reveal an atorvastatin-sensitive phenotype and further analysis uncovers a decreased respiratory capacity. These findings constitute the first reported phenotype associated with SNPs in the EF-G2mt gene and implicate the human EF-G2mt gene as a pharmacogenetic candidate gene for statin toxicity in humans.

Techno-economic assessment of membrane assisted fluidized bed reactors for pure H_2 production with CO_2 capture

International Nuclear Information System (INIS)

Spallina, V.; Pandolfo, D.; Battistella, A.; Romano, M.C.; Van Sint Annaland, M.; Gallucci, F.

2016-01-01

Highlights: • Membrane reactors improve the overall efficiency of H_2 production up to 20%. • Respect to conventional reforming, the H_2 yield increases from 12% to 20%. • The COH is reduced of at least 220% using membrane reactors. • FBMR capture 72% of CO_2 with a specific cost of 8 eur/tonn_C_O_2_. • MA-CLR can reach 90% of CO_2 avoided with same cost of FTR. - Abstract: This paper addresses the techno-economic assessment of two membrane-based technologies for H_2 production from natural gas, fully integrated with CO_2 capture. In the first configuration, a fluidized bed membrane reactor (FBMR) is integrated in the H_2 plant: the natural gas reacts with steam in the catalytic bed and H_2 is simultaneously separated using Pd-based membranes, and the heat of reaction is provided to the system by feeding air as reactive sweep gas in part of the membranes and by burning part of the permeated H_2 (in order to avoid CO_2 emissions for heat supply). In the second system, named membrane assisted chemical looping reforming (MA-CLR), natural gas is converted in the fuel rector by reaction with steam and an oxygen carrier (chemical looping reforming), and the produced H_2 permeates through the membranes. The oxygen carrier is re-oxidized in a separate air reactor with air, which also provides the heat required for the endothermic reactions in the fuel reactor. The plants are optimized by varying the operating conditions of the reactors such as temperature, pressures (both at feed and permeate side), steam-to-carbon ratio and the heat recovery configuration. The plant design is carried out using Aspen Simulation, while the novel reactor concepts have been designed and their performance have been studied with a dedicated phenomenological model in Matlab. Both configurations have been designed and compared with reference technologies for H_2 production based on conventional fired tubular reforming (FTR) with and without CO_2 capture. The results of the analysis show

A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

Directory of Open Access Journals (Sweden)

Tobias Gröβl

Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

A Decade of Experience in Primary Prevention of Clostridium difficile Infection at a Community Hospital Using the Probiotic Combination Lactobacillus acidophilus CL1285, Lactobacillus casei LBC80R, and Lactobacillus rhamnosus CLR2 (Bio-K+).

Science.gov (United States)

Maziade, Pierre-Jean; Pereira, Pascale; Goldstein, Ellie J C

2015-05-15

In August 2003, the 284-bed community hospital Pierre-Le Gardeur (PLGH) in Quebec experienced a major outbreak associated with the Clostridium difficile NAP1/027/BI strain. Augmented standard preventive measures (SPMs) were not able to control this outbreak. It was decided in February 2004 to give to every adult inpatient on antibiotics, without any exclusion, a probiotic (Bio-K+: Lactobacillus acidophilus CL1285, Lactobacillus casei LBC80R, and Lactobacillus rhamnosus CLR2) within 12 hours of the antibiotic prescription. Augmented SPMs were continued. The use of the probiotic in addition to SPMs was associated with a marked reduction of C. difficile infection (CDI). During the 10 years of observation, 44 835 inpatients received Bio-K+, and the CDI rate at PLGH declined from 18.0 cases per 10,000 patient-days and remained at low mean levels of 2.3 cases per 10,000 patient-days. Additionally, 10-year data collected by the Ministry of Health in Quebec comparing the CDI rate between Quebec hospitals showed that CDI rates at PLGH were consistently and continuously lower compared with those at similar hospitals. Blood cultures were monitored at PLGH for Lactobacillus bacteremia through the 10 years' experience, and no Lactobacillus bacteremias were detected. Despite the limitation of an observational study, we concluded that the probiotic Bio-K+ was safe and effective in decreasing our primary CDI rate. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

International Nuclear Information System (INIS)

Liu Xiaoqun; Qiao Tiankui

2014-01-01

Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

Directory of Open Access Journals (Sweden)

Saeedeh Shafiee Nahrkhalaji

2013-05-01

Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

Communicative Silences: Forms and Functions

Science.gov (United States)

Bruneau, Thomas J.

1973-01-01

The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The Gift of Silence

Science.gov (United States)

Haskins, Cathleen

2011-01-01

Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

Science.gov (United States)

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway.

Science.gov (United States)

Foda, Bardees M; Singh, Upinder

2015-08-21

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

Directory of Open Access Journals (Sweden)

Amelia Peral Crespo

2015-11-01

Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

Directory of Open Access Journals (Sweden)

Howard Amanda

2005-03-01

Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

Silencing of Foxp3 enhances the antitumor efficacy of GM-CSF genetically modified tumor cell vaccine against B16 melanoma

Directory of Open Access Journals (Sweden)

Miguel A

2017-01-01

Full Text Available Antonio Miguel,1 Luis Sendra,1 Verónica Noé,2 Carles J Ciudad,2 Francisco Dasí,3,4 David Hervas,5 María José Herrero,1,6 Salvador F Aliño17 1Department of Pharmacology, Faculty of Medicine, University of Valencia, 2Department of Biochemistry and Molecular Biology, Faculty of Pharmacy, University of Barcelona, 3Research University Hospital of Valencia, INCLIVA Health Research Institute, 4Department of Physiology, Faculty of Medicine, University of Valencia Foundation, 5Biostatistics Unit, 6Pharmacogenetics Unit, Instituto de Investigación Sanitaria La Fe (IIS La Fe, 7Clinical Pharmacology Unit, ACM Hospital Universitario y Politécnico La Fe, Valencia, Spain Abstract: The antitumor response after therapeutic vaccination has a limited effect and seems to be related to the presence of T regulatory cells (Treg, which express the immunoregulatory molecules CTLA4 and Foxp3. The blockage of CTLA4 using antibodies has shown an effective antitumor response conducing to the approval of the human anti-CTLA4 antibody ipilimumab by the US Food and Drug Administration. On the other hand, Foxp3 is crucial for Treg development. For this reason, it is an attractive target for cancer treatment. This study aims to evaluate whether combining therapeutic vaccination with CTLA4 or Foxp3 gene silencing enhances the antitumor response. First, the “in vitro” cell entrance and gene silencing efficacy of two tools, 2'-O-methyl phosphorotioate-modified oligonucleotides (2'-OMe-PS-ASOs and polypurine reverse Hoogsteen hairpins (PPRHs, were evaluated in EL4 cells and cultured primary lymphocytes. Following B16 tumor transplant, C57BL6 mice were vaccinated with irradiated B16 tumor cells engineered to produce granulocyte-macrophage colony-stimulating factor (GM-CSF and were intraperitoneally treated with CTLA4 and Foxp3 2'-OMe-PS-ASO before and after vaccination. Tumor growth, mice survival, and CTLA4 and Foxp3 expression in blood cells were measured. The following

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

Science.gov (United States)

Shouse, Sarah H.; Nilsson, Johanna

2011-01-01

Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

Directory of Open Access Journals (Sweden)

José Luis Arráez Llobregat

2015-11-01

Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

Gas turbine exhaust system silencing design

International Nuclear Information System (INIS)

Ozgur, D.

1991-01-01

Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

Directory of Open Access Journals (Sweden)

Oliver A Zill

Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

Directory of Open Access Journals (Sweden)

Ma Changhui

2009-01-01

Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

Silencing of osteopontin promotes the radiosensitivity of breast cancer cells by reducing the expression of hypoxia inducible factor 1 and vascular endothelial growth factor

Institute of Scientific and Technical Information of China (English)

YANG Li; ZHAO Wei; ZUO Wen-shu; WEI Ling; SONG Xian-rang; WANG Xing-wu; ZHENG Gang; ZHENG Mei-zhu

2012-01-01

Background Osteopontin (OPN) is a secreted phosphoglycoprotein (SSP) that is overexpressed in a variety of tumors and was regarded as a molecular marker of tumors.In this study,we intended to demonstrate the role of OPN in human breast cancer cell line MDA-MB-231.Methods Recombinant plasmid expressing small interfering RNA (siRNA) specific to OPN mRNA was transfected into MDA-MB-231 cells to generate the stable transfected cell line MDA-MB-343,and the empty plasmid tansfected cells (MDA-MB-neg) or wildtype MDA-MB-231 cells were used as control cells respectively.Expression of OPN,hypoxia inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) proteins was analyzed by Western blotting analysis.The radiosensitivity of cells was determined by detecting cell apoptosis,cell proliferation and cell senescence.Results HIF-1 and VEGF proteins in MDA-MB-343 cells were significantly downregulated upon the efficient knockdown of OPN expression under either hypoxia or normoxia environment.Moreover,expression of OPN protein was upregualted upon hypoxic culture.Stable OPN-silencing also decreased cell invasion,increased cell apoptosis and cell senescence,as well as reduced clonogenic survival,resulting in increase radiation tolerance.Conclusions Suppression of OPN gene expression can enhance radiosensitivity and affect cell apoptosis in breast cancer cells.OPN seems to be an attractive target for the improvement of radiotherapy.

Reduction of IgE binding and nonpromotion of Aspergillus flavus fungal growth by simultaneously silencing Ara h 2 and Ara h 6 in peanut.

Science.gov (United States)

The most potent peanut allergens, Ara h 2 and 6, were silenced in transgenic plants by RNA interference. Three independent transgenic lines were recovered after microprojectile bombardment, of which two contained single, integrated copies of the transgene. The third line contained multiple copies ...

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

Science.gov (United States)

Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

2017-08-15

Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W

Science.gov (United States)

Lou, Yonggen; Baldwin, Ian T.

2006-01-01

Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381

Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

African Journals Online (AJOL)

To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

Driving in unheard silence: Disability and the politics of shutting up.

Science.gov (United States)

Lourens, Heidi

2018-03-01

The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

KAUST Repository

Hou, Xu; Liu, Yaohua; Liu, Huailei; Chen, Xin; Liu, Min; Che, Hui; Guo, Fei; Wang, Chunlei; Zhang, Daming; Wu, Jianing; Chen, Xiaofeng; Shen, Chen; Li, Chenguang; Peng, Fei; Bi, Yunke; Yang, Zhuowen; Yang, Guang; Ai, Jing; Gao, Xin; Zhao, Shiguang

2015-01-01

Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

PERK silence inhibits glioma cell growth under low glucose stress by blockage of p-AKT and subsequent HK2's mitochondria translocation

KAUST Repository

Hou, Xu

2015-03-12

Glioma relies on glycolysis to obtain energy and sustain its survival under low glucose microenvironment in vivo. The mechanisms on glioma cell glycolysis regulation are still unclear. Signaling mediated by Double-stranded RNA-activated protein kinase (PKR) - like ER kinase (PERK) is one of the important pathways of unfolded protein response (UPR) which is comprehensively activated in cancer cells upon the hypoxic and low glucose stress. Here we show that PERK is significantly activated in human glioma tissues. PERK silencing results in decreased glioma cell viability and ATP/lactate production upon low glucose stress, which is mediated by partially blocked AKT activation and subsequent inhibition of Hexokinase II (HK2)\\'s mitochondria translocation. More importantly, PERK silenced glioma cells show decreased tumor formation capacity. Our results reveal that PERK activation is involved in glioma glycolysis regulation and may be a potential molecular target for glioma treatment.

Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

Directory of Open Access Journals (Sweden)

Line Kikkenborg Christensen

2018-02-01

Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Changho Eun

Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

Between the Unbearable Weight and Lightness of the Past. Banal Silence in Spain's Post-Dictatorship Memory Politics.

Science.gov (United States)

Brescó de Luna, Ignacio

2018-05-04

This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.

Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

Science.gov (United States)

Wu, H; Zhang, J; Shi, H

2016-01-01

Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

Directory of Open Access Journals (Sweden)

Zhimin Zheng

2015-05-01

Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

Silence in liturgy as the space for the Holy Ghost’s activity

Directory of Open Access Journals (Sweden)

Adelajda Sielepin

2006-06-01

Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

Directory of Open Access Journals (Sweden)

Cem KAHYA

2015-06-01

Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

Energy Technology Data Exchange (ETDEWEB)

Ando, Hitoshi [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Natsume, Atsushi, E-mail: anatsume@med.nagoya-u.ac.jp [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Iwami, Kenichiro; Ohka, Fumiharu [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae [Department of Biomolecular Engineering, Tokyo Institute of Technology Graduate School of Bioscience and Biotechnology, Yokohama (Japan); Ito, Kengo [National Center for Geriatrics and Gerontology, Aichi (Japan); Saito, Kiyoshi [Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Sugita, Sachi; Hoshino, Tsuneyoshi [MICRON Inc.Medical Facilities Support Department, Aichi (Japan); Wakabayashi, Toshihiko [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan)

2013-03-29

Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas.

A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

International Nuclear Information System (INIS)

Ando, Hitoshi; Natsume, Atsushi; Iwami, Kenichiro; Ohka, Fumiharu; Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae; Ito, Kengo; Saito, Kiyoshi; Sugita, Sachi; Hoshino, Tsuneyoshi; Wakabayashi, Toshihiko

2013-01-01

Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas

Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

Science.gov (United States)

Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

2017-10-13

Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis

International Nuclear Information System (INIS)

Patel, Divya; Chaudhary, Jaideep

2012-01-01

Highlights: ► E2A, considered as a tumor suppressor is highly expressed in prostate cancer. ► Silencing of E2A attenuates cell proliferation and promotes apoptosis. ► E2A regulates c-myc, Id1, Id3 and CDKN1A expression. ► Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. ► Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.

Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

Directory of Open Access Journals (Sweden)

Praveen Guleria

Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

Silencing Histone Deacetylase 7 Alleviates Transforming Growth Factor-β1-Induced Profibrotic Responses in Fibroblasts Derived from Peyronie’s Plaque

Directory of Open Access Journals (Sweden)

Dong Hyuk Kang

2018-05-01

Full Text Available Purpose: Epigenetic modifications, such as histone acetylation/deacetylation and DNA methylation, play a crucial role in the pathogenesis of inflammatory disorders and fibrotic diseases. The aim of this study was to study the differential gene expression of histone deacetylases (HDACs in fibroblasts isolated from plaque tissue of Peyronie’s disease (PD or normal tunica albuginea (TA and to examine the anti-fibrotic effect of small interfering RNA (siRNA-mediated silencing of HDAC7 in fibroblasts derived from human PD plaque. Materials and Methods: For differential gene expression study, we performed reverse-transcriptase polymerase chain reaction for HDAC isoforms (1–11 in fibroblasts isolated from PD plaque or normal TA. Fibroblasts isolated from PD plaque were pretreated with HDAC7 siRNA (100 pmol and then stimulated with transforming growth factor-β1 (TGF-β1, 10 ng/mL. Protein was extracted from treated fibroblasts for Western blotting. We also performed immunocytochemistry to detect the expression of extracellular matrix proteins and to examine the effect of HDAC2 siRNA on the TGF-β1-induced nuclear translocation of Smad2/3 and myofibroblastic differentiation. Results: The mRNA expression of HDAC2, 3, 4, 5, 7, 8, 10, and 11 was higher in fibroblasts isolated from PD plaque than in fibroblasts isolated from normal TA tissue. Knockdown of HDAC7 in PD fibroblasts inhibited TGF-β1-induced nuclear shuttle of Smad2 and Smad3, transdifferentiation of fibroblasts into myofibroblasts, and abrogated TGF-β1-induced production of extracellular matrix protein. Conclusions: These findings suggest that specific inhibition of HDAC7 with RNA interference may represent a promising epigenetic therapy for PD.

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-10-01

Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-12-01

Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

Science.gov (United States)

Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

2016-02-24

There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

Analysing the significance of silence in qualitative interviewing: questioning and shifting power relations

DEFF Research Database (Denmark)

Bengtsson, Tea Torbenfeldt; Fynbo, Lars

2017-01-01

In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

Directory of Open Access Journals (Sweden)

Adriana F. Fusaro

2017-10-01

Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

Is our knowledge of voice and silence in organizations growing?

DEFF Research Database (Denmark)

Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

2016-01-01

This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

Directory of Open Access Journals (Sweden)

Liyang Chen

2015-11-01

Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2.

Science.gov (United States)

Huang, Ming-De; Chen, Wen-Ming; Qi, Fu-Zhen; Sun, Ming; Xu, Tong-Peng; Ma, Pei; Shu, Yong-Qian

2015-09-04

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal squamous cell carcinoma (ESCC). However, its clinical significance and potential role in HCC remain unclear. In this study, expression of TUG1 was analyzed in 77 HCC tissues and matched normal tissues by using quantitative polymerase chain reaction (qPCR). TUG1 expression was up-regulated in HCC tissues and the higher expression of TUG1 was significantly correlated with tumor size and Barcelona Clinic Liver Cancer (BCLC) stage. Moreover, silencing of TUG1 expression inhibited HCC cell proliferation, colony formation, tumorigenicity and induced apoptosis in HCC cell lines. We also found that TUG1 overexpression was induced by nuclear transcription factor SP1 and TUG1 could epigeneticly repress Kruppel-like factor 2 (KLF2) transcription in HCC cells by binding with PRC2 and recruiting it to KLF2 promoter region. Our results suggest that lncRNA TUG1, as a growth regulator, may serve as a new diagnostic biomarker and therapy target for HCC.

The silencing of Pokemon attenuates the proliferation of hepatocellular carcinoma cells in vitro and in vivo by inhibiting the PI3K/Akt pathway.

Science.gov (United States)

Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin

2012-01-01

Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner.

The silencing of Pokemon attenuates the proliferation of hepatocellular carcinoma cells in vitro and in vivo by inhibiting the PI3K/Akt pathway.

Directory of Open Access Journals (Sweden)

Chan-Chan Lin

Full Text Available Pokemon (POK erythroid myeloid ontogenic factor, which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC. We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner.

Developing a Capacity Assessment Framework for Marine Logistics Groups

Science.gov (United States)

2017-02-20

Corps, 2015; and 1st Marine Logistics Group, 2015. RAND RR1572-2.3 1st FSSG Headquarters Regiment Security Company CLR-1 CLR-15 7th ESB 1st Medical... Companies . Supply and maintenance battalions form the bulk of CLR-15. The Combat Logistics Companies are small, task-organized companies that support Marine...under- standing logistics capacity as it pertains to informing decisions to improve efficiencies and reduce costs . Most often these assessments of

The High Court's lost chance in medical negligence: Tabet v Gett (2010) 240 CLR 537.

Science.gov (United States)

Faunce, Thomas; McEwan, Alexandra

2010-12-01

In 2010 the High Court of Australia in Tabet v Gett (2010) 240 CLR 537 determined an appeal in a medical negligence case concerning a six-year-old girl who had presented to a major paediatric hospital with symptoms over several weeks of headaches and vomiting after a recent history of chicken pox. The differential diagnosis was varicella, meningitis or encephalitis and two days later, after she deteriorated neurologically, she received a lumbar puncture. Three days later she suffered a seizure and irreversible brain damage. A CT scan performed at that point showed a brain tumour. As Australia does not have a no-fault system providing compensation to cover the long-term care required for such a condition, the girl (through her parents and lawyers) sued her treating physician. She alleged that, because a cerebral CT scan was not performed when clinically indicated after the diagnosis of meningitis or encephalitis and before the lumbar puncture, she had "lost the chance" to have her brain tumour treated before she sustained permanent brain damage. She succeeded at first instance, but lost on appeal. The High Court also rejected her claim, holding unanimously that there were no policy reasons to allow recovery of damages based on possible (less than 50%) "loss of a chance" of a better medical outcome. The court held that the law of torts in Australia required "all or nothing" proof that physical injury was caused or contributed to by a negligent party. The High Court, however, did not exclude loss of chance as forming the substance of a probable (greater than 50%) claim in medical negligence in some future case. In the meantime, patients injured in Australia as a result of possible medical negligence (particularly in the intractable difficult instances of late diagnosis) must face the injustice of the significant day-to-day care needs of victims being carried by family members and the taxpayer-funded public hospital system. The High Court in Tabet v Gett again provides

Silencing CAPN2 Expression Inhibited Castration-Resistant Prostate Cancer Cells Proliferation and Invasion via AKT/mTOR Signal Pathway

Directory of Open Access Journals (Sweden)

Pu Li

2017-01-01

Full Text Available The mRNA expression of CAPN2 was upregulated in CRPC cells (DU145 and PC3 than that in non-CRPC cells. Silencing CAPN2 expression could inhibit DU145 and PC3 cells proliferation by cell cycle arrest at G1 phase. Knockdown of CPAN2 level suppressed the migration and invasion capacity of CRPC cells by reducing matrix metalloproteinase-2 (MMP-2 and MMP-9 activation, as well as repressing the phosphorylation protein expression of AKT and mTOR. In addition, we found that the expression of CAPN2 was elevated in Pca tissues than that in normal control tissues. Therefore, we showed the important roles of CAPN2 in the development and progression in CRPC cells, suggesting a new therapeutic intervention for treating castration-resistant prostate cancer patients.

EZH2 regulates dental pulp inflammation by direct effect on inflammatory factors.

Science.gov (United States)

Hui, Tianqian; A, Peng; Zhao, Yuan; Yang, Jing; Ye, Ling; Wang, Chenglin

2018-01-01

Pulpitis is a multi-factorial disease that could be caused by complex interactions between genetics, epigenetics and environmental factors. We aimed to evaluate the role of Enhancer of Zeste Homolog 2 (EZH2) in the inflammatory response of human dental pulp cells (HDPCs) and dental pulp tissues. The expressions of inflammatory cytokines in HDPCs treated by EZH2 complex or EZH2 siRNA with or without rhTNF-α were examined by quantitative real-time polymerase chain reaction (q-PCR). The levels of secreted inflammatory cytokines including IL-6, IL-8, IL-15, CCL2 and CXCL12 in culture supernatants were measured by Luminex assay. In rat pulpitis model, the effects of EZH2 on dental pulp tissues were verified by histology. We invested the mechanisms of the effect of EZH2 on the inflammatory factors by ChIP assay. EZH2 down-regulation inhibited the expression of inflammatory factors, including IL-6, IL-8, IL-15, CCL2 and CXCL12 in HDPCs. EZH2 complex promoted the expression and secretion of these inflammatory factors in HDPCs, while EZH2 silencing could attenuate the promotion of inflammatory factors that were induced by rhTNF-α. In pulpitis models of rats, EZH2 down-regulation inhibited the inflammatory process of dental pulp while EZH2 complex showed no significant facilitation of pulpal inflammation. In addition, EZH2 could bind on the promoters of IL-6, IL-8 and CCL2, but not IL-15 and CXCL12, to affect the transcription of these proinflammatory cytokines. In HDPCs, EZH2 could induce inflammation, while EZH2 down-regulation could attenuate the inflammatory responses. EZH2 plays an important role in this inflammatory process of dental pulp. Copyright © 2017 Elsevier Ltd. All rights reserved.

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...

Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

Directory of Open Access Journals (Sweden)

Jinhuan Pang

Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

Directory of Open Access Journals (Sweden)

Li JM

2013-06-01

Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

The Silence of Michelangelo

DEFF Research Database (Denmark)

Foote, Jonathan

2016-01-01

In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry

Directory of Open Access Journals (Sweden)

Mehdi Afkhami Ardakani

2015-05-01

Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and

Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

Science.gov (United States)

Guleria, Praveen; Yadav, Sudesh Kumar

2013-01-01

Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Veiled Word(s) – Sacred Silence

DEFF Research Database (Denmark)

Isar, Nicoletta

2014-01-01

or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

Directory of Open Access Journals (Sweden)

Ruilin Wang

Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

Directory of Open Access Journals (Sweden)

Ibrahim Tekedereli

2013-01-01

Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

Science.gov (United States)

Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

2017-08-01

This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

Science.gov (United States)

Kant, Ravi; Dasgupta, Indranil

2017-07-01

Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

Directory of Open Access Journals (Sweden)

Jose C Garcia-Garcia

2009-06-01

Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

Expression of adrenomedullin in human colorectal tumors and its role in cell growth and invasion in vitro and in xenograft growth in vivo

International Nuclear Information System (INIS)

Nouguerède, Emilie; Berenguer, Caroline; Garcia, Stéphane; Bennani, Bahia; Delfino, Christine; Nanni, Isabelle; Dahan, Laetitia; Gasmi, Mohamed; Seitz, Jean-François; Martin, Pierre-Marie; Ouafik, L'Houcine

2013-01-01

Adrenomedullin (AM) is a multifunctional peptide vasodilator that transduces its effects through calcitonin receptor-like receptor/receptor activity-modifying protein-2 and -3 (CLR/RAMP2 and CLR/RAMP3). In this study, real-time quantitative reverse transcription demonstrated a significant expression of AM mRNA in tumor samples from colorectal cancer (CRC) patients in clinical stage II, III, and IV when compared with normal colorectal tissue. AM, CLR, RAMP2, and RAMP3 proteins were immunohistochemically localized in the carcinomatous epithelial compartment of CRC tissue. Tissue microarray analysis revealed a clear increase of AM, CLR, RAMP2, and RAMP3 staining in lymph node and distant metastasis when compared with primary tumors. The human colon carcinoma cells HT-29 expressed and secreted AM into the culture medium with a significant increase under hypoxia. Treatment of HT-29 cells with synthetic AM stimulated cell proliferation and invasion in vitro. Incubation with anti-AM antibody (αAM), anti-AM receptors antibodies (αAMR), or AM antagonist AM 22–52 inhibited significantly basal levels of proliferation of HT-29 cells, suggesting that AM may function as an autocrine growth factor for CRC cells. Treatment with αAM significantly suppressed the growth of HT-29 tumor xenografts in vivo. Histological examination of αAM-treated tumors showed evidence of disruption of tumor vascularity with decreased microvessel density, depletion of endothelial cells and pericytes, and increased tumor cell apoptosis. These findings highlight the potential importance of AM and its receptors in the progression of CRC and support the conclusion that αAM treatment inhibits tumor growth by suppression of angiogenesis and tumor growth, suggesting that AM may be a useful therapeutic target

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

The acute effects of body position strategies and respiratory therapy in paralyzed patients with acute lung injury.

Science.gov (United States)

Davis, K; Johannigman, J A; Campbell, R S; Marraccini, A; Luchette, F A; Frame, S B; Branson, R D

2001-01-01

Routine turning of critically ill patients is a standard of care. In recent years, specialized beds that provide automated turning have been introduced. These beds have been reported to improve lung function, reduce hospital-acquired pneumonia, and facilitate secretion removal. This trial was designed to measure the physiological effects of routine turning and respiratory therapy in comparison with continuous lateral rotation (CLR). The study was a prospective, quasi-experimental, random assignment, trial with patients serving as their own controls. Paralyzed, sedated patients with acute respiratory distress syndrome were eligible for study. Patients were randomized to receive four turning and secretion management regimens in random sequence for 6 h each over a period of 24 h: (1) routine turning every 2 h from the left to right lateral position; (2) routine turning every 2 h from the left to right lateral position including a 15-min period of manual percussion and postural drainage (P&PD); (3) CLR with a specialized bed that turned patients from left to right lateral position, pausing at each position for 2 min; and (4) CLR with a specialized bed that turned patients from left to right lateral position pausing at each position for 2 min, and a 15-min period of percussion provided by the pneumatic cushions of the bed every 2 h. Nineteen patients were entered into the study. There were no statistically significant differences in the measured cardiorespiratory variables. There was a tendency for the ratio of partial pressure of arterial oxygen to fractional inspired oxygen concentration (PaO2/FIO2) to increase (174 +/- 31 versus 188 +/- 36; P = 0.068) and for the ratio of deadspace to tidal volume (Vd/Vt) to decrease (0.62 +/- 0.18 versus 0.59 +/- 0.18; P = 0.19) during periods of CLR, but these differences did not achieve statistical significance. There were statistically significant increases in sputum volume during the periods of CLR. The addition of P&PD did not

The Role of Silence at the Retreats of a Buddhist Community

Directory of Open Access Journals (Sweden)

Orsolya Huszár

2016-12-01

Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

Science.gov (United States)

Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

2015-12-01

Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

Directory of Open Access Journals (Sweden)

Guillaume Jannot

2016-12-01

Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

The Application of Coconut Fiber as Dissipative Silencer

Science.gov (United States)

Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

2017-01-01

Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

Silencing Deafness: Displacing Disability in the Nineteenth Century

Directory of Open Access Journals (Sweden)

Esme Cleall

2015-03-01

Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.

"Was it something I said?" "No, it was something you posted!" A study of the spiral of silence theory in social media contexts.

Science.gov (United States)

Gearhart, Sherice; Zhang, Weiwu

2015-04-01

New media technologies make it necessary for scholars to reassess mass communication theories developed among legacy media. One such theory is the spiral of silence theory originally proposed by Noelle-Neumann in the 1970s. Increasing diversity of media content, selectivity, social networking site (SNS) interactivity, and the potential for anonymity have posed various challenges to its theoretical assumptions. While application of the spiral of silence in SNS contexts has been theorized, its empirical testing is scarce. To fill this void, the Pew 2012 Search, Social Networks, and Politics survey is used to test the theory. Results reveal that encountering agreeable political content predicts speaking out, while encountering disagreeable postings stifles opinion expression, supporting the spiral of silence theory in the SNS environment. However, certain uses of SNSs and psychological factors demonstrate a liberating effect on opinion expression.

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

Science.gov (United States)

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

Science.gov (United States)

Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

2012-09-01

The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

Friction coefficient measurements of silencers on specialized duct tract

Directory of Open Access Journals (Sweden)

Sehnalek Stanislav

2016-01-01

Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

Association of helicobacter pylori dupA with the failure of primary eradication.

Science.gov (United States)

Shiota, Seiji; Nguyen, Lam Tung; Murakami, Kazunari; Kuroda, Akiko; Mizukami, Kazuhiro; Okimoto, Tadayoshi; Kodama, Masaaki; Fujioka, Toshio; Yamaoka, Yoshio

2012-04-01

To determine whether the presence of dupA Helicobacter pylori (H. pylori) influences the cure rate of primary eradication therapy. Several virulence factors of H. pylori have been reported to affect the efficacy of the eradication rate. However, no study has investigated whether the presence of dupA affects eradication failure. The presence of dupA was evaluated in 142 H. pylori strains isolated from 142 patients with gastrointestinal diseases. Of these patients, 104 received primary eradication therapy for 1 week. The risk factors for eradication failure were determined using univariate and multivariate analyses. Among 142 strains, 44 (31.0%) were dupA positive. There was no association between dupA status and gastroduodenal diseases (P>0.05). The clarithromycin (CLR) resistance rate was generally lower in the dupA-positive than in the dupA-negative group (20.4% vs. 35.7%, P=0.06). However, dupA prevalence was higher in the eradication failure group than in the success group (36.3% vs. 21.9%). Among the CLR-resistant H. pylori infected group, the successful eradication rate was significantly lower in patients infected with dupA-positive H. pylori than dupA-negative H. pylori (P=0.04). In multivariate analysis adjusted for age, sex, and type of disease, not only CLR resistance but also dupA presence was independent risk factors for eradication failure (adjusted odds ratio=3.71; 95% confidence interval,1.07-12.83). Although CLR resistant was more reliable predictor, the presence of dupA may also be an independent risk factor for eradication failure.

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

The Silencing of Pokemon Attenuates the Proliferation of Hepatocellular Carcinoma Cells In Vitro and In Vivo by Inhibiting the PI3K/Akt Pathway

OpenAIRE

Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin

2012-01-01

Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell prolifer...

Silence in the second language classroom

CERN Document Server

King, J

2013-01-01

Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

Science.gov (United States)

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

Science.gov (United States)

Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

2014-01-01

SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

Science.gov (United States)

Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

2015-08-11

The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of

Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

Directory of Open Access Journals (Sweden)

Katherine S. Bridge

2017-07-01

Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing

2010-05-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Amoebapore is an important virulence factor of Entamoeba histolytica

Indian Academy of Sciences (India)

... ap-a genes. The silenced transfectant was not virulent at all. These results demonstrate that important factors need to be expressed at the correct cellular location and that the parasite has additional internal control mechanisms such as transcriptional gene silencing which can prevent excess amounts of gene expression.

Postpartum Depression: How Childbirth Educators Can Help Break the Silence

Science.gov (United States)

Zauderer, Cheryl

2009-01-01

The voices of women suffering from postpartum depression are often silent. Women are reluctant to reveal to others that they are unhappy after the birth of their babies. Much has been written on possible causes, risk factors, and treatments for postpartum depression, but little has been done to investigate why women take so long to seek help. Early detection and treatment are key to a full recovery. Childbirth educators are in the position to offer anticipatory guidance on possible complications of the postpartum period, including postpartum depression. This article explores why women with postpartum depression choose to suffer in silence and suggests how childbirth educators can help new mothers find their voices. PMID:20190853

STAT6 silencing induces hepatocellular carcinoma-derived cell apoptosis and growth inhibition by decreasing the RANKL expression.

Science.gov (United States)

Qing, Tian; Yamin, Zhang; Guijie, Wang; Yan, Jin; Zhongyang, Shen

2017-08-01

Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC) patients. The objective of this study was to investigate the effects and mechanism of STAT6 in human HCC cells. We found that STAT6 silencing significantly inhibited HepG2 and Hep3B cell survival and proliferation. We observed that depletion of STAT6 increased HepG2 and Hep3B cell apoptosis by using a histone DNA ELISA detection kit. STAT6 silencing induced expression of apoptosis-associated genes Bax and caspase-3/7 and inhibited anti-apoptosis gene Bcl-2 levels. We also observed that STAT6 silencing downregulated the expression of receptor activator of NF-κB ligand (RANKL). Our results demonstrated that treatment with pcDNA3.1-RANKL abolished STAT6 depletion-induced HepG2 and Hep3B cell apoptosis and growth inhibition. Based on these findings, we believe that RANKL plays a major role in STAT6-induced HCC cell apoptosis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Polycomb complexes and silencing mechanisms

DEFF Research Database (Denmark)

Lund, Anders H; van Lohuizen, Maarten

2004-01-01

Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis

Directory of Open Access Journals (Sweden)

Diana eSánchez-Rangel

2016-03-01

Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.

Hypoxia-inducible factor-1α mediates the toll-like receptor 4 signaling pathway leading to anti-tumor effects in human hepatocellular carcinoma cells under hypoxic conditions.

Science.gov (United States)

Zhang, Xiaoyu; Li, Shuchen; Li, Mingrong; Huang, Haiying; Li, Jingyuan; Zhou, Changwei

2016-08-01

Hypoxia-inducible factor-1α (HIF-1α) and toll-like receptor 4 (TLR4) are involved in numerous mechanisms of cancer biology, including cell proliferation and survival; however the interaction of the two factors under hypoxic conditions remains unclear. The present study investigated the in vitro mechanism that results in the suppression of tumor cell growth and cellular functions when HIF-1α is silenced. In the present study, the human hepatocellular carcinoma HepG2 cell line was transfected with short hairpin RNA (shRNA) against HIF-1α and cultured under hypoxic conditions (1% O 2 for 24 h). The expression of HIF-1α and various growth factors, including epidermal growth factor (EGF), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF) and fibroblast growth factor 2 (FGF2), were examined using quantitative polymerase chain reaction and immunoblotting. Tumor growth was measured using a Cell Counting Kit-8 assay and tumor activity was measured using tumor cell invasion and migration assays. Lipopolysaccharide and TAK-242 were used to activate and inhibit TLR4, respectively, to observe the role of TLR4 in the HIF-1α silenced tumor cells. The expression of TLR4 signaling pathway associates, including myeloid differentiation primary response gene 88 (MyD88), apoptosis signal-regulating kinase 1 (ASK1), p38 mitogen-activated protein kinases and HIF-1α, were analyzed by western blot assay. Under hypoxic conditions, silencing of HIF-1α expression suppressed tumor cell growth and regulated the expression of tumor growth-associated genes, including EGF, HGF, VEGF and FG2. Suppression of tumor cell invasion and migration was also observed in the HIF-1α silenced HepG2 cell line. In addition, TLR4 was identified to be involved in HIF-1α and MyD88 accumulation, and activation of ASK1 and p38 were demonstrated to be critical for TLR4-mediated HIF-1α pathway. In conclusion, silencing of HIF-1α expression may induce anti-tumor effects under hypoxic

Synovitis in dogs with stable stifle joints and incipient cranial cruciate ligament rupture: a cross-sectional study.

Science.gov (United States)

Bleedorn, Jason A; Greuel, Erin N; Manley, Paul A; Schaefer, Susan L; Markel, Mark D; Holzman, Gerianne; Muir, Peter

2011-07-01

To evaluate stifle joints of dogs for synovitis, before development of joint instability and cranial cruciate ligament rupture (CrCLR). Cross-sectional study. Dogs (n = 16) with CrCLR and stable contralateral stifles; 10 control dogs with intact CrCL. Arthritis and tibial translation were graded radiographically. Synovitis severity and cruciate pathology were assessed arthroscopically. Presence of inflammatory cells in synovial membrane biopsies was scored histologically. CrCLR stifle pairs and control stifles were compared. Radiographic evidence of arthritis, cranial tibial translation, and arthroscopic synovitis were increased in unstable stifles, when compared with stable contralateral stifles in CrCLR dogs (P < .05). Arthroscopic synovitis in both joints of CrCLR dogs was increased compared with controls, was correlated with radiographic arthritis (S(R) = 0.71, P < .05), and was present in all stable contralateral stifles. Arthroscopically, 75% of stable stifle joints had CrCL fiber disruption, which correlated with severity of synovitis (S(R) = 0.56, P < .05). Histologic evidence of synovitis was identified in all CrCLR dogs, but was only significantly correlated with arthroscopic observations in stable stifles (r(2) = 0.57, P < .005). Synovitis is an early feature of the CrCLR arthropathy in dogs before development of joint instability clinically. Severity of synovitis is correlated with radiographic arthritis in joints with minimal to no clinically detectable CrCL damage. © Copyright 2011 by The American College of Veterinary Surgeons.

Transcription factor KLF7 regulates differentiation of neuroectodermal and mesodermal cell lineages

International Nuclear Information System (INIS)

Caiazzo, Massimiliano; Colucci-D'Amato, Luca; Esposito, Maria T.; Parisi, Silvia; Stifani, Stefano; Ramirez, Francesco; Porzio, Umberto di

2010-01-01

Previous gene targeting studies in mice have implicated the nuclear protein Krueppel-like factor 7 (KLF7) in nervous system development while cell culture assays have documented its involvement in cell cycle regulation. By employing short hairpin RNA (shRNA)-mediated gene silencing, here we demonstrate that murine Klf7 gene expression is required for in vitro differentiation of neuroectodermal and mesodermal cells. Specifically, we show a correlation of Klf7 silencing with down-regulation of the neuronal marker microtubule-associated protein 2 (Map2) and the nerve growth factor (NGF) tyrosine kinase receptor A (TrkA) using the PC12 neuronal cell line. Similarly, KLF7 inactivation in Klf7-null mice decreases the expression of the neurogenic marker brain lipid-binding protein/fatty acid-binding protein 7 (BLBP/FABP7) in neural stem cells (NSCs). We also report that Klf7 silencing is detrimental to neuronal and cardiomyocytic differentiation of embryonic stem cells (ESCs), in addition to altering the adipogenic and osteogenic potential of mouse embryonic fibroblasts (MEFs). Finally, our results suggest that genes that are key for self-renewal of undifferentiated ESCs repress Klf7 expression in ESCs. Together with previous findings, these results provide evidence that KLF7 has a broad spectrum of regulatory functions, which reflect the discrete cellular and molecular contexts in which this transcription factor operates.

Transcription factor KLF7 regulates differentiation of neuroectodermal and mesodermal cell lineages

Energy Technology Data Exchange (ETDEWEB)

Caiazzo, Massimiliano, E-mail: caiazzo@igb.cnr.it [Institute of Genetics and Biophysics ' A. Buzzati-Traverso,' CNR, 80131 Naples (Italy); Istituto di diagnosi e cura ' Hermitage Capodimonte,' 80131 Naples (Italy); Colucci-D' Amato, Luca, E-mail: luca.colucci@unina2.it [Institute of Genetics and Biophysics ' A. Buzzati-Traverso,' CNR, 80131 Naples (Italy); Dipartimento di Scienze della Vita, Seconda Universita di Napoli, 81100 Caserta (Italy); Esposito, Maria T., E-mail: maria_teresa.esposito@kcl.ac.uk [CEINGE Biotecnologie Avanzate, 80145 Naples (Italy); Parisi, Silvia, E-mail: parisi@ceinge.unina.it [CEINGE Biotecnologie Avanzate, 80145 Naples (Italy); Stifani, Stefano, E-mail: stefano.stifani@mcgill.ca [Centre for Neuronal Survival, Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada H3A 2B4 (Canada); Ramirez, Francesco, E-mail: francesco.ramirez@mssm.edu [Department of Pharmacology and Systems Therapeutics, Mount Sinai School of Medicine, New York, NY 10029 (United States); Porzio, Umberto di, E-mail: diporzio@igb.cnr.it [Institute of Genetics and Biophysics ' A. Buzzati-Traverso,' CNR, 80131 Naples (Italy)

2010-08-15

Previous gene targeting studies in mice have implicated the nuclear protein Krueppel-like factor 7 (KLF7) in nervous system development while cell culture assays have documented its involvement in cell cycle regulation. By employing short hairpin RNA (shRNA)-mediated gene silencing, here we demonstrate that murine Klf7 gene expression is required for in vitro differentiation of neuroectodermal and mesodermal cells. Specifically, we show a correlation of Klf7 silencing with down-regulation of the neuronal marker microtubule-associated protein 2 (Map2) and the nerve growth factor (NGF) tyrosine kinase receptor A (TrkA) using the PC12 neuronal cell line. Similarly, KLF7 inactivation in Klf7-null mice decreases the expression of the neurogenic marker brain lipid-binding protein/fatty acid-binding protein 7 (BLBP/FABP7) in neural stem cells (NSCs). We also report that Klf7 silencing is detrimental to neuronal and cardiomyocytic differentiation of embryonic stem cells (ESCs), in addition to altering the adipogenic and osteogenic potential of mouse embryonic fibroblasts (MEFs). Finally, our results suggest that genes that are key for self-renewal of undifferentiated ESCs repress Klf7 expression in ESCs. Together with previous findings, these results provide evidence that KLF7 has a broad spectrum of regulatory functions, which reflect the discrete cellular and molecular contexts in which this transcription factor operates.

Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.

Science.gov (United States)

Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G

2015-01-14

In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.

siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

Directory of Open Access Journals (Sweden)

Keshava Mysore

2015-11-01

Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

Dismantling the Silence: LGBTQ Aging Emerging From the Margins

Science.gov (United States)

Fredriksen-Goldsen, Karen I.

2017-01-01

Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. PMID:28053011

Silence is golden : keeping a lid on noise quiets opposition to oilpatch operations

International Nuclear Information System (INIS)

Macedo, R.

2006-01-01

Record levels of drilling activity have led to denser well spacings that are often close to residential areas. Many oil and gas operators are now investing in noise suppression technology in order to suppress public concern over noise levels. This article reviewed some new silencing technologies available to the oil and gas industry. Issues concerning permissible sound levels for remote facilities were discussed. Silencing equipment details were presented for turbine exhaust engines, turbo inlet systems, reciprocating engines, and specialty silencers for ventilation systems. Issues concerning acoustical systems and retrofits for existing buildings were also examined. It was noted that a new muffler has been acoustically engineered to provide engine exhaust noise removal along with an internal acoustic treatment to eliminate radiated noise from the muffler shell. The loudest noise source at a compression station is often the engine exhaust of large reciprocating engines. Various computer programs are now available that analyze noise, create models to predict noise levels in decibels for nearby residents, and help to engineer noise control plans. It was concluded that many of the new sound-proofing technologies for the walls and roofs of buildings and enclosures were developed during the design of new compression units built by TransCanada Pipeline on main pipelines across Canada. 2 figs

Transcriptional provirus silencing as a crosstalk of de novo DNA methylation and epigenomic features at the integration site

Czech Academy of Sciences Publication Activity Database

Šenigl, Filip; Auxt, Miroslav; Hejnar, Jiří

2012-01-01

Roč. 40, č. 12 (2012), s. 5298-5312 ISSN 0305-1048 R&D Projects: GA ČR GP301/09/P667; GA ČR GAP502/11/2207 Institutional research plan: CEZ:AV0Z50520514 Keywords : retrovirus integration * provirus silencing * epigenomics Subject RIV: EB - Genetic s ; Molecular Biology Impact factor: 8.278, year: 2012

Fibroblast growth factor receptor mediates fibroblast-dependent growth in EMMPRIN-depleted head and neck cancer tumor cells.

Science.gov (United States)

Liu, Zhiyong; Hartman, Yolanda E; Warram, Jason M; Knowles, Joseph A; Sweeny, Larissa; Zhou, Tong; Rosenthal, Eben L

2011-08-01

Head and neck squamous cell carcinoma tumors (HNSCC) contain a dense fibrous stroma which is known to promote tumor growth, although the mechanism of stroma-mediated growth remains unclear. As dysplastic mucosal epithelium progresses to cancer, there is incremental overexpression of extracellular matrix metalloprotease inducer (EMMPRIN) which is associated with tumor growth and metastasis. Here, we present evidence that gain of EMMPRIN expression allows tumor growth to be less dependent on fibroblasts by modulating fibroblast growth factor receptor-2 (FGFR2) signaling. We show that silencing EMMPRIN in FaDu and SCC-5 HNSCC cell lines inhibits cell growth, but when EMMPRIN-silenced tumor cells were cocultured with fibroblasts or inoculated with fibroblasts into severe combined immunodeficient mice, the growth inhibition by silencing EMMPRIN was blunted by the presence of fibroblasts. Coculture experiments showed fibroblast-dependent tumor cell growth occurred via a paracrine signaling. Analysis of tumor gene expression revealed expression of FGFR2 was inversely related to EMMPRIN expression. To determine the role of FGFR2 signaling in EMMPRIN-silenced tumor cells, ligands and inhibitors of FGFR2 were assessed. Both FGF1 and FGF2 enhanced tumor growth in EMMPRIN-silenced cells compared with control vector-transfected cells, whereas inhibition of FGFR2 with blocking antibody or with a synthetic inhibitor (PD173074) inhibited tumor cell growth in fibroblast coculture, suggesting the importance of FGFR2 signaling in fibroblast-mediated tumor growth. Analysis of xenografted tumors revealed that EMMPRIN-silenced tumors had a larger stromal compartment compared with control. Taken together, these results suggest that EMMPRIN acquired during tumor progression promotes fibroblast-independent tumor growth.

Fibroblast growth factor receptor mediates fibroblast-dependent growth in EMMPRIN depleted head and neck cancer tumor cells

Science.gov (United States)

Liu, Zhiyong; Hartman, Yolanda E.; Warram, Jason M.; Knowles, Joseph A.; Sweeny, Larrisa; Zhou, Tong; Rosenthal, Eben L.

2011-01-01

Head and neck squamous cell carcinoma tumors (HNSCC) contain a dense fibrous stroma which is known to promote tumor growth, although the mechanism of stroma mediated growth remains unclear. As dysplastic mucosal epithelium progresses to cancer there is incremental overexpression of extracellular matrix metalloprotease inducer (EMMPRIN) which is associated with tumor growth and metastasis. Here we present evidence that gain of EMMPRIN expression allows tumor growth to be less dependent on fibroblasts by modulating fibroblast growth factor receptor-2 (FGFR2) signaling. We show that silencing EMMPRIN in FaDu and SCC-5 HNSCC cell lines inhibits cell growth, but when EMMPRIN-silenced tumor cells were co-cultured with fibroblasts or inoculated with fibroblasts into SCID mice, the growth inhibition by silencing EMMPRIN was blunted by the presence of fibroblasts. Co-culture experiments demonstrated fibroblast-dependent tumor cell growth occurred via a paracrine signaling. Analysis of tumor gene expression revealed expression of FGFR2 was inversely related to EMMPRIN expression. To determine the role of FGFR2 signaling in EMMPRIN silenced tumor cells, ligands and inhibitors of FGFR2 were assessed. Both FGF1 and FGF2 enhanced tumor growth in EMMPRIN silenced cells compared to control vector transfected cells, while inhibition of FGFR2 with blocking antibody or with a synthetic inhibitor (PD173074) inhibited tumor cell growth in fibroblast co-culture, suggesting the importance of FGFR2 signaling in fibroblast mediated tumor growth. Analysis of xenografted tumors revealed EMMPRIN silenced tumors had a larger stromal compartment compared to control. Taken together, these results suggest that EMMPRIN acquired during tumor progression promotes fibroblast independent tumor growth. PMID:21665938

Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)

2012-03-23

Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

Directory of Open Access Journals (Sweden)

Sateesh Krishnamurthy

2012-01-01

Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.

Science.gov (United States)

Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill

2017-11-01

Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.

[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].

Science.gov (United States)

Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie

2012-12-01

To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.

Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

Science.gov (United States)

Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

2016-01-01

The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

Phosphorylation of Krüppel-like factor 3 (KLF3/BKLF) and C-terminal binding protein 2 (CtBP2) by homeodomain-interacting protein kinase 2 (HIPK2) modulates KLF3 DNA binding and activity.

Science.gov (United States)

Dewi, Vitri; Kwok, Alister; Lee, Stella; Lee, Ming Min; Tan, Yee Mun; Nicholas, Hannah R; Isono, Kyo-ichi; Wienert, Beeke; Mak, Ka Sin; Knights, Alexander J; Quinlan, Kate G R; Cordwell, Stuart J; Funnell, Alister P W; Pearson, Richard C M; Crossley, Merlin

2015-03-27

Krüppel-like factor 3 (KLF3/BKLF), a member of the Krüppel-like factor (KLF) family of transcription factors, is a widely expressed transcriptional repressor with diverse biological roles. Although there is considerable understanding of the molecular mechanisms that allow KLF3 to silence the activity of its target genes, less is known about the signal transduction pathways and post-translational modifications that modulate KLF3 activity in response to physiological stimuli. We observed that KLF3 is modified in a range of different tissues and found that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) can both bind and phosphorylate KLF3. Mass spectrometry identified serine 249 as the primary phosphorylation site. Mutation of this site reduces the ability of KLF3 to bind DNA and repress transcription. Furthermore, we also determined that HIPK2 can phosphorylate the KLF3 co-repressor C-terminal binding protein 2 (CtBP2) at serine 428. Finally, we found that phosphorylation of KLF3 and CtBP2 by HIPK2 strengthens the interaction between these two factors and increases transcriptional repression by KLF3. Taken together, our results indicate that HIPK2 potentiates the activity of KLF3. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

Directory of Open Access Journals (Sweden)

Lehto Kirsi

2011-04-01

Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

Directory of Open Access Journals (Sweden)

Ran Ao

2017-07-01

Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

Optical silencing of C. elegans cells with arch proton pump.

Directory of Open Access Journals (Sweden)

Ayako Okazaki

Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

Tumorigenic and Antiproliferative Properties of the TALE-Transcription Factors MEIS2D and MEIS2A in Neuroblastoma.

Science.gov (United States)

Groß, Anja; Schulz, Catrine; Kolb, Jasmine; Koster, Jan; Wehner, Sibylle; Czaplinski, Sebastian; Khilan, Abdulghani; Rohrer, Hermann; Harter, Patrick N; Klingebiel, Thomas; Langer, Julian D; Geerts, Dirk; Schulte, Dorothea

2018-04-15

Neuroblastoma is one of only a few human cancers that can spontaneously regress even after extensive dissemination, a poorly understood phenomenon that occurs in as many as 10% of patients. In this study, we identify the TALE-homeodomain transcription factor MEIS2 as a key contributor to this phenomenon. We identified MEIS2 as a MYCN-independent factor in neuroblastoma and showed that in this setting the alternatively spliced isoforms MEIS2A and MEIS2D exert antagonistic functions. Specifically, expression of MEIS2A was low in aggressive stage 4 neuroblastoma but high in spontaneously regressing stage 4S neuroblastoma. Moderate elevation of MEIS2A expression reduced proliferation of MYCN -amplified human neuroblastoma cells, induced neuronal differentiation and impaired the ability of these cells to form tumors in mice. In contrast, MEIS2A silencing or MEIS2D upregulation enhanced the aggressiveness of the tumor phenotype. Mechanistically, MEIS2A uncoupled a negative feedback loop that restricts accumulation of cellular retinoic acid, an effective agent in neuroblastoma treatment. Overall, our results illuminate the basis for spontaneous regression in neuroblastoma and identify an MEIS2A-specific signaling network as a potential therapeutic target in this common pediatric malignancy. Significance: This study illuminates the basis for spontaneous regressions that can occur in a common pediatric tumor, with implications for the development of new treatment strategies. Cancer Res; 78(8); 1935-47. ©2018 AACR . ©2018 American Association for Cancer Research.

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

Science.gov (United States)

Zhang, Yu-Qin; Xiao, Chuan-Xing; Lin, Bi-Yun; Shi, Ying; Liu, Yun-Peng; Liu, Jing-Jing; Guleng, Bayasi; Ren, Jian-Lin

2013-01-01

The role of Pokemon (POK erythroid myeloid ontogenic actor), a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC) and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma) as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

Directory of Open Access Journals (Sweden)

Yu-Qin Zhang

Full Text Available The role of Pokemon (POK erythroid myeloid ontogenic actor, a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

Epigenetic silencing of CYP24 in the tumor microenvironment

Science.gov (United States)

Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

2010-01-01

Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

Science.gov (United States)

Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

2009-11-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

Transcription factor activating protein 2 beta (TFAP2B) mediates noradrenergic neuronal differentiation in neuroblastoma.

Science.gov (United States)

Ikram, Fakhera; Ackermann, Sandra; Kahlert, Yvonne; Volland, Ruth; Roels, Frederik; Engesser, Anne; Hertwig, Falk; Kocak, Hayriye; Hero, Barbara; Dreidax, Daniel; Henrich, Kai-Oliver; Berthold, Frank; Nürnberg, Peter; Westermann, Frank; Fischer, Matthias

2016-02-01

Neuroblastoma is an embryonal pediatric tumor that originates from the developing sympathetic nervous system and shows a broad range of clinical behavior, ranging from fatal progression to differentiation into benign ganglioneuroma. In experimental neuroblastoma systems, retinoic acid (RA) effectively induces neuronal differentiation, and RA treatment has been therefore integrated in current therapies. However, the molecular mechanisms underlying differentiation are still poorly understood. We here investigated the role of transcription factor activating protein 2 beta (TFAP2B), a key factor in sympathetic nervous system development, in neuroblastoma pathogenesis and differentiation. Microarray analyses of primary neuroblastomas (n = 649) demonstrated that low TFAP2B expression was significantly associated with unfavorable prognostic markers as well as adverse patient outcome. We also found that low TFAP2B expression was strongly associated with CpG methylation of the TFAP2B locus in primary neuroblastomas (n = 105) and demethylation with 5-aza-2'-deoxycytidine resulted in induction of TFAP2B expression in vitro, suggesting that TFAP2B is silenced by genomic methylation. Tetracycline inducible re-expression of TFAP2B in IMR-32 and SH-EP neuroblastoma cells significantly impaired proliferation and cell cycle progression. In IMR-32 cells, TFAP2B induced neuronal differentiation, which was accompanied by up-regulation of the catecholamine biosynthesizing enzyme genes DBH and TH, and down-regulation of MYCN and REST, a master repressor of neuronal genes. By contrast, knockdown of TFAP2B by lentiviral transduction of shRNAs abrogated RA-induced neuronal differentiation of SH-SY5Y and SK-N-BE(2)c neuroblastoma cells almost completely. Taken together, our results suggest that TFAP2B is playing a vital role in retaining RA responsiveness and mediating noradrenergic neuronal differentiation in neuroblastoma. Copyright © 2015 Federation of European Biochemical Societies

Differentiation of Nerve Fibers Storing CGRP and CGRP Receptors in the Peripheral Trigeminovascular System

DEFF Research Database (Denmark)

Eftekhari, Sajedeh; Warfvinge, Karin; Blixt, Frank W

2013-01-01

Primary headaches such as migraine are postulated to involve the activation of sensory trigeminal pain neurons that innervate intracranial blood vessels and the dura mater. It is suggested that local activation of these sensory nerves may involve dural mast cells as one factor in local inflammation...... and in human dural vessels. The relative distributions of CGRP, CLR, and RAMP1 were evaluated with respect to each other and in relationship to mast cells, myelin, substance P, neuronal nitric oxide synthase, pituitary adenylate cyclase-activating polypeptide, and vasoactive intestinal peptide. CGRP expression...... was found in thin unmyelinated fibers, whereas CLR and RAMP1 were expressed in thicker myelinated fibers coexpressed with an A-fiber marker. CLR and RAMP1 immunoreactivity colocalized with mast cell tryptase in rodent; however, expression of both receptor components was not observed in human mast cells...

DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

Directory of Open Access Journals (Sweden)

Thanh Theresa Dinh

2014-07-01

Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

The great silence science and philosophy of Fermi's paradox

CERN Document Server

Cirkovic, Milan M

2018-01-01

The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

Refracted arrival waves in a zone of silence from a finite thickness mixing layer.

Science.gov (United States)

Suzuki, Takao; Lele, Sanjiva K

2002-02-01

Refracted arrival waves which propagate in the zone of silence of a finite thickness mixing layer are analyzed using geometrical acoustics in two dimensions. Here, two simplifying assumptions are made: (i) the mean flow field is transversely sheared, and (ii) the mean velocity and temperature profiles approach the free-stream conditions exponentially. Under these assumptions, ray trajectories are analytically solved, and a formula for acoustic pressure amplitude in the far field is derived in the high-frequency limit. This formula is compared with the existing theory based on a vortex sheet corresponding to the low-frequency limit. The analysis covers the dependence on the Mach number as well as on the temperature ratio. The results show that both limits have some qualitative similarities, but the amplitude in the zone of silence at high frequencies is proportional to omega(-1/2), while that at low frequencies is proportional to omega(-3/2), omega being the angular frequency of the source.

Surface functionalisation of PLGA nanoparticles for gene silencing

DEFF Research Database (Denmark)

Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

2010-01-01

. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

Science.gov (United States)

Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

2006-10-01

Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

Science.gov (United States)

Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

2015-10-02

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

An investigation of noise produced by unsteady gas flow through silencer elements

Science.gov (United States)

Mawhinney, Graeme Hugh

This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.

A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

Science.gov (United States)

Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

2009-01-01

Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

Conifers have a unique small RNA silencing signature.

Science.gov (United States)

Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

2008-08-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

Tacit Authorization : A Legal Solution for Administrative Silence

NARCIS (Netherlands)

Hoogstra, Nicole; de Graaf, K.J.

2016-01-01

This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

Silencing of the Drosophila ortholog of SOX5 in heart leads to cardiac dysfunction as detected by optical coherence tomography.

Science.gov (United States)

Li, Airong; Ahsen, Osman O; Liu, Jonathan J; Du, Chuang; McKee, Mary L; Yang, Yan; Wasco, Wilma; Newton-Cheh, Christopher H; O'Donnell, Christopher J; Fujimoto, James G; Zhou, Chao; Tanzi, Rudolph E

2013-09-15

The SRY-related HMG-box 5 (SOX5) gene encodes a member of the SOX family of transcription factors. Recently, genome-wide association studies have implicated SOX5 as a candidate gene for susceptibility to four cardiac-related endophenotypes: higher resting heart rate (HR), the electrocardiographic PR interval, atrial fibrillation and left ventricular mass. We have determined that human SOX5 has a highly conserved Drosophila ortholog, Sox102F, and have employed transgenic Drosophila models to quantitatively measure cardiac function in adult flies. For this purpose, we have developed a high-speed and ultrahigh-resolution optical coherence tomography imaging system, which enables rapid cross-sectional imaging of the heart tube over various cardiac cycles for the measurement of cardiac structural and dynamical parameters such as HR, dimensions and areas of heart chambers, cardiac wall thickness and wall velocities. We have found that the silencing of Sox102F resulted in a significant decrease in HR, heart chamber size and cardiac wall velocities, and a significant increase in cardiac wall thickness that was accompanied by disrupted myofibril structure in adult flies. In addition, the silencing of Sox102F in the wing led to increased L2, L3 and wing marginal veins and increased and disorganized expression of wingless, the central component of the Wnt signaling pathway. Collectively, the silencing of Sox102F resulted in severe cardiac dysfunction and structural defects with disrupted Wnt signaling transduction in flies. This implicates an important functional role for SOX5 in heart and suggests that the alterations in SOX5 levels may contribute to the pathogenesis of multiple cardiac diseases or traits.

The Shadow of Silence on the Sexual Rights of Married Iranian Women

Directory of Open Access Journals (Sweden)

Roksana Janghorban

2015-01-01

Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.

PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Science.gov (United States)

Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

2017-02-02

Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

Science.gov (United States)

Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

2016-02-01

Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

What does it take to break the silence in teams: Authentic leadership or proactive followership?

NARCIS (Netherlands)

Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua

2017-01-01

Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in

Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

Science.gov (United States)

Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

2015-06-01

Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

Resounding Silences : Subtle Norm Regulation in Everyday Interactions

NARCIS (Netherlands)

Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

Directory of Open Access Journals (Sweden)

Vijayalakshmi H Nagaraj

Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

Establishment of an efficient virus-induced gene silencing (VIGS) assay in Arabidopsis by Agrobacterium-mediated rubbing infection.

Science.gov (United States)

Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo

2015-01-01

Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.

Epigenetic silencing of serine protease HTRA1 drives polyploidy

International Nuclear Information System (INIS)

Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael

2016-01-01

Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users

'So Much the Worse for the Whites': Dialectics of the Haitian Revolution

Directory of Open Access Journals (Sweden)

George Ciccariello-Maher

2014-09-01

Full Text Available This article sets out from an analysis of the pioneering work of Susan Buck-Morss to rethink, not only Hegel and Haiti, but broader questions surrounding dialectics and the universal brought to light by the Haitian Revolution. Reading through the lens of C.L.R. James’ The Black Jacobins, I seek to correct a series of ironic silences in her account, re-centering the importance of Toussaint’s successor, Jean-Jacques Dessalines, and underlining the dialectical importance of identitarian struggles in forging the universal. Finally, I offer Frantz Fanon’s reformulation of the Hegelian master-slave dialectic—overlooked in Buck-Morss’ account—as a corrective that allows us to truly rethink progress toward the universal in decolonized dialectical terms.

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages.

Directory of Open Access Journals (Sweden)

Min-Gu Song

Full Text Available Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS are known to be an important contributor to monocytes' differentiation and macrophages' function. NF-E2-related factor 2 (NRF2, a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA. In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNFα were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1 was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB p50 and extracellular signal-regulated kinase (ERK-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

Science.gov (United States)

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Breaking Classroom Silences: A View from Linguistic Ethnography

Science.gov (United States)

Rampton, Ben; Charalambous, Constadina

2016-01-01

This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

Breaking the Silence Surrounding Mental Health on Campus

Science.gov (United States)

Roper, Larry D.

2013-01-01

Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

Dismantling the Silence: LGBTQ Aging Emerging From the Margins.

Science.gov (United States)