Mortality risk from entomopathogenic fungi affects oviposition behavior in the parasitoid wasp Trybliographa rapae.

Science.gov (United States)

Rännbäck, Linda-Marie; Cotes, Belen; Anderson, Peter; Rämert, Birgitta; Meyling, Nicolai V

2015-01-01

Biological control of pests in agroecosystems could be enhanced by combining multiple natural enemies. However, this approach might also compromise the control efficacy through intraguild predation (IGP) among the natural enemies. Parasitoids may be able to avoid the risk of unidirectional IGP posed by entomopathogenic fungi through selective oviposition behavior during host foraging. Trybliographa rapae is a larval parasitoid of the cabbage root fly, Delia radicum. Here we evaluated the susceptibility of D. radicum and T. rapae to two species of generalist entomopathogenic fungi, Metarhizium brunneum isolate KVL 04-57 and Beauveria bassiana isolate KVL 03-90. Furthermore, T. rapae oviposition behavior was assessed in the presence of these entomopathogenic fungi either as infected hosts or as infective propagules in the environment. Both fungi were pathogenic to D. radicum larvae and T. rapae adults, but with variable virulence. When host patches were inoculated with M. brunneum conidia in a no-choice situation, more eggs were laid by T. rapae in hosts of those patches compared to control and B. bassiana treated patches. Females that later succumbed to mycosis from either fungus laid significantly more eggs than non-mycosed females, indicating that resources were allocated to increased oviposition due to perceived decreased life expectancy. When presented with a choice between healthy and fungal infected hosts, T. rapae females laid more eggs in healthy larvae than in M. brunneum infected larvae. This was less pronounced for B. bassiana. Based on our results we propose that T. rapae can perceive and react towards IGP risk posed by M. brunneum but not B. bassiana to the foraging female herself and her offspring. Thus, M. brunneum has the potential to be used for biological control against D. radicum with a limited risk to T. rapae populations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Nocturnal Oviposition Behavior of Forensically Important Diptera in Central England.

Science.gov (United States)

Barnes, Kate M; Grace, Karon A; Bulling, Mark T

2015-11-01

Timing of oviposition on a corpse is a key factor in entomologically based minimum postmortem interval (mPMI) calculations. However, there is considerable variation in nocturnal oviposition behavior of blow flies reported in the research literature. This study investigated nocturnal oviposition in central England for the first time, over 25 trials from 2011 to 2013. Liver-baited traps were placed in an urban location during control (diurnal), and nocturnal periods and environmental conditions were recorded during each 5-h trial. No nocturnal activity or oviposition was observed during the course of the study indicating that nocturnal oviposition is highly unlikely in central England. © 2015 American Academy of Forensic Sciences.

Daily oviposition patterns of the African malaria mosquito Anopheles gambiae Giles (Diptera: Culicidae on different types of aqueous substrates

Directory of Open Access Journals (Sweden)

Knols Bart GJ

2004-12-01

Full Text Available Abstract Background Anopheles gambiae Giles is the most important vector of human malaria in sub-Saharan Africa. Knowledge of the factors that influence its daily oviposition pattern is crucial if field interventions targeting gravid females are to be successful. This laboratory study investigated the effect of oviposition substrate and time of blood feeding on daily oviposition patterns of An. gambiae mosquitoes. Methods Greenhouse-reared gravid and hypergravid (delayed oviposition onset An. gambiae sensu stricto and wild-caught An. gambiae sensu lato were exposed to three types of substrates in choice and no-choice cage bioassays: water from a predominantly anopheline colonised ground pool (anopheline habitat water, swamp water mainly colonised by culicine larvae (culicine habitat water and distilled water. The daily oviposition pattern and the number of eggs oviposited on each substrate during the entire egg-laying period were determined. The results were subjected to analysis of variance using the General Linear Model (GLM procedure. Results The main oviposition time for greenhouse-reared An. gambiae s.s. was between 19:00 and 20:00 hrs, approximately one hour after sunset. Wild-caught gravid An. gambiae s.l. displayed two distinct peak oviposition times between 19:00 and 20:00 hrs and between 22:00 and 23:00 hrs, respectively. During these times, both greenhouse-reared and wild-caught mosquitoes significantly (P P Conclusion This study shows that the peak oviposition time of An. gambiae s.l. may be regulated by the light-dark cycle rather than oviposition habitat characteristics or feeding times. However, the number of eggs laid by the female mosquito during the peak oviposition time is affected by the suitability of the habitat.

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

Oviposition site selection by the grasshoppers Melanoplus borealis and M. sanguinipes (Orthoptera: Acrididae)

Science.gov (United States)

Female grasshoppers can affect the fitness of their offspring through their selection of oviposition sites. Successful embryological development depends on suitable temperature and moisture levels, factors which may vary considerably on a fine scale in natural environments where grasshoppers occur. ...

Strong oviposition preference for Bt over non-Bt maize in Spodoptera frugiperda and its implications for the evolution of resistance

Science.gov (United States)

2014-01-01

Background Transgenic crops expressing Bt toxins have substantial benefits for growers in terms of reduced synthetic insecticide inputs, area-wide pest management and yield. This valuable technology depends upon delaying the evolution of resistance. The ‘high dose/refuge strategy’, in which a refuge of non-Bt plants is planted in close proximity to the Bt crop, is the foundation of most existing resistance management. Most theoretical analyses of the high dose/refuge strategy assume random oviposition across refugia and Bt crops. Results In this study we examined oviposition and survival of Spodoptera frugiperda across conventional and Bt maize and explored the impact of oviposition behavior on the evolution of resistance in simulation models. Over six growing seasons oviposition rates per plant were higher in Bt crops than in refugia. The Cry1F Bt maize variety retained largely undamaged leaves, and oviposition preference was correlated with the level of feeding damage in the refuge. In simulation models, damage-avoiding oviposition accelerated the evolution of resistance and either led to requirements for larger refugia or undermined resistance management altogether. Since larval densities affected oviposition preferences, pest population dynamics affected resistance evolution: larger refugia were weakly beneficial for resistance management if they increased pest population sizes and the concomitant degree of leaf damage. Conclusions Damaged host plants have reduced attractiveness to many insect pests, and crops expressing Bt toxins are generally less damaged than conventional counterparts. Resistance management strategies should take account of this behavior, as it has the potential to undermine the effectiveness of existing practice, especially in the tropics where many pests are polyvoltinous. Efforts to bring down total pest population sizes and/or increase the attractiveness of damaged conventional plants will have substantial benefits for slowing the

Oviposition Attractancy of Bacterial Culture Filtrates: response of Culex quinquefasciatus

Directory of Open Access Journals (Sweden)

S Poonam

2002-04-01

Full Text Available Oviposition attractants could be used for monitoring as well as controlling mosquitoes by attracting them to lay eggs at chosen sites. In the present study, culture filtrates of seven bacterial species were tested for their attractancy against gravid females of Culex quinquefasciatus. When their oviposition active indices (OAI were studied, the culture filtrates of Bacillus cereus and Pseudomonas fluorescens exhibited oviposition attractancy (OAI = >0.3 at 100 ppm and the OAI were respectively 0.70 and 0.47. Culture filtrates of B. thuringiensis var. israelensis (wild type, B. t. var. israelensis (mutant and B. sphaericus showed attractancy at 2000 ppm with OAI of respectively 0.71, 0.59 and 0.68. However, the OAI of B. megaterium as well as Azospirillum brasilense was 0.13 (at 2000 ppm, which was less than 0.3 required to be considered them as attractants. When the oviposition attractancy of the bacterial culture filtrates were compared with that of a known oviposition attractant, p-cresol (at 10 ppm, the culture filtrates of B. t. var. israelensis (wild type and B. cereus were found to be more active than p-cresol, respectively with 64.2 and 54.3% oviposition.

Species Abundance and Colour Preferences of Oviposition by ...

African Journals Online (AJOL)

A study was conducted to determine the occurrence and colour preferences of oviposition by mosquitoes in man-made containers under field conditions. A total of nine (9) different colour 2 litre plastic containers were used as artificial mosquito oviposition containers. They were filled with equal amounts of water and placed ...

Rhagoletis cerasi: Oviposition Reduction Effects of Oil Products

Directory of Open Access Journals (Sweden)

Claudia Daniel

2014-04-01

Full Text Available The European cherry fruit fly, Rhagoletis cerasi (L. (Diptera: Tephritidae, is a highly destructive pest. Methods to control it are limited and alternatives are needed. Observations of cherry fruit flies suggest that females exert much effort to penetrate cherries at color change stage (from green to yellow for oviposition. Therefore, the question arose as to whether a physical barrier on the fruit surface could reduce oviposition. The effects of different commercial horticultural oil products on R. cerasi oviposition were evaluated in a series of laboratory, semi-field and field experiments. In the laboratory experiments, the rate of successful oviposition on fruits treated with 0.25% v/v of the rapeseed oil product Telmion was significantly reduced by 90% compared to the untreated control. In semi-field experiments, deposits of 1% of rapeseed, mineral and paraffinic oil significantly reduced oviposition for up to 3 days. Semi-field experiments indicated that the oil products lose efficacy within 3 to 6 days after application due to degradation. Although treatments with the rapeseed oil product Telmion reduced infestation rates in an on-farm field experiment, the infested fruit clearly exceeded the level of market tolerance of 2%. Further research is needed to assess whether combinations of oil products, higher application rates and different formulations might improve field efficacy.

Oviposition of aquatic insects in a tropical high altitude stream.

Science.gov (United States)

Rios-Touma, Blanca; Encalada, A C; Prat, N

2012-12-01

The persistence of aquatic insect populations in streams depends on the recruitment of larval populations from egg masses deposited by adults, especially after disturbance. However, recruitment of aquatic populations by oviposition is a process that remains unstudied in streams and rivers. The objectives of our study were to document flying and oviposition patterns of aquatic insects in a high altitude tropical stream during both dry and wet seasons. In particular we studied 1) richness and abundance of adult forms of aquatic insects flying and ovipositing; 2) number of eggs (oviposition pattern), egg mass identity, and morphology; and 3) substrate preferences by ovipositing females. We found 2,383 aquatic insects corresponding to 28 families, with dipterans representing 89% of total individuals collected. Adult insects had lower richness (28 taxa) than larval diversity (up to 52 taxa) and distinct community composition. Richness and relative abundance of most taxa (adults) were not significantly different between seasons, behaviors, diel period, or all three. During both sampling periods we found females with eggs in a total of 15 different families (13 in the dry season and 14 in the wet season). There were no significant differences in the proportion of females with eggs between seasons, diel periods, or different behaviors (flying versus ovipositing traps) of the different female taxa. Few types of egg masses were found in rocks at the stream during both seasons, and most egg masses found corresponded to families Baetidae and Chironomidae. Finally, we provide the first description of eggs masses (size, shape, color, and number of eggs per female) of gravid females (10 taxa) and those found in the stream substrate (six taxa) of Andean macroinvertebrates. This is the first study reporting oviposition, adult diversity, and oviposition patterns of aquatic insects in the Andean region.

Spatial variability in oviposition damage by periodical cicadas in a fragmented landscape.

Science.gov (United States)

Cook, William M; Holt, Robert D; Yao, Jin

2001-03-01

Effects of the periodical cicada (Magicicada spp.) on forest dynamics are poorly documented. A 1998 emergence of M. cassini in eastern Kansas led to colonization of a fragmented experimental landscape undergoing secondary succession. We hypothesized that per-tree rates of oviposition damage by cicadas would reflect: (1) distance from the source of the emergence, (2) patch size, and (3) local tree density. Ovipositing females displayed clear preferences for host species and damage incidence showed predictable spatial patterns. Two species (smooth sumac, Rhus glabra, and eastern red cedar, Juniperus virginiana) were rarely attacked, whereas others (rough-leaved dogwood, Cornus drummondii; slippery elm, Ulmus rubra; box elder, Acer negundo, and honey locust, Gleditsia triacanthos) were strongly attacked. The dominant early successional tree, dogwood, received on average the most attacks. As predicted, attacks per stem declined strongly with distance from the emergence source, and with local stem density (a "dilution" effect). Contrary to expectations, there were more attacks per stem on larger patches. Because ovipositing cicadas cut damaging slits in host tree branches, potentially affecting tree growth rate, competitive ability, and capacity to reproduce, cicada damage could potentially influence spatial variation in secondary succession.

Differential and Synergistic Functionality of Acylsugars in Suppressing Oviposition by Insect Herbivores.

Directory of Open Access Journals (Sweden)

Brian M Leckie

Full Text Available Acylsugars are secondary metabolites exuded from type IV glandular trichomes that provide broad-spectrum insect suppression for Solanum pennellii Correll, a wild relative of cultivated tomato. Acylsugars produced by different S. pennellii accessions vary by sugar moieties (glucose or sucrose and fatty acid side chains (lengths and branching patterns. Our objective was to determine which acylsugar compositions more effectively suppressed oviposition of the whitefly Bemisia tabaci (Gennadius (Middle East--Asia Minor 1 Group, tobacco thrips, Frankliniella fusca (Hinds, and western flower thrips, Frankliniella occidentalis (Pergande. We extracted and characterized acylsugars from four S. pennellii accessions with different compositions, as well as from an acylsugar-producing tomato breeding line. We also fractionated the acylsugars of one S. pennellii accession to examine the effects of its components. Effects of acylsugars on oviposition were evaluated by administering a range of doses to oviposition sites of adult whiteflies and thrips in non-choice and choice bioassays, respectively. The acylsugars from S. pennellii accessions and the tomato breeding line demonstrated differential functionality in their ability to alter the distribution of whitefly oviposition and suppress oviposition on acylsugar treated substrates. Tobacco thrips were sensitive to all compositions while western flower thrips and whiteflies were more sensitive to acylsugars from a subset of S. pennellii accessions. It follows that acylsugars could thus mediate plant-enemy interactions in such a way as to affect evolution of host specialization, resistance specificity, and potentially host differentiation or local adaptation. The acylsugars from S. pennellii LA1376 were separated by polarity into two fractions that differed sharply for their sugar moieties and fatty acid side chains. These fractions had different efficacies, with neither having activity approaching that of the

Oviposition Site Selection by the Dengue Vector Aedes aegypti and Its Implications for Dengue Control

Science.gov (United States)

Wong, Jacklyn; Stoddard, Steven T.; Astete, Helvio; Morrison, Amy C.; Scott, Thomas W.

2011-01-01

Background Because no dengue vaccine or antiviral therapy is commercially available, controlling the primary mosquito vector, Aedes aegypti, is currently the only means to prevent dengue outbreaks. Traditional models of Ae. aegypti assume that population dynamics are regulated by density-dependent larval competition for food and little affected by oviposition behavior. Due to direct impacts on offspring survival and development, however, mosquito choice in oviposition site can have important consequences for population regulation that should be taken into account when designing vector control programs. Methodology/Principal Findings We examined oviposition patterns by Ae. aegypti among 591 naturally occurring containers and a set of experimental containers in Iquitos, Peru. Using larval starvation bioassays as an indirect measure of container food content, we assessed whether females select containers with the most food for their offspring. Our data indicate that choice of egg-laying site is influenced by conspecific larvae and pupae, container fill method, container size, lid, and sun exposure. Although larval food positively influenced oviposition, our results did not support the hypothesis that females act primarily to maximize food for larvae. Females were most strongly attracted to sites containing immature conspecifics, even when potential competitors for their progeny were present in abundance. Conclusion/Significance Due to strong conspecific attraction, egg-laying behavior may contribute more to regulating Ae. aegypti populations than previously thought. If highly infested containers are targeted for removal or larvicide application, females that would have preferentially oviposited in those sites may instead distribute their eggs among other suitable, previously unoccupied containers. Strategies that kill mosquitoes late in their development (i.e., insect growth regulators that kill pupae rather than larvae) will enhance vector control by creating �

Predation-related odours reduce oviposition in a herbivorous mite.

Science.gov (United States)

Choh, Yasuyuki; Uefune, Masayoshi; Takabayashi, Junji

2010-01-01

When adult females of the herbivorous mite, Tetranychus urticae, were exposed to the predatory mite, Phytoseiulus persimilis, they laid fewer eggs than females that had not been exposed to P. persimilis when transferred onto a new leaf patch. However, when T. urticae females were exposed to either products of P. persimilis or artificially damaged conspecific eggs on a leaf patch, the number of T. urticae eggs on a new leaf patch did not differ significantly from the control. The reduced oviposition was neither due to the feeding activity on the leaf patch with P. persimilis nor to that on the new leaf patch. There was also no significant difference between the number of T. urticae eggs produced on a new leaf patch following exposure to the odours of a neighbouring leaf patch where there had previously been either P. persimilis or T. urticae adults. However, female T. urticae that had been exposed to odours from neighbouring leaf patches on which both T. urticae and P. persimilis had been placed produced significantly fewer eggs on a new leaf patch than those that had not been exposed to such odours. Neither odours from neighbouring intact leaf patches on which T. urticae eggs were preyed on by P. persimilis, nor odours from a neighbouring Parafilm patch on which T. urticae was preyed on by P. persimilis affected the oviposition of T. urticae. These data suggest that the presence of T. urticae, P. persimilis and a leaf patch are needed for the emission of odours to reduce oviposition in T. urticae.

Induction of oviposition by the administration of oxytocin in hawksbill turtles.

Science.gov (United States)

Kawazu, Isao; Kino, Masakatsu; Maeda, Konomi; Yamaguchi, Yasuhiro; Sawamukai, Yutaka

2014-12-01

We set out to develop an oviposition induction technique for captive female hawksbill turtles Eretmochelys imbricata. The infertile eggs of nine females were induced to develop by the administration of follicle-stimulating hormone, after which we investigated the effects of administering oxytocin on oviposition. Seven of the turtles were held in a stationary horizontal position on a retention stand, and then oxytocin was administrated (0.6-0.8 units/kg of body weight; 5 mL). The seven turtles were retained for a mandatory 2 h period after oxytocin administration, and were then returned to the holding tanks. As the control, normal saline (5 mL) was administered to the other two turtles, followed by the administration of oxytocin after 24 h. The eggs in oviducts of all nine turtles were observed by ultrasonography at 24 h after oxytocin administration. The control experiment validated that stationary retention and normal saline administration had no effect on egg oviposition. Eight of the turtles began ovipositing eggs at 17-43 min after oxytocin administration, while one began ovipositing in the holding tank immediately after retention. All turtles finished ovipositing eggs within 24 h of oxytocin administration. This report is the first to demonstrate successful induced oviposition in sea turtles. We suggest that the muscles in the oviducts of hawksbill turtles may respond to relatively lower doses of oxytocin (inducing contractions) compared to land and freshwater turtles (4-40 units/kg) based on existing studies.

Oviposition-stimulant and ovicidal activities of Moringa oleifera lectin on Aedes aegypti.

Directory of Open Access Journals (Sweden)

Nataly Diniz de Lima Santos

Full Text Available Natural insecticides against the vector mosquito Aedes aegypti have been the object of research due to their high level of eco-safety. The water-soluble Moringa oleifera lectin (WSMoL is a larvicidal agent against A. aegypti. This work reports the effects of WSMoL on oviposition and egg hatching of A. aegypti.WSMoL crude preparations (seed extract and 0-60 protein fraction, at 0.1 mg/mL protein concentration, did not affect oviposition, while A. aegypti gravid females laid their eggs preferentially (73% in vessels containing isolated WSMoL (0.1 mg/mL, compared with vessels containing only distilled water (control. Volatile compounds were not detected in WSMoL preparation. The hatchability of fresh eggs deposited in the solutions in the oviposition assay was evaluated. The numbers of hatched larvae in seed extract, 0-60 protein fraction and WSMoL were 45 ± 8.7 %, 20 ± 11 % and 55 ± 7.5 %, respectively, significantly (p<0.05 lower than in controls containing only distilled water (75-95%. Embryos were visualized inside fresh control eggs, but not within eggs that were laid and maintained in WSMoL solution. Ovicidal activity was also assessed using stored A. aegypti eggs. The protein concentrations able to reduce the hatching rate by 50% (EC50 were 0.32, 0.16 and 0.1 mg/mL for seed extract, 0-60 protein fraction and WSMoL, respectively. The absence of hatching of stored eggs treated with WSMoL at 0.3 mg/mL (EC99 after transfer to medium without lectin indicates that embryos within the eggs were killed by WSMoL. The reduction in hatching rate of A. aegypti was not linked to decrease in bacteria population.WSMoL acted both as a chemical stimulant cue for ovipositing females and ovicidal agent at a given concentration. The oviposition-stimulant and ovicidal activities, combined with the previously reported larvicidal activity, make WSMoL a very interesting candidate in integrated A. aegypti control.

Predation and the evolution of complex oviposition behaviour in Amazon rainforest frogs.

Science.gov (United States)

Magnusson, William E; Hero, Jean-Marc

1991-05-01

Terrestrial oviposition with free-living aquatic larvae is a common reproductive mode used by amphibians within the central Amazonian rainforest. We investigated the factors presently associated with diversity of microhabitats (waterbodies) that may be maintaining the diversity of reproductive modes. In particular, desiccation, predation by fish, competition with other anurans and water quality were examined in 11 waterbodies as possible forces leading to the evolution of terrestrial oviposition. Predation experiments demonstrated that fish generally do not eat anuran eggs, and that predacious tadpoles and dytiscid beetle larvae are voracious predators of anuran eggs. The percentage of species with terrestrial oviposition was only weakly correlated with the occurrence of pond drying, pH and oxygen concentration, suggesting that anurans in this tropical community are able to use the range of water quality available for egg development. There was a tendency for terrestrial oviposition to be associated with the number of species of tadpoles using the waterbody, but we consider this to be spurious as there was no obvious competitive mechanism that could result in this relationship. The percentage of species with terrestrial oviposition was significantly positively related to our index of egg predation pressure, and negatively related to our index of fish biomass. Egg predation pressure was also negatively related to the index of fish biomass. These results allow us to discount as improbable the hypothesis that predation by fish on anuran eggs was an important selective pressure leading to terrestrial oviposition in this community. The strong positive relationship between terrestrial oviposition and our index of egg predation pressure indicates that these predators have exerted, and are exerting, a significant selective pressure for terrestrial oviposition. The strong negative relationship between the occurrence of fish and the egg predators suggests the surprising

Oviposition strategies of conifer seed chalcids in relation to host phenology

Science.gov (United States)

Rouault, Gaëlle; Turgeon, Jean; Candau, Jean-Noël; Roques, Alain; Aderkas, Patrick

2004-10-01

Insects are considered the most important predators of seed cones, the female reproductive structures of conifers, prior to seed dispersal. Slightly more than 100 genera of insects are known to parasitize conifer seed cones. The most diverse (i.e., number of species) of these genera is Megastigmus (Hymenoptera: Torymidae), which comprises many important seed pests of native and exotic conifers. Seed chalcids, Megastigmus spp., lay eggs inside the developing ovules of host conifers and, until recently, oviposition was believed to occur only in fertilized ovules. Ovule development begins just after pollination, but stops if cells are not fertilized. The morphological stage of cone development at the time of oviposition by seed chalcids has been established for many species; however, knowledge of ovule development at that time has been documented for only one species, M. spermotrophus. Megastigmus spermotrophus oviposits in Douglas-fir ovules after pollination but before fertilization. Unlike the unfertilized ovules, those containing a M. spermotrophus larva continue to develop, whether fertilized or not, stressing the need to broaden our understanding of the insect plant interactions for this entire genus. To achieve this task, we reviewed the scientific literature and assembled information pertaining to the timing of oviposition and to the pollination and fertilization periods of their respective host(s). More specifically, we were searching for circumstantial evidence that other species of Megastigmus associated with conifers could behave (i.e., oviposit before ovule fertilization) and impact on female gametophyte (i.e., prevent abortion) like M. spermotrophus. The evidence from our compilation suggests that seed chalcids infesting Pinaceae may also oviposit before ovule fertilization, just like M. spermotrophus, whereas those infesting Cupressaceae seemingly oviposit after ovule fertilization. Based on this evidence, we hypothesize that all species of Megastigmus

Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

Directory of Open Access Journals (Sweden)

Joachim-Bravo Iara S.

2001-01-01

Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

Natural and synthetic oviposition stimulants forCatolaccus grandis (Burks) females.

Science.gov (United States)

Guerra, A A; Martinez, S; Sonia Del Rio, H

1994-07-01

Oviposition behavior was elicited fromCatolaccus grandis (Burks) (Hymenoptera: Pteromalidae) females, an ectoparasitoid of the boll weevil,Anthonomus grandis Boheman (Coleoptera: Curculionidae), by smears of freshly cut cotton bolls or smears of extracts prepared with boll weevil damaged or undamaged cotton boll tissues. Oviposition behavior was also elicited fromC. grandis females by smears made withn-pentane,n-hexane,n-heptane, and isooctane. This is the first report of oviposition behavior elicited for any parasitoid by these short-chain saturated hydrocarbons (alkanes), introducing a new concept on the chemical mediation of parasitoid behavior during host selection. Oviposition behavior was also elicited fromC. grandis females by volatiles emanating from an artificial diet devoid of insect components that was specifically developed for the in vitro rearing of ectoparasitoids. The possible use of a synergistic combination ofn-hexane and diet to optimize the mechanized production of noncontaminated eggs is also discussed.

FMR1 epigenetic silencing commonly occurs in undifferentiated fragile X-affected embryonic stem cells.

Science.gov (United States)

Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

2014-11-11

Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5'-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

FMR1 Epigenetic Silencing Commonly Occurs in Undifferentiated Fragile X-Affected Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Michal Avitzour

2014-11-01

Full Text Available Fragile X syndrome (FXS is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5′-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%. In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

Periodical cicadas use light for oviposition site selection.

Science.gov (United States)

Yang, Louie H

2006-12-07

Organisms use incomplete information from local experience to assess the suitability of potential habitat sites over a wide range of spatial and temporal scales. Although ecologists have long recognized the importance of spatial scales in habitat selection, few studies have investigated the temporal scales of habitat selection. In particular, cues in the immediate environment may commonly provide indirect information about future habitat quality. In periodical cicadas (Magicicada spp.), oviposition site selection represents a very long-term habitat choice. Adult female cicadas insert eggs into tree branches during a few weeks in the summer of emergence, but their oviposition choices determine the underground habitats of root-feeding nymphs over the following 13 or 17 years. Here, field experiments are used to show that female cicadas use the local light environment of host trees during the summer of emergence to select long-term host trees. Light environments may also influence oviposition microsite selection within hosts, suggesting a potential behavioural mechanism for associating solar cues with host trees. In contrast, experimental nutrient enrichment of host trees did not influence cicada oviposition densities. These findings suggest that the light environments around host trees may provide a robust predictor of host tree quality in the near future. This habitat selection may influence the spatial distribution of several cicada-mediated ecological processes in eastern North American forests.

Quasi-double-blind screening of semiochemicals for reducing navel orangeworm oviposition on almonds.

Directory of Open Access Journals (Sweden)

Kevin Cloonan

Full Text Available A three-step, quasi-double-bind approach was used as a proof-of-concept study to screen twenty compounds for their ability to reduce oviposition of gravid female navel orangeworm(NOW, Ameylois transitella (Lepidoptera: Pyralidae. First, the panel of compounds, whose identity was unknown to the experimenters, was tested by electroantennogram (EAG using antennae of two-day old gravid females as the sensing element. Of the twenty compounds tested three showed significant EAG responses. These three EAG-active compounds and a negative control were then analyzed for their ability to reduce oviposition via small-cage, two-choice laboratory assays. Two of the three compounds significantly reduced oviposition under laboratory conditions. Lastly, these two compounds were deployed in a field setting in an organic almond orchard in Arbuckle, CA using black egg traps to monitor NOW oviposition. One of these two compounds significantly reduced oviposition on black egg traps under these field conditions. Compound 9 (later identified as isophorone showed a significant reduction in oviposition in field assays and thus has a potential as a tool to control the navel orangeworm as a pest of almonds.

Repellent activity of Cnidoscolus phyllacanthus Mart. and Ricinus communis L. extracts against Aedes aegypti L. oviposition behavior

Directory of Open Access Journals (Sweden)

Lafayette Pereira Candido

2015-12-01

Full Text Available Female Aedes aegypti lay their eggs on nearly any moist substrate. Methods with potential to repel oviposition may reduce infestation, thereby contributing to control of epidemics. We evaluated the influence of Cnidoscolus phyllacanthus and Ricinus communis plant extracts on the oviposition behavior of A. aegypti. Lethal concentrations were first determined in experiments with larvae after 24 h of exposure, after which LC50 and LC90 were used to test oviposition repellency. The experiment consisted of an oviposition preference test based multiple-choice and no-choice assays. The Oviposition Activity Indices (OAIs from the multiple-choice test using both R. communis and C. phyllacanthus were negative, suggesting oviposition repellent and deterrent activity. The LC90 of both plant extracts deterred oviposition by this vector, as demonstrated by an OAI = value of -1. In the choice study, mean oviposition values were significantly different between R. communis and C. phyllacanthus. In the absence of choice, mosquitoes laid eggs independent of the substrate. In conclusion, our OAI values indicate that all substrates used repelled oviposition by A. aegypti.

Salicylic Acid Induces Changes in Mango Fruit that Affect Oviposition Behavior and Development of the Oriental Fruit Fly, Bactrocera dorsalis.

Directory of Open Access Journals (Sweden)

Kamala Jayanthi Pagadala Damodaram

Full Text Available The Oriental fruit fly, Bactrocera dorsalis (Hendel is an important quarantine pest around the globe. Although measures for its control are implemented worldwide through IPM and male annihilation, there is little effect on their population. Hence, there is a need for new strategies to control this minacious pest. A strategy that has received negligible attention is the induction of 'natural plant defenses' by phytohormones. In this study, we investigated the effect of salicylic acid (SA treatment of mango fruit (cv. Totapuri on oviposition and larval development of B. dorsalis. In oviposition choice assays, gravid females laid significantly less eggs in SA treated compared to untreated fruit. Headspace volatiles collected from SA treated fruit were less attractive to gravid females compared to volatiles from untreated fruit. GC-MS analysis of the headspace volatiles from SA treated and untreated fruit showed noticeable changes in their chemical compositions. Cis-ocimene and 3-carene (attractants to B. dorsalis were reduced in the headspace volatiles of treated fruit. Further, reduced pupae formation and adult emergence was observed in treated fruit compared to control. Increased phenol and flavonoid content was recorded in treated fruit. We also observed differential expression of anti-oxidative enzymes namely catalase (CAT, polyphenoloxidase (PPO and peroxidase (POD. In summary, the results indicate that SA treatment reduced oviposition, larval development and adult emergence of B. dorsalis and suggest a role of SA in enhancing mango tolerance to B. dorsalis.

Forest litter crickets prefer higher substrate moisture for oviposition: Evidence from field and lab experiments.

Science.gov (United States)

de Farias-Martins, Fernando; Sperber, Carlos Frankl; Albeny-Simões, Daniel; Breaux, Jennifer Ann; Fianco, Marcos; Szinwelski, Neucir

2017-01-01

For insects, choosing a favorable oviposition site is a type of parental care, as far as it increases the fitness of its offspring. Niche theory predicts that crickets should show a bell-shaped oviposition response to substrate moisture. However, lab experiments with mole crickets showed a linear oviposition response to substrate moisture. Studies with the house cricket Acheta domesticus also showed a linear juvenile body growth response to water availability, thus adult ovipositing females should respond positively to substrate moisture. We used a field experiment to evaluate the relationship between oviposition preference and substrate moisture in forest litter-dwelling cricket species. We also evaluated oviposition responses to substrate moisture level in Ubiquepuella telytokous, the most abundant litter cricket species in our study area, using a laboratory study. We offered cotton substrate for oviposition which varied in substrate moisture level from zero (i.e., dry) to maximum water absorption capacity. We used two complementary metrics to evaluate oviposition preference: (i) presence or absence of eggs in each sampling unit as binary response variable, and (ii) number of eggs oviposited per sampling unit as count response variable. To test for non-linear responses, we adjusted generalized additive models (GAMM) with mixed effects. We found that both cricket oviposition probability and effort (i.e., number of eggs laid) increased linearly with substrate moisture in the field experiment, and for U. telytokous in the lab experiment. We discarded any non-linear responses. Our results demonstrate the importance of substrate moisture as an ecological niche dimension for litter crickets. This work bolsters knowledge of litter cricket life history association with moisture, and suggests that litter crickets may be particularly threatened by changes in climate that favor habitat drying.

Ant-Related Oviposition and Larval Performance in a Myrmecophilous Lycaenid

Directory of Open Access Journals (Sweden)

Matthew D. Trager

2013-01-01

Full Text Available We experimentally assessed ant-related oviposition and larval performance in the Miami blue butterfly (Cyclargus thomasi bethunebakeri. Ant tending had sex-dependent effects on most measures of larval growth: female larvae generally benefitted from increased tending frequency whereas male larvae were usually unaffected. The larger size of female larvae tended by ants resulted in a substantial predicted increase in lifetime egg production. Oviposition by adult females that were tended by C. floridanus ants as larvae was similar between host plants with or without ants. However, they laid relatively more eggs on plants with ants than did females raised without ants, which laid less than a third of their eggs on plants with ants present. In summary, we found conditional benefits for larvae tended by ants that were not accompanied by oviposition preference for plants with ants present, which is a reasonable result for a system in which ant presence at the time of oviposition is not a reliable indicator of future ant presence. More broadly, our results emphasize the importance of considering the consequences of variation in interspecific interactions, life history traits, and multiple measures of performance when evaluating the costs and benefits of mutualistic relationships.

Keeping the golden mean: plant stiffness and anatomy as proximal factors driving endophytic oviposition site selection in a dragonfly.

Science.gov (United States)

Matushkina, Natalia; Lambret, Philippe; Gorb, Stanislav

2016-12-01

Oviposition site selection is a crucial component of habitat selection in dragonflies. The presence of appropriate oviposition plants at breeding waters is considered to be one of the key habitat determinants for species laying eggs endophytically. Thus, Lestes macrostigma, a species which is regarded as threatened in Europe because of its highly disjunct distribution, typically prefers to lay eggs in the sea club rush Bolboschoenus maritimus. However, little is known about how the anatomical and mechanical properties of plant tissues determine the choice of L. macrostigma females. We examined green shoots of six plant species used by L. macrostigma for oviposition, either in the field (actual oviposition plants) or under experimental conditions (potential oviposition plants), to analyse anatomical and mechanical properties of shoots in a framework of known preferences regarding plant substrates for oviposition. As expected, the anatomy of shoots differed between representatives of two plant families, Cyperaceae and Juncaceae, most essentially in the distribution of supporting bundles and the presence of large aeriferous cavities that may affect egg placing within a shoot. The force necessary to puncture the tested plant samples ranged from 360 to 3298 mN, and their local stiffness ranged from 777 to 3363N/m. We show that the shoots of B. maritimus, the plant most preferred by L. macrostigma, have intermediate characteristics regarding both the stiffness and specific anatomical characteristics. The bending stiffness of the ovipositor in L. macrostigma was estimated as 1414N/m, one of the highest values recorded for zygopteran dragonflies so far. The ecological and behavioural implications of plant choice mechanisms in L. macrostigma are discussed in the context of the disjunct distribution of this species. Copyright © 2016 Elsevier GmbH. All rights reserved.

Competing dopamine neurons drive oviposition choice for ethanol in Drosophila.

Science.gov (United States)

Azanchi, Reza; Kaun, Karla R; Heberlein, Ulrike

2013-12-24

The neural circuits that mediate behavioral choice evaluate and integrate information from the environment with internal demands and then initiate a behavioral response. Even circuits that support simple decisions remain poorly understood. In Drosophila melanogaster, oviposition on a substrate containing ethanol enhances fitness; however, little is known about the neural mechanisms mediating this important choice behavior. Here, we characterize the neural modulation of this simple choice and show that distinct subsets of dopaminergic neurons compete to either enhance or inhibit egg-laying preference for ethanol-containing food. Moreover, activity in α'β' neurons of the mushroom body and a subset of ellipsoid body ring neurons (R2) is required for this choice. We propose a model where competing dopaminergic systems modulate oviposition preference to adjust to changes in natural oviposition substrates.

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

Silencing of ACO decreases reproduction and energy metabolism in triazophos-treated female brown plant hoppers, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

Science.gov (United States)

Liu, Zong-Yu; Jiang, Yi-Ping; Li, Lei; You, Lin-Lin; Wu, You; Xu, Bin; Ge, Lin-Quan; Wu, Jin-Cai

2016-03-01

The brown plant hopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), is a major pest affecting rice in Asia, and outbreaks of this pest are closely linked to pesticide-induced stimulation of reproduction. Therefore, the BPH is a classic example of a resurgent pest. However, the effects of different genes on the regulation of pesticide-induced reproductive stimulation in the BPH are unclear. In this study, the regulatory effects of acyl-coenzyme A oxidase (ACO) on the reproduction and biochemistry of the BPH were investigated with gene silencing. The number of eggs laid per female by triazophos (TZP)+dsACO BPH females was significantly lower than those of TZP-treated (without ACO silencing) or TZP+GFP females (negative control), with the number of eggs decreasing by 30.8% (from 529.5 to 366.3) and 32.0% (from 540.5 to 366.3), respectively. The preoviposition period, oviposition period, and longevity of the TZP-treated females were also influenced by dsACO treatment. Additionally, the amounts of crude fat, protein, and some fatty acids (oleic acid, palmitic acid, linoleic acid, stearic acid, and myristoleic acid) in TZP+dsACO females were significantly lower than in TZP-treated females. Thus, ACO is one of the key genes regulating the TZP-induced stimulation of reproduction in BPH females. Copyright © 2015 Elsevier Inc. All rights reserved.

Host ant independent oviposition in the parasitic butterfly Maculinea alcon

DEFF Research Database (Denmark)

Fürst, Matthias A; Nash, David Richard

2010-01-01

to host-ant nests and non-host-ant nests, and the number and position of eggs attached were assessed. Our results show no evidence for host-ant-based oviposition in M. alcon, but support an oviposition strategy based on plant characteristics. This suggests that careful management of host-ant distribution......Parasitic Maculinea alcon butterflies can only develop in nests of a subset of available Myrmica ant species, so female butterflies have been hypothesized to preferentially lay eggs on plants close to colonies of the correct host ants. Previous correlational investigations of host......-ant-dependent oviposition in this and other Maculinea species have, however, shown equivocal results, leading to a long-term controversy over support for this hypothesis. We therefore conducted a controlled field experiment to study the egg-laying behaviour of M. alcon. Matched potted Gentiana plants were set out close...

Factors affecting oviposition of Bemisia tabaci (Genn.) biotype B (Hemiptera: Aleyrodidae) in sweet pepper; Fatores que afetam a oviposicao de Bemisia tabaci (Genn.) biotipo B (Hemiptera: Aleyrodidae) em pimentao

Energy Technology Data Exchange (ETDEWEB)

Lima, Larissa C. de; Campos, Alcebiades R. [UNESP, Ilha Solteira, SP (Brazil). Dept. de Fitossanidade, Engenharia Rural e Solos]. E-mail: lclima@aluno.feis.unesp.br; campos@bio.feis.unesp.br

2008-03-15

Bemisia tabaci (Gen.) biotype B is considered a pest of economical importance for several vegetables. The oviposition behaviour of the while fly was evaluated in sweet pepper plants. The trials were carried out under greenhouse condition and in the Laboratory of Entomology of DEFERS/ UNESP, Campus of Ilha Solteira-SP, with the sweet pepper Magali-R genotype. The effect of plant age on the whitefly oviposition was evaluated in free-choice tests, in plants, 25, 30, 35, 40 and 45- day-old, as egg distribution in the plant and on the leaf blade was evaluated in 35-days-old plants. In a no-choice tests, 35-day-old plants were used to evaluate the effect of the densities of 50, 100, 150, 200 and 250 adults per plant on the number of eggs laid by insects. The silver leaf whitefly preferred to oviposition the third to sixth leaflets, of the medium and superior part of plants of sweet pepper; the leaf blade areas, located in the lobes right and left close the base of the leaf were the preferential site for whitefly oviposition. Older plants, 40- and 45-day-old, were preferentially used for oviposition, and 200 and 250 adults per plant were both enough to lay a number of eggs that allowed to differentiate among sweet pepper genotypes with different whitefly resistance levels. (author)

Temporal patterns in Homalodisca spp. (Hemiptera: Cicadellidae) oviposition on southern California citrus and jojoba.

Science.gov (United States)

Al-Wahaibi, Ali K; Morse, Joseph G

2010-02-01

A detailed study of the distribution of egg masses of Homalodisca vitripennis (Germar) and H. liturata Ball was done across a 2-yr period (2001-2003) on six host plants in southern California (Marsh grapefruit, Lisbon lemon, Washington navel, Dancy tangerine, rough lemon, and jojoba in Riverside; jojoba in Desert Center). The majority of egg masses in Riverside belonged to H. vitripennis (84-100%), whereas in Desert Center, all Homalodisca egg masses were H. liturata. Oviposition in Riverside occurred in two discrete periods, a late winter and spring period (mid-February to late May), followed by a short interval of very low oviposition during most of June, and then a summer period (late June to late September) followed by a relatively long period of very low oviposition in fall and early winter (October to mid-February). Levels of oviposition during the late winter-spring period were similar to those during the summer despite an observed larger population of adults during the latter period. Moreover, egg clutch size for H. vitripennis was generally greater in spring than during summer and was generally higher than that for H. liturata, especially on Riverside jojoba. Larger egg clutch size was seen on grapefruit than on lemon, navel, and tangerine during summer. There appeared to be temporal host shifts in oviposition; most evident was the shift from relatively high rates of oviposition on lemon and tangerine in late winter-early spring to relatively higher rates of oviposition on grapefruit and navel during summer.

Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae): influence of female age and experience

OpenAIRE

Joachim-Bravo, Iara S.; Fernandes, Odair A.; Bortoli, Sérgio A.; Zucoloto, Fernando S.

2001-01-01

The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824) females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laborator...

Silence multiple

DEFF Research Database (Denmark)

Søndergaard, Katia Dupret

The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

Presence of a predator image in potential breeding sites and oviposition responses of a dengue vector.

Science.gov (United States)

Dieng, Hamady; Satho, Tomomitsu; Suradi, Nur Farrahana Binti; Hakim, Hafijah; Abang, Fatimah; Aliasan, Nur Ezzati; Miake, Fumio; Zuharah, Wan Fatma; Kassim, Nur Faeza A; Majid, Abdul Hafiz A; Fadzly, Nik; Vargas, Ronald E Morales; Morales, Noppawan P; Noweg, Gabriel Tonga

2017-12-01

In dengue vector control, attempts to minimize or replace the use of pesticides have mostly involved use of predators, but success has been severely impeded by difficulties associated with financial and environmental costs, predator mass production, and persistence in target habitats. Visual deterrents have been used successfully to control animal pests, in some cases in an effort to replace pesticide use. Despite evidence that visual signals are crucial in site choice for egg deposition by dengue vectors, and that female mosquitoes respond to artificial predation, the role of predator intimidation as it affects the oviposition behavior of dengue vectors remains largely unexplored. Here, we examined the oviposition responses of Aedes aegypti exposed to various mosquito predator pictures. Gravid females were presented with equal opportunities to oviposit in two cups with predator images [Toxorhynchites splendens-TXI, Goldfish (Carassius auratus)-small (SFI) and large (LFI) and Tx. splendens+Goldfish-TXFI] and two others without pictures. Differences in egg deposition were examined between sites with and without these images. When given a chance to oviposit in cups with and without TXI, Ae. aegypti females were similarly attracted to both sites. When provided an opportunity to oviposit in cups displaying pictures of fish (SFI or LFI) and blank cups, egg deposition rates were much lower in the fish picture sites. Females showed a preference for blank cups over TXFI for egg deposition. They also equally avoided cups with pictures of fish, regardless of the size of the picture. Our results indicate that the presence of images of goldfish and their association with Tx. larvae significantly reduced egg deposition by Ae. aegypti, and this was not the case with the predatory larvae alone. The observations that the images of natural predators can repel gravid females of a dengue vector provide novel possibilities to develop effective and inexpensive alternative tools to

Oviposition site-selection by Bactrocera dorsalis is mediated through an innate recognition template tuned to γ-octalactone.

Directory of Open Access Journals (Sweden)

Kamala Jayanthi Pagadala Damodaram

Full Text Available Innate recognition templates (IRTs in insects are developed through many years of evolution. Here we investigated olfactory cues mediating oviposition behavior in the oriental fruit fly, Bactrocera dorsalis, and their role in triggering an IRT for oviposition site recognition. Behavioral assays with electrophysiologically active compounds from a preferred host, mango, revealed that one of the volatiles tested, γ-octalactone, had a powerful effect in eliciting oviposition by gravid B. dorsalis females. Electrophysiological responses were obtained and flies clearly differentiated between treated and untreated substrates over a wide range of concentrations of γ-octalactone. It triggered an innate response in flies, overriding inputs from other modalities required for oviposition site evaluation. A complex blend of mango volatiles not containing γ-octalactone elicited low levels of oviposition, whereas γ-octalactone alone elicited more oviposition response. Naïve flies with different rearing histories showed similar responses to γ-octalactone. Taken together, these results indicate that oviposition site selection in B. dorsalis is mediated through an IRT tuned to γ-octalactone. Our study provides empirical data on a cue underpinning innate behavior and may also find use in control operations against this invasive horticultural pest.

Oviposition behavior of the silver leaf whitefly Bemisia tabaci biotype B on tomato

International Nuclear Information System (INIS)

Vendramim, Jose D.; Souza, Antonio P. de; Ongarelli, Maria das G.

2009-01-01

The objective of this work was to evaluate the influence of the leaf surface, the insect geotropic behavior and the type of foliar trichome on Bemisia tabaci (Genn.) biotype B oviposition on tomato leaves. Bemisia tabaci females were confined in acrylic boxes in which tomato leaflets were fixed at the bottom and top part of the boxes to allow insects to access the leaf surface to be tested (adaxial and/or abaxial) in both no-choice and free choice tests. Oviposition was always higher when the leaf was offered at the top of the box and preferably at the abaxial leaf surface. The effects of leaf trichomes (glandular and non glandular) on B. tabaci oviposition was evaluated by offering the abaxial surface of tomato leaflets to females after a 70% ethanol wash to remove glandular exsudates against a control treatment (without a ethanol wash). Oviposition was concentrated mostly near to non glandular trichomes, showing whitefly females can discriminate among the trichomes. (author)

Different patterns of oviposition learning in two closely related ectoparasitoid wasps with contrasting reproductive strategies

Science.gov (United States)

Sasakawa, Kôji; Uchijima, Kenta; Shibao, Harunobu; Shimada, Masakazu

2013-02-01

Many parasitoid wasps learn host-associated cues and use them in subsequent host-searching behavior. This associative learning, namely "oviposition learning," has been investigated in many studies. However, few studies have compared multiple species, and no comparative study has previously been conducted on ectoparasitoid species. We compared the effects of oviposition learning on host preference and offspring sex ratio in two closely related ectoparasitoid wasps with contrasting reproductive strategies, Anisopteromalus calandrae (r-strategist) and its sibling species (K-strategist). Using two bruchine hosts, Callosobruchus chinensis and Callosobruchus maculatus larvae infesting the cowpea Vigna unguiculata, oviposition choice experiments were performed at high and low host densities. In both species, no conspicuous effect on the offspring sex ratio was detected, but effects on host preference were found to differ between the species. In A. calandrae, the effects were detected only at high host density, suggesting that oviposition learning plays a role in host discrimination from a short distance but not from a long distance. In the sibling species, those effects were not detected in any of the cases, suggesting the absence of oviposition learning. These results are compatible with those of previous comparative studies of endoparasitoid wasps in that few lifetime oviposition experiences and/or low reward per foraging decision result in low or absent oviposition learning ability. This finding may indicate that ecological traits contributing to learning ability are similar between endoparasitoid and ectoparasitoid wasps. Thus, our species comparison of ectoparasitoids provides another model system for investigating learning and memory dynamics in parasitoid wasps.

Studies on the post-oviposition blood-feeding behaviour of Aedes aegypti (L.) (Diptera: Culicidae) in the laboratory.

Science.gov (United States)

Chadee, D D

2012-11-01

The blood-feeding behaviour of the Trinidad strain of Aedes aegypti was studied, under laboratory conditions, using one female per cage and monitoring blood feeding immediately, 12, and 24 hours after oviposition. To get large numbers of females that had newly completed their first gonotrophic cycle, the diel oviposition periodicity was conducted using single females per cage and monitoring at 2-hour intervals. The diel oviposition periodicity showed a small morning peak (8%) during the first 2 hours of the photophase after which oviposition declined: during the second half of the photophase, oviposition increased reaching a peak comprising 56% of eggs (G = 59·9, P>0·01) between 16:00 and 18:00 hours. At post-oviposition hour 0, only five (10%) of the females accepted a blood meal but at post-oviposition hour 12, significantly more (G = 46·98, P>0·02) females, 35 (70%) accepted a blood meal. This pattern was consistently observed when females were offered blood meals at 12 and 24 hours after completing their first gonotrophic cycle. Multiple feeding was observed among the blood-feeding females and the results of this study are discussed in the context of disease transmission patterns and physiological mechanisms which control their blood-feeding behaviours.

Aedes albopictus (Diptera: Culicidae) Oviposition Preference as Influenced by Container Size and Buddleja davidii Plants.

Science.gov (United States)

Davis, Timothy J; Kline, Daniel L; Kaufman, Phillip E

2016-03-01

Aedes albopictus (Skuse) is a container-breeding mosquito commonly found in residential areas of its range in the United States. Mosquitoes are known to utilize flowering plants for sugar acquisition. Limited information is known about the influences on oviposition site selection, outside of container size. Residential areas are often landscaped with a variety of flowering plants and are known to provide numerous sizes of potential larval developmental sites for container-breeding mosqutioes. Through screened enclosure and field studies, the oviposition preference of Ae. albopictus for containers of three selected sizes (473, 946 and 1,892 ml) and the influence of flowering butterfly bush (Buddleja davidii Franchett cultivar 'Guinevere') plants were examined. Our results document that significantly more eggs were oviposited in the largest containers. Additionally, significantly more eggs were oviposited in containers adjacent to flowering butterfly bushes than in those without a flowering butterfly bush. Finally, our results document that flowering butterfly bushes exerted greater influence over Ae. albopictus oviposition decisions than did container size. Our findings can be applied to several aspects of Ae. albopictus surveillance and control.

Oviposition site selection in Aedes albopictus (Diptera: Culicidae): are the effects of predation risk and food level independent?

Science.gov (United States)

Wasserberg, Gideon; White, L; Bullard, A; King, J; Maxwell, R

2013-09-01

For organisms lacking parental care and where larval dispersal is limited, oviposition site selection decisions are critical fitness-enhancing choices. However, studies usually do not consider the interdependence of the two. In this study, we evaluated the effect of food level on the oviposition behavior of Aedes albopictus (Skuse) in the presence or the absence of a nonlethal predator (caged dragonfly nymph). We also attempted to quantify the perceived cost of predation to ovipositioning mosquitoes. Mosquitoes were presented with oviposition cups containing four levels of larval food (fermented leaf infusion) with or without a caged libellulid nymph. By titrating larval food, we estimated the amount of food needed to attract the female mosquito to oviposit in the riskier habitat. As expected, oviposition rate increased with food level and decreased in the presence of a predator. However, the effect of food level did not differ between predator treatments. By calculating the difference in the amount of food for points of equal oviposition rate in the predator-present and predator-absent regression lines, we estimated the cost of predation risk to be 1950 colony-forming-units per milliliter. Our study demonstrated the importance of considering the possible interdependence of predation risk and food abundance for oviposition-site-seeking insects. This study also quantified the perceived cost of predation and found it to be relatively low, a fact with positive implications for biological control.

Titration and hysteresis in epigenetic chromatin silencing

International Nuclear Information System (INIS)

Dayarian, Adel; Sengupta, Anirvan M

2013-01-01

Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

D-Pinitol in Fabaceae: an Oviposition Stimulant for the Common Grass Yellow Butterfly, Eurema mandarina.

Science.gov (United States)

Mukae, Shin-Ya; Ohashi, Toshiki; Matsumoto, Yuika; Ohta, Shinji; Ômura, Hisashi

2016-11-01

The common grass yellow butterfly, Eurema mandarina (formerly Eurema hecabe mandarina) (Lepidoptera, Pieridae), recently has been separated taxonomically from a subtropical population of Eurema hecabe in Japan. This species is widely distributed in the temperate region of Japan, and feeds mainly on various ligneous plants within the Fabaceae. We attempted to identify an oviposition stimulant for E. mandarina from its primary hosts, Albizia julibrissin and Lespedeza cuneata. In both hosts, crude extract and an aqueous fraction elicited oviposition responses from gravid females. A polar subfraction of the aqueous fraction also stimulated high oviposition-stimulatory activity, comparable to the original aqueous fraction, suggesting that E. mandarina females use water-soluble compounds for host recognition. Subsequent activity-directed fractionation by ion exchange chromatography indicated that one of the key substances was contained in the neutral/amphoteric fraction. Chemical analyses revealed that the active fractions of both hosts contained D-(+)-pinitol as the major component. We examined female responses to authentic D-pinitol and found that it induced oviposition responses at concentrations greater than 0.1 %. Since this cyclitol is omnipresent in Fabaceae, we conclude that D-pinitol plays a role in mediating oviposition of E. mandarina on fabaceous plants.

Oviposition by Female Plodia interpunctella (Lepidoptera: Pyralidae): Description and Time Budget Analysis of Behaviors in Laboratory Studies.

Science.gov (United States)

Sambaraju, Kishan R; Donelson, Sarah L; Bozic, Janko; Phillips, Thomas W

2016-01-22

The oviposition behavior of the Indian meal moth, Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae), a major insect pest of durable stored foods, was studied in small experimental arenas under laboratory conditions using videography, and a time budget analysis of its behaviors was documented. Resting gravid females typically became active shortly after the start of the scotophase. The characteristic behaviors exhibited by mated females prior to oviposition included antennal movement, grooming of antennae and mouth parts using the forelegs, walking or flying, and abdomen bending and dragging. Pre-oviposition behaviors such as antennal grooming and walking or flying were observed to alternate several times before females commenced the abdominal dragging behavior that preceded egg laying. Eggs were laid singly or sometimes in groups, either freely or stuck to food material. Gravid females showed little or no movement during the photophase; however, they actively flew and oviposited during the scotophase. Females allocated only a small portion of their time to oviposition while the rest of the time was spent away from food. Females oviposited on food material by making repeated visits, predominantly during the first four hours of the scotophase. Visits and time spent on food declined as the scotophase advanced.

REPELLENT AND OVIPOSITION DETERRENT ACTIVITIES OFTHE ESSENTIAL OIL FROM MIKANIA MICRANTHA AND ITS COMPOUNDS ON PLUTELLA XYLOSTELLA

Institute of Scientific and Technical Information of China (English)

Mao-xinZhang; BingLing; Shao-yingChen; Guang-wenLiang; Xiong-feiPang

2004-01-01

Repellent and oviposition deterrent activities of the essential oil from Mikania micrantha and five volatile compounds including limonene, a-terpinene, linalool, B-caryophylene and verbenone on the diamondback moth (DBM), Plutella xylostella, was investigated in door and in net-house. The results showed that the essential oil of the M. micrantha had significant repellant effect (at flow 100-180 mL/min) and oviposition deterrent activity at dose 1020 uL/seedling for the DBM. In five volatile compounds, a-terpinene, limonene and linalool had significant effect on repellent and oviposition deterrent of the DBM moths, but verbenone and B-caryophylene, no significantly effect was observed in repellent and oviposition deterrent.

The role of cow urine in the oviposition site preference of culicine and Anopheles mosquitoes

Directory of Open Access Journals (Sweden)

Kweka Eliningaya J

2011-09-01

Full Text Available Abstract Background Chemical and behavioural ecology of mosquitoes plays an important role in the development of chemical cue based vector control. To date, studies available have focused on evaluating mosquito attractants and repellents of synthetic and human origins. This study, however, was aimed at seasonal evaluation of the efficiency of cow urine in producing oviposition cues to Anopheles gambiae s.l. and Culex quinquefasciatus in both laboratory and field conditions. Methods Oviposition response evaluation in laboratory conditions was carried out in mosquito rearing cages. The oviposition substrates were located in parallel or in diagonal positions inside the cage. Urine evaluation against gravid females of An. arabiensis and Cx. quinquefasciatus was carried out at Day 1, Day 3 and Day 7. Five millilitres (mls of cow urine was added to oviposition substrate while de-chlorinated water was used as a control. In field experiments, 500 mls of cow urine was added in artificial habitats with 2500 mls of de-chlorinated water and 2 kgs of soil. The experiment was monitored for thirty consecutive days, eggs were collected daily from the habitats at 7.00 hrs. Data analysis was performed using parametric and non-parametric tests for treatments and controls while attraction of the oviposition substrate in each species was presented using Oviposition Activity Index (OAI. Results The OAI was positive with ageing of cattle urine in culicine species in both laboratory and field experiments. The OAI for anopheline species was positive with fresh urine. The OAI during the rainy season was positive for all species tested while in the dry season the OAI for culicine spp and Anopheles gambiae s.l., changed with time from positive to negative values. Based on linear model analysis, seasons and treatments had a significant effect on the number of eggs laid in habitats, even though the number of days had no effect. Conclusion Oviposition substrates treated with

Oviposition by Female Plodia interpunctella (Lepidoptera: Pyralidae: Description and Time Budget Analysis of Behaviors in Laboratory Studies

Directory of Open Access Journals (Sweden)

Kishan R. Sambaraju

2016-01-01

Full Text Available The oviposition behavior of the Indian meal moth, Plodia interpunctella (Hübner (Lepidoptera: Pyralidae, a major insect pest of durable stored foods, was studied in small experimental arenas under laboratory conditions using videography, and a time budget analysis of its behaviors was documented. Resting gravid females typically became active shortly after the start of the scotophase. The characteristic behaviors exhibited by mated females prior to oviposition included antennal movement, grooming of antennae and mouth parts using the forelegs, walking or flying, and abdomen bending and dragging. Pre-oviposition behaviors such as antennal grooming and walking or flying were observed to alternate several times before females commenced the abdominal dragging behavior that preceded egg laying. Eggs were laid singly or sometimes in groups, either freely or stuck to food material. Gravid females showed little or no movement during the photophase; however, they actively flew and oviposited during the scotophase. Females allocated only a small portion of their time to oviposition while the rest of the time was spent away from food. Females oviposited on food material by making repeated visits, predominantly during the first four hours of the scotophase. Visits and time spent on food declined as the scotophase advanced.

Predatory mites avoid ovipositing near counter-attacking prey

NARCIS (Netherlands)

Faraji, F.; Janssen, A.; Sabelis, M.W.

2001-01-01

Attacking prey is not without risk; predators may endure counterattackby the prey. Here, we study the oviposition behaviour of a predatory mite(Iphiseius degenerans) in relation to its prey, thewesternflower thrips (Frankliniella occidentalis). This thrips iscapable of killing the eggs of the

High temperature triggers latent variation among individuals: oviposition rate and probability for outbreaks.

Directory of Open Access Journals (Sweden)

Christer Björkman

2011-01-01

Full Text Available It is anticipated that extreme population events, such as extinctions and outbreaks, will become more frequent as a consequence of climate change. To evaluate the increased probability of such events, it is crucial to understand the mechanisms involved. Variation between individuals in their response to climatic factors is an important consideration, especially if microevolution is expected to change the composition of populations.Here we present data of a willow leaf beetle species, showing high variation among individuals in oviposition rate at a high temperature (20 °C. It is particularly noteworthy that not all individuals responded to changes in temperature; individuals laying few eggs at 20 °C continued to do so when transferred to 12 °C, whereas individuals that laid many eggs at 20 °C reduced their oviposition and laid the same number of eggs as the others when transferred to 12 °C. When transferred back to 20 °C most individuals reverted to their original oviposition rate. Thus, high variation among individuals was only observed at the higher temperature. Using a simple population model and based on regional climate change scenarios we show that the probability of outbreaks increases if there is a realistic increase in the number of warm summers. The probability of outbreaks also increased with increasing heritability of the ability to respond to increased temperature.If climate becomes warmer and there is latent variation among individuals in their temperature response, the probability for outbreaks may increase. However, the likelihood for microevolution to play a role may be low. This conclusion is based on the fact that it has been difficult to show that microevolution affect the probability for extinctions. Our results highlight the urge for cautiousness when predicting the future concerning probabilities for extreme population events.

Cell provisioning and oviposition in Melipona beecheii (Apidae, Meliponinae),with a note on caste determination

NARCIS (Netherlands)

Veen, Johan Wilhelm van

1999-01-01

We examined the food provisioning and oviposition process (POP) for worker- and gyne-producing cells of Melipona beecheii. POPs for both castes did not differ significantly in duration and number of trophic eggs oviposited by workers in the cells. The frequency of food discharges by workers in

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

Science.gov (United States)

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Silencing a sugar transporter gene reduces growth and fecundity in the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

Science.gov (United States)

Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai

2015-07-17

The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.

Push-Pull Effects of Three Plant Secondary Metabolites on Oviposition of the Potato Tuber Moth, Phthorimaea operculella

Science.gov (United States)

Ma, Y.F.; Xiao, C.

2013-01-01

The push-pull effects of three plant secondary metabolites, azadirachtin, eucalyptol, and heptanal, on the oviposition choices of potato tubers by the potato tuber moth, Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae) were tested in the laboratory. Azadirachtin at concentrations from 1.5 to 12 mg/L had a significant repellent effect on oviposition. Eucalyptol at concentrations from 3 to 12 mg/L promoted oviposition. Heptanal promoted oviposition at low concentrations from 0.1875 to 3.0 mg/L but repelled it at higher concentrations from 12 to 24 mg/L. The combination of azadirachtin (12 mg/L) with eucalyptol (3.0 mg/L) resulted in a significant pushpull effect of 56.3% on oviposition. The average maximum push-pull effects occurred with the combinations of azadirachtin with heptanal (12 and 0.375 mg/L, respectively; 38.7% push-pull effect), heptanal with eucalyptol (12 and 6 mg/L, respectively; 31.4% push-pull effect), and heptanal (high concentration) with heptanal (low concentration) (12.0 and 0.375 mg/L, respectively; 25% push-pull effect). PMID:24786822

Oviposition inhibitor in umbelliferous medicinal plants for the common yellow swallowtail (Papilio machaon).

Science.gov (United States)

Morino, Chisato; Morita, Yusuke; Minami, Kazuki; Nishidono, Yuto; Nakashima, Yoshitaka; Ozawa, Rika; Takabayashi, Junji; Ono, Naoaki; Kanaya, Shigehiko; Tamura, Takayuki; Tezuka, Yasuhiro; Tanaka, Ken

2018-01-01

Umbelliferous medicinal plants, such as Angelica acutiloba Kitagawa and Angelica dahurica Bentham et Hooker filius ex Franchet et Savatier, account for a large percentage of crude drug consumption in Japan. The most serious problem in the cultivation of umbelliferous medicinal plants is the feeding damage caused by the common yellow swallowtail (Papilio machaon hippocrates C. & R. Felder, 1864). When we compared the numbers of eggs laid by P. machaon on six umbelliferous medicinal plants, the eggs on A. acutiloba, A. dahurica, and Glehnia littoralis Fr. Schmidt ex Miquel were the most numerous, those on Saposhnikovia divaricata Schischkin and Cnidium officinale Makino were rare, and Bupleurum falcatum Linné was not oviposited at all. To identify oviposition inhibitors for P. machaon in B. falcatum, S. divaricata, and C. officinale, the volatile chemical constituents of these umbelliferous medicinal plants were compared with GC-MS. We carried out multivariate analysis of gas chromatographic data and concluded that germacrene D, α-humulene, and trans-caryophyllene play important roles in protecting plants from oviposition by P. machaon. Their oviposition repellent activity was confirmed by the fact that the number of eggs laid on the leaves around a repellent device containing a mixture of germacrene D, α-humulene, and trans-caryophyllene was reduced by 40% compared to a control.

Laboratory and field evaluation of an oviposition trap for Culex quinquefasciatus(Diptera: Culicidae

Directory of Open Access Journals (Sweden)

Rosângela MR Barbosa

2007-06-01

Full Text Available An ovitrap (BR-OVT based on physical and chemical stimuli for attracting gravid Culex quinquefasciatus (Diptera: Culicidae females was developed and evaluated under laboratory and field conditions. Attractants were assayed using alternative chamber bioassays prior to being used in the BR-OVT oviposition trap. A significant preference of gravid females for sites containing conspecific egg rafts was observed, as a response to the natural oviposition pheromone, as well as for sites treated with the synthetic pheromone erythro-6-acetoxy-5-hexadecanolide. Five- to 20-day old grass infusion was strongly attractive to gravid females for laying eggs. On the other hand, entomopathogenic Bacillus sphaericus (Bs did not influence the choice of an oviposition site when used in combination with grass infusion and can therefore be used as a larvicide in ovitraps. Results from field trials showed that the BR-OVT with grass infusion and with or without Bs works as a preferred oviposition site for Cx. quinquefasciatus. The BR-OVT was more effective for egg collection when placed indoors and comparison with the number of egg rafts laid in cesspits over 40 days indicates that this very simple ovitrap may be a useful tool for monitoring populations of the most important of the vectors of bancroftian filariasis.

Construction of a field trap for initiating an ovipositional response in Aedes taeniorhynchus.

Science.gov (United States)

Wallace, F L

1996-09-01

An oviposition trap was constructed for the black saltmarsh mosquito, Aedes taeniorhynchus. The trap consisted of a 50 x 60-cm piece of contaminated 100% cotton bath towel, saturated with 85% tap water, a container, and a cover of dried plant parts placed over the contaminated toweling. This combination initiated oviposition. Contamination of the toweling was due to populations of bacteria and fungi. The eggs recovered were free from soil and debris.

Mediterranean fruit fly: interference of oviposition by radiation-sterilized females in field cages

Energy Technology Data Exchange (ETDEWEB)

McInnis, D. O. [Tropical Fruit and Vegetable Research Lab. USDA-ARS, Honolulu, HI (United States); Wong, T. T.Y.

1990-07-01

In experiments between April and September 1984, the behaviour of nonirradiated and radiation-sterilized laboratory-adapted adults of the tephritid Ceratitis capitata was observed on apples hung on guava trees in outdoor cages in Hawaii. The numbers of nonirradiated females observed resting on fruit were reduced several times by the presence of irradiated females, either alone or with irradiated males, but not by irradiated males alone. Similarly, the number of nonirradiated females observed ovipositing and the duration of oviposition was reduced by the presence of irradiated females. In control cages (all nonirradiated flies), the duration of oviposition by females averaged 255.9±15.0 s on fruit, while most of nonirradiated and irradiated females in the mixed (treatment) cage averaged 157±19.8 s and 77.5±7.5 s on fruit, resp. Irradiated females behaved skittishly on fruit and frequently engaged in physical encounters with other flies.

Spatial Distribution of Adult Anthonomus grandis Boheman (Coleoptera: Curculionidae) and Damage to Cotton Flower Buds Due to Feeding and Oviposition.

Science.gov (United States)

Grigolli, J F J; Souza, L A; Fernandes, M G; Busoli, A C

2017-08-01

The cotton boll weevil Anthonomus grandis Boheman (Coleoptera: Curculionidae) is the main pest in cotton crop around the world, directly affecting cotton production. In order to establish a sequential sampling plan, it is crucial to understand the spatial distribution of the pest population and the damage it causes to the crop through the different developmental stages of cotton plants. Therefore, this study aimed to investigate the spatial distribution of adults in the cultivation area and their oviposition and feeding behavior throughout the development of the cotton plants. The experiment was conducted in Maracaju, Mato Grosso do Sul, Brazil, in the 2012/2013 and 2013/2014 growing seasons, in an area of 10,000 m 2 , planted with the cotton cultivar FM 993. The experimental area was divided into 100 plots of 100 m 2 (10 × 10 m) each, and five plants per plot were sampled weekly throughout the crop cycle. The number of flower buds with feeding and oviposition punctures and of adult A. grandis was recorded throughout the crop cycle in five plants per plot. After determining the aggregation indices (variance/mean ratio, Morisita's index, exponent k of the negative binomial distribution, and Green's coefficient) and adjusting the frequencies observed in the field to the distribution of frequencies (Poisson, negative binomial, and positive binomial) using the chi-squared test, it was observed that flower buds with punctures derived from feeding, oviposition, and feeding + oviposition showed an aggregated distribution in the cultivation area until 85 days after emergence and a random distribution after this stage. The adults of A. grandis presented a random distribution in the cultivation area.

Size of and damage on shoots of Passiflora suberosa (Passifloraceae influence oviposition site selection of Heliconius erato phyllis (Fabricius (Lepidoptera, Nymphalidae

Directory of Open Access Journals (Sweden)

Elna Mugrabi-Oliveira

1996-01-01

Full Text Available Oviposition site selection of Heliconius erato phyllis (Fabricius, 1775 (Lepidoptera, Nymphalidae was studied when size of and damage on shoots were variable in a natural population of Passiflora suberosa Linnaeus (Passifloraceae, and through sequential and simultaneous choice experiments performed under insectary conditions. Females showed marked oviposition preference for undamaged and largest shoots of P. suberosa. Eggs were mostly laid on the terminal buds of intact shoots under natural conditions. In simultaneous choice trials, females preferred to oviposit on shoots from which leaves (ten were removed but the terminal bud maintained to those where leaves were kept but the terminal bud was cut out. In sequential choice trials, they did not lay eggs on shoots from which the terminal bud was removed. Females preferred to oviposit on large to short intact shoots in both sequential and simultaneous choice trials. Females laid eggs preferentially on shoots with the greatest leaf area when most plants were intact in the field during early spring. Later in fall, when mostly large, old shoots were damaged or in a reproductive stage (less desirable for oviposition, oviposition intensity was highest on the shortest, youngest shoots of P. suberosa. Thus, females might rank these quality attributes higher than size while selecting shoots for oviposition. The consequences of ovipositing selectively on intact, large shoots of P. suberosa are discussed from the view point of H. erato phyllis larval performance.

Performative Silences

DEFF Research Database (Denmark)

Dupret, Katia

2018-01-01

static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

Does a Change from Whole to Powdered Food (Artemia franciscana eggs Increase Oviposition in the Ladybird Coleomegilla maculata?

Directory of Open Access Journals (Sweden)

Eric W. Riddick

2015-09-01

Full Text Available The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered vs. whole Artemia franciscana (A. franciscana (brine shrimp eggs with or without a dietary supplement on development and reproduction of Coleomegilla maculata (C. maculata (Coleoptera: Coccinellidae. We tested the hypotheses that (1 powdered A. franciscana eggs are more suitable than whole eggs; and (2 palmitic acid, a common fatty acid in natural prey, i.e., aphids, is an effective dietary supplement. Development time, pre-imaginal survival, sex ratio, and body weight of adults did not differ significantly amongst individuals fed powdered vs. whole eggs, with or without 5% palmitic acid. Significantly more oviposition occurred when females were fed powdered eggs than whole eggs and powdered eggs with 5% palmitic acid than whole eggs with or without 5% palmitic acid. A weak functional relationship was found between pre-oviposition time and total oviposition by females fed powdered eggs with 5% palmitic acid; pre-oviposition time decreased as oviposition increased. Food treatments had no significant differential effect on progeny (egg hatch rate. In conclusion, a simple change in A. franciscana egg texture and particle size (i.e., blending whole eggs into a dust-like powder increases oviposition in C. maculata. Supplementing powdered eggs with 5% palmitic acid might accelerate oogenesis (egg maturation in some females.

First record of invasive Burmese Python oviposition and brooding inside an anthropogenic structure

Science.gov (United States)

Hanslowe, Emma; Falk, Bryan; Collier, Michelle A. M.; Josimovich, Jillian; Rahill, Thomas; Reed, Robert

2016-01-01

We discovered an adult female Python bivittatus (Burmese Python) coiled around a clutch of 25 eggs in a cement culvert in Flamingo, FL, in Everglades National Park. To our knowledge, this is the first record of an invasive Burmese Python laying eggs and brooding inside an anthropogenic structure in Florida. A 92% hatch-success rate suggests that the cement culvert provided suitable conditions for oviposition, embryonic development, and hatching. Given the plenitude of such anthropogenic structures across the landscape, available sites for oviposition and brooding may not be limiting for the invasive Burmese Python population.

The effects of simulated rainfall on immature population dynamics of Aedes albopictus and female oviposition

Science.gov (United States)

Dieng, Hamady; Rahman, G. M. Saifur; Abu Hassan, A.; Che Salmah, M. R.; Satho, Tomomitsu; Miake, Fumio; Boots, Michael; Sazaly, Abubakar

2012-01-01

Larvae of Aedes albopictus Skuse typically inhabit natural and artificial containers. Since these larval habitats are replenished by rainfall, Ae. albopictus may experience increased loss of immature stages in areas with high levels of rainfall. In this study, we investigated the effects of rainfall and container water level on population density, and oviposition activity of Ae. albopictus. In field and laboratory experiments, we found that rainfall resulted in the flushing of breeding habitats. Excess rain negatively impacted larval and pupal retention, especially in small habitats. When filled with water to overflowing, container habitats were significantly repellent to ovipositing females. Taken together, these data suggest that rainfall triggers population loss of Ae. albopictus and related species through a direct detrimental effect (flushing out) and an indirect effect (ovipositional repellency).

Mortality risk from entomopathogenic fungi affects oviposition behavior in the parasitoid wasp Trybliographa rapae

DEFF Research Database (Denmark)

Rännbäck, Linda-Marie; Cotes, Belen; Anderson, Peter

2015-01-01

brunneum isolate KVL 04-57 and Beauveria bassiana isolate KVL 03-90. Furthermore, T. rapae oviposition behavior was assessed in the presence of these entomopathogenic fungi either as infected hosts or as infective propagules in the environment. Both fungi were pathogenic to D. radicum larvae and T. rapae...... adults, but with variable virulence. When host patches were inoculated with M. brunneum conidia in a no-choice situation, more eggs were laid by T. rapae in hosts of those patches compared to control and B. bassiana treated patches. Females that later succumbed to mycosis from either fungusi laid...... larvae. This was less pronounced for B. bassiana. Based on our results we propose that T. rapae can perceive and react towards IGP risk posed by M. brunneum but not B. bassiana to the foraging female herself and her offspring. Thus, M. brunneum has the potential to be used for biological control against...

Taxonomic variation in oviposition by tailed frogs (Aschaphus spp.).

Science.gov (United States)

Nancy E. Karraker; David S. Pilliod; Michael J. Adams; Evelyn L. Bull; Paul Stephen Corn; Lowell V. Diller; Linda A. Dupuis; Marc P. Hayes; Blake R. Hossack; Garth R. Hodgson; Erin J. Hyde; Kirk Lohman; Bradford R. Norman; Lisa M. Ollivier; Christopher A. Pearl; Charles R. Peterson

2006-01-01

Tailed frogs (Ascaphus spp.) oviposit in cryptic locations in streams of the Pacific Northwest and Rocky Mountains. This aspect of their life history has restricted our understanding of their reproductive ecology. The recent split of A. montanus in the Rocky Mountains from A. truei was based on molecular...

Age-dependent effects of oral infection with dengue virus on Aedes aegypti (Diptera: Culicidae) feeding behavior, survival, oviposition success and fecundity.

Science.gov (United States)

Sylvestre, Gabriel; Gandini, Mariana; Maciel-de-Freitas, Rafael

2013-01-01

Aedes aegypti is the main vector of dengue, a disease that is increasing its geographical range as well as incidence rates. Despite its public health importance, the effect of dengue virus (DENV) on some mosquito traits remains unknown. Here, we investigated the impact of DENV-2 infection on the feeding behavior, survival, oviposition success and fecundity of Ae. aegypti females. After orally-challenging Ae. aegypti females with a DENV-2 strain using a membrane feeder, we monitored the feeding behavior, survival, oviposition success and fecundity throughout the mosquito lifespan. We observed an age-dependent cost of DENV infection on mosquito feeding behavior and fecundity. Infected individuals took more time to ingest blood from anesthetized mice in the 2(nd) and 3(rd) weeks post-infection, and also longer overall blood-feeding times in the 3(rd) week post-infection, when females were around 20 days old. Often, infected Ae. aegypti females did not lay eggs and when they were laid, smaller number of eggs were laid compared to uninfected controls. A reduction in the number of eggs laid per female was evident starting on the 3(rd) week post-infection. DENV-2 negatively affected mosquito lifespan, since overall the longevity of infected females was halved compared to that of the uninfected control group. The DENV-2 strain tested significantly affected Ae. aegypti traits directly correlated with vectorial capacity or mosquito population density, such as feeding behavior, survival, fecundity and oviposition success. Infected mosquitoes spent more time ingesting blood, had reduced lifespan, laid eggs less frequently, and when they did lay eggs, the clutches were smaller than uninfected mosquitoes.

Age-dependent effects of oral infection with dengue virus on Aedes aegypti (Diptera: Culicidae feeding behavior, survival, oviposition success and fecundity.

Directory of Open Access Journals (Sweden)

Gabriel Sylvestre

Full Text Available BACKGROUND: Aedes aegypti is the main vector of dengue, a disease that is increasing its geographical range as well as incidence rates. Despite its public health importance, the effect of dengue virus (DENV on some mosquito traits remains unknown. Here, we investigated the impact of DENV-2 infection on the feeding behavior, survival, oviposition success and fecundity of Ae. aegypti females. METHODS/PRINCIPAL FINDINGS: After orally-challenging Ae. aegypti females with a DENV-2 strain using a membrane feeder, we monitored the feeding behavior, survival, oviposition success and fecundity throughout the mosquito lifespan. We observed an age-dependent cost of DENV infection on mosquito feeding behavior and fecundity. Infected individuals took more time to ingest blood from anesthetized mice in the 2(nd and 3(rd weeks post-infection, and also longer overall blood-feeding times in the 3(rd week post-infection, when females were around 20 days old. Often, infected Ae. aegypti females did not lay eggs and when they were laid, smaller number of eggs were laid compared to uninfected controls. A reduction in the number of eggs laid per female was evident starting on the 3(rd week post-infection. DENV-2 negatively affected mosquito lifespan, since overall the longevity of infected females was halved compared to that of the uninfected control group. CONCLUSIONS: The DENV-2 strain tested significantly affected Ae. aegypti traits directly correlated with vectorial capacity or mosquito population density, such as feeding behavior, survival, fecundity and oviposition success. Infected mosquitoes spent more time ingesting blood, had reduced lifespan, laid eggs less frequently, and when they did lay eggs, the clutches were smaller than uninfected mosquitoes.

Integration of multiple intraguild predator cues for oviposition decisions by a predatory mite

Science.gov (United States)

Walzer, Andreas; Schausberger, Peter

2012-01-01

In mutual intraguild predation (IGP), the role of individual guild members is strongly context dependent and, during ontogeny, can shift from an intraguild (IG) prey to a food competitor or to an IG predator. Consequently, recognition of an offspring's predator is more complex for IG than classic prey females. Thus, IG prey females should be able to modulate their oviposition decisions by integrating multiple IG predator cues and by experience. Using a guild of plant-inhabiting predatory mites sharing the spider mite Tetranychus urticae as prey and passing through ontogenetic role shifts in mutual IGP, we assessed the effects of single and combined direct cues of the IG predator Amblyseius andersoni (eggs and traces left by a female on the substrate) on prey patch selection and oviposition behaviour of naïve and IG predator-experienced IG prey females of Phytoseiulus persimilis. The IG prey females preferentially resided in patches without predator cues when the alternative patch contained traces of predator females or the cue combination. Preferential egg placement in patches without predator cues was only apparent in the choice situation with the cue combination. Experience increased the responsiveness of females exposed to the IG predator cue combination, indicated by immediate selection of the prey patch without predator cues and almost perfect oviposition avoidance in patches with the cue combination. We argue that the evolution of the ability of IG prey females to evaluate offspring's IGP risk accurately is driven by the irreversibility of oviposition and the functionally complex relationships between predator guild members. PMID:23264692

Differential Larval Toxicity and Oviposition Altering Activity of Some Indigenous Plant Extracts against Dengue and Chikungunya Vector Aedes albopictus.

Directory of Open Access Journals (Sweden)

Ruchi Yadav

2014-12-01

Full Text Available Mosquitoes are well known as vectors of several disease causing pathogens. The extensive use of synthetic insecticides in the mosquito control strategies resulted to the development of pesticide resistance and fostered environmental deterioration. Hence in recent years plants become alternative source of mosquito control agents. The present study assessed the larvicidal and oviposition altering activity of six different plants species-Alstonia scholaris, Callistemon viminalis, Hyptis suaveolens, Malvastrum coromandelianum, Prosopis juliflora, Vernonia cinerea against Aedes albopictus mosquito in laboratory.Leaf extracts of all the six plants species in five different solvents of various polarities were used in the range of 20-400ppm for larval bioassay and 50,100 and 200ppm for cage bioassay (for the study of oviposition behavior against Ae. albopictus. The larval mortality data were recorded after 24 h and subjected to Probit analysis to determine the lethal concentrations (LC50, while OAI (Oviposition activity index was calculated for oviposition altering activity of the plant extracts.Vernonia cinerea extract in acetone and C. viminalis extract in isopropanol were highly effective against Aedes albopictus larvae with LC50 value 64.57, 71.34ppm respectively. Acetone extract of P. juliflora found to be strong oviposition-deterrent which inhibited >2 fold egg laying (OAI-0.466 at 100ppm.Vernonia cinerea and C. viminallis leaf extracts have the potential to be used as larvicide and P. juliflora as an oviposition-deterrent for the control of Ae. albopictus mosquito.

Differential Larval Toxicity and Oviposition Altering Activity of Some Indigenous Plant Extracts against Dengue and Chikungunya Vector Aedes albopictus

Science.gov (United States)

Yadav, Ruchi; Tyagi, Varun; Tikar, Sachin N; Sharma, Ajay K; Mendki, Murlidhar J; Jain, Ashok K; Sukumaran, Devanathan

2014-01-01

Background: Mosquitoes are well known as vectors of several disease causing pathogens. The extensive use of synthetic insecticides in the mosquito control strategies resulted to the development of pesticide resistance and fostered environmental deterioration. Hence in recent years plants become alternative source of mosquito control agents. The present study assessed the larvicidal and oviposition altering activity of six different plants species-Alstonia scholaris, Callistemon viminalis, Hyptis suaveolens, Malvastrum coromandelianum, Prosopis juliflora, Vernonia cinerea against Aedes albopictus mosquito in laboratory. Methods: Leaf extracts of all the six plants species in five different solvents of various polarities were used in the range of 20–400ppm for larval bioassay and 50,100 and 200ppm for cage bioassay (for the study of oviposition behavior) against Ae. albopictus. The larval mortality data were recorded after 24 h and subjected to Probit analysis to determine the lethal concentrations (LC50), while OAI (Oviposition activity index) was calculated for oviposition altering activity of the plant extracts. Results: Vernonia cinerea extract in acetone and C. viminalis extract in isopropanol were highly effective against Aedes albopictus larvae with LC50 value 64.57, 71.34ppm respectively. Acetone extract of P. juliflora found to be strong oviposition-deterrent which inhibited >2 fold egg laying (OAI-0.466) at 100ppm. Conclusion: Vernonia cinerea and C. viminallis leaf extracts have the potential to be used as larvicide and P. juliflora as an oviposition-deterrent for the control of Ae. albopictus mosquito. PMID:26114131

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

Influence ofAmaranthus hybridus L. allelochemics on oviposition behavior ofSpodoptera exigua andS. eridania (Lepidoptera: Noctuidae).

Science.gov (United States)

Mitchell, E R; Heath, R R

1985-05-01

Common pigweed,Amaranthus hybridus L., is a favorite host of the beet army worm (BAW),Spodoptera exigua L. Chemicals extracted from homogenized pigweed with distilled water, ethanol, or dichloromethane and sprayed back on pigweed deterred oviposition by the BAW. Similarly, water extracts of frass from conspecific larvae or southern armyworm (SAW) larvae,S. eridania (Cramer), fed pigweed leaves and sprayed back on pigweed plants also deterred BAW oviposition, thus confirming that deterrence was due to plant allelochemics rather than specific compounds associated with the metabolic or excretory products of the larvae. Confirmation of the presence of oviposition-deterring chemicals in pigweed was used to explain a previously observed seasonal displacement of BAW by SAW on pigweed in the field.

Correlation of molecular expression with diel rhythm of oviposition in Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae) and implications for forensic entomology.

Science.gov (United States)

George, Kelly A; Archer, Melanie S; Toop, Tes

2015-01-01

This study explored the molecular mechanisms potentially underlying blow fly nocturnal oviposition. A behavioral study revealed that Calliphora vicina (Robineau-Desvoidy) (Diptera: Calliphoridae) possesses a diel rhythm of oviposition in light under 12:12 light/dark conditions. Reversal to 12:12 dark/light resulted in oviposition behavior changing to align with the adjusted regime in most females, but four of 59 experimental females lacked a diel rhythm of oviposition (were arrhythmic). Real-time PCR was used to monitor the molecular expression levels of known circadian genes per and tim in C. vicina to determine whether gene expression and behavior correlated. As with behavior, reversing light/dark conditions changed rhythmic gene expression to align with an adjusted light regime. This suggests that although it is unlikely that C. vicina will colonize dead bodies at night, arrhythmic females and oviposition in the dark was demonstrated. © 2014 American Academy of Forensic Sciences.

"Listening Silence" and Its Discursive Effects

Science.gov (United States)

Applebaum, Barbara

2016-01-01

While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

Prediction of the diffuse-field transmission loss of interior natural-ventilation openings and silencers.

Science.gov (United States)

Bibby, Chris; Hodgson, Murray

2017-01-01

The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.

Use of artificial substrates of different colors for oviposition by the brown stink bug Euschistus heros (Hemiptera, Pentatomidae

Directory of Open Access Journals (Sweden)

Diones Krinski

2013-09-01

Full Text Available Aiming to contribute to a rearing methodology for the brown stink bug, Euschistus heros, in the laboratory, we evaluated oviposition on artificial substrates of different colors. During six days, oviposition was evaluated daily, by counting the total number of eggs, number of clutches, and eggs/clutch. Females laid 12,463 eggs, in 1,677 clutches, resulting in an average of 7.28 ± 0.44 eggs/clutch. Black, brown, and green felt had the most eggs and clutches. The results demonstrated that many colors are suitable as oviposition substrate for E. heros, providing information for the mass rearing of this insect.

Oviposition Preference for Young Plants by the Large Cabbage Butterfly (Pieris brassicae) Does not Strongly Correlate with Caterpillar Performance

NARCIS (Netherlands)

Fei, Minghui; Harvey, Jeffrey A.; Yin, Yi; Gols, Rieta

2017-01-01

The effects of temporal variation in the quality of short-lived annual plants on oviposition preference and larval performance of insect herbivores has thus far received little attention. This study examines the effects of plant age on female oviposition preference and offspring performance in the

Attraction, Oviposition Preferences, and Olfactory Responses of Corn-Infesting Ulidiidae (Diptera) to Various Host-Based Substrates.

Science.gov (United States)

Owens, D; Nuessly, G S; Kendra, P E; Colquhoun, T A; Seal, D R

2017-08-01

Fresh market sweet corn (Zea mays L., convar. saccharata var. rugosa, Poales: Poaceae) ears produced in Florida are damaged by the larvae of Euxesta stigmatias Loew, Euxesta eluta Loew, and Chaetopsis massyla Walker (Diptera: Ulidiidae) that renders ears unmarketable. No standard lure exists for monitoring these pests. Oviposition substrate and attractant bioassays were designed to identify attractive substrates for further semiochemical investigation. Frass from the fall armyworm, Spodoptera frugiperda J.E. Smith (Lepidoptera: Noctuidae), was more attractive than other ovipositional substrates tested for E. eluta and C. massyla, and resulted in greater ovipositional output. Tassel-derived armyworm frass was more attractive than leaf-derived frass for oviposition. Frass also resulted in greater oviposition output by two species. In attraction bioassays, frass was generally preferred over the corresponding corn tissue, and only C. massyla demonstrated a preference for silk-frass over tassel-frass. The most promising substrates were then evaluated by electroantennography (EAG) to quantify olfactory responses. Frass volatiles also elicited greater antennal responses than corn volatiles. With tassel-frass, greater amplitude EAG responses were recorded from immature E. eluta female antennae, while mature female E. stigmatias exhibited greater responses. Equivalent antennal response to silk-frass was observed from E. eluta. Overall, silk-frass elicited the greatest EAG responses among all three fly species. Our results indicate that armyworm frass is an important resource in the chemical ecology of corn-infesting silk flies, and this substrate warrants further investigation for potential attractants that may facilitate development of novel management tools for these pests. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Plastic pellets as oviposition site and means of dispersal for the ocean-skater insect Halobates.

Science.gov (United States)

Majer, A P; Vedolin, M C; Turra, A

2012-06-01

Microplastics are omnipresent in the oceans and generally have negative impacts on the biota. However, flotsam may increase the availability of hard substrates, which are considered a limiting resource for some oceanic species, e.g. as oviposition sites for the ocean insect Halobates. This study describes the use of plastic pellets as an oviposition site for Halobates micans and discusses possible effects on its abundance and dispersion. Inspection of egg masses on stranded particles on beaches revealed that a mean of 24% (from 0% to 62%) of the pellets bore eggs (mean of 5 and max. of 48 eggs per pellet). Most eggs (63%) contained embryos, while 37% were empty egg shells. This shows that even small plastic particles are used as oviposition site by H. micans, and that marine litter may have a positive effect over the abundance and dispersion of this species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Oviposition Decision of the Weevil Exapion ulicis on Ulex europaeus Depends on External and Internal Pod Cues

Directory of Open Access Journals (Sweden)

Jean-Sébastien Pierre

2013-09-01

Full Text Available Understanding mechanisms underlying insects’ host choice and plant susceptibility is important to the study of plant-insect interactions in general, and in the context of plant invasions. This study investigates the oviposition and feeding choices of the specialist weevil Exapion ulicis on the invasive plant species Ulex europaeus, gorse. To do so, we studied the oviposition and feeding preferences of the weevil in choice experiments, using pods and flowers, respectively, from gorses grown in a common garden. The plants used came from regions with different infestation histories: Brittany and Scotland belong to the native range, where the weevil is present, while Reunion and New Zealand belong to the invasive range, where the weevil was not initially introduced with gorse. Results of these experiments suggest that the oviposition choice of E. ulicis females is driven by cues located at the surface of pods and inside them, including pod size and pod seed content. Feeding-choice experiments showed a different pattern of preference compared to oviposition. Taken together with previous studies, our results reveal that E. ulicis uses several traits to choose its host, including whole-plant traits, flower traits and pod traits.

Oviposition behavior and performance aspects of Ascia monuste (Godart, 1919 (Lepidoptera, Pieridae on kale (Brassica oleracea var. acephala

Directory of Open Access Journals (Sweden)

Catta-Preta Patrícia Diniz

2003-01-01

Full Text Available Host part selection by ovipositing females of Ascia monuste (Godart, 1919 (Lepidoptera, Pieridae on kale (Brassica oleracea var. acephala was determined in greenhouse and field. Performance of offspring (larval period, efficiency of food utilization, number of eggs/female and others was investigated under laboratory conditions. In the field, the number of A. monuste egg clutches on the apical and medium parts of kale leaves was greater than on the basal part. In greenhouse, A. monuste exhibited a strong preference for the apical part of kale leaves for ovipositing. The best results on food utilization indices, pupal mass and female wing size were obtained with the leaf apical part. This part of kale leaves exhibited the highest nitrogen and protein concentration and the smallest water content, when compared to the other leaf parts. However, the apical part of the leaves seems not to provide ovipositing females with enough protection against birds, making them easy preys in the field. We suggest that good relationship between oviposition preference and performance of offspring was hindered by predation in field conditions.

A(maize)ing attraction: gravid Anopheles arabiensis are attracted and oviposit in response to maize pollen odours.

Science.gov (United States)

Wondwosen, Betelehem; Hill, Sharon R; Birgersson, Göran; Seyoum, Emiru; Tekie, Habte; Ignell, Rickard

2017-01-23

Maize cultivation contributes to the prevalence of malaria mosquitoes and exacerbates malaria transmission in sub-Saharan Africa. The pollen from maize serves as an important larval food source for Anopheles mosquitoes, and females that are able to detect breeding sites where maize pollen is abundant may provide their offspring with selective advantages. Anopheles mosquitoes are hypothesized to locate, discriminate among, and select such sites using olfactory cues, and that synthetic volatile blends can mimic these olfactory-guided behaviours. Two-port olfactometer and two-choice oviposition assays were used to assess the attraction and oviposition preference of gravid Anopheles arabiensis to the headspace of the pollen from two maize cultivars (BH-660 and ZM-521). Bioactive compounds were identified using combined gas chromatography and electroantennographic detection from the headspace of the cultivar found to be most attractive (BH-660). Synthetic blends of the volatile compounds were then assessed for attraction and oviposition preference of gravid An. arabiensis, as above. Here the collected headspace volatiles from the pollen of two maize cultivars was shown to differentially attract and stimulate oviposition in gravid An. arabiensis. Furthermore, a five-component synthetic maize pollen odour blend was identified, which elicited the full oviposition behavioural repertoire of the gravid mosquitoes. The cues identified from maize pollen provide important substrates for the development of novel control measures that modulate gravid female behaviour. Such measures are irrespective of indoor or outdoor feeding and resting patterns, thus providing a much-needed addition to the arsenal of tools that currently target indoor biting mosquitoes.

Oviposition preferences of two forensically important blow fly species, Chrysomya megacephala and C. rufifacies (Diptera: Calliphoridae), and implications for postmortem interval estimation.

Science.gov (United States)

Yang, Shih-Tsai; Shiao, Shiuh-Feng

2012-03-01

Necrophagous blow fly species (Diptera: Calliphoridae) are the most important agents for estimating the postmortem interval (PMI) in forensic entomology. Nevertheless, the oviposition preferences of blow flies may cause a bias of PMI estimations because of a delay or acceleration of egg laying. Chrysomya megacephala (F.) and C. rufifacies (Macquart) are two predominant necrophagous blow fly species in Taiwan. Their larvae undergo rather intense competition, and the latter one can prey on the former under natural conditions. To understand the oviposition preferences of these two species, a dual-choice device was used to test the choice of oviposition sites by females. Results showed when pork liver with and without larvae of C. rufifacies was provided, C. megacephala preferred to lay eggs on the liver without larvae. However, C. megacephala showed no preference when pork liver with and without conspecific larvae or larvae of Hemipyrellia ligurriens (Wiedemann) was provided. These results indicate that females of C. megacephala try to avoid laying eggs around larvae of facultatively predaceous species of C. rufifacies. However, C. rufifacies showed significant oviposition preference for pork liver with larvae of C. megacephala or conspecific ones when compared with pork liver with no larvae. These results probably imply that conspecific larvae or larvae of C. megacephala may potentially be alternative food resources for C. rufifacies, so that its females prefer to lay eggs in their presence. When considering the size of the oviposition media, pork livers of a relatively small size were obviously unfavorable to both species. This may be because females need to find sufficient resources to meet the food demands of their larvae. In another experiment, neither blow fly species showed an oviposition preference for pork livers of different stages of decay. In addition, the oviposition preferences of both species to those media with larvae were greatly disturbed in a dark

Influence of some plant extracts on the ovi-position behavior of Aedes fluviatilis and Culex quinquifasciatus

Directory of Open Access Journals (Sweden)

Abdulhakim A. El Maghrbi

2014-06-01

Full Text Available Alcoholic/acetone extracts of nine species of plants (Allium tuberosum, Apium leptophylum, Carica papaya, Cymbopogon citratus, Euphorbia cotinofolia, Melia azedarach, Ocimum canum, Ricinus communis and Tagetes erecta were tested in respect to their influence on the ovi-position behavior of the mosquito, Aedes fluviatilis and Culex quinquifasciatus in concentrations of 100, 10 and 1 mg/L. Three days after mosquito females had fed on blood of anesthetized mice and pigeon respectively, experimental and control dishes were placed into cages for 24 h then number of eggs laid in each dish was counted. Alcoholic/acetone extracts of C. papaya, C. citratus and T. erecta at 100 mg/L; E. cotinofolia and O. canum at 100 and 10 mg/L were proved to be repulsive for ovi-position of Ae. fluviatilis. On the other hand, acetone extracts of A. tuberosum and M. azederach at 100 and 10 mg/L; A. leptophyllum, O. canum, E. cotinofolia and R. communis at 100 mg/L produced same effect on ovi-position behavior of Ae. fluviatilis. Alcoholic extracts E. cotinofolia, R. communis (100 mg/L and M. azedarach (100 and 10 mg/L were attractive to Cx. quinquifasciatus. Five acetone extracts (A. tuberosum, A. leptophylum, C. papaya, C. Citrates and M. azedarach were repulsive for ovi-position at 100 mg/L. Acetone extract of A. tuberosum and M. azedarach at 10 and 1 mg/L and C. citratus at 10 mg/L maintained the same properties. Our results concluded that each plant extract has the potential to control ovi-position behavior of mosquito. The differences in obtained responses necessitate the adoption of deeper research to isolate the active principle of such plants for potential use in mosquito control program.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Oviposition Preference for Young Plants by the Large Cabbage Butterfly (Pieris brassicae ) Does not Strongly Correlate with Caterpillar Performance.

Science.gov (United States)

Fei, Minghui; Harvey, Jeffrey A; Yin, Yi; Gols, Rieta

2017-06-01

The effects of temporal variation in the quality of short-lived annual plants on oviposition preference and larval performance of insect herbivores has thus far received little attention. This study examines the effects of plant age on female oviposition preference and offspring performance in the large cabbage white butterfly Pieris brassicae. Adult female butterflies lay variable clusters of eggs on the underside of short-lived annual species in the family Brassicaceae, including the short-lived annuals Brassica nigra and Sinapis arvensis, which are important food plants for P. brassicae in The Netherlands. Here, we compared oviposition preference and larval performance of P. brassicae on three age classes (young, mature, and pre-senescing) of B. nigra and S. arvensis plants. Oviposition preference of P. brassicae declined with plant age in both plant species. Whereas larvae performed similarly on all three age classes in B. nigra, preference and performance were weakly correlated in S. arvensis. Analysis of primary (sugars and amino acids) and secondary (glucosinolates) chemistry in the plant shoots revealed that differences in their quality and quantity were more pronounced with respect to tissue type (leaves vs. flowers) than among different developmental stages of both plant species. Butterflies of P. brassicae may prefer younger and smaller plants for oviposition anticipating that future plant growth and size is optimally synchronized with the final larval instar, which contributes >80% of larval growth before pupation.

Oviposition efficacy of Drosophila suzukii (Diptera: Drosophilidae) on different cultivars of blueberry.

Science.gov (United States)

Kinjo, Hirotoshi; Kunimi, Yasuhisa; Ban, Takuya; Nakai, Madoka

2013-08-01

Drosophila suzukii (Matsumura) is an important pest of thin-skinned fruits including blueberry, raspberry, strawberry, and cherry. Blueberry was introduced into Japan in the 1950s, and severe economic losses attributable to D. suzukii were first reported in 2002. The objective of this study was to elucidate whether oviposition behavior varies among blueberry cultivars having different firmness of fruit. Fruit firmness in 12 cultivars of highbush blueberry (Vaccinium corymbosum L.) and rabbiteye blueberry (Vaccinium virgatum Aiton) was determined using a rheometer. More eggs tended to be laid in berries of cultivars possessing softer fruits than in those having firmer fruits. Choice tests, where one female was allowed to oviposit on blueberry fruits with different firmness, showed that softer fruits were more vulnerable to D. suzukii females than firmer fruits.

Effect of different oviposition media and number of matings on the mass rearing of the olive Fruit Fly Dacus Oleae Gmel. (Diptera Tephritidae)

International Nuclear Information System (INIS)

El-Moursy, A.A.; Roushdy, H.M.; Abdel-Rahman, A.M.; Ali, G.M.

1986-01-01

The highest average egg of female dacus oleae was obtained when the texwax domes m.p. 121 degree C were used together with G.G.M. as oviposition medium, whereas the lowest mean was obtained when the paraffin mixture domes used. Using the texwax domes as a new oviposition medium was superior to either the G.G.M.or the paraffin mixture. The optimum percent hatchability was recorded when the G.G.M., texwax and paraffin mixture were used together as oviposition media, where the lowest percent hatchability was recorded when the G.G.M. was used only as oviposition medium. The longest oviposition duration was recorded when using the G.G.M. whereas the shortest duration occurred when the paraffin mixture was used. The highest rate of egg production was obtained by the twice mated females, whereas the lowest rate was obtained by the virgin ones. Also the percent hatchability recorded was higher in case of the twice-mated females than in females mated once

Relationships of abscised cotton fruit to boll weevil (Coleoptera: Curculionidae) feeding, oviposition, and development.

Science.gov (United States)

Showler, Allan T

2008-02-01

Abscised cotton, Gossypium hirsutum L., fruit in field plots planted at different times were examined to assess adult boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), use of squares and bolls during 2002 and 2003 in the Lower Rio Grande Valley of Texas. Although boll abscission is not necessarily related to infestation, generally more bolls abscised than squares and abundances of fallen bolls were not related to the planting date treatments. During 2003, fallen squares were most abundant in the late-planted treatment. Although large squares (5.5-8-mm-diameter) on the plant are preferred for boll weevil oviposition, diameter of abscised squares is not a reliable measurement because of shrinkage resulting from desiccation and larval feeding. Fallen feeding-punctured squares and bolls were most abundant in late plantings but differences between fallen feeding-punctured squares versus fallen feeding-punctured bolls were found in only one treatment in 2003. During the same year, fallen oviposition-punctured squares were more numerous in the late-planted treatment than in the earlier treatments. Treatment effects were not found on numbers of oviposition-punctured bolls, but fallen oviposition-punctured squares were more common than bolls in the late-planted treatment compared with earlier treatments each year. Dead weevil eggs, larvae, and pupae inside fallen fruit were few and planting date treatment effects were not detected. Living third instars and pupae were more abundant in fallen squares of the late-planted treatment than in the earlier treatments and bolls of all three treatments. This study shows that fallen squares in late-planted cotton contribute more to adult boll weevil populations than bolls, or squares of earlier plantings.

Silêncios Silences

Directory of Open Access Journals (Sweden)

Luciano Marcondes Godoy

1999-01-01

Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

Voice and silence in organizations

Directory of Open Access Journals (Sweden)

Moaşa, H.

2011-01-01

Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

Feeding and oviposition deterrent activities of flower buds of globemallow,Sphaeralcea emoryi torrey, against boll weevil,Anthonomus grandis Boheman (Coleoptera: Curculionidae).

Science.gov (United States)

Honda, H; Bowers, W S

1996-01-01

The globemallow,Sphaeralcea emoryi Torrey, a plant native to Arizona was evaluated as a source of feeding or oviposition deterrents to the boll weevil,Anthonomus grandis Boheman. Feeding and oviposition responses of reproductive weevils to the flower buds and artificial diets spiked with dry powder or extracts of the globemallow buds were determined. Boll weevils were deterred from feeding and ovipositing in the flower buds unless the calyxes were removed. Male and virgin female weevils were discouraged from feeding as much as gravid weevils. Secondary chemicals in the flower buds served primarily as feeding deterrents but also prevented oviposition. The concentration of these chemicals was highest in the calyxes of the buds, and potent deterrent activity could be extracted from the calyxes with methanol. Boll weevils were able to perceive the deterrents by contact chemosensory organs on the antennae, maxillary palps and labial palps.

Effect of Population Density on Timing of Oviposition and Brood Size Reduction in the Burying Beetle Nicrophorus pustulatus Herschel (Coleoptera: Silphidae

Directory of Open Access Journals (Sweden)

Claudia M. Rauter

2012-01-01

Full Text Available Burying beetles (Nicrophorus spp. bury small carcasses to feed their larvae. Carcasses are a limited, high-quality resource and contests over carcasses become more frequent with increasing population density. Successful beetles kill eggs and larvae present on carcass. In response, females should accelerate oviposition, while offspring development should increase to minimize mortality. Both value of a carcass and frequency of contests decrease as larvae develop. If overproduction of offspring is an insurance against high mortality, females should reduce brood size as carcass value declines. Testing our predictions, we reared female burying beetles, Nicrophorus pustulatus, at high and low densities and compared oviposition and brood reduction. High-density females delayed oviposition, suggesting that high population density imposes nutritional and/or physiological stress. Females responded to the physiological constraints and the potentially high mortality rates of eggs and newly hatched larvae by lengthening oviposition period and changing brood reduction rate.

Optical silencing of C. elegans cells with arch proton pump.

Directory of Open Access Journals (Sweden)

Ayako Okazaki

Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.

The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

Science.gov (United States)

Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

2007-09-18

Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

The fission yeast ubiquitin-conjugating enzymes UbcP3, Ubc15, and Rhp6 affect transcriptional silencing of the mating-type region

DEFF Research Database (Denmark)

Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M

2002-01-01

Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

Silence, an Eye of Knowledge

Directory of Open Access Journals (Sweden)

Mehdi Aghamohammadi

2017-04-01

Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

Oviposition activity and seasonal pattern of a population of Aedes (Stegomyia aegypti (L. (Diptera: Culicidae in subtropical Argentina

Directory of Open Access Journals (Sweden)

Micieli María Victoria

2003-01-01

Full Text Available Monthly oviposition activity and the seasonal density pattern of Aedes aegypti were studied using larvitraps and ovitraps during a research carried out by the Public Health Ministry of Salta Province, in Tartagal, Aguaray and Salvador Mazza cities, in subtropical Argentina. The A. aegypti population was active in both dry and wet seasons with a peak in March, accordant with the heaviest rainfall. From May to November, the immature population level remained low, but increased in December. Ae. aegypti oviposition activity increased during the fall and summer, when the relative humidity was 60% or higher. Eggs were found in large numbers of ovitraps during all seasons but few eggs were observed in each one during winter. The occurrence and the number of eggs laid were variable when both seasons and cities were compared. The reduction of the population during the winter months was related to the low in the relative humidity of the atmosphere. Significant differences were detected between oviposition occurrences in Tartagal and Aguaray and Salvador Mazza cities, but no differences in the number of eggs were observed. Two factors characterize the seasonal distribution pattern of Ae. aegypti in subtropical Argentina, the absence of a break during winter and an oviposition activity concomitant of the high relative humidity of the atmosphere.

Ombuds’ corner: Employee silence

CERN Multimedia

Vincent Vuillemin

2013-01-01

Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

Food-plant niche selection rather than the presence of ant nests explains oviposition patterns in the myrmecophilous butterfly genus Maculinea.

Science.gov (United States)

Thomas, J A; Elmes, G W

2001-03-07

It has been suggested that the socially parasitic butterfly Maculinea alcon detects ant odours before ovipositing on initial larval food plants near colonies of its obligate ant host Myrmica ruginodis. It has also been suggested that overcrowding on food plants near M. ruginodis is avoided by an ability to detect high egg loads, resulting in a switch to selecting plants near less suitable ant species. If confirmed, this hypothesis (H1) would have serious implications for the application of current population models aimed at the conservation of endangered Maculinea species, which are based on the null hypothesis (H0) that females randomly select food plants whose flower buds are at a precise phenological stage, making oviposition independent of ants. If H1 were wrong, practical management based upon its assumptions could lead to the extinction of protected populations. We present data for the five European species of Maculinea which show that (i) each oviposits on a phenologically restricted flower-bud stage, which accounts for the apparent host-ant-mediated niche separation in sympatric populations of Maculinea nausithous and Maculinea teleius, (ii) there is no temporal shift in oviposition by Maculinea arion in relation to host ant distribution or egg density, and (iii) oviposition patterns in 13 populations of M. alcon's closest relative, Macaulinea rebeli, conform to H0 not H1 predictions. It is concluded that conservation measures should continue to be based on H0.

The silence.

Science.gov (United States)

Millenson, Michael L

2003-01-01

Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

Oviposition behaviour of the soil mite Pergamasus brevicornis (Acari: Parasitidae).

Science.gov (United States)

Marquardt, Tomasz; Faleńczyk-Koziróg, Katarzyna; Kaczmarek, Sławomir

2013-07-01

We observed the oviposition behaviour of the soil mite Pergamasus brevicornis Berlese (Acari: Parasitidae) using continuous video-monitoring. Oviposition consisted of six sequential phases. The first phase (I) involved inspection of the substrate. In the second phase (II) there were rhythmic movements of the first pair of legs and slight reciprocating movements of the body. The third (III) was a resting phase. In the fourth phase (IV) the gnathosoma was lowered and the body was raised. In the next phase (V) there were two sub-phases. During the first (Va), the female held the egg below the gnathosoma. In the second sub-phase (Vb), the gnathosoma moved up holding the egg, which was then placed on the substrate. The last phase (VI) involved intense 'cleaning' movements of the chelicerae and palps. During Va a protective external eggshell structure is gradually formed, involving a phase where the egg shell is sticky. After moving the egg to the substrate, the female freed her palps and chelicerae from the sticky egg shell and cleaned her gnathosomal appendages. Phases II-V took on average 207 ± 69 s.

Infestation Level Influences Oviposition Site Selection in the Tomato Leafminer Tuta absoluta (Lepidoptera: Gelechiidae

Directory of Open Access Journals (Sweden)

Thomas Bawin

2014-11-01

Full Text Available The tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae, is a devastating pest that develops principally on solanaceous plants throughout South and Central America and Europe. In this study, we tested the influence of three levels of T. absoluta infestations on the attraction and oviposition preference of adult T. absoluta. Three infestation levels (i.e., non-infested plants, plants infested with 10 T. absoluta larvae, and plants infested with 20 T. absoluta larvae were presented by pairs in a flying tunnel to groups of T. absoluta adults. We found no differences in terms of adult attraction for either level of infestations. However, female oviposition choice is influenced by larvae density on tomato plants. We discuss the underlying mechanisms and propose recommendations for further research.

Oviposition and egg quality traits of dwarf and naked neck layers ...

African Journals Online (AJOL)

Oviposition and egg quality traits were studied in dwarf and naked neck layers in Maputo (Mozambique) during a 28-d period at 35 weeks of age. Birds were caged individually in a laying house with natural light and ventilation. Average daylight length during the study was 11.2 hr and minimum and maximum temperature ...

Comparison of BG-Sentinel Trap and Oviposition Cups for Aedes aegypti and Aedes albopictus Surveillance in Jacksonville, Florida, USA

Science.gov (United States)

2015-03-01

COMPARISON OF BG-SENTINELH TRAP AND OVIPOSITION CUPS FOR AEDES AEGYPTI AND AEDES ALBOPICTUS SURVEILLANCE IN JACKSONVILLE, FLORIDA, USA JENNIFER A...trap and oviposition cups (OCs) have both proven effective in the surveillance of Aedes species. This study aimed to determine which of the 2 traps could...best characterize the relative population sizes of Aedes albopictus and Aedes aegypti in an urban section of Jacksonville, FL. Until 1986, Ae

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato

Science.gov (United States)

Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo

2016-12-01

Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.

On the origin of grasshopper oviposition behavior: structural homology in pregenital and genital motor systems.

Science.gov (United States)

Thompson, Karen J; Jones, Alaine D; Miller, Sandra A

2014-01-01

In female grasshoppers, oviposition is a highly specialized behavior involving a rhythm-generating neural circuit, the oviposition central pattern generator, unusual abdominal appendages, and dedicated muscles. This study of Schistocerca americana (Drury) grasshoppers was undertaken to determine whether the simpler pregenital abdominal segments, which do not contain ovipositor appendages, share common features with the genital segment, suggesting a roadmap for the genesis of oviposition behavior. Our study revealed that although 5 of the standard pregenital body wall muscles were missing in the female genital segment, homologous lateral nerves were, indeed, present and served 4 ovipositor muscles. Retrograde labeling of the corresponding pregenital nerve branches in male and female grasshoppers revealed motor neurons, dorsal unpaired median neurons, and common inhibitor neurons which appear to be structural homologues of those filled from ovipositor muscles. Some pregenital motor neurons displayed pronounced contralateral neurites; in contrast, some ovipositor motor neurons were exclusively ipsilateral. Strong evidence of structural homology was also obtained for pregenital and ovipositor skeletal muscles supplied by the identified neurons and of the pregenital and ovipositor skeletons. For example, transient embryonic segmental appendages were maintained in the female genital segments, giving rise to ovipositor valves, but were lost in pregenital abdominal segments. Significant proportional differences in sternal apodemes and plates were observed, which partially obscure the similarities between the pregenital and genital skeletons. Other changes in reorganization included genital muscles that displayed adult hypertrophy, 1 genital muscle that appeared to represent 2 fused pregenital muscles, and the insertion points of 2 ovipositor muscles that appeared to have been relocated. Together, the comparisons support the idea that the oviposition behavior of genital

[Oviposition, development, and reproduction of Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) fed on different hosts of economic importance].

Science.gov (United States)

Barros, Eduardo M; Torres, Jorge B; Bueno, Adeney F

2010-01-01

The host selection for oviposition by Spodoptera frugiperda (J.E. Smith) among corn, millet, cotton and soybean, and its relationship with the biological characteristics were investigated. Free and non-choice tests for oviposition using plots containing five plants each, from each host in plastic greenhouse, resulted in similar oviposition preference among the host plants. In addition, selected biological characteristics of S. frugiperda were determined in the laboratory with larvae feeding on host leaves, and the combination of leaf and cotton boll. Neonate larvae exhibited low success of colonization on cotton boll compared to the leaves of all other hosts. Spodoptera frugiperda fed only on cotton bolls exhibited longer larval and pupal development, and longer adult life span; however with similar egg production. Larvae fed cotton leaves during six days and then transferred to cotton bolls, however, exhibited development and reproduction similar to those reared on corn or only on cotton leaves. Therefore, the variations on immature stages of S. frugiperda were not related with host selection for oviposition which was similar among the studied hosts. Based on our data, the millet as a winter, rotational, and cover crop is a potential host for S. frugiperda, while leaves and cotton bolls were diets of intermediate suitability as compared to corn and soybean leaves.

Dispersal and oviposition of laboratory-reared gravid females of Toxorhynchites moctezuma in an arid urban area of Sonora, Mexico.

Science.gov (United States)

Macías-Duarte, Alberto; Alvarado-Castro, J Andrés; Dórame-Navarro, María E; Félix-Torres, A Amalia

2009-12-01

Dengue is a serious public health problem worldwide. Biological control of its vector, Aedes aegypti, remains a feasible option in light of increasing urbanization and insecticide resistance. We studied the dispersal and oviposition activity of Toxorhynchites moctezuma in a dengue-endemic urban area in SSonora, Mexico, to provide information about the potential of Toxorhynchites as a control agent for Ae. aegypti in arid areas. We released 210 and 100 laboratory-reared gravid females of Tx. moctezuma in 2 city blocks during the summer and fall of 1993. We set 3 1-liter containers and 1 car tire as sentinel traps at each of 10 backyards within each city block. Spatial and temporal patterns of dispersal and oviposition activity differed between city blocks and between releases. However, a Cox regression analysis showed no significant difference in the per-day probability of Tx. moctezuma oviposition events in sentinel traps between summer and fall releases. Per-day oviposition probability was nearly 5 times greater for sentineltraps that contained larvae of Ae. aegypti, suggesting a high specificity of the predator for its prey. The proportion of sentinel traps positive for Tx. moctezuma eggs did not increase substantially after the 8th day piost-release, reaching 66% and 23% for sentinel traps with and without Ae. aegypti larvae, respectively.

How parasitoid females produce sexy sons: a causal link between oviposition preference, dietary lipids and mate choice in Nasonia.

Science.gov (United States)

Blaul, Birgit; Ruther, Joachim

2011-11-07

Sexual selection theory predicts that phenotypic traits used to choose a mate should reflect honestly the quality of the sender and thus, are often costly. Physiological costs arise if a signal depends on limited nutritional resources. Hence, the nutritional condition of an organism should determine both its quality as a potential mate and its ability to advertise this quality to the choosing sex. In insects, the quality of the offspring's nutrition is often determined by the ovipositing female. A causal connection, however, between the oviposition decisions of the mother and the mating chances of her offspring has never been shown. Here, we demonstrate that females of the parasitic wasp Nasonia vitripennis prefer those hosts for oviposition that have been experimentally enriched in linoleic acid (LA). We show by (13)C-labelling that LA from the host diet is a precursor of the male sex pheromone. Consequently, males from LA-rich hosts produce and release higher amounts of the pheromone and attract more virgin females than males from LA-poor hosts. Finally, males from LA-rich hosts possess three times as many spermatozoa as those from LA-poor hosts. Hence, females making the right oviposition decisions may increase both the fertility and the sexual attractiveness of their sons.

Oviposition deterrent activities of Pachyrhizus erosus seed extract and other natural products on Plutella xylostella (Lepidoptera: Plutellidae).

Science.gov (United States)

Basukriadi, Adi; Wilkins, Richard M

2014-01-01

An extract of a rotenone-containing plant yam bean, Pachyrhizus erosus (L.) Urban, seeds was tested against the diamondback moth, Plutella xylostella (L.) in a greenhouse to determine its potential as an oviposition deterrent and compared with coumarin and rutin, known as diamondback moth oviposition deterrent compounds, rotenone, and an extract of Peruvian cube root, at a concentration of 0.5% (w/v). Oviposition deterrent index (ODI) was used to determine effects of extracts or compounds in inhibiting oviposition of diamondback moth. Coumarin showed a stronger deterrent effect than the yam bean seed extract with a higher ODI value. On the contrary, rotenone, rutin, and the cube root extract, containing 6.7% (w/w) of rotenone, showed no significant deterrent effects having low or negative ODI values, suggesting that the deterrent effect of the yam bean seed extract is not due to rotenone content of the yam bean seeds. The extract of yam bean seed and coumarin partially deterred the moth from laying eggs on treated leaves in a concentration-dependent manner. The effective concentration for 50% deterrency of coumarin and the yam bean seed extract were 0.11 and 0.83% (w/v), respectively. However, the yam bean seed extract showed a residual deterrent effect on the moth even at 3 d after the treatment and is probably because of its low volatile nature. A long-term deterrency of the yam bean seed extract is an advantage over coumarins. Both the yam bean seed extract and coumarin deterred diamondback moth from laying eggs in total darkness, indicating their nonvisual deterrent effect. This made the extract an effective deterrence to diamondback moth in light and in darkness. To conclude, this study revealed the potential of the crude extract of the yam bean seed to prevent diamondback moth from ovipositing on its plant host. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].

Science.gov (United States)

Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie

2012-12-01

To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.

How Silent is the Right to Silence?

Directory of Open Access Journals (Sweden)

Katherine Biber

2012-11-01

Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

Selection of oviposition sites by wild Anastrepha obliqua (Macquart) (Diptera: Tephritidae) based on the nutritional composition

Energy Technology Data Exchange (ETDEWEB)

Fontellas-Brandalha, Tania M.L.; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia]. E-mail: zucoloto@ffclrp.usp.br

2004-09-15

Few works have studied in detail the types of nutrients associated to hosts which are attractive to females of Anastrepha obliqua (Macquart) and influence the choice of the oviposition site. The relationship of the males in the physiology and in the behavior of those females has also been scarcely studied and some ecological relationships seem to be quite important for the knowledge of this species' biology. Our objective in this study was to evaluate the discriminatory behavior of A. obliqua between oviposition sites containing different nutrients. The presence of the male and the nutritional status of the female were also considered in this work. Two experiments were developed: in the first, the preference of A. obliqua females between artificial oviposition substrates was evaluated; in the second, females were submitted to two types of artificial oviposition substrates in the presence and in the absence of males and were fed either on a poor diet or on an adequate diet concerning sucrose concentration. In the first experiment, A. obliqua showed higher preference for substrates containing brewer's yeast and sucrose. Substrate containing only yeast was the second most accepted. Offspring development and adult feeding may have determined the choice for the substrate containing brewer's yeast and sucrose. In addition, the presence of protein in the brewer's yeast may indicate nutritional quality to the females in a more accurate way than the sucrose. In the second experiment, the brewer's yeast was the most accepted by the females. The male absence was also an important factor in the selection of hosts and in the egg production of A. obliqua. (author)

Selection of oviposition sites by wild Anastrepha obliqua (Macquart) (Diptera: Tephritidae) based on the nutritional composition

International Nuclear Information System (INIS)

Fontellas-Brandalha, Tania M.L.; Zucoloto, Fernando S.

2004-01-01

Few works have studied in detail the types of nutrients associated to hosts which are attractive to females of Anastrepha obliqua (Macquart) and influence the choice of the oviposition site. The relationship of the males in the physiology and in the behavior of those females has also been scarcely studied and some ecological relationships seem to be quite important for the knowledge of this species' biology. Our objective in this study was to evaluate the discriminatory behavior of A. obliqua between oviposition sites containing different nutrients. The presence of the male and the nutritional status of the female were also considered in this work. Two experiments were developed: in the first, the preference of A. obliqua females between artificial oviposition substrates was evaluated; in the second, females were submitted to two types of artificial oviposition substrates in the presence and in the absence of males and were fed either on a poor diet or on an adequate diet concerning sucrose concentration. In the first experiment, A. obliqua showed higher preference for substrates containing brewer's yeast and sucrose. Substrate containing only yeast was the second most accepted. Offspring development and adult feeding may have determined the choice for the substrate containing brewer's yeast and sucrose. In addition, the presence of protein in the brewer's yeast may indicate nutritional quality to the females in a more accurate way than the sucrose. In the second experiment, the brewer's yeast was the most accepted by the females. The male absence was also an important factor in the selection of hosts and in the egg production of A. obliqua. (author)

Influence of rain and malathion on the oviposition and development of blowflies (Diptera: Calliphoridae) infesting rabbit carcasses in Kelantan, Malaysia.

Science.gov (United States)

Mahat, N A; Zafarina, Z; Jayaprakash, P T

2009-11-20

The influence of rain and malathion on the initial oviposition as well as development of blowfly species infesting rabbit carcasses decomposing in sunlit and shaded habitats were studied over a period of 1 year in Kelantan, Malaysia. Chrysomya megacephala (Fabricius) was the most dominant species that infested the carcasses, followed by Chrysomya rufifacies (Macquart). In general, rain, depending on its intensity, delayed initial oviposition by 1-2 days and prolonged the pupation period by 1-3 days. The presence of malathion in the carcasses delayed initial oviposition by 1-3 days and prolonged the pupation period by 2-3 days. These findings deserve consideration while estimating postmortem interval since rain is a commonplace occurrence in Malaysia and malathion is one of the common poisons as an agent for choice to commit suicide.

Silencing cinema: film censorship around the world

OpenAIRE

Biltereyst, Daniël; Vande Winkel, Roel

2013-01-01

Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...

Judicial review of administrative silence

Directory of Open Access Journals (Sweden)

Radošević Ratko S.

2015-01-01

Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

Durability of timber silencers at Wairakei geothermal steam field

Energy Technology Data Exchange (ETDEWEB)

Hedley, M E

1979-02-01

After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

Different levels of shade on population of grasshoppers and its oviposition preference on heliconias

Directory of Open Access Journals (Sweden)

Ana Cristina Bittar

2018-02-01

Full Text Available ABSTRACT: Grasshoppers of the families Acrididae and Romaleidae (Orthoptera are among the insects that defoliate heliconias and have been gaining status as pests of commercial crops of these plants in Brazil. The objectives of the present study were to identify the grasshopper defoliating heliconias in the municipality of Santo Antônio de Pádua, RJ (Brazil, to evaluate the effect of different levels of shade on the population of this grasshopper and the production parameters of heliconias, and to determine if this grasshopper has an oviposition preference among the heliconias evaluated. The experiment was in a completely randomized block design, in subdivided plots (four levels of shade in the plot, 0%, 30%, 50% and 80%, and four species of Heliconia: H. psittacorum, H. stricta, H. wagneriana and H. psittacorum x H. spathocircinata ‘Golden Torch’ in the subplot, with four replications. The grasshopper was identified as Cornops frenatum frenatum (Acrididae. An increase in shade resulted in a decrease in the number of oviposition holes from the grasshopper and the number of lateral buds. Shade did not influence the number of C. f. frenatum nymphs and adults and the number of flower stems. H. wagneriana was the most preferred species for oviposition by C. f. frenatum. Results suggested using screens to shade heliconia plants can help control C. f. frenatum populations, however, the light requirements of the heliconias should be considered to guarantee productivity.

Methyl salicylate production in tomato affects biotic interactions.

Science.gov (United States)

Ament, Kai; Krasikov, Vladimir; Allmann, Silke; Rep, Martijn; Takken, Frank L W; Schuurink, Robert C

2010-04-01

The role of methyl salicylate (MeSA) production was studied in indirect and direct defence responses of tomato (Solanum lycopersicum) to the spider mite Tetranychus urticae and the root-invading fungus Fusarium oxysporum f. sp. lycopersici, respectively. To this end, we silenced the tomato gene encoding salicylic acid methyl transferase (SAMT). Silencing of SAMT led to a major reduction in SAMT expression and MeSA emission upon herbivory by spider mites, without affecting the induced emission of other volatiles (terpenoids). The predatory mite Phytoseiulus persimilis, which preys on T. urticae, could not discriminate between infested and non-infested SAMT-silenced lines, as it could for wild-type tomato plants. Moreover, when given the choice between infested SAMT-silenced and infested wild-type plants, they preferred the latter. These findings are supportive of a major role for MeSA in this indirect defence response of tomato. SAMT-silenced tomato plants were less susceptible to a virulent strain of F. oxysporum f. sp. lycopersici, indicating that the direct defense responses in the roots are also affected in these plants. Our studies show that the conversion of SA to MeSA can affect both direct and indirect plant defence responses.

Temperature studies with the Asian citrus psyllid, Diaphorina citri: cold hardiness and temperature thresholds for oviposition.

Science.gov (United States)

Hall, David G; Wenninger, Erik J; Hentz, Matthew G

2011-01-01

This study was conducted to obtain information on the cold hardiness of the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), in Florida and to assess upper and lower temperature thresholds for oviposition. The psyllid is an important pest in citrus because it transmits the bacterial pathogens responsible for citrus greening disease, Huanglongbing, considered the most serious citrus disease worldwide. D. citri was first found in Florida during 1998, and the disease was discovered during 2005. Little was known regarding cold hardiness of D. citri, but Florida citrus is occasionally subjected to notable freeze events. Temperature and duration were each significant sources of variation in percent mortality of D. citri subjected to freeze events. Relatively large percentages of adults and nymphs survived after being exposed for several hours to temperatures as low as -5 to -6 °C. Relatively large percentages of eggs hatched after being exposed for several hours to temperatures as low as -8 °C. Research results indicated that adult D. citri become cold acclimated during the winter through exposure to cooler winter temperatures. There was no evidence that eggs became cold acclimated during winter. Cold acclimation in nymphs was not investigated. Research with adult D. citri from laboratory and greenhouse colonies revealed that mild to moderate freeze events were usually nonlethal to the D. citri irrespective of whether they were cold acclimated or not. Upper and lower temperature thresholds for oviposition were investigated because such information may be valuable in explaining the geographic distribution and potential spread of the pest from Florida as well as how cooler winter temperatures might limit population growth. The estimated lower and upper thresholds for oviposition were 16.0 and 41.6 °C, respectively; the estimated temperature of peak oviposition over a 48 h period was 29.6 °C.

Synchronized oviposition triggered by migratory flight intensifies larval outbreaks of beet webworm.

Directory of Open Access Journals (Sweden)

Yun Xia Cheng

Full Text Available Identifying the reproductive consequences of insect migration is critical to understanding its ecological and evolutionary significance. However, many empirical studies are seemingly contradictory, making recognition of unifying themes elusive and controversial. The beet webworm, Loxostege sticticalis L. is a long-range migratory pest of many crops in the northern temperate zone from 36 °N to 55 °N, with larval populations often exploding in regions receiving immigrants. In laboratory experiments, we examined (i the reproductive costs of migratory flight by tethered flight, and (ii the reproductive traits contributing to larval outbreaks of immigrant populations. Our results suggest that the beet webworm does not initiate migratory flight until the 2nd or 3rd night after emergence. Preoviposition period, lifetime fecundity, mating capacity, and egg hatch rate for adults that experienced prolonged flight after the 2nd night did not differ significantly from unflown moths, suggesting these traits are irrelevant to the severity of beet webworm outbreaks after migration. However, the period of first oviposition, a novel parameter developed in this paper measuring synchrony of first egg-laying by cohorts of post-migratory females, for moths flown on d 3 and 5 of adulthood was shorter than that of unflown moths, indicating a tightened time-window for onset of oviposition after migration. The resulting synchrony of egg-laying will serve to increase egg and subsequent larval densities. A dense population offers potential selective advantages to the individual larvae comprising it, whereas the effect from the human standpoint is intensification of damage by an outbreak population. The strategy of synchronized oviposition may be common in other migratory insect pests, such as locust and armyworm species, and warrants further study.

Ovipositional Deterrence of Methanolic and Etherial Extracts of Five Plants to the Cowpea Bruchid, Callosobruchus maculatus (F. (Coleoptera: Bruchidae

Directory of Open Access Journals (Sweden)

E.A. Elhag

1999-06-01

Full Text Available Methanol and diethyl ether extracts of Harmal, Rhazya stricta Decne.; neem seed kernels, Azadirachta indica A.Juss; cloves, Syzygeum aromarticum (L.; citrus peel and Ramram, Heliotropium bacciferum (Forssk- were evaluated for their deterrence to oviposition by Callosobruchus maculatus (F. on chickpeas in choice tests. Both extracts of all materials significantly reduced oviposition on treated seeds. Maximum deterrent effects (91.8% were obtained in the neem seed methanol extract at 0.5% concentration, citrus peel O. l% ether extract (90.9%, R stricta 0.5% methanol extract (83.9%, and clove 0. 1% ether extract (80.0%. Methanol extracts of neem seeds and R. stricta evoked higher deterrent effects than their etherial extracts, whereas the responses for cloves and citrus peel were more pronounced in their ether extracts. H. bacirferum % deterrency due to both types of extracts were practically identical. The results encourage future incorporation of such plant extracts as ovipositional deterrents in stored-product lPM programmes.

Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

Science.gov (United States)

Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

2015-01-01

The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

The tale of two buckets and associated containers: impact on aedes albopictus oviposition

Science.gov (United States)

Aedes albopictus is an invasive species. Its oviposition behavior is the subject of several projects in our research unit. The main emphasis of this presentation is a study which utilizes two five gallon buckets, one heated and one with ambient temperature. The heat is provided by an aquarium hea...

Breaching cultural silence: enhancing resilience among Ugandan ...

African Journals Online (AJOL)

Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

The Role of Silence at the Retreats of a Buddhist Community

Directory of Open Access Journals (Sweden)

Orsolya Huszár

2016-12-01

Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.

Organizational Silence in Sports Employees

Science.gov (United States)

Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

2016-01-01

Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

The effects of sedative music, arousal music, and silence on electrocardiography signals.

Science.gov (United States)

Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid

2011-01-01

Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.

Heat dosage and oviposition depth influence egg mortality of two common rangeland grasshopper species

Science.gov (United States)

Rangeland fire is a common naturally occurring event and management tool, with the amount and structure of biomass controlling transfer of heat belowground. Temperatures grasshopper eggs are exposed to during rangeland fires are mediated by species specific oviposition traits. This experiment examin...

Volatiles of grape inoculated with microorganisms: modulation of grapevine moth oviposition and field attraction

Science.gov (United States)

Semiochemicals released by plant-microbe associations are used by herbivorous insects to access and evaluate food resources and oviposition sites. Adult insects may utilize microbial-derived nutrients to prolong their lifespan, promote egg development and offer a high nutritional substrate to their ...

Calcium signalling silencing in atrial fibrillation.

Science.gov (United States)

Greiser, Maura

2017-06-15

Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

The effect of relatedness on the response of Adalia bipunctata L. to oviposition deterring cues

Czech Academy of Sciences Publication Activity Database

Martini, X.; Dixon, Anthony F. G.; Hemptinne, J. L.

2013-01-01

Roč. 103, č. 1 (2013), s. 14-19 ISSN 0007-4853 Institutional support: RVO:67179843 Keywords : Coccinellidae * relatedness * kin * larval tracks * oviposition deterring pheromone Subject RIV: EH - Ecology, Behaviour Impact factor: 1.895, year: 2013

Silence, an Eye of Knowledge

Science.gov (United States)

Aghamohammadi, Mehdi

2017-01-01

One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

Oviposition of Quesada gigas in weed no hostess: implication in pest management

Directory of Open Access Journals (Sweden)

Douglas Henrique Bottura Maccagnan

Full Text Available ABSTRACT: This study recorded the choice of dry plant of Conyza spp as oviposition site by cicada Quesada gigas (Olivier, 1790. We presented issues of natural history of the cicadas that indicate the inability of immatures to complete life cycle in this species of plant. Some implications on cultures where Q. gigas has economic importance are also discussed.

Avoidance of host resistance in the oviposition-site preferences of rose bitterling

Czech Academy of Sciences Publication Activity Database

Rouchet, Romain; Smith, Carl; Liu, H.; Methling, Caroline; Douda, K.; Yu, D.; Tang, Q.; Reichard, Martin

2017-01-01

Roč. 31, č. 5 (2017), s. 769-783 ISSN 0269-7653 R&D Projects: GA ČR GA13-05872S Institutional support: RVO:68081766 Keywords : Brood parasitism * Coevolutionary dynamic * Egg ejection * Host selection * Oviposition choice * Parasite specialisation Subject RIV: EG - Zoology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 1.818, year: 2016

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Variation in the Volatile Profiles of Black and Manchurian Ash in Relation to Emerald Ash Borer Oviposition Preferences.

Science.gov (United States)

Rigsby, Chad M; McCartney, Nathaniel B; Herms, Daniel A; Tumlinson, James H; Cipollini, Don

2017-08-01

Emerald ash borer (EAB; Agrilus planipennis) is a devastating pest of ash (Fraxinus spp.) in its invaded range in North America. Its coevolved Asian hosts are more resistant and less preferred for oviposition than susceptible North American species. We compared EAB oviposition preferences and bark and canopy volatile organic compound (VOC) emissions of resistant Manchurian ash and susceptible black ash, and examined relationships between VOC profiles and oviposition. In the field, black ash was highly preferred for oviposition while no eggs were laid on Manchurian ash, and we found clear differences in the VOC profiles of Manchurian and black ash. We detected 78 compounds emitted from these species, including 16 compounds that elicited EAB antennal activity in prior studies. Four compounds were unique to black and 11 to Manchurian ash. Emission rates of 14 canopy and 19 bark volatiles varied among the two species, including four previously reported as antennally active. Specifically, 7-epi-sesquithujene (bark) emissions were greater from black ash, while β-caryophyllene (canopy), linalool (bark), and α-cubebene (bark) were emitted at higher rates by Manchurian ash. No relationships were found between the emission rate of any single compound or group of compounds (e.g. monoterpenes) suggesting that preference may be based on complex profile combinations. This is the first study to directly compare VOCs of black and Manchurian ash as well as the first to examine bark- and canopy-specific VOCs. The unique bark and canopy VOC profiles of these two species implicates potentially important variation in VOCs between a closely related resistant and susceptible species that provides a foundation for future studies of host preferences of EAB.

Deceptive female oviposition behaviour elicits male ejaculation in the European bitterling

Czech Academy of Sciences Publication Activity Database

Smith, C.; Zhu, Y.; Liu, H.; Reichard, Martin

2007-01-01

Roč. 71, č. 6 (2007), s. 1841-1846 ISSN 0022-1112 R&D Projects: GA AV ČR KJB600930501 Grant - others:The Leverhulme Trust(GB) NSFC 30470237 Institutional research plan: CEZ:AV0Z60930519 Keywords : mating tactics * pre-oviposition ejaculation * signal evolution * sneaking sperm competition Subject RIV: EH - Ecology, Behaviour Impact factor: 1.404, year: 2007 http://www.blackwell-synergy.com/doi/pdf/10.1111/j.1095-8649.2007.01624.x

Chinanteco children’s silences in different classroom situations

Directory of Open Access Journals (Sweden)

Valeria Rebolledo Angulo

2016-01-01

Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Influence of container size, location, and time of day on oviposition patterns of the dengue vector, Aedes aegypti, in Thailand.

Science.gov (United States)

Harrington, L C; Ponlawat, A; Edman, J D; Scott, T W; Vermeylen, F

2008-06-01

We conducted a study to determine the effect of container size and location on oviposition site selection by Ae. aegypti in large outdoor field enclosures (10 x 10 x 4 m high). There was a strong positive relationship between increasing container diameter, container volume, and water surface area with egg numbers over both high (rainy, July) and low (cool-dry, January) dengue transmission seasons. Location of containers (indoors versus immediately outdoors and underneath houses) did not influence the number of eggs deposited for containers 5-32 cm in diameter in either season. No trends based on container color (black, brown, or grey) were observed. A slight trend with a greater numbers of eggs laid outdoors in the largest containers (42 cm diameter) during the dry season was observed. Three separate models were run using the mixed model procedure in SAS for each container attribute. Controlling for season, time, and date, the most important container attribute predicting total egg numbers was container volume (total capacity) explaining 88% of the variation, followed by water surface area (85%), and container diameter opening (83%). Oviposition peaked in the afternoon at 1600 hrs and 2000 hrs in the dry and rainy seasons, respectively. Few eggs were laid overnight (2000 hrs-0600 hrs). Our results indicate that physical attributes of oviposition sites, such as size, light-dark contrasts, and specular reflectance from water surfaces, play a significant role in oviposition site selection.

Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

Science.gov (United States)

Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

Larvicidal, ovicidal, and oviposition-deterrent activities of four plant extracts against three mosquito species.

Science.gov (United States)

Prathibha, K P; Raghavendra, B S; Vijayan, V A

2014-05-01

In mosquito control programs, insecticides of botanical origin have the potential to eliminate eggs, larvae, and adults. So, the larvicidal, ovicidal, and oviposition-deterrent activities of petroleum ether and ethyl acetate extracts of the leaves of Eugenia jambolana, Solidago canadensis, Euodia ridleyi, and Spilanthes mauritiana were assayed against the three vector mosquito species, namely Anopheles stephensi, Aedes aegypti, and Culex quinquefasciatus. The larval bioassay was conducted following the World Health Organization method. The maximum larval mortality was found with ethyl acetate extract of S. mauritiana against the larvae of A. stephensi, A. aegypti, and C. quinquefasciatus with LC50 values of 11.51, 28.1, 14.10 ppm, respectively. The mean percent hatchability of the ovicidal activity was observed at 48-h post-treatment. The percent hatchability was found to be inversely proportional to the concentration of the extract and directly proportional to the number of eggs. The flower head extract of S. mauritiana gave 100% mortality followed by E. ridleyi, S. canadensis, and E. jambolana against the eggs of the three mosquito vectors. For oviposition-deterrent effect, out of the five concentrations tested (20, 40, 60, 80, and 100 ppm), the concentration of 100 ppm showed a significant egg laying-deterrent capacity. The oviposition activity index value of E. jambolana, E. ridleyi, S. canadensis, and S. mauritiana against A. aegypti, A. stephensi, C. quinquefasciatus at 100 ppm were -0.71, -0.71, -0.90, -0.93, -0.85, -0.91, -1, -1, -0.71, -0.85, -1, and -1, respectively. These results suggest that the leaf/flower extracts of certain local plants have the potential to be developed as possible eco-friendly means for the control of mosquitoes.

(E-Caryophyllene and α-Humulene: Aedes aegypti Oviposition Deterrents Elucidated by Gas Chromatography-Electrophysiological Assay of Commiphora leptophloeos Leaf Oil.

Directory of Open Access Journals (Sweden)

Rayane Cristine Santos da Silva

Full Text Available Aedes aegypti is responsible for the transmission of dengue, a disease that infects millions of people each year. Although essential oils are well recognized as sources of compounds with repellent and larvicidal activities against the dengue mosquito, much less is known about their oviposition deterrent effects. Commiphora leptophloeos, a tree native to South America, has important pharmacological properties, but the chemical profile and applicability of its essential oil in controlling the spread of the dengue mosquito have not been investigated. The aim of this study was to determine the composition of C. leptophloeos leaf oil and to evaluate its larvicidal and oviposition deterrent effects against A. aegypti. Fifty-five components of the essential oil were detected by gas chromatography (GC-mass spectrometry, with α-phellandrene (26.3%, (E-caryophyllene (18.0% and β-phellandrene (12.9% identified as the major constituents. Bioassays showed that the oil exhibited strong oviposition deterrent effects against A. aegypti at concentrations between 25 and 100 ppm, and possessed good larvicidal activity (LC50 = 99.4 ppm. Analysis of the oil by GC coupled with electroantennographic detection established that seven constituents could trigger antennal depolarization in A. aegypti gravid females. Two of these components, namely (E-caryophyllene and α-humulene, were present in substantial proportions in the oil, and oviposition deterrence assays confirmed that both were significantly active at concentrations equivalent to those present in the oil. It is concluded that these sesquiterpenes are responsible, at least in part, for the deterrent effect of the oil. The oviposition deterrent activity of the leaf oil of C. leptophloeos is one of the most potent reported so far, suggesting that it could represent an interesting alternative to synthetic insecticides. The results of this study highlight the importance of integrating chemical and

Choosing Silence for Equality in and through Schooling

Science.gov (United States)

Lees, Helen E.

2016-01-01

This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

Egg-laying by the butterfly Iphiclides podalirius (Lepidoptera, Papilionidae on alien plants: a broadening of host range or oviposition mistakes?

Directory of Open Access Journals (Sweden)

Stefanescu, C.

2006-06-01

Full Text Available Iphiclides podalirius is an oligophagous butterfly which feeds on plants of the Rosaceae family. In 2002 and 2005 in NE Spain, we recorded for the first time oviposition on two alien plant species, Cotoneaster franchetii and Spiraea cantoniensis. To ascertain if this unusual behaviour represents a broadening of host range or, alternatively, an oviposition mistake, larval performance on the new plants was investigated in the laboratory and compared with performance on the most common host plants used in the study area. Although larval performance on common hosts differed to some extent, the use of a wide range of plants of different quality at population level may in fact respond to the so-called “spreading of risk” strategy in variable environments. On the other hand, larval performance and survival to adulthood were so low on the two new hosts that our observations probably represent a case of maladaptive oviposition behaviour. This may be due to an evolutionary lag between the newly introduced plants and the insect, although other possible explanations are also taken into account.

The Shadow of Silence on the Sexual Rights of Married Iranian Women

Directory of Open Access Journals (Sweden)

Roksana Janghorban

2015-01-01

Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.

Occurrence of Toxorhynchites guadeloupensis (Dyar and Knab) in oviposition trap of Aedes aegypti (L.) (Diptera: Culicidae)

International Nuclear Information System (INIS)

Honorio, Nildimar A.

2007-01-01

Toxorhynchites guadeloupensis (Dyar and Knab), a poorly known mosquito species, was observed preying upon Aedes aegypti (L.) larvae, in an oviposition trap placed for routine dengue entomological surveillance, during 2003-2004 in the urban area of Boa Vista, Roraima, Brazil. This is the first report for Tx. guadeloupensis using Ae. aegypti oviposition traps as breeding places. This finding may have important consequences in the epidemiology and local dengue control since Ae. aegypti density is a basic variable in dengue prediction. Whether predation of Ae aegypti by Tx. guadeloupensis in the Amazon is of significance, is a question to be examined. Also, larval predation may be a cause for underestimation of the actual Ae aegypti numbers. Together these hypotheses need to be better investigated as they are directly related to dengue epidemiology, to the success of any outbreak prediction and surveillance program. (author)

Occurrence of Toxorhynchites guadeloupensis (Dyar and Knab) in oviposition trap of Aedes aegypti (L.) (Diptera: Culicidae)

Energy Technology Data Exchange (ETDEWEB)

Honorio, Nildimar A. [Instituto Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Entomologia. Lab. de Transmissores de Hematozoarios; Barros, Fabio S.M. de [Universidade Federal de Roraima (UFRR), Boa Vista, RR (Brazil). Centro de Ciencias Biologicas e da Saude. Nucleo Avancado de Vetores; Tsouris, Pantelis; Rosa-Freitas, Maria G. [Freitas and Tsouris Consultants, Spata-Attikis (Greece)]. E-mail: maria@freitas-tsouris.com

2007-09-15

Toxorhynchites guadeloupensis (Dyar and Knab), a poorly known mosquito species, was observed preying upon Aedes aegypti (L.) larvae, in an oviposition trap placed for routine dengue entomological surveillance, during 2003-2004 in the urban area of Boa Vista, Roraima, Brazil. This is the first report for Tx. guadeloupensis using Ae. aegypti oviposition traps as breeding places. This finding may have important consequences in the epidemiology and local dengue control since Ae. aegypti density is a basic variable in dengue prediction. Whether predation of Ae aegypti by Tx. guadeloupensis in the Amazon is of significance, is a question to be examined. Also, larval predation may be a cause for underestimation of the actual Ae aegypti numbers. Together these hypotheses need to be better investigated as they are directly related to dengue epidemiology, to the success of any outbreak prediction and surveillance program. (author)

Effects of covering highland banana stumps with soil on banana weevil Cosmopolites sordidus (Coleoptera: Curculionidae) oviposition

NARCIS (Netherlands)

Masanza, M.; Gold, C.S.; Huis, van A.; Ragama, P.E.

2005-01-01

The effect of covering post-harvest banana stumps with soil on banana weevil Cosmopolites sordidus (Germar) oviposition levels was investigated at three locations, Sendusu, Kawanda Agricultural Research Institute (KARI) and Ntungamo district of southwestern Uganda. In the first experiment

[E. M. Jellinek's silenced and silencing transgenerational story].

Science.gov (United States)

Kelemen, Gábor; Márk, Mónika

2013-01-01

Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

Directory of Open Access Journals (Sweden)

Đerić Gordana

2007-01-01

Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Phenetic distances in the Drosophila melanogaster-subgroup species and oviposition-site preference for food components

NARCIS (Netherlands)

Bos, M.; Boerema, A.

1981-01-01

Oviposition-site preferences (O.S.P.) have been investigated in females of six sibling species of the Drosophila melanogaster subgroup. O.S.P. were determined for standard food components and yeast genotypes. Females of all species showed a strong preference for complete medium and avoidance of pure

Listen and the question of silence

DEFF Research Database (Denmark)

Doubinsky, Sebastien

2018-01-01

Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

The ethics of silence: Does conflict of interest explain employee silence?

Science.gov (United States)

Anderson, James

2018-03-01

Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

Silence as a Response to Everyday Violence

DEFF Research Database (Denmark)

Gammeltoft, Tine

2016-01-01

Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Breaking an epigenetic chromatin switch: curious features of hysteresis in Saccharomyces cerevisiae telomeric silencing.

Directory of Open Access Journals (Sweden)

Vijayalakshmi H Nagaraj

Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.

Oviposition behavior of the silver leaf whitefly Bemisia tabaci biotype B on tomato; Comportamento de oviposicao da mosca-branca Bemisia tabaci (Genn.) (Hemiptera: Aleyrodidae) biotipo B em tomateiro

Energy Technology Data Exchange (ETDEWEB)

Vendramim, Jose D. [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ). Dept. de Entomologia, Fitopatologia e Zoologia Agricola]. E-mail: jdvendra@esalq.usp.br; Souza, Antonio P. de [Universidade Federal de Mato Grosso do Sul (UFMS), Campo Grande, MS (Brazil). Dept. de Morfofisiologia. Lab. de Anatomia Humana]. E-mail: apsouza@nin.ufms.br; Ongarelli, Maria das G. [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ). Lab. de Fisiologia e Bioquimica Pos-Colheita]. E-mail: mgong@esalq.usp.br

2009-01-15

The objective of this work was to evaluate the influence of the leaf surface, the insect geotropic behavior and the type of foliar trichome on Bemisia tabaci (Genn.) biotype B oviposition on tomato leaves. Bemisia tabaci females were confined in acrylic boxes in which tomato leaflets were fixed at the bottom and top part of the boxes to allow insects to access the leaf surface to be tested (adaxial and/or abaxial) in both no-choice and free choice tests. Oviposition was always higher when the leaf was offered at the top of the box and preferably at the abaxial leaf surface. The effects of leaf trichomes (glandular and non glandular) on B. tabaci oviposition was evaluated by offering the abaxial surface of tomato leaflets to females after a 70% ethanol wash to remove glandular exsudates against a control treatment (without a ethanol wash). Oviposition was concentrated mostly near to non glandular trichomes, showing whitefly females can discriminate among the trichomes. (author)

Attraction, oviposition preferences, and olfactory responses of corn-infesting Ulidiidae (Diptera) to various host-based substrates

Science.gov (United States)

Fresh market sweet corn produced in Florida is threatened by larval damage by Euxesta stigmatias Loew, E. eluta Loew, and Chaetopsis massyla Walker (Diptera: Ulidiidae) that renders ears unmarketable. No standard lure exists for monitoring these pests. Oviposition and attraction bioassays were desig...

Mutuality, Self-Silencing, and Disordered Eating in College Women

Science.gov (United States)

Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

2006-01-01

The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

After the Blackbird Whistles: Listening to Silence in Classrooms

Science.gov (United States)

Schultz, Katherine

2010-01-01

Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

Memories Persist in Silence

Directory of Open Access Journals (Sweden)

Sandra Patricia Arenas Grisales

2012-08-01

Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

Silencing of PINK1 expression affects mitochondrial DNA and oxidative phosphorylation in dopaminergic cells.

Directory of Open Access Journals (Sweden)

Matthew E Gegg

Full Text Available Mitochondrial dysfunction has been implicated in the pathogenesis of Parkinson's disease (PD. Impairment of the mitochondrial electron transport chain (ETC and an increased frequency in deletions of mitochondrial DNA (mtDNA, which encodes some of the subunits of the ETC, have been reported in the substantia nigra of PD brains. The identification of mutations in the PINK1 gene, which cause an autosomal recessive form of PD, has supported mitochondrial involvement in PD. The PINK1 protein is a serine/threonine kinase localized in mitochondria and the cytosol. Its precise function is unknown, but it is involved in neuroprotection against a variety of stress signalling pathways.In this report we have investigated the effect of silencing PINK1 expression in human dopaminergic SH-SY5Y cells by siRNA on mtDNA synthesis and ETC function. Loss of PINK1 expression resulted in a decrease in mtDNA levels and mtDNA synthesis. We also report a concomitant loss of mitochondrial membrane potential and decreased mitochondrial ATP synthesis, with the activity of complex IV of the ETC most affected. This mitochondrial dysfunction resulted in increased markers of oxidative stress under basal conditions and increased cell death following treatment with the free radical generator paraquat.This report highlights a novel function of PINK1 in mitochondrial biogenesis and a role in maintaining mitochondrial ETC activity. Dysfunction of both has been implicated in sporadic forms of PD suggesting that these may be key pathways in the development of the disease.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Organizational Silence in Universities as the Predictor of Organizational Culture

Directory of Open Access Journals (Sweden)

Erkan YAMAN

2014-04-01

Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.

Science.gov (United States)

Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2010-06-01

Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Ability of a Generalist Seed Beetle to Colonize an Exotic Host: Effects of Host Plant Origin and Oviposition Host.

Science.gov (United States)

Amarillo-Suárez, A; Repizo, A; Robles, J; Diaz, J; Bustamante, S

2017-08-01

The colonization of an exotic species by native herbivores is more likely to occur if that herbivore is a generalist. There is little information on the life-history mechanisms used by native generalist insects to colonize exotic hosts and how these mechanisms are affected by host properties. We examined the ability of the generalist seed beetle Stator limbatus Horn to colonize an exotic species. We compared its host preference, acceptability, performance, and egg size when ovipositing and developing on two native (Pithecellobium dulce (Roxb.) Benth and Senegalia riparia (Kunth)) and one exotic legume species (Leucaena leucocephala (Lam.)). We also analyzed the seed chemistry. We found that females recognize the exotic species as an unfavorable host for larval development and that they delayed oviposition and laid fewer and larger eggs on the exotic species than on the native species. Survivorship on the exotic host was 0%. Additionally, seeds of the native species contain five chemical compounds that are absent in the exotic species, and the exotic species contains three sterols, which are absent in the native legumes. Genetically based differences between beetles adapted to different hosts, plastic responses toward new hosts, and chemical differences among seeds are important in host colonization and recognition of the exotic host. In conclusion, the generalist nature of S. limbatus does not influence its ability to colonize L. leucocephala. Explanations for the colonization of exotic hosts by generalist native species and for the success of invasive species must be complemented with studies measuring local adaptation and plasticity.

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

Science.gov (United States)

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

Science.gov (United States)

Ussher, Jane M.; Perz, Janette

2010-01-01

This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

The physics of chromatin silencing: Bi-stability and front propagation

Science.gov (United States)

Sedighi, Mohammad

A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

Directory of Open Access Journals (Sweden)

Ruilin Wang

Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

Science.gov (United States)

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

An empirical analysis on influencing factors on organizational silence and its relationship with employee’s organizational commitment

Directory of Open Access Journals (Sweden)

Belal Panahi

2012-04-01

Full Text Available Today, there is no doubt that in many organizations, many employees refuse to provide their opinions and comments about the organizational problems. In fact, in many organizations there is a created climate, which often makes employees feel their opinion is not valued. This phenomenon is examined as an organizational silence that by identifying the factors affecting on it we can effectively take steps to eliminate barriers to commenting staff in organizations. In this regard, this paper presents an empirical work conducted on data obtained from 260 employees Payame Noor University of East Azerbaijan Province. These data are analyzed by SPSS software and regression and path analysis tests. The results showed that there is a significant relationship between silence climate dimensions and employee organizational commitment with silence behavior employee. In addition, there is a positive correlation between higher management attitudes and supervisor’s attitudes with workers silent behavior. We have also observed that there is a negative correlation between communication opportunities and organizational commitment with employee silence behavior of employees.

Control of thermoacoustic instability with a drum-like silencer

Science.gov (United States)

Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

2017-10-01

Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

Spatial distribution of oviposition sites determines variance in the reproductive rate of European bitterling (Rhodeus amarus)

Czech Academy of Sciences Publication Activity Database

Przybylski, M.; Reichard, Martin; Spence, R.; Smith, C.

2007-01-01

Roč. 144, č. 11 (2007), s. 1403-1417 ISSN 0005-7959 R&D Projects: GA AV ČR KJB600930501 Institutional research plan: CEZ:AV0Z60930519 Keywords : mating system * opportunity for selection * oviposition * sexual selection Subject RIV: EG - Zoology Impact factor: 1.604, year: 2007

Significance of bacteria in oviposition and larval development of the sand fly Lutzomyia longipalpis

Science.gov (United States)

2012-01-01

contrast to that of Bacillus spp. (76 days, 36.0 %). From the complex natural bacterial community of rabbit feces, R. radiobacter survived pupation and colonized the newly emerged females most successfully (82.6 % of all bacteria cultured); however, only 25 % of females were positive for bacteria in the digestive tract upon emergence. Immunohistochemistry did not reveal any obvious differences in anatomy of the digestive tract between control and axenic larvae. Conclusions The bacterial community in the sand fly larval habitat affects oviposition and larval development although bacteria are not essential for successful development of L. longipalpis. Different bacteria contribute to larval development to various degrees and some, e.g. Rhizobium radiobacter, survive pupation and colonize the digestive tract of newly emerged females. With the establishment of the axenic rearing system, this study opens new venues to study the effect of bacteria on the gut epithelial immunity and vector competence of sand flies for Leishmania parasites with a goal to develop paratransgenic approaches for Leishmania control. PMID:22827861

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

No-Big-Silence teeb klubituuri / Urmas Hännile

Index Scriptorium Estoniae

Hännile, Urmas

2009-01-01

Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

Breaking the silence

DEFF Research Database (Denmark)

Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

2012-01-01

and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

Toward a science of silence: The consequences of leaving a memory unsaid

DEFF Research Database (Denmark)

Stone, Charles; Coman, Alin; Brown, Adam

2012-01-01

of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

Crystal and solution structures of an odorant-binding protein from the southern house mosquito complexed with an oviposition pheromone

Energy Technology Data Exchange (ETDEWEB)

Mao, Yang; Xu, Xianzhong; Xu, Wei; Ishida, Yuko; Leal, Walter S.; Ames, James B.; Clardy, Jon (Harvard-Med); (UCD)

2010-11-15

Culex mosquitoes introduce the pathogens responsible for filariasis, West Nile virus, St. Louis encephalitis, and other diseases into humans. Currently, traps baited with oviposition semiochemicals play an important role in detection efforts and could provide an environmentally friendly approach to controlling their populations. The odorant binding proteins (OBPs) in the female's antenna play a crucial, if yet imperfectly understood, role in sensing oviposition cues. Here, we report the X-ray crystallography and NMR 3D structures of OBP1 for Culex quinquefasciatus (CquiOBP1) bound to an oviposition pheromone (5R,6S)-6-acetoxy-5-hexadecanolide (MOP). In both studies, CquiOBP1 had the same overall six-helix structure seen in other insect OBPs, but a detailed analysis revealed an important previously undescribed feature. There are two models for OBP-mediated signal transduction: (i) direct release of the pheromone from an internal binding pocket in a pH-dependent fashion and (ii) detection of a pheromone-induced conformational change in the OBP {center_dot} pheromone complex. Although CquiOBP1 binds MOP in a pH-dependent fashion, it lacks the C terminus required for the pH-dependent release model. This study shows that CquiOBP binds MOP in an unprecedented fashion using both a small central cavity for the lactone head group and a long hydrophobic channel for its tail.

Electric nets and sticky materials for analysing oviposition behaviour of gravid malaria vectors

Directory of Open Access Journals (Sweden)

Dugassa Sisay

2012-11-01

Full Text Available Abstract Background Little is known about how malaria mosquitoes locate oviposition sites in nature. Such knowledge is important to help devise monitoring and control measures that could be used to target gravid females. This study set out to develop a suite of tools that can be used to study the attraction of gravid Anopheles gambiae s.s. towards visual or olfactory cues associated with aquatic habitats. Methods Firstly, the study developed and assessed methods for using electrocuting nets to analyse the orientation of gravid females towards an aquatic habitat. Electric nets (1m high × 0.5m wide were powered by a 12V battery via a spark box. High and low energy settings were compared for mosquito electrocution and a collection device developed to retain electrocuted mosquitoes when falling to the ground. Secondly, a range of sticky materials and a detergent were tested to quantify if and where gravid females land to lay their eggs, by treating the edge of the ponds and the water surface. A randomized complete block design was used for all experiments with 200 mosquitoes released each day. Experiments were conducted in screened semi-field systems using insectary-reared An. gambiae s.s. Data were analysed by generalized estimating equations. Results An electric net operated at the highest spark box energy of a 400 volt direct current made the net spark, creating a crackling sound, a burst of light and a burning smell. This setting caught 64% less mosquitoes than a net powered by reduced voltage output that could neither be heard nor seen (odds ratio (OR 0.46; 95% confidence interval (CI 0.40-0.53, p Conclusion A square of four e-nets with yellow sticky boards as a collection device can be used for quantifying the numbers of mosquitoes approaching a small oviposition site. Shiny sticky surfaces attract gravid females possibly because they are visually mistaken as aquatic habitats. These materials might be developed further as gravid traps

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2004-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2005-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2006-01-01

...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

Longevidade e oviposição de Ophyra albuquerquei (Diptera, Muscidae em condições de laboratório Longevity and oviposition of Ophyra albuquerquei (Diptera, Muscidae under laboratory conditions

Directory of Open Access Journals (Sweden)

Rodrigo F. Krüger

2004-06-01

Full Text Available Aspects related to the longevity and oviposition of Ophyra albuquerquei Lopes, 1985 are studied. Males had a mean lifespan longer than females (40.24 vs. 33.15 days, respectively, while still possessing qualitative advantages during this period. Females O. albuquerquei were fed on powdered milk, fish flour, refined sugar and water, and provided fish flour and moistened sawdust for oviposition. The length of the oviposition period for females was 46.75 days, and most of the deposition of the eggs occurred in the first days of the colony. Females completed 50% of their egg deposition by Day 16, seven days before the large last mortality peak and about 12 days after the first oviposition in the colony. Females deposited an average of 184 eggs per individual. Mortality of males, unlike females, was low until the 28th day, and increased thereafter. It was demonstrated that it is possible to maintain colonies of this species under laboratory conditions for at least 28 days with high fertility and low cost.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

Acceptance and preference of fruits for oviposition in two Ceratitis capitata (Diptera, Tephritidae) populations

OpenAIRE

Joachim-Bravo, Iara Sordi; Silva-Neto, Alberto Moreira da

2004-01-01

The influence of four host fruits, orange (Citrus sinensis L.), papaya (Carica papaya L.), mango (Mangifera indica L.) and apple (Malus domestica Borkh) on oviposition behavior of Ceratitis capitata (Wiedemann, 1824) was evaluated. Experiments were carried out on two C. capitata laboratory-reared populations: one with artificial diet for 10 years with periodic introduction of wild flies and other reared with artificial diet for 20 years without wild flies introduction. In acceptance experimen...

Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

Science.gov (United States)

Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

2016-10-01

Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Sampling gravid Culex quinquefasciatus (Diptera: Culicidae) in Tanzania with traps baited with synthetic oviposition pheromone and grass infusions

NARCIS (Netherlands)

Mboera, L.E.G.; Takken, W.; Mdira, K.Y.; Pickett, J.A.

2000-01-01

The effectiveness of traps baited with (5R,6S)-6-acetoxy-5-hexadecanolide (the synthetic oviposition pheromone) and grass infusions in sampling a population of gravid Culex quinquefasciatus Say was conducted in Muheza, Northeast Tanzania. A counterflow geometry (CFG) trap baited with pheromone and

The potential attractant or repellent effects of different water types on oviposition in Aedes aegypti L. (Dipt., Culicidae)

NARCIS (Netherlands)

Navarro, D.M.A.F.; Oliveira, de P.E.S.; Potting, R.P.J.; Brito, A.C.; Fital, S.J.F.; Goulart Sant Ana, A.E.

2003-01-01

The selection of oviposition sites by the yellow-fever mosquito, Aedes aegypti , was studied in the laboratory. The repellent or attractant effects of salinity and the presence of bacteria in water collected from a local community on the Brazilian coast were investigated. Water contaminated with

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

The organisational silence of midwives and nurses: reasons and results.

Science.gov (United States)

Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

2016-07-01

The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

Maternal influences on early development: preferred temperature prior to oviposition hastens embryogenesis and enhances offspring traits in the Children's python, Antaresia childreni.

Science.gov (United States)

Lorioux, Sophie; DeNardo, Dale F; Gorelick, Root; Lourdais, Olivier

2012-04-15

Embryonic life is particularly sensitive to its surroundings, and the developmental environment can have long-lasting effects on offspring. In oviparous species, the impacts of the developmental environment on offspring traits are mostly examined during development within the egg. However, as more than 25% of the development of squamate reptiles can occur prior to oviposition, we explored the effect of thermal conditions on development prior to oviposition in an oviparous snake species, the Children's python (Antaresia childreni). We housed gravid female pythons under three thermal cycles: an optimal regime that reflected maternal preference in a non-constrained environment (constant preferred body temperature of gravid females, T(set)=31.5°C) and two mildly suboptimal regimes that shared the same mean temperature of 27.7°C, but differed in the duration at T(set). In one of the constraining regimes, females had access to T(set) for 4 h daily whereas in the other regime, females never reached T(set) (maximal temperature of 29.0°C). Thermal treatments were maintained throughout gravidity in all three groups, but, after oviposition, all eggs were incubated at T(set) until hatching. Compared with the optimal regime, the two suboptimal regimes had a longer duration of gravidity, which resulted in delayed hatching. Between the two suboptimal regimes, gravidity was significantly shorter in the treatment that included time at T(set). Furthermore, suboptimal regimes influenced offspring traits at hatching, including body morphology, antipredator behavior, strength and metabolism. However, partial access to maternal T(set) significantly enhanced several offspring traits, including performance. Our results demonstrate the importance of time at T(set) on early development and suggest an adaptive significance of maternal thermoregulation prior to oviposition.

Silencing criticism in Mexico

Directory of Open Access Journals (Sweden)

Ximena Suárez

2017-10-01

Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

Development and oviposition preference of house flies and stable flies (Diptera: Muscidae) in six substrates from Florida equine facilities

Science.gov (United States)

House flies, Musca domestica L., and stable flies, Stomoxys calcitrans (L.), (Diptera: Muscidae), common pests on equine facilities, were studied in the laboratory to determine their oviposition preferences and larval development on six substrates commonly found on equine facilities. The substrates...

Mediation of oviposition site selection in the African malaria mosquito Anopheles gambiae (Diptera: Culicidae) by semiochemicals of microbial origin

NARCIS (Netherlands)

Sumba, L.A.; Guda, T.O.; Deng, A.L.; Hassanali, A.; Beier, J.C.; Knols, B.G.J.

2004-01-01

Laboratory studies were carried out to investigate the role of larval habitat-derived microorganisms in the production of semiochemicals for oviposition site selection by Anopheles gambiae Giles sensu stricto mosquitoes. Dual-choice bioassays with gravid females were conducted in standard mosquito

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Gated audiovisual speech identification in silence vs. noise: effects on time and accuracy

Science.gov (United States)

Moradi, Shahram; Lidestam, Björn; Rönnberg, Jerker

2013-01-01

This study investigated the degree to which audiovisual presentation (compared to auditory-only presentation) affected isolation point (IPs, the amount of time required for the correct identification of speech stimuli using a gating paradigm) in silence and noise conditions. The study expanded on the findings of Moradi et al. (under revision), using the same stimuli, but presented in an audiovisual instead of an auditory-only manner. The results showed that noise impeded the identification of consonants and words (i.e., delayed IPs and lowered accuracy), but not the identification of final words in sentences. In comparison with the previous study by Moradi et al., it can be concluded that the provision of visual cues expedited IPs and increased the accuracy of speech stimuli identification in both silence and noise. The implication of the results is discussed in terms of models for speech understanding. PMID:23801980

Use of statistical models based on radiographic measurements to predict oviposition date and clutch size in rock iguanas (Cyclura nubila)

International Nuclear Information System (INIS)

Alberts, A.C.

1995-01-01

The ability to noninvasively estimate clutch size and predict oviposition date in reptiles can be useful not only to veterinary clinicians but also to managers of captive collections and field researchers. Measurements of egg size and shape, as well as position of the clutch within the coelomic cavity, were taken from diagnostic radiographs of 20 female Cuban rock iguanas, Cyclura nubila, 81 to 18 days prior to laying. Combined with data on maternal body size, these variables were entered into multiple regression models to predict clutch size and timing of egg laying. The model for clutch size was accurate to 0.53 ± 0.08 eggs, while the model for oviposition date was accurate to 6.22 ± 0.81 days. Equations were generated that should be applicable to this and other large Cyclura species. © 1995 Wiley-Liss, Inc

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans

OpenAIRE

Takahashi, Megumi; Takagi, Shin

2017-01-01

Feeding, a vital behavior in animals, is modulated depending on internal and external factors. In the nematode Caenorhabditis elegans, the feeding organ called the pharynx ingests food by pumping driven by the pharyngeal muscles. Here we report that optical silencing of the body wall muscles, which drive the locomotory movement of worms, affects pumping. In worms expressing the Arch proton pump or the ACR2 anion channel in the body wall muscle cells, the pumping rate decreases after activatio...

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

Directory of Open Access Journals (Sweden)

Dawn Llewellyn

2016-06-01

Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

Bodies, Spaces, Voices, Silences

Directory of Open Access Journals (Sweden)

Donatella Mazzoleni

2013-07-01

Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Diversity of mosquitoes and the aquatic insects associated with their oviposition sites along the Pacific coast of Mexico.

Science.gov (United States)

Bond, J Guillermo; Casas-Martínez, Mauricio; Quiroz-Martínez, Humberto; Novelo-Gutiérrez, Rodolfo; Marina, Carlos F; Ulloa, Armando; Orozco-Bonilla, Arnoldo; Muñoz, Miguel; Williams, Trevor

2014-01-22

The abundance, richness and diversity of mosquitoes and aquatic insects associated with their oviposition sites were surveyed along eight states of the Pacific coast of Mexico. Diversity was estimated using the Shannon index (H'), similarity measures and cluster analysis. Oviposition sites were sampled during 2-3 months per year, over a three year period. Field collected larvae and pupae were reared and identified to species following adult emergence. Aquatic insects present at oviposition sites were also collected, counted and identified to species or genus. In total, 15 genera and 74 species of mosquitoes were identified: Anopheles pseudopunctipennis, An. albimanus and Aedes aegypti were the most abundant and widely-distributed species, representing 47% of total mosquito individuals sampled. New species records for certain states are reported. Anopheline diversity was lowest in Sinaloa state (H' = 0.54) and highest in Chiapas (H' = 1.61) and Michoacán (H' = 1.56), whereas culicid diversity was lowest in Michoacán (H' = 1.93), Colima (H' = 1.95), Sinaloa (H' = 1.99) and Jalisco (H' = 2.01) and highest in Chiapas (H' = 2.66). In total, 10 orders, 57 families, 166 genera and 247 species of aquatic insects were identified in samples. Aquatic insect diversity was highest in Chiapas, Oaxaca and Michoacán (H' = 3.60-3.75). Mosquito larval/pupal abundance was not correlated with that of predatory Coleoptera and Hemiptera. This represents the first update on the diversity and geographic distribution of the mosquitoes and aquatic insects of Mexico in over five decades. This information has been cataloged in Mexico's National Biodiversity Information System (SNIB-CONABIO) for public inspection.

Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

International Nuclear Information System (INIS)

Liu Xiaoqun; Qiao Tiankui

2014-01-01

Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

Effect of alternative prey on development and consumption of Orius insidiosus (Say) (Hemiptera, Anthocoridae) and oviposition behavior on chrysantemum cultivars

International Nuclear Information System (INIS)

Soglia, Maria da Conceicao M.; Bueno, Vanda Helena Paes; Carvalho, Livia Mendes

2007-01-01

This work aimed to evaluate the development time and the consumption of Orius insidiosus (Say, 1832) feeding on Aphis gossypii Glover, 1877 as well as its oviposition behavior on two chrysanthemum cut cultivars. The trials were conducted in climatic chamber at 25 ± 1 deg C, RH 70 ± 10% and 12h photo phase. Nymphs of the predator, less than 24h old, were kept individually in petri dishes (5cm) with 20 nymphs of A. gossypii (first, second and third instar) on leaf disc (4 cm) of each cultivar ('White Reagan' and 'Yellow Snowdon') in a layer of agar-water (1%). Petiole of each chrysanthemum cultivar as oviposition substrate was evaluated and the females were feeding on eggs of Anagasta kuehniella (Zeller, 1879). The predator complete its development feeding on A. gossypii kept in both cultivars. The duration of nymphal phase of O. insidiosus were 21.1 and 18.3 days on 'White Reagan' and 'Yellow Snowdon', respectively. The consumption of the females of O. insidiosus was higher (P<0.01) on A. gossypii in 'White Reagan' (2.63 nymphs) compared to the consumption in 'Yellow Snowdon' (0.7 nymphs). Females of O. insidiosus oviposited in petiole of both cultivars with 22.5 and 23.3 eggs/female on 'White Reagan' and 'Yellow Snowdon', respectively. Release of O. insidiosus on chrysanthemum crops could be important to decrease the A. gossypii population, as the predator completes its development having this aphid as prey, and the chrysanthemum cultivars offer conditions to colonization and establishment of O. insidiosus. (author)

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

Science.gov (United States)

Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

2015-10-02

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

Directory of Open Access Journals (Sweden)

Michael Gary Duncan

2012-03-01

Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

Science.gov (United States)

Suhor, Charles

1991-01-01

Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

OpenAIRE

Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

2011-01-01

Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

Assessment of patch quality by aphidophagous ladybirds: Laboratory study on the minimum density of aphids required for oviposition

Czech Academy of Sciences Publication Activity Database

Das, B. C.; Dixon, Anthony F. G.

2011-01-01

Roč. 1, č. 1 (2011), s. 57-60 ISSN 1805-0174 R&D Projects: GA MŠk LC06073; GA MŠk(CZ) ED1.1.00/02.0073 Institutional research plan: CEZ:AV0Z60870520 Keywords : Adalia bipunctata * Aphididae * arrestant * Coccinellidae * cues for oviposition * honeydew * minimum aphid density * patch quality * predator Subject RIV: EH - Ecology, Behaviour

Marie Nimier, au cœur du silence

Directory of Open Access Journals (Sweden)

Joëlle Papillon

2012-01-01

Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

Sex differences in the responses to oviposition site cues by a fish revealed by tests with an artificial host

Czech Academy of Sciences Publication Activity Database

Phillips, A.; Reichard, Martin; Smith, Carl

2017-01-01

Roč. 126, April (2017), s. 187-194 ISSN 0003-3472 R&D Projects: GA ČR GA13-05872S Institutional support: RVO:68081766 Keywords : maternal effect * mussel * oviposition site cue * reproduction * Rhodeus * sexual conflict Subject RIV: EG - Zoology OBOR OECD: Behavioral sciences biology Impact factor: 2.869, year: 2016

Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

Directory of Open Access Journals (Sweden)

Saeedeh Shafiee Nahrkhalaji

2013-05-01

Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

Communicative Silences: Forms and Functions

Science.gov (United States)

Bruneau, Thomas J.

1973-01-01

The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

Propensity for Bistability of Bursting and Silence in the Leech Heart Interneuron

Directory of Open Access Journals (Sweden)

Tatiana Dashevskiy

2018-02-01

Full Text Available The coexistence of neuronal activity regimes has been reported under normal and pathological conditions. Such multistability could enhance the flexibility of the nervous system and has many implications for motor control, memory, and decision making. Multistability is commonly promoted by neuromodulation targeting specific membrane ionic currents. Here, we investigated how modulation of different ionic currents could affect the neuronal propensity for bistability. We considered a leech heart interneuron model. It exhibits bistability of bursting and silence in a narrow range of the leak current parameters, conductance (gleak and reversal potential (Eleak. We assessed the propensity for bistability of the model by using bifurcation diagrams. On the diagram (gleak, Eleak, we mapped bursting and silent regimes. For the canonical value of Eleak we determined the range of gleak which supported the bistability. We use this range as an index of propensity for bistability. We investigated how this index was affected by alterations of ionic currents. We systematically changed their conductances, one at a time, and built corresponding bifurcation diagrams in parameter planes of the maximal conductance of a given current and the leak conductance. We found that conductance of only one current substantially affected the index of propensity; the increase of the maximal conductance of the hyperpolarization-activated cationic current increased the propensity index. The second conductance with the strongest effect was the conductance of the low-threshold fast Ca2+ current; its reduction increased the propensity index although the effect was about two times smaller in magnitude. Analyzing the model with both changes applied simultaneously, we found that the diagram (gleak, Eleak showed a progressively expanded area of bistability of bursting and silence.

ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

Directory of Open Access Journals (Sweden)

Berta Bekti Retnawati

2016-11-01

Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

The Gift of Silence

Science.gov (United States)

Haskins, Cathleen

2011-01-01

Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

Directory of Open Access Journals (Sweden)

Amelia Peral Crespo

2015-11-01

Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

Acquired Smell? Mature Females of the Common Green Bottle Fly Shift Semiochemical Preferences from Feces Feeding Sites to Carrion Oviposition Sites.

Science.gov (United States)

Brodie, Bekka S; Babcock, Tamara; Gries, Regine; Benn, Arlan; Gries, Gerhard

2016-01-01

We investigated foraging decisions by adult females of the common green bottle fly, Lucilia sericata, in accordance with their physiological state. When we gave female flies a choice between visually occluded, fresh canine feces (feeding site) and a CO2-euthanized rat (carrion oviposition site), 3-d-old "protein-starved" females responded equally well to feces and carrion, whereas protein-fed gravid females with mature oocytes responded only to carrion, indicating resource preferences based on a fly's physiological state. Dimethyl trisulfide (DMTS) is known to attract gravid L. sericata females to carrion. Therefore, we analyzed headspace from canine feces by gas chromatographic-electroantennographic detection (GC-EAD) and GC/mass spectrometry. In bioassays, of the 17 fecal odorants that elicited GC-EAD responses from fly antennae, a blend of indole and one or more of the alcohols phenol, m-/p-cresol and 1-octen-3-ol proved as attractive to flies as canine feces. Unlike young females, gravid females need to locate carrion for oviposition and distinguish between fresh and aging carrion, the latter possibly detrimental to offspring. Gravid female L. sericata accomplish this task, in part, by responding to trace amounts of DMTS emanating from fresh carrion and by discriminating against carrion as soon it begins to produce appreciable amounts of indole, which is also the second-most abundant semiochemical in fresh canine feces, and apparently serves as an indicator of food rather than oviposition resources. Our results emphasize the importance of studying foraging choices by flies in accordance with their physiological stage.

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

Science.gov (United States)

Shouse, Sarah H.; Nilsson, Johanna

2011-01-01

Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

Directory of Open Access Journals (Sweden)

José Luis Arráez Llobregat

2015-11-01

Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Oviposition punctures in cucurbit fruits and their economic damage caused by the sterile female melon fly, Bactrocera cucurbitae Coquillett

International Nuclear Information System (INIS)

Miyatake, T.; Irabu, T.; Higa, R.

1993-01-01

Oviposition punctures caused by sterile females of the tephritid Bactrocera cucurbitae in cucurbit fruits were examined and economic damage was evaluated in Okinawa, Ryukyu Archipelago, Japan. Cage experiments in the field confirmed that sterile females make punctures (sterile stings) on fruits. The features of sterile stings differed depending on fruit species and were classified into 5 types

Precedents and consequences of prosocial behaviors of voice and silence

Directory of Open Access Journals (Sweden)

Alicia Omar

2015-09-01

Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

Insect attraction versus plant defense: young leaves high in glucosinolates stimulate oviposition by a specialist herbivore despite poor larval survival due to high saponin content.

Directory of Open Access Journals (Sweden)

Francisco R Badenes-Perez

Full Text Available Glucosinolates are plant secondary metabolites used in plant defense. For insects specialized on Brassicaceae, such as the diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae, glucosinolates act as "fingerprints" that are essential in host plant recognition. Some plants in the genus Barbarea (Brassicaceae contain, besides glucosinolates, saponins that act as feeding deterrents for P. xylostella larvae, preventing their survival on the plant. Two-choice oviposition tests were conducted to study the preference of P. xylostella among Barbarea leaves of different size within the same plant. P. xylostella laid more eggs per leaf area on younger leaves compared to older ones. Higher concentrations of glucosinolates and saponins were found in younger leaves than in older ones. In 4-week-old plants, saponins were present in true leaves, while cotyledons contained little or no saponins. When analyzing the whole foliage of the plant, the content of glucosinolates and saponins also varied significantly in comparisons among plants that were 4, 8, and 12 weeks old. In Barbarea plants and leaves of different ages, there was a positive correlation between glucosinolate and saponin levels. This research shows that, in Barbarea plants, ontogenetical changes in glucosinolate and saponin content affect both attraction and resistance to P. xylostella. Co-occurrence of a high content of glucosinolates and saponins in the Barbarea leaves that are most valuable for the plant, but are also the most attractive to P. xylostella, provides protection against this specialist herbivore, which oviposition behavior on Barbarea seems to be an evolutionary mistake.

Insect Attraction versus Plant Defense: Young Leaves High in Glucosinolates Stimulate Oviposition by a Specialist Herbivore despite Poor Larval Survival due to High Saponin Content

Science.gov (United States)

Badenes-Perez, Francisco R.; Gershenzon, Jonathan; Heckel, David G.

2014-01-01

Glucosinolates are plant secondary metabolites used in plant defense. For insects specialized on Brassicaceae, such as the diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), glucosinolates act as “fingerprints” that are essential in host plant recognition. Some plants in the genus Barbarea (Brassicaceae) contain, besides glucosinolates, saponins that act as feeding deterrents for P. xylostella larvae, preventing their survival on the plant. Two-choice oviposition tests were conducted to study the preference of P. xylostella among Barbarea leaves of different size within the same plant. P. xylostella laid more eggs per leaf area on younger leaves compared to older ones. Higher concentrations of glucosinolates and saponins were found in younger leaves than in older ones. In 4-week-old plants, saponins were present in true leaves, while cotyledons contained little or no saponins. When analyzing the whole foliage of the plant, the content of glucosinolates and saponins also varied significantly in comparisons among plants that were 4, 8, and 12 weeks old. In Barbarea plants and leaves of different ages, there was a positive correlation between glucosinolate and saponin levels. This research shows that, in Barbarea plants, ontogenetical changes in glucosinolate and saponin content affect both attraction and resistance to P. xylostella. Co-occurrence of a high content of glucosinolates and saponins in the Barbarea leaves that are most valuable for the plant, but are also the most attractive to P. xylostella, provides protection against this specialist herbivore, which oviposition behavior on Barbarea seems to be an evolutionary mistake. PMID:24752069

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Gas turbine exhaust system silencing design

International Nuclear Information System (INIS)

Ozgur, D.

1991-01-01

Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

Identification of leaf volatiles from olive (Olea europaea) and their possible role in the ovipositional preferences of olive fly, Bactrocera oleae (Rossi) (Diptera: Tephritidae).

Science.gov (United States)

Malheiro, Ricardo; Casal, Susana; Cunha, Sara C; Baptista, Paula; Pereira, José Alberto

2016-01-01

The olive fly, Bactrocera oleae (Rossi), is a monophagous pest that displays an oviposition preference among cultivars of olive (Olea europaea L.). To clarify the oviposition preference, the olive leaf volatiles of three olive cultivars (Cobrançosa, Madural and Verdeal Transmontana) were assessed by headspace solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC/MS) at six different periods of olive fruit maturation and degrees of infestation. A total of 39 volatiles were identified, mainly esters and alcohols, with a minor percentage of aldehydes, ketones and terpenic compounds, including sesquiterpenes. At sampling dates with higher degrees of infestation, cv. Cobrançosa had, simultaneously, significantly lower infestation degrees and higher volatile amounts than the other two cultivars, with a probable deterrent effect for oviposition. The green leaf volatiles (GLVs) (Z)-3-hexen-1-ol and (Z)-3-hexen-1-ol acetate) were the main compounds identified in all cultivars, together with toluene. The abundance of GLVs decreased significantly throughout maturation, without significant differences among cultivars, while toluene showed a general increase and positive correlation with olive fly infestation levels. The results obtained could broaden our understanding of the roles of various types and amounts of olive volatiles in the environment, especially in olive fly host selection and cultivar preference. Copyright © 2015 Elsevier Ltd. All rights reserved.

Inbreeding in horsenettle (Solanum carolinense) alters night-time volatile emissions that guide oviposition by Manduca sexta moths.

Science.gov (United States)

Kariyat, Rupesh R; Mauck, Kerry E; Balogh, Christopher M; Stephenson, Andrew G; Mescher, Mark C; De Moraes, Consuelo M

2013-04-22

Plant volatiles serve as key foraging and oviposition cues for insect herbivores as well as their natural enemies, but little is known about how genetic variation within plant populations influences volatile-mediated interactions among plants and insects. Here, we explore how inbred and outbred plants from three maternal families of the native weed horsenettle (Solanum carolinense) vary in the emission of volatile organic compounds during the dark phase of the photoperiod, and the effects of this variation on the oviposition preferences of Manduca sexta moths, whose larvae are specialist herbivores of Solanaceae. Compared with inbred plants, outbred plants consistently released more total volatiles at night and more individual compounds-including some previously reported to repel moths and attract predators. Female moths overwhelmingly chose to lay eggs on inbred (versus outbred) plants, and this preference persisted when olfactory cues were presented in the absence of visual and contact cues. These results are consistent with our previous findings that inbred plants recruit more herbivores and suffer greater herbivory under field conditions. Furthermore, they suggest that constitutive volatiles released during the dark portion of the photoperiod can convey accurate information about plant defence status (and/or other aspects of host plant quality) to foraging herbivores.

Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

Directory of Open Access Journals (Sweden)

Oliver A Zill

Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

Directory of Open Access Journals (Sweden)

Krystyna Adamska

2017-06-01

Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

Decreasing erucic acid level by RNAi-mediated silencing of fatty ...

African Journals Online (AJOL)

To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...

HMGA1 silencing reduces stemness and temozolomide resistance in glioblastoma stem cells.

Science.gov (United States)

Colamaio, Marianna; Tosti, Nadia; Puca, Francesca; Mari, Alessia; Gattordo, Rosaria; Kuzay, Yalçın; Federico, Antonella; Pepe, Anna; Sarnataro, Daniela; Ragozzino, Elvira; Raia, Maddalena; Hirata, Hidenari; Gemei, Marica; Mimori, Koshi; Del Vecchio, Luigi; Battista, Sabrina; Fusco, Alfredo

2016-10-01

Glioblastoma multiforme (GBM) develops from a small subpopulation of stem-like cells, which are endowed with the ability to self-renew, proliferate and give rise to progeny of multiple neuroepithelial lineages. These cells are resistant to conventional chemo- and radiotherapy and are hence also responsible for tumor recurrence. HMGA1 overexpression has been shown to correlate with proliferation, invasion, and angiogenesis of GBMs and to affect self-renewal of cancer stem cells from colon cancer. The role of HMGA1 in GBM tumor stem cells is not completely understood. We have investigated the role of HMGA1 in brain tumor stem cell (BTSC) self-renewal, stemness and resistance to temozolomide by shRNA- mediated HMGA1 silencing. We first report that HMGA1 is overexpressed in a subset of BTSC lines from human GBMs. Then, we show that HMGA1 knockdown reduces self-renewal, sphere forming efficiency and stemness, and sensitizes BTSCs to temozolomide. Interestingly, HMGA1 silencing also leads to reduced tumor initiation ability in vivo. These results demonstrate a pivotal role of HMGA1 in cancer stem cell gliomagenesis and endorse HMGA1 as a suitable target for CSC-specific GBM therapy.

Effect of the linkers between the zinc fingers in zinc finger protein 809 on gene silencing and nuclear localization

Energy Technology Data Exchange (ETDEWEB)

Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi

2016-03-18

Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

Driving in unheard silence: Disability and the politics of shutting up.

Science.gov (United States)

Lourens, Heidi

2018-03-01

The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.

Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict

Directory of Open Access Journals (Sweden)

Line Kikkenborg Christensen

2018-02-01

Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.

The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

Science.gov (United States)

Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

2007-09-18

Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

Between the Unbearable Weight and Lightness of the Past. Banal Silence in Spain's Post-Dictatorship Memory Politics.

Science.gov (United States)

Brescó de Luna, Ignacio

2018-05-04

This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.

Silence in liturgy as the space for the Holy Ghost’s activity

Directory of Open Access Journals (Sweden)

Adelajda Sielepin

2006-06-01

Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Oviposition Behavior and Survival of Tamarixia radiata (Hymenoptera: Eulophidae), an Ectoparasitoid of the Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Liviidae), on Hosts Exposed to an Entomopathogenic Fungus, Isaria fumosorosea (Hypocreales: Cordycipitaceae), Under Laboratory Conditions.

Science.gov (United States)

Chow, Andrew; Dunlap, Christopher A; Jackson, Mark A; Flores, Daniel; Patt, Joseph M; Sétamou, Mamoudou

2016-10-01

Antagonistic interactions between the nymphal parasitoid, Tamarixia radiata Waterston (Hymenoptera: Eulophidae), and the ARSEF 3581 strain of the entomopathogenic fungus, Isaria fumosorosea Wize (Hypocreales: Cordycipitaceae), could disrupt biological control of the Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae). Three interactions were evaluated under laboratory conditions at 25 °C: 1) parasitoid survival if parasitized hosts were exposed to ARSEF 3581 blastospores before or after host mummification; 2) parasitoid survival if mummies containing larva or pupa were exposed to ARSEF 3581 hyphae; 3) parasitoid oviposition on infected hosts with visible or without visible hyphae. Topical application of blastospore formulation onto the dorsal surfaces of live nymphs parasitized with second-instar wasp larva (3 d after parasitism) reduced host mummification by 50% and parasitoid emergence by 85%. However, parasitoid emergence was not affected by topical application of blastospore formulation onto mummies that contained fourth-instar wasp larva (6 d after parasitism). Parasitoid emergence was reduced by 80% if mummies containing fourth-instar wasp larva were covered with blastospore formulation colonized by fungal hyphae. In comparison, parasitoid emergence was not affected if mummies containing wasp pupa (9 d after parasitism) were covered with formulation colonized by fungal hyphae. Female parasitoids oviposited on infected hosts without visible hyphae but not on infected hosts with visible hyphae. Our findings suggest that I. fumosorosea could detrimentally affect T. radiata, if both natural enemies are simultaneously deployed for biological control of D. citri However, temporal separation of the fungus and parasitoid could reduce antagonism and enhance control of D. citri. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Influences of Cry1Ac broccoli on larval survival and oviposition of diamondback moth.

Science.gov (United States)

Yi, Dengxia; Cui, Shusong; Yang, Limei; Fang, Zhiyuan; Liu, Yumei; Zhuang, Mu; Zhang, Yangyong

2015-01-01

Larval survival and oviposition behavior of three genotypes of diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), (homozygous Cry1Ac-susceptibile, Cry1Ac-resistant, and their F1 hybrids), on transgenic Bacillus thuringiensis (Bt) broccoli expressing different levels of Cry1Ac protein were evaluated in laboratory. These Bt broccoli lines were designated as relative low, medium, and high, respectively, according to the Cry1Ac content. Untransformed brocccoli plants were used as control. Larval survival of diamondback moth on non-Bt leaves was not significantly different among the three genotypes. The Cry1Ac-resistant larvae could survive on the low level of Bt broccoli plants, while Cry1Ac-susceptible and F1 larvae could not survive on them. The three genotypes of P. xylostella larvae could not survive on medium and high levels of Bt broccoli. In oviposition choice tests, there was no significant difference in the number of eggs laid by the three P. xylostella genotypes among different Bt broccoli plants. The development of Cry1Ac-susceptible and Cry1Ac-resistant P. xylostella on intact Bt plants was also tested in greenhouse. All susceptible P. xylostella larvae died on all Bt plants, while resistant larvae could survive on broccoli, which expresses low Cry1Ac protein under greenhouse conditions. The results of the greenhouse trials were similar to that of laboratory tests. This study indicated that high dose of Bt toxins in broccoli cultivars or germplasm lines is required for effective resistance management. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

An Empirical Study to Determine The Relationship between Occupational Self-Efficacy and Organizational Silence

Directory of Open Access Journals (Sweden)

Cem KAHYA

2015-06-01

Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

Silencing the epigenetic silencer KDM4A for TRAIL and DR5 simultaneous induction and antitumor therapy.

Science.gov (United States)

Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu

2016-11-01

Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.

Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

Directory of Open Access Journals (Sweden)

Dacheng Liang

2014-12-01

Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

Evaluation of the influence of electric nets on the behaviour of oviposition site seeking Anopheles gambiae s.s

Science.gov (United States)

2014-01-01

Background Electric nets (e-nets) are used to analyse the flight behaviour of insects and have been used extensively to study the host-oriented flight of tsetse flies. Recently we adapted this tool to analyse the oviposition behaviour of gravid malaria vectors, Anopheles gambiae s.s., orienting towards aquatic habitats and traps by surrounding an artificial pond with e-nets and collecting electrocuted mosquitoes on sticky boards on the ground next to the nets. Here we study whether e-nets themselves affect the responses of gravid An. gambiae s.s.. Methods Dual-choice experiments were carried out in 80 m2 screened semi-field systems where 200 gravid An. gambiae s.s. were released each night for 12 nights per experiment. The numbers of mosquito landing on or approaching an oviposition site were studied by adding detergent to the water in an artificial pond or surrounding the pond with a square of e-nets. We also assessed whether the supporting framework of the nets or the sticky boards used to retain electrocuted mosquitoes influenced the catch. Results Two similar detergent treated ponds presented in choice tests caught an equal proportion of the mosquitoes released, whereas a pond surrounded by e-nets caught a higher proportion than an open pond (odds ratio (OR) 1.7, 95% confidence interval (CI) 1.1 - 2.7; p electric nets and the yellow boards on the approach of gravid females towards a pond suggests that the tower-like construction of the square of electric nets did not restrict the approach of females but the yellow sticky boards on the ground attract gravid females to a source of water (OR 2.7 95% CI 1.7 – 4.3; p trapping efficiency of the electric nets is increased when large yellow sticky boards are placed on the ground next to the e-nets to collect electrocuted mosquitoes, possibly because of increased visual contrast to the aquatic habitat. It is therefore important when comparing two treatments that the same trapping device is used in both. The

DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

Directory of Open Access Journals (Sweden)

Thanh Theresa Dinh

2014-07-01

Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

Effects of a neem extract on blood feeding, oviposition and oocyte ultrastructure in Anopheles stephensi Liston (Diptera: Culicidae).

Science.gov (United States)

Lucantoni, L; Giusti, F; Cristofaro, M; Pasqualini, L; Esposito, F; Lupetti, P; Habluetzel, A

2006-12-01

Secondary metabolites of the neem tree (Azadirachta indica A. Juss., Meliaceae) exhibit a wide range of biological activities in insects. However, few studies have addressed the effects of neem extracts or compounds in arthropods of medical importance. In this study, a laboratory strain of Anopheles stephensi was used to assess the effects of a commercial formulation (Neem Azal) (NA)), containing azadirachtin A at 34%, on blood feeding, oviposition and oocyte ultrastructure. Oral administration of Neem Azal) to A. stephensi females through artificial blood meals did impair blood intake and oviposition in a concentration dependent manner. Similar results were obtained on females, which had consumed Neem Azal) in sucrose solution before taking a blood meal of plain blood. Neem treated females displayed a delay in oocyte development in both the phase of vitellogenesis and the phase of choriogenesis. The ultrastructural studies on ovaries from Neem Azal) treated females revealed distinct structural modifications indicative of: (i) a complete block of oogenesis, (ii) impairment of vitellogenesis and vitelline envelope formation, (iii) a severe degeneration of follicle cells. In agreement with results obtained in other insects, this study indicates that Neem Azal) impairs hormone control of oogenesis and exerts a cytotoxic effect on both follicular cells and oocytes of the Asian malaria vector A. stephensi.

Influence of breeding site availability on the oviposition behaviour of Aedes aegypti

Directory of Open Access Journals (Sweden)

Filipe Vieira Santos de Abreu

2015-08-01

Full Text Available Despite the importance of the mosquito Aedes aegypti in the transmission of arboviruses, such as yellow fever, Chikungunya fever and dengue fever, some aspects of their behaviour remain unknown. In the present study, the oviposition behaviour of Ae. aegypti females that were exposed to different densities of breeding sites (2, 4, 8 and 16 was evaluated in laboratory and semi-field conditions. The number of breeding sites that were used was proportional to the number available, but tended towards stabilisation. Females used four-six breeding sites on average, with a maximum of 11. A high percentage of eggs was observed in the water, along with the presence of a breeding site termed “favourite”, which received at least 40% of the eggs. The results are discussed in ecological, evolutionary and epidemiological approaches.

Influence of breeding site availability on the oviposition behaviour of Aedes aegypti

Science.gov (United States)

de Abreu, Filipe Vieira Santos; Morais, Maira Moreira; Ribeiro, Sérvio Pontes; Eiras, Álvaro Eduardo

2015-01-01

Despite the importance of the mosquito Aedes aegypti in the transmission of arboviruses, such as yellow fever, Chikungunya fever and dengue fever, some aspects of their behaviour remain unknown. In the present study, the oviposition behaviour of Ae. aegypti females that were exposed to different densities of breeding sites (2, 4, 8 and 16) was evaluated in laboratory and semi-field conditions. The number of breeding sites that were used was proportional to the number available, but tended towards stabilisation. Females used four-six breeding sites on average, with a maximum of 11. A high percentage of eggs was observed in the water, along with the presence of a breeding site termed “favourite”, which received at least 40% of the eggs. The results are discussed in ecological, evolutionary and epidemiological approaches. PMID:26154742

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-10-01

Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches

Directory of Open Access Journals (Sweden)

Mustafa Emre Civelek

2015-12-01

Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.

A conversation analysis of the function of silence in writing conferences

Directory of Open Access Journals (Sweden)

Milad Mirzaee

2016-07-01

Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.

Adult carbohydrate feeding affects reproduction of Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae)

Energy Technology Data Exchange (ETDEWEB)

Jordao, Alexandre L., E-mail: aljordao@hotmail.co [Instituto de Pesquisas Cientificas e Tecnologicas do Estado do Amapa (IEPA), Macapa, AP (Brazil); Nakano, Octavio, E-mail: onakano@esalq.usp.b [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia e Acarologia; Janeiro, Vanderly, E-mail: vjaneiro@hotmail.co [Universidade Estadual de Maringa (UEM), PR (Brazil). Dept. de Estatistica

2010-06-15

Reproduction of most insects depend on nutrients accumulated during the larval stage, but many lepidopteran species will also depend on nutrients obtained at the adult stage. Feeding at the adult stage allows the intake of carbohydrate and amino acid rich solutions, which may have an effect on the species reproduction and population growth. The objectives of the current study were to characterize the effects of sugar consumption by adults of the potato tuber moth, Phthorimaea operculella (Zeller), on its reproduction. To initially test the food intake by adults, a 10% honey solution or water (control), both containing a liquid dye were offered to adult insects 24 h after emergence, and the presence of the dye was observed by analysis of their digestive system. The effects of adult feeding on a 10% honey solution on the reproductive performance of P. operculella were evaluated by assessing the oviposition rate, fecundity and fertility. Adult feeding was proved by the presence of the dye within the digestive system of adults of P. operculella. Although the oviposition rate and fertility were not affected by adult feeding, female fecundity was higher in honey-fed females as compared to the water-fed females. (author)

Adult carbohydrate feeding affects reproduction of Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae)

International Nuclear Information System (INIS)

Jordao, Alexandre L.; Nakano, Octavio; Janeiro, Vanderly

2010-01-01

Reproduction of most insects depend on nutrients accumulated during the larval stage, but many lepidopteran species will also depend on nutrients obtained at the adult stage. Feeding at the adult stage allows the intake of carbohydrate and amino acid rich solutions, which may have an effect on the species reproduction and population growth. The objectives of the current study were to characterize the effects of sugar consumption by adults of the potato tuber moth, Phthorimaea operculella (Zeller), on its reproduction. To initially test the food intake by adults, a 10% honey solution or water (control), both containing a liquid dye were offered to adult insects 24 h after emergence, and the presence of the dye was observed by analysis of their digestive system. The effects of adult feeding on a 10% honey solution on the reproductive performance of P. operculella were evaluated by assessing the oviposition rate, fecundity and fertility. Adult feeding was proved by the presence of the dye within the digestive system of adults of P. operculella. Although the oviposition rate and fertility were not affected by adult feeding, female fecundity was higher in honey-fed females as compared to the water-fed females. (author)

Adaptation to new nutritional environments: larval performance, foraging decisions, and adult oviposition choices in Drosophila suzukii.

Science.gov (United States)

Silva-Soares, Nuno F; Nogueira-Alves, A; Beldade, P; Mirth, Christen Kerry

2017-06-07

Understanding how species adapt to new niches is a central issue in evolutionary ecology. Nutrition is vital for the survival of all organisms and impacts species fitness and distribution. While most Drosophila species exploit rotting plant parts, some species have diversified to use ripe fruit, allowing earlier colonization. The decomposition of plant material is facilitated by yeast colonization and proliferation. These yeasts serve as the main protein source for Drosophila larvae. This dynamic rotting process entails changes in the nutritional composition of the food and other properties, and animals feeding on material at different stages of decay are expected to have behavioural and nutritional adaptations. We compared larval performance, feeding behaviour and adult oviposition site choice between the ripe fruit colonizer and invasive pest Drosophila suzukii, and a closely-related rotting fruit colonizer, Drosophila biarmipes. Through the manipulation of protein:carbohydrate ratios in artificial diets, we found that D. suzukii larvae perform better at lower protein concentrations and consume less protein rich diets relative to D. biarmipes. For adult oviposition, these species differed in preference for substrate hardness, but not for the substrate nutritional composition. Our findings highlight that rather than being an exclusive specialist on ripe fruit, D. suzukii's adaptation to use ripening fruit allow it to colonize a wider range of food substrates than D. biarmipes, which is limited to soft foods with higher protein concentrations. Our results underscore the importance of nutritional performance and feeding behaviours in the colonization of new food niches.

Influence of larval and pupal products on the oviposition behavior of Aedes Fluviatilis (Lutz (Diptera: Culicidae

Directory of Open Access Journals (Sweden)

Rotraut A. G. B. Consoli

1988-06-01

Full Text Available Several larval and pupal products of Aedes fluviatilis (Lutz were tested for their influence on the oviposition behaviour of females of the same species. Significant (alfa = 0,05 atractiveness was shown by: larval water, previously containing 5 to 15 larvae/1,5 ml; larval water, preserved up to 38 days; evaporate and reconstructed larval water extracts up to 2 years after production and water filtered through fresh or dried ground larvae. hexanic larval water extracts and water filtered through fresh or dired ground pupae did not influence oviposition.Estudou-se a influência sobre o comportamento de oviposição das fêmeas de Aedes fluviatilis (Lutz de produtos derivados das formas imaturas da mesma espécie. As fêmeas foram atraídas significativamente (x=0,05 por ocasião da ovoposição por: água destilada que contivera 5 ou 15 larvas/1,5 ml, a mesma água (5 larvas/1,5 mlapós sua preservação por 38 dias; extratos evaporados e reconstituídos de água que conteve larvas, por até dois anos a sua produção, e filtrados de macerados frescos e secos de larvas. Extratos hexânicos de água que conteve larvas e filtrados de macerados descos e secos de pupas não atraíram a ovoposição das fêmeas.

Analysing the significance of silence in qualitative interviewing: questioning and shifting power relations

DEFF Research Database (Denmark)

Bengtsson, Tea Torbenfeldt; Fynbo, Lars

2017-01-01

In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

Directory of Open Access Journals (Sweden)

Adriana F. Fusaro

2017-10-01

Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

Is our knowledge of voice and silence in organizations growing?

DEFF Research Database (Denmark)

Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine

2016-01-01

This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...

Impacto da temperatura e fotoperíodo no desenvolvimento ovariano e oviposição de traça-das-crucíferas Impact of temperature and photoperiod on ovarian development and oviposition of the Diamondback Moth

Directory of Open Access Journals (Sweden)

Allan Crema

2004-06-01

Full Text Available A migração é um fenômeno que pode ocorrer em algumas espécies de insetos e ela geralmente começa quando os ovários não estão desenvolvidos, ou o estão parcialmente. Para traça-das-crucíferas, Plutella xylostella (Lepidoptera: Yponomeutidae já foi observado que a densidade larval afetou o grau de desenvolvimento ovariano. Neste trabalho foi determinado o impacto da temperatura e do fotoperíodo no desenvolovimento ovariano e na oviposição do inseto. Larvas de quarto estágio foram criadas individualmente em placas de Petri à temperaturas de 14 e 25ºC e fotofase de 8 e 14 h. As fêmeas recém-emergidas foram mortas em um freezer, dissecadas sob um microscópio e o ovário observado. Para determinar o impacto da temperatura sobre a oviposição do inseto, larvas de quarto estágio foram criadas a temperaturas de 14 e 25ºC e, quando os machos e fêmeas emergiram, casais foram colocados individualmente em placas de Petri. Foi determinado o período de pré-oviposição e o número de ovos depositados no primeiro dia. Os resultados mostraram que o grau de desenvolvimento ovariano não foi afetado pela temperatura e fotoperíodo empregados, indicando que estes fatores não afetaram o potencial migratório da espécie. Fêmeas criadas a 25ºC depositaram seus ovos dois dias após a emergência enquanto que fêmeas criadas a 14ºC o fizeram aos cinco dias, sugerindo que o período de pré-oviposição é aumentado a baixas temperaturas. O impacto destes resultados sobre a migração e dispersão da TDC são discutidos.Migration occurs in some insect species, and in many cases it commences when the ovaries are immature. Environmental conditions can affect the rate of ovarian development and oviposition of insects. In the Diamondback Moth (DBM, Plutella xylostella (Lepidoptera: Yponomeutidae, the larval density affected the rate of ovarian development. In this work we determined the impact of temperatures and photoperiods on DBM ovarian

Patterns of oviposition and development of Chrysomya megacephala (Fabricius) (Diptera: Calliphoridae) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) on burned rabbit carcasses.

Science.gov (United States)

Mahat, N A; Zainol-Abidin, N L; Nordin, N H; Abdul-Wahab, R; Jayaprakash, P T

2016-03-01

Considering that crimes against animals such as illegal killing and cruelty have been alarmingly increasing and since burning is one of the common ways for disposing cadavers, ability to estimate minimum postmortem interval (PMI) using entomological data merits consideration. Chrysomya megacephala and Chrysomya rufifacies are common necrophagous species recovered from cadavers in many countries including Malaysia. Specific studies focusing on the oviposition and developmental patterns of both species on cadavers manifesting different levels of burn as described by the Crow-Glassman Scale (CGS) remain scarce. In four replicates, rabbit carcasses were burned to CGS levels #1, #2 and #3 by varying the amount of petrol used and duration of burning. Oviposition by C. megacephala and C. rufifacies was delayed by one day in the case of carcasses burned to the CGS level #3 (p0.05) in the duration of development were found between control and burned carcasses. These findings deserve consideration while estimating minimum PMI since burning as a mean for disposing animal and human cadavers is gaining popularity. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

No evidence for change in oviposition behaviour of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) after widespread adoption of transgenic insecticidal cotton.

Science.gov (United States)

Zalucki, M P; Cunningham, J P; Downes, S; Ward, P; Lange, C; Meissle, M; Schellhorn, N A; Zalucki, J M

2012-08-01

Cotton growing landscapes in Australia have been dominated by dual-toxin transgenic Bt varieties since 2004. The cotton crop has thus effectively become a sink for the main target pest, Helicoverpa armigera. Theory predicts that there should be strong selection on female moths to avoid laying on such plants. We assessed oviposition, collected from two cotton-growing regions, by female moths when given a choice of tobacco, cotton and cabbage. Earlier work in the 1980s and 1990s on populations from the same geographic locations indicated these hosts were on average ranked as high, mid and low preference plants, respectively, and that host rankings had a heritable component. In the present study, we found no change in the relative ranking of hosts by females, with most eggs being laid on tobacco, then cotton and least on cabbage. As in earlier work, some females laid most eggs on cotton and aspects of oviposition behaviour had a heritable component. Certainly, cotton is not avoided as a host, and the implications of these finding for managing resistance to Bt cotton are discussed.

HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

Science.gov (United States)

Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

2012-11-07

affected kernel germination or anther development and as a consequence setting the seeds. The final phenotypic effect was the decreased productivity of T(0) plants and T(1) lines obtained via the biolistic silencing of HvCKX2. The phenotypic result, which was higher productivity of silenced lines obtained via Agrobacterium, confirms the hypothesis that spatial and temporal differences in expression contributed to functional differentiation. The applicability of Agrobacterium-mediated transformation for gene silencing of developmentally regulated genes, like HvCKX2, was proven. Otherwise low productivity and disturbances in plant development of biolistic-silenced lines documented the unsuitability of the method. The possible reasons are discussed.

Dismantling the Silence: LGBTQ Aging Emerging From the Margins

Science.gov (United States)

Fredriksen-Goldsen, Karen I.

2017-01-01

Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. PMID:28053011

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...

The Silence of Michelangelo

DEFF Research Database (Denmark)

Foote, Jonathan

2016-01-01

In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....

Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry

Directory of Open Access Journals (Sweden)

Mehdi Afkhami Ardakani

2015-05-01

Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and

Dim artificial light at night affects mating, reproductive output, and reactive oxygen species in Drosophila melanogaster.

Science.gov (United States)

McLay, Lucy Katherine; Nagarajan-Radha, Venkatesh; Green, Mark Philip; Jones, Therésa Melanie

2018-05-07

Humans are lighting the night-time environment with ever increasing extent and intensity, resulting in a variety of negative ecological effects in individuals and populations. Effects of light at night on reproductive fitness traits are demonstrated across taxa however, the mechanisms underlying these effects are largely untested. One possible mechanism is that light at night may result in perturbed reactive oxygen species (ROS) and oxidative stress levels. Here, we reared Drosophila melanogaster under either dim (10 lx) light or no light (0 lx) at night for three generations and then compared mating and lifetime oviposition patterns. In a second experiment, we explored whether exposure to light at night treatments resulted in variation in ROS levels in the heads and ovaries of six, 23- and 36-day-old females. We demonstrate that dim light at night affects mating and reproductive output: 10 lx flies courted for longer prior to mating, and female oviposition patterns differed to 0 lx females. ROS levels were lower in the ovaries but not heads, of 10 lx compared with 0 lx females. We suggest that reduced ROS levels may reflect changes in ovarian physiology and cell signaling, which may be related to the differences observed in oviposition patterns. Taken together, our results indicate negative consequences for invertebrates under more stressful, urban, lit conditions and further investigation into the mechanisms driving these changes is warranted to manage invertebrate communities in a brighter future. © 2018 Wiley Periodicals, Inc.

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Veiled Word(s) – Sacred Silence

DEFF Research Database (Denmark)

Isar, Nicoletta

2014-01-01

or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...

Role of methyl salicylate on oviposition deterrence in Arabidopsis thaliana.

Science.gov (United States)

Groux, Raphaël; Hilfiker, Olivier; Gouhier-Darimont, Caroline; Peñaflor, Maria Fernanda Gomes Villalba; Erb, Matthias; Reymond, Philippe

2014-07-01

Plants attacked by herbivores have evolved different strategies that fend off their enemies. Insect eggs deposited on leaves have been shown to inhibit further oviposition through visual or chemical cues. In some plant species, the volatile methyl salicylate (MeSA) repels gravid insects but whether it plays the same role in the model species Arabidopsis thaliana is currently unknown. Here we showed that Pieris brassicae butterflies laid fewer eggs on Arabidopsis plants that were next to a MeSA dispenser or on plants with constitutively high MeSA emission than on control plants. Surprisingly, the MeSA biosynthesis mutant bsmt1-1 treated with egg extract was still repellent to butterflies when compared to untreated bsmt1-1. Moreover, the expression of BSMT1 was not enhanced by egg extract treatment but was induced by herbivory. Altogether, these results provide evidence that the deterring activity of eggs on gravid butterflies is independent of MeSA emission in Arabidopsis, and that MeSA might rather serve as a deterrent in plants challenged by feeding larvae.

Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.

Science.gov (United States)

Kant, Ravi; Dasgupta, Indranil

2017-07-01

Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

Science.gov (United States)

Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

2004-02-01

The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

Relationship between oviposition, virulence gene expression and parasitism success in Cotesia typhae nov. sp. parasitoid strains.

Science.gov (United States)

Benoist, R; Chantre, C; Capdevielle-Dulac, C; Bodet, M; Mougel, F; Calatayud, P A; Dupas, S; Huguet, E; Jeannette, R; Obonyo, J; Odorico, C; Silvain, J F; Le Ru, B; Kaiser, L

2017-12-01

Studying mechanisms that drive host adaptation in parasitoids is crucial for the efficient use of parasitoids in biocontrol programs. Cotesia typhae nov. sp. (Fernández-Triana) (Hymenoptera: Braconidae) is a newly described parasitoid of the Mediterranean corn borer Sesamia nonagrioides (Lefebvre) (Lepidoptera: Noctuidae). Braconidae are known for their domesticated bracovirus, which is injected with eggs in the host larva to overcome its resistance. In this context, we compared reproductive success traits of four Kenyan strains of C. typhae on a French and a Kenyan populations of its host. Differences were found between the four strains and the two most contrasted ones were studied more thoroughly on the French host population. Parasitoid offspring size was correlated with parasitism success and the expression of bracovirus virulence genes (CrV1 and Cystatin) in the host larva after parasitism. Hybrids between these two parasitoid strains showed phenotype and gene expression profiles similar to the most successful parental strain, suggesting the involvement of dominant alleles in the reproductive traits. Ovary dissections revealed that the most successful strain injected more eggs in a single host larva than the less successful one, despite an equal initial ovocyte number in ovaries. It can be expected that the amount of viral particles increase with the number of eggs injected. The ability to bypass the resistance of the allopatric host may in consequence be related to the oviposition behaviour (eggs allocation). The influence of the number of injected eggs on parasitism success and on virulence gene expression was evaluated by oviposition interruption experiments.

The Application of Coconut Fiber as Dissipative Silencer

Science.gov (United States)

Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

2017-01-01

Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

Silencing Deafness: Displacing Disability in the Nineteenth Century

Directory of Open Access Journals (Sweden)

Esme Cleall

2015-03-01

Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.

Effects of gamma irradiation on the sperm transmission and oviposition response in Helicoverpa armigera (L. Noctuidae)

International Nuclear Information System (INIS)

Liu Xiaohui; Wang Huasong; Song Jiaxiang

1999-12-01

The transmission of sperm by unirradiated and irradiated cotton bollworm, Helicoverpa armigera, was studied by live dissection of the female immediately after the initiation of mating. In cotton bollworm the sperm transfer was a rather complex process. In fact, the unirradiated male failed to transfer sperm in about 19% of their matings. After being irradiated with 250 Gy and 400 Gy, the aberrations of sperm transmission were about 21% and 50% respectively. The failure of spermatophore 'cap' location was an important reason of sperm transmission aberrations. When female mated to high-dose-irradiated males, its oviposition response appeared abnormal

Friction coefficient measurements of silencers on specialized duct tract

Directory of Open Access Journals (Sweden)

Sehnalek Stanislav

2016-01-01

Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.

Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

2013-05-10

Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

Directory of Open Access Journals (Sweden)

Knowles Donald P

2009-11-01

Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

Oviposition responses of Aedes mosquitoes to bacterial isolates from attractive bamboo infusions.

Science.gov (United States)

Ponnusamy, Loganathan; Schal, Coby; Wesson, Dawn M; Arellano, Consuelo; Apperson, Charles S

2015-09-23

The mosquitoes Aedes aegypti and Aedes albopictus are vectors of pathogenic viruses that cause major human illnesses including dengue, yellow fever and chikungunya. Both mosquito species are expanding their geographic distributions and now occur worldwide in temperate and tropical climates. Collection of eggs in oviposition traps (ovitraps) is commonly used for monitoring and surveillance of container-inhabiting Aedes populations by public health agencies charged with managing mosquito-transmitted illness. Addition of an organic infusion in these traps increases the number of eggs deposited. Gravid females are guided to ovitraps by volatile chemicals produced from the breakdown of organic matter by microbes. We previously isolated and cultured 14 species of bacteria from attractive experimental infusions, made from the senescent leaves of canebrake bamboo (Arundinaria gigantea). Cultures were grown for 24 h at 28 °C with constant shaking (120 rpm) and cell densities were determined with a hemocytometer. Behavioral responses to single bacterial isolates and to a mix of isolates at different cell densities were evaluated using two-choice sticky-screen bioassay methods with gravid Ae. aegypti and Ae. albopictus. In behavioral assays of a mix of 14 bacterial isolates, significantly greater attraction responses were exhibited by Ae. aegypti and Ae. albopictus to bacterial densities of 10(7) and 10(8) cells/mL than to the control medium. When we tested single bacterial isolates, seven isolates (B1, B2, B3, B5, B12, B13 and B14) were significantly attractive to Ae. aegypti, and six isolates (B1, B5, B7, B10, B13 and B14) significantly attracted Ae. albopictus. Among all the isolates tested at three different cell densities, bacterial isolates B1, B5, B13 and B14 were highly attractive to both Aedes species. Our results show that at specific cell densities, some bacteria significantly influence the attraction of gravid Ae. aegypti and Ae. albopictus females to

The propensity to bi-stability of bursting and silence of the leech heart interneuron

Science.gov (United States)

Malaschenko, Tatiana; Williams, Diana; Shilnikov, Andrey; Cymbalyuk, Gennady

2009-11-01

Bursting is one of primary activity regimes of neurons. Our previous study was focused on determining a generic biophysical mechanism underlying the transition between bursting and silence and the co-existence of these two regimes observed in a neuron model. We show that this co-existence can be explained by the unstable sub-threshold oscillations (USTO) separating silence and bursting. The range of the controlling parameters, where the co-existence is observed, is limited by the critical values of the system at which the Andronov-Hopf and homoclinic bifurcations occur. We investigate how different parameters of the model affect the width of the co-existence area. We study the effects of the variations of maximal conductances of every voltage-dependent current. The influence of each current was tested individually, one at the time. We found that only two of them had a significant effect on the range of co-existence. The increase of the maximal conductance of the hyperpolarization-activated cationic current Ih would expand the area of co-existence. The decrease of the conductance of the LVA fast Ca^2+ current has the opposite effect.

Silence in the second language classroom

CERN Document Server

King, J

2013-01-01

Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing

2010-05-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

Directory of Open Access Journals (Sweden)

Sirjana Devi Shrestha

Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

Oviposition behaviour and egg distribution of the European corn borer, Ostrinia nubilalis, on maize, and its effect on host finding by Trichogramma egg parasitoids

NARCIS (Netherlands)

Suverkropp, B.P.; Dutton, A.; Bigler, F.; Lenteren, van J.C.

2008-01-01

Oviposition behaviour and egg distribution of Ostrinia nubilalis is reviewed based on published information and new research. The position of egg masses of O. nubilalis on maize plants and leaves were sampled in the field. Most egg masses were found on the lower leaf side, on the middle part of the

Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

Directory of Open Access Journals (Sweden)

Li Xiao Hui

2015-09-01

Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

The CNP signal is able to silence a supra threshold neuronal model

Directory of Open Access Journals (Sweden)

Francesca eCamera

2015-04-01

Full Text Available Several experimental results published in the literature showed that weak pulsed magnetic fields affected the response of the central nervous system. However, the specific biological mechanisms that regulate the observed behaviors are still unclear and further scientific investigation is required. In this work we performed simulations on a neuronal network model exposed to a specific pulsed magnetic field signal that seems to be very effective in modulating the brain activity: the Complex Neuroelectromagnetic Pulse (CNP. Results show that CNP can silence the neurons of a feed-forward network for signal intensities that depend on the strength of the bias current, the endogenous noise level and the specific waveforms of the pulses.

Polycomb complexes and silencing mechanisms

DEFF Research Database (Denmark)

Lund, Anders H; van Lohuizen, Maarten

2004-01-01

Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

Science.gov (United States)

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

Influence des engrais de type NPK sur l’oviposition d’Aedes aegypti

Directory of Open Access Journals (Sweden)

Darriet F.

2008-03-01

Full Text Available Les engrais sont des associations de minéraux destinées à apporter aux plantes des compléments nutritifs nécessaires à leur croissance. Les engrais modernes de type NPK combinent les trois éléments de base que sont l’azote (N, le phosphore (P et le potassium (K. Dans cette étude de laboratoire réalisée dans des tunnels expérimentaux, nous avons étudié l’influence de solutions aqueuses contenant différentes concentrations en engrais NPK sur l’oviposition de femelles d’Aedes aegypti. Les résultats ont montré que les solutions contenant les concentrations en NK = 17-33 mg/l et P = 23-47 mg/l attiraient significativement plus de femelles gravides que l’eau osmosée seule (P 0,05. Ces résultats suggèrent que certaines teneurs en engrais NPK peuvent influencer le comportement de ponte du moustique Ae. aegypti.

Ways to Promote the Classroom Participation of International Students by Understanding the Silence of Japanese University Students

Science.gov (United States)

Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.

2016-01-01

The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…

Feeding and oviposition deterrent activities of microencapsulated cardamom oleoresin and eucalyptol against Cydia pomonella

Directory of Open Access Journals (Sweden)

Orkun Baris Kovanci

2016-03-01

Full Text Available Behavioral manipulation of codling moth with spice-based deterrents may provide an alternative control strategy. Microencapsulation technology could lead to more effective use of spice essential oils and oleoresins in the field by extending their residual activity. The feeding and oviposition deterrent potential of the microencapsulated cardamom (Elettaria cardamomum [L.] Maton oleoresin (MEC-C and eucalyptol (MEC-E were evaluated against codling moth, Cydia pomonella Linnaeus, 1758. MEC-C capsules contained both 1,8-cineole and a-terpinyl acetate, whereas MEC-E capsules contained only 1,8-cineole. In larval feeding bioassays, MEC-E exhibited the lowest feeding deterrent activity (33% while MEC-C at 100 mg mL-1 had the highest (91%. The highest oviposition deterrence activity against gravid females was also shown by MEC-C at 100 mg mL-1 with 84% effective repellency. In 2010 and 2011, two apple orchards were divided into four 1 ha blocks and sprayed with the following treatments in ultra-low volume sprays: (a MEC-E at 100 g L-1, (b MEC-C at 50 g L-1, (c MEC-C at 100 g L-1, and (d MEC-pyrethrin at 15 mL L-1. Water-treated abandoned orchards were used as negative controls. Moth catches were monitored weekly using Ajar traps baited with the combination of codlemone, pear ester, and terpinyl acetate. Based on pooled data, mean cumulative moth catch per trap per week was significantly higher in the MEC-E blocks (26.3 male and 13.5 female moths than those in other treatments except the abandoned blocks. At mid-season and pre-harvest damage assessment, the percentage of infested fruits with live larvae in the high dose MEC-C-treated blocks was reduced to 1.9% and 2.3% in 2010 and to 1.1% and 1.8% in 2011, respectively. Since fruit damage exceeded the economic damage threshold of 1%, high-dose MEC-C treatment may only offer supplementary protection against codling moth in integrated pest management programs.

RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

Directory of Open Access Journals (Sweden)

Jian Liu

2014-01-01

Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

Dismantling the Silence: LGBTQ Aging Emerging From the Margins.

Science.gov (United States)

Fredriksen-Goldsen, Karen I

2017-02-01

Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Epigenetic silencing of CYP24 in the tumor microenvironment

Science.gov (United States)

Johnson, Candace S.; Chung, Ivy; Trump, Donald L.

2010-01-01

Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy

Science.gov (United States)

Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.

2016-01-01

Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199

Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

Directory of Open Access Journals (Sweden)

Jiexiong Feng

Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

Excavating silences and tensions of agency|passivity in science education reform

Science.gov (United States)

Rivera Maulucci, Maria S.

2010-12-01

I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

The impact of organizational culture on employees’ organizational silence In Shiraz University of Medical Sciences

Directory of Open Access Journals (Sweden)

Ebrahim Parcham

2017-01-01

Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

Science.gov (United States)

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Olive fruit fly (Diptera: Tephritidae) in California: longevity, oviposition, and development in canning olives in the laboratory and greenhouse.

Science.gov (United States)

Yokoyama, Victoria Y

2012-02-01

The biology of olive fruit fly, Bactrocera oleae (Rossi), was studied in the laboratory, greenhouse, and in canning olives, Olea europaea L., in relation to California regional climates. Adults survived in laboratory tests at constant temperatures and relative humidities of 5 degrees C and 83%; 15 degrees C and 59%; 25 degrees C and 30%; and 35 degrees C and 29% for 15, 6, 3, and 2 d without provisions of food and water and for 37, 63, 25, and 4 d with provisions, respectively. In a divided greenhouse, adults survived for 8-11 d in the warm side (36 degrees C and 31% RH daytime); and in the cool side (26 degrees C and 63% RH daytime) 10 d without provisions and 203 d with provisions. A significantly greater number of adults survived in the cool side than the warm side, and with provisions than without. First and last eggs were oviposited in olive fruit when females were 6 and 90 d old, respectively. The highest number of eggs was 55 per day in 10 olive fruit oviposited by 10 28 d-old females, with maximum egg production by 13-37 d-old females. A significantly greater number of ovipositional sites occurred in all sizes of immature green fruit when exposed to adults in cages for 5 d than 2 d. Adults emerged from fruit with a height of > or = 1.0 cm or a volume of > or = 0.2 cm3. More than seven adults per 15 fruit emerged from field infested fruit with a height of 1.1 cm and volume of 0.1 cm3. Larval length was significantly different among the first, second, and third instars and ranged from 0.7 to 1.6, 2.4-4.3, and 4.8-5.6 mm at 14 degrees C; 0.8-1.1, 1.9-2.9, and 3.9-4.4 mm at 21 degrees C, and 0.7-1.3, 2.4-2.9, and 4.4-4.8 mm at 26 degrees C, respectively. Survival of pupae to the adult stage was significantly lower at 26 degrees C than 14 degrees C or 21 degrees C. The period of adult emergence began at 38, 14, and 11 d over a period of 8, 5, and 1 d at 14, 21, and 26 degrees C, respectively. Findings were related to the occurrence and control of California

A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

Science.gov (United States)

Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

2014-12-01

RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Attraction and Oviposition of Lucilia eximia (Diptera: Calliphoridae) to Resources Colonized by the Invasive Competitor Chrysomya albiceps (Diptera: Calliphoridae).

Science.gov (United States)

Spindola, Aline F; Zheng, Le; Tomberlin, Jeffery K; Thyssen, Patricia J

2017-03-01

The present study aimed to determine if the presence of immatures of the invasive blow fly species Chrysomya albiceps (Wiedemann) influences the adult behavior of the native species Lucilia eximia (Wiedemann) in Brazil. The level of attraction and oviposition by the native species was assessed in a dual-choice assay. The evaluation was based on sex and stage of ovarian development of L. eximia adults to a resource not colonized (NCR) or colonized (RPC) with eggs, different instars, or densities of C. albiceps. A significant difference in attraction was observed based on sex and stages of ovarian development. Males and nongravid females were more attracted to RPC, whereas gravid females preferred NCR. Moreover, males exhibited the lowest response in all assays among the three sex categories examined. In general, adults preferably oviposited on NCR rather than RPC. Also, between the eggs and second instar treatments, L. eximia laid more eggs on RPC with eggs than second instars (predatory stage). Lucilia eximia attraction to second-instar C. albiceps at different densities was marginally significant. Overall, results indicate the invasive species, C. albiceps, is impacting the behavior of the native blow fly, L. eximia, with regards to its attraction and colonization of vertebrate carrion, which could explain why native blow fly populations have significantly decreased since the introduction of C. albiceps. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The great silence science and philosophy of Fermi's paradox

CERN Document Server

Cirkovic, Milan M

2018-01-01

The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.

Attractiveness of botanical infusions to ovipositing Culex quinquefasciatus, Cx. nigripalpus, and Cx. erraticus in San Antonio, Texas.

Science.gov (United States)

McPhatter, Lee P; Debboun, Mustapha

2009-12-01

Field experiments were conducted on the Fort Sam Houston Military Reservation, San Antonio, TX, in fall 2008 to observe the attractiveness of selected botanical infusions to ovipositing female mosquitoes. The following infusions were tested in Centers for Disease Control and Prevention gravid traps: Bermuda grass (Cynodon dactylon), oak leaf (Quercus virginiana), acacia leaf (Acacia schaffneri), rabbit chow (alfalfa pellets), and algae (Spirogyra sp.). Four (Bermuda, acacia, oak, and algae) of the 5 infusions were effective in collecting Culex quinquefasciatus, Cx. nigripalpus, and Cx. erraticus. Of the 4 infusions, Bermuda collected the greatest number of the mosquitoes sampled. Female Aedes albopictus mosquitoes were collected in moderate numbers during this study.

Surface functionalisation of PLGA nanoparticles for gene silencing

DEFF Research Database (Denmark)

Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob

2010-01-01

. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Designing and Manufacturing a Noise Controlling Silencer for the Cooling Tower Pump of Sarcheshmeh Copper Power Station

Directory of Open Access Journals (Sweden)

Sajad Zare

2017-08-01

Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.

An investigation of noise produced by unsteady gas flow through silencer elements

Science.gov (United States)

Mawhinney, Graeme Hugh

This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.

Conifers have a unique small RNA silencing signature.

Science.gov (United States)

Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

2008-08-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

Oviposition behaviour of four ant parasitoids (Hymenoptera, Braconidae, Euphorinae, Neoneurini and Ichneumonidae, Hybrizontinae, with the description of three new European species

Directory of Open Access Journals (Sweden)

Kees van Achterberg

2011-08-01

Full Text Available The oviposition behaviour of four ant parasitoids was observed and filmed for the first time. The movies are available from YouTube (search for Elasmosoma, Hybrizon, Kollasmosoma and Neoneurus. Two of the observed species (Neoneurus vesculus sp. n. and Kollasmosoma sentum sp. n. are new to science. A third species (Neoneurus recticalcar sp. n. is described from Slovakia and Norway. Keys to the Palaearctic species of the genera Neoneurus and Kollasmosoma are added.

A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

Directory of Open Access Journals (Sweden)

Pengfei Ding

2015-06-01

Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

Tacit Authorization : A Legal Solution for Administrative Silence

NARCIS (Netherlands)

Hoogstra, Nicole; de Graaf, K.J.

2016-01-01

This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if

PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Science.gov (United States)

Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun

2017-02-02

Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.

Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati

Index Scriptorium Estoniae

2000-01-01

Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"

Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

Directory of Open Access Journals (Sweden)

Yixiang Han

Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

2008-11-15

Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

What does it take to break the silence in teams: Authentic leadership or proactive followership?

NARCIS (Netherlands)

Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua

2017-01-01

Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

Resounding Silences : Subtle Norm Regulation in Everyday Interactions

NARCIS (Netherlands)

Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.

In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Papel dos tricomas glandulares da folha do tomateiro na oviposição de Tuta absoluta Role of tomato leaf glandular trichomes on oviposition of Tuta absoluta

Directory of Open Access Journals (Sweden)

Elsa Gilardón

2001-03-01

Full Text Available Os tricomas glandulares presentes nas folhas e ramos das plantas do gênero Lycopersicon são responsáveis pela secreção de metabólitos de diferentes naturezas. A presença de alguns desses compostos tem sido associada à resistência do tomate a diferentes insetos. A traça-do-tomateiro, Tuta absoluta (Meyrick, é uma das pragas mais nocivas da América do Sul. O adulto oviposita sobre as folhas do tomate e suas larvas abrem galerias no mesófilo das folhas, ramos, flores e frutos. As espécies silvestres do tomate conservam a capacidade de biossintetizar compostos químicos que lhes conferem resistência a esta praga. No presente trabalho, foi avaliada a preferência para oviposição desse inseto sobre folhas com e sem tricomas glandulares de L. esculentum (Mill. cv. Uco Plata, suscetível, e de L. hirsutum f. glabratum (Mull. PI 134417, espécie silvestre afim ao tomate, e resistente à traça. Os resultados sugerem que as fêmeas ovipositam indistintamente sobre as folhas de ambas espécies, independentemente da presença, ou não, dos tricomas glandulares. E a presença destes e de seus exsudatos não têm efeito inibidor na oviposição do inseto.In the genus Lycopersicon, different metabolites are secreted by the glandular trichomes of leaves and stems. These compounds have been associated to different tomato pests resistance. The South American tomato pinworm, Tuta absoluta (Meyrick, is one of the most harmful pests in South America. The females oviposit on tomato leaves and the larvae mine the leaf mesophyl, stems, flowers and fruits. Some wild accessions of Lycopersicon keep their capacity to synthesize allelochemicals that protect them from the pest. In this paper a comparison was made between the tomato pinworm oviposition on leaves with and without trichomes of L. esculentum (Mill. cv. Uco Plata, a susceptible cultivar, and L. hirsutum f. glabratum (Mull. PI 134417, a resistant wild accession. Results suggest that the female

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

Science.gov (United States)

Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

2015-12-02

Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

Science.gov (United States)

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Directory of Open Access Journals (Sweden)

Pizzichini Daniele

2007-03-01

Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

Breaking Classroom Silences: A View from Linguistic Ethnography

Science.gov (United States)

Rampton, Ben; Charalambous, Constadina

2016-01-01

This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…

Breaking the Silence Surrounding Mental Health on Campus

Science.gov (United States)

Roper, Larry D.

2013-01-01

Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

Science.gov (United States)

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

An intronic microRNA silences genes that are functionally antagonistic to its host gene.

Science.gov (United States)

Barik, Sailen

2008-09-01

MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L

DEFF Research Database (Denmark)

Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon

2017-01-01

Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...

Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Underground laboratories: Cosmic silence, loud science

Energy Technology Data Exchange (ETDEWEB)

Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)

2010-01-01

Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.

Silencing the Girdin gene enhances radio-sensitivity of hepatocellular carcinoma via suppression of glycolytic metabolism.

Science.gov (United States)

Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo

2017-08-15

Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

Comparison of exclusion and imidacloprid for reduction of oviposition damage to young trees by periodical cicadas (Hemiptera: Cicadidae).

Science.gov (United States)

Ahern, Robert G; Frank, Steven D; Raupp, Michael J

2005-12-01

Insecticides are traditionally used to control periodical cicadas (Homoptera: Cicadidae) and to reduce associated injury caused by oviposition. However, research has shown that conventional insecticides have low or variable season-long efficacy in reducing injury caused by cicadas. New systemic neonicotinoid insecticides provide excellent levels of control against a variety of sucking insects. We compared the efficacy of a neonicotinoid insecticide, imidacloprid, and a nonchemical control measure, netting, to reduce cicada injury. Netted trees sustained very little injury, whereas unprotected trees were heavily damaged. Fewer eggnests, scars, and flags were observed on trees treated with imidacloprid compared with unprotected trees; however, the hatching of cicada eggs was unaffected by imidacloprid.

Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

Directory of Open Access Journals (Sweden)

Ida Bagus Andika

2016-09-01

Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.

Science.gov (United States)

Rober, Peter; Rosenblatt, Paul C

2017-03-01

A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.

Renal-Specific Silencing of TNF (Tumor Necrosis Factor) Unmasks Salt-Dependent Increases in Blood Pressure via an NKCC2A (Na+-K+-2Cl- Cotransporter Isoform A)-Dependent Mechanism.

Science.gov (United States)

Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R

2018-06-01

We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.

47 CFR 80.304 - Watch requirement during silence periods.

Science.gov (United States)

2010-10-01

....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Sound attenuation of a finite length dissipative flow duct silencer with internal mean flow in the absorbent

Science.gov (United States)

Cummings, A.; Chang, I.-J.

1988-11-01

Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.

RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

Science.gov (United States)

Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

2014-04-01

Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

Please silence your cell phone: Your ringtone captures other people′s attention

Directory of Open Access Journals (Sweden)

Jan P Röer

2014-01-01

Full Text Available Ringtones are designed to draw attention away from on-going activities. In the present study, it was investigated whether the disruptive effects of a ringing cell phone on short-term memory are inevitable or become smaller as a function of exposure and whether (self- relevance plays a role. Participants performed a serial recall task either in silence or while task-irrelevant ringtones were presented. Performance was worse when a ringing phone had to be ignored, but gradually recovered compared with the quiet control condition with repeated presentation of the distractor sound. Whether the participant′s own ringtone was played or that of a yoked-control partner did not affect performance and habituation rate. The results offer insight into auditory distraction by highly attention-demanding distractors and recovery therefrom. Implications for work environments and other applied settings are discussed.

Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

Science.gov (United States)

Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

2018-02-01

Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

The silencing of cathepsin K used in gene therapy for periodontal disease reveals the role of cathepsin K in chronic infection and inflammation.

Science.gov (United States)

Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P

2016-10-01

Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence

Directory of Open Access Journals (Sweden)

Beatrice Nori

2017-07-01

Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author iden­tifies the broken syntax and the combi­nation of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonmen­t of chronological time in linguistic terms conveys the subjecti­ve, circular, and illogical elemen­t of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their presen­t experiences. The presen­t work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

Directory of Open Access Journals (Sweden)

Jinhuan Pang

Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

Speaking of Silence: Comments from an Irish Studies Perspective

DEFF Research Database (Denmark)

McQuaid, Sara Dybris; Beville, Maria

2012-01-01

argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...

Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing

Science.gov (United States)

Ullman, Jacqueline; Ferfolja, Tania

2015-01-01

National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…

Small silencing RNAs: an expanding universe.

Science.gov (United States)

Ghildiyal, Megha; Zamore, Phillip D

2009-02-01

Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

Science.gov (United States)

Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

2017-01-10

In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

Directory of Open Access Journals (Sweden)

Philippe Lashermes

2016-09-01

Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Evaluation of oviposition traps as an entomological surveillance method for Aedes aegypti (Diptera, Culicidae Avaliação das armadilhas de oviposição como método de vigilância entomológica para Aedes aegypti (Diptera, Culicidae

Directory of Open Access Journals (Sweden)

Angelita Anália Carniel Barbosa

2010-06-01

Full Text Available This study aimed to describe the behavior of oviposition traps for Aedes aegypti over time, to compare it with the larval survey and to investigate the association with climatic variables. It was conducted in São José do Rio Preto city, São Paulo. Daily climatic data and fortnightly measurements for oviposition traps and larval infestation were collected from October 2003 to September 2004. Three different periods were identified in the behavior of oviposition traps' positivity and mean number of eggs: increase, plateau and decrease in values. These measurements followed the variation of climatic data from the first and third periods. High correlation was obtained between the positivity and the mean number of eggs. The oviposition traps showed higher capacity to detect the vector than did larval survey. It was observed that the first (October to December and third (May to September periods were considered to be the most suitable to use oviposition traps than larval surveys.O estudo teve como objetivos descrever o comportamento da armadilha de oviposição para Aedes aegypti ao longo do tempo, comparar com a pesquisa larvária e investigar sua associação com variáveis climáticas. O trabalho foi realizado em São José do Rio Preto, São Paulo. Entre outubro de 2003 a setembro de 2004, as armadilhas e a pesquisa larvária forneceram dados quinzenais e foram obtidos dados climáticos. Três períodos distintos foram identificados no comportamento da positividade das armadilhas e no número médio de ovos: aumento, patamar e decréscimo dos valores. Estas medidas acompanharam as variações climáticas. Alta correlação foi obtida entre a positividade e número de ovos. As armadilhas de oviposição apresentam maior capacidade para detectar o vetor do que a pesquisa larvária. Foi observado que o primeiro (outubro a dezembro e terceiro (maio a setembro períodos foram os mais adequados para utilização das armadilhas de oviposição em

FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

Science.gov (United States)

Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

2014-01-01

Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

Duplication of an upstream silencer of FZP increases grain yield in rice.

Science.gov (United States)

Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong

2017-11-01

Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

Directory of Open Access Journals (Sweden)

Ma Changhui

2009-01-01

Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

2010-01-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian

2010-07-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

Performances of Student Activism: Sound, Silence, Gender, and Dis/ability

Science.gov (United States)

Pasque, Penny A.; Vargas, Juanita Gamez

2014-01-01

This chapter explores the various performances of activism by students through sound, silence, gender, and dis/ability and how these performances connect to social change efforts around issues such as human trafficking, homeless children, hunger, and children with varying abilities.

Effects of nymphal diet and adult feeding on allocation of resources to glassy-winged sharpshooter egg production

Science.gov (United States)

The glassy-winged sharpshooter is an invasive insect capable of transmitting the bacterial pathogen Xylella fastidiosa. Pre-oviposition periods of laboratory reared glassy-winged sharpshooters are variable. Here, two questions were addressed: does nymphal diet affect pre-oviposition period and how d...

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

International Nuclear Information System (INIS)

Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

2012-01-01

ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

Not the Honey Bee (Apis mellifera L. Queen, but the Drone Determines the Termination of the Nuptial Flight and the Onset of Oviposition - The Polemics, Abnegations, Corrections and Supplements

Directory of Open Access Journals (Sweden)

Woyke Jerzy

2016-12-01

Full Text Available This paper emphasizes the topics concerning honey bee (Apis mellifera L. mating biology, which have not been described in the recently published book of Koeniger et al. (2014. At the beginning of natural mating, the drone becomes paralyzed. However, the muscles in the abdomen continuously contract shrinking the abdomen till mating has ended and the pair have separated. It is not the queen that ends the nuptial flight. The termination of the nuptial flight is determined by the drone, which fails to remove the mating sign of the previous drone from the sting chamber of the queen. The mating sign originates from two or more drones. The queen also does not determine the age at which she starts oviposition. It is the last drone, which tried to mate, but failed to remove the mating sign of the predecessor, that determines the age that the queen starts oviposition. The book of Koeniger et al. (2014, together with this paper, present the current knowledge of the mating biology of honey bees.

High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

Institute of Scientific and Technical Information of China (English)

SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo

2014-01-01

RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

Science.gov (United States)

Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

2017-05-01

Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Relationship between Organizational Mobbing and Silence Behavior among Teachers

Science.gov (United States)

Hüsrevsahi, Selda Polat

2015-01-01

This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…

Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

Science.gov (United States)

Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

2013-05-01

We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

Science.gov (United States)

Kelleher, Erin S.

2016-01-01

Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional

OpenAIRE

Retnawati, Berta Bekti

2003-01-01

There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Ce que l’on fait dire au silence : posture, ethos, image d’auteur How to make silence talk… Posture, ethos, author’s image

Directory of Open Access Journals (Sweden)

Jérôme Meizoz

2009-10-01

Full Text Available Après la parution de Postures littéraires (2007 cet article revient sur la visée méthodologique de la notion de « posture », en la confrontant à deux notions voisines, celles d’« ethos » et d’« image d’auteur ». Il propose de hiérarchiser ces trois notions dans un ensemble conceptuel. Une brève analyse du Silence de la mer (1942 de Vercors illustre cette réflexion.After the publication of Literary postures (2007, this article revisits the methodological approach based on the notion of “posture” by comparing it with two related notions, “ethos” and “author’s image”. It shows how these three notions can be organized into a hierarchy inside an integrated conceptual whole. A brief analysis of Vercors’ TheSilence of the Sea (1942 illustrates this proposition.

flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

Science.gov (United States)

Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela

2013-02-01

Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.

flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.

Directory of Open Access Journals (Sweden)

Louise E Atkinson

2013-02-01

Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.

Exon silencing by UAGG motifs in response to neuronal excitation.

Directory of Open Access Journals (Sweden)

Ping An

2007-02-01

Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.

ABCE1 is a highly conserved RNA silencing suppressor.

Directory of Open Access Journals (Sweden)

Kairi Kärblane

Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

Feeding and oviposition preference of Phyllophaga cuyabana (Moser) (Coleoptera: Melolonthidae) on several crops

International Nuclear Information System (INIS)

Oliveira, Lenita J.; Hoffmann-Campo, Clara B.

2007-01-01

Laboratory and greenhouse experiments were carried out to study food and oviposition preference by Phyllophaga cuyabana (Moser) on different plant species as Cajanus cajan L. (pigeon pea), Crotalaria juncea L. (sun hemp), Crotalaria spectabilis Roth (showy crotalaria), Crotalaria ochroleuca G. Don (slenderleaf rattlebox), Glycine max [L.] Merrill (soybean), Gossypium hirsutum L. (cotton), Helianthus annuus L. (sunflower), Stizolobium aterrimum [Mucuna aterrima] Piper and Tracey (velvetbean) and Zea mays L. (mayze). In no-choice experiments, the number of eggs layed in sunflower, C. juncea and soybean was larger compared to cotton. Despite the fact that the adults did not discriminate among plants, in dual-choice test, the proportion of eggs layed and leaf consumption by P. cuyabana adults in soybean were significantly higher than in C. spectabilis. The larval distribution in the soil was at random in multiple-choice, without any trend of preference, but in dual-choice, when soybean was the control, larvae always preferred to feed on its roots. P. cuyabana adults had preference for more suitable hosts and that could stand their offspring survival. This behaviour can be usefully exploited in an integrated management program for this pest. (author)

Feeding and oviposition preference of Phyllophaga cuyabana (Moser) (Coleoptera: Melolonthidae) on several crops

Energy Technology Data Exchange (ETDEWEB)

Oliveira, Lenita J.; Hoffmann-Campo, Clara B. [EMBRAPA Soja, Londrina, PR (Brazil). Centro Nacional de Pesquisa de Soja]. E-mail: lenita@cnpso.embrapa.br; Garcia, Maria A. [Universidade Estadual de Campinas (UNICAMP), Campinas, SP (Brazil). Inst. de Biologia. Dept. de Zoologia; Amaral, Maria L.B. do [Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq), Brasilia, DF (Brazil)

2007-09-15

Laboratory and greenhouse experiments were carried out to study food and oviposition preference by Phyllophaga cuyabana (Moser) on different plant species as Cajanus cajan L. (pigeon pea), Crotalaria juncea L. (sun hemp), Crotalaria spectabilis Roth (showy crotalaria), Crotalaria ochroleuca G. Don (slenderleaf rattlebox), Glycine max [L.] Merrill (soybean), Gossypium hirsutum L. (cotton), Helianthus annuus L. (sunflower), Stizolobium aterrimum [Mucuna aterrima] Piper and Tracey (velvetbean) and Zea mays L. (mayze). In no-choice experiments, the number of eggs layed in sunflower, C. juncea and soybean was larger compared to cotton. Despite the fact that the adults did not discriminate among plants, in dual-choice test, the proportion of eggs layed and leaf consumption by P. cuyabana adults in soybean were significantly higher than in C. spectabilis. The larval distribution in the soil was at random in multiple-choice, without any trend of preference, but in dual-choice, when soybean was the control, larvae always preferred to feed on its roots. P. cuyabana adults had preference for more suitable hosts and that could stand their offspring survival. This behaviour can be usefully exploited in an integrated management program for this pest. (author)

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

Science.gov (United States)

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

Paul Leni’s Waxworks: Writing Images from Silence, through Media and Philosophy

Directory of Open Access Journals (Sweden)

Marcondes Ciro Inácio

2016-12-01

Full Text Available The so-called German Weimar Cinema encompasses a profusion of films that used frame narratives. In the case of Paul Leni’s Waxworks (Das Wachsfigurenkabinett, 1924, as the framing stems from a literary act (the stories are framed by the act of narration, the film proposes the mise-en-abyme technique as a sort of immersion into the intermedial when it deals with notions like speaking, writing, silence, image and cinema. In the case of silent cinema, and especially in Waxworks, the presence of a perverse relation with the medium of writing becomes noticeable (producing a fantasy of writing, since every effort to represent the literary act on film results in an infinite production of silent images, creating a parody effect and even postulating an act of aggression against writing. This confrontational relation between the writing code and the code of the mute image in silent cinema allows us to suggest that there is an inherent inflexibility in the language of silent cinema which does not allow the coexistence of written and spoken word as complementary codes. On the contrary, in silent cinema, the image and the silence of the film seem to work against the word, the spoken word being set forth against silence, and the written word against images.

Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

Energy Technology Data Exchange (ETDEWEB)

Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

2012-09-10

ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

Shame and Silence | Janz | South African Journal of Philosophy

African Journals Online (AJOL)

Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...

Phengaris (Maculinea) alcon butterflies deposit their eggs on tall plants with many large buds in the vicinity of Myrmica ants

NARCIS (Netherlands)

Wynhoff, I.; Bakker, R.B.; Oteman, B.; Arnaldo, P.S.; Langevelde, van F.

2015-01-01

The survival of eggs and larvae is dependent on the oviposition site selection of their mothers. In obligate myrmecophilic butterflies, both host plant phenology and host ant presence are expected to affect the decision where to deposit eggs. The importance of ant nest presence in the oviposition

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

The effects of thinking in silence on creativity and innovation

NARCIS (Netherlands)

de Vet, A.J.

2007-01-01

This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized

Novel Genes Affecting the Interaction between the Cabbage Whitefly and Arabidopsis Uncovered by Genome-Wide Association Mapping.

Directory of Open Access Journals (Sweden)

Colette Broekgaarden

Full Text Available Plants have evolved a variety of ways to defend themselves against biotic attackers. This has resulted in the presence of substantial variation in defense mechanisms among plants, even within a species. Genome-wide association (GWA mapping is a useful tool to study the genetic architecture of traits, but has so far only had limited exploitation in studies of plant defense. Here, we study the genetic architecture of defense against the phloem-feeding insect cabbage whitefly (Aleyrodes proletella in Arabidopsis thaliana. We determined whitefly performance, i.e. the survival and reproduction of whitefly females, on 360 worldwide selected natural accessions and subsequently performed GWA mapping using 214,051 SNPs. Substantial variation for whitefly adult survival and oviposition rate (number of eggs laid per female per day was observed between the accessions. We identified 39 candidate SNPs for either whitefly adult survival or oviposition rate, all with relatively small effects, underpinning the complex architecture of defense traits. Among the corresponding candidate genes, i.e. genes in linkage disequilibrium (LD with candidate SNPs, none have previously been identified as a gene playing a role in the interaction between plants and phloem-feeding insects. Whitefly performance on knock-out mutants of a number of candidate genes was significantly affected, validating the potential of GWA mapping for novel gene discovery in plant-insect interactions. Our results show that GWA analysis is a very useful tool to gain insight into the genetic architecture of plant defense against herbivorous insects, i.e. we identified and validated several genes affecting whitefly performance that have not previously been related to plant defense against herbivorous insects.

Phengaris (Maculinea) alcon

NARCIS (Netherlands)

Wynhoff, I.; Bakker, R.B.; Oteman, B.; Seixas Arnaldo, .P.; van Langevelde, F.

2015-01-01

1.The survival of eggs and larvae is dependent on the oviposition site selection of their mothers. In obligate myrmecophilic butterflies, both host plant phenology and host ant presence are expected to affect the decision where to deposit eggs. The importance of ant nest presence in the oviposition

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

Silencing the SpMPK1, SpMPK2, and SpMPK3 Genes in Tomato Reduces Abscisic Acid—Mediated Drought Tolerance

Directory of Open Access Journals (Sweden)

Yan Liang

2013-11-01

Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.

RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

Science.gov (United States)

Dare, Andrew P; Hellens, Roger P

2013-08-01

Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

The Improved Adaptive Silence Period Algorithm over Time-Variant Channels in the Cognitive Radio System

Directory of Open Access Journals (Sweden)

Jingbo Zhang

2018-01-01

Full Text Available In the field of cognitive radio spectrum sensing, the adaptive silence period management mechanism (ASPM has improved the problem of the low time-resource utilization rate of the traditional silence period management mechanism (TSPM. However, in the case of the low signal-to-noise ratio (SNR, the ASPM algorithm will increase the probability of missed detection for the primary user (PU. Focusing on this problem, this paper proposes an improved adaptive silence period management (IA-SPM algorithm which can adaptively adjust the sensing parameters of the current period in combination with the feedback information from the data communication with the sensing results of the previous period. The feedback information in the channel is achieved with frequency resources rather than time resources in order to adapt to the parameter change in the time-varying channel. The Monte Carlo simulation results show that the detection probability of the IA-SPM is 10–15% higher than that of the ASPM under low SNR conditions.

Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

Science.gov (United States)

Wu, H; Zhang, J; Shi, H

2016-01-01

Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

Directory of Open Access Journals (Sweden)

Barik Sailen

2001-12-01

Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

Identification of a maize chlorotic dwarf virus silencing suppressor protein

Science.gov (United States)

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

Pond dyes are Culex mosquito oviposition attractants

Directory of Open Access Journals (Sweden)

Natali Ortiz Perea

2017-05-01

Full Text Available Background British mosquito population distribution, abundance, species composition and potential for mosquito disease transmission are intimately linked to the physical environment. The presence of ponds and water storage can significantly increase the density of particular mosquito species in the garden. Culex pipiens is the mosquito most commonly found in UK gardens and a potential vector of West Nile Virus WNV, although the current risk of transmission is low. However any factors that significantly change the distribution and population of C. pipiens are likely to impact subsequent risk of disease transmission. Pond dyes are used to control algal growth and improve aesthetics of still water reflecting surrounding planting. However, it is well documented that females of some species of mosquito prefer to lay eggs in dark water and/or containers of different colours and we predict that dyed ponds will be attractive to Culex mosquitoes. Methods Black pond dye was used in oviposition choice tests using wild-caught gravid C. pipiens. Larvae from wild-caught C. pipiens were also reared in the pond dye to determine whether it had any impact on survival. An emergence trap caught any adults that emerged from the water. Water butts (80 L were positioned around university glasshouses and woodland and treated with black pond dye or left undyed. Weekly sampling over a six month period through summer and autumn was performed to quantified numbers of larvae and pupae in each treatment and habitat. Results Gravid female Culex mosquitoes preferred to lay eggs in dyed water. This was highly significant in tests conducted under laboratory conditions and in a semi-field choice test. Despite this, survivorship in black dyed water was significantly reduced compared to undyed water. Seasonal analysis of wild larval and pupal numbers in two habitats with and without dye showed no impact of dye but a significant impact of season and habitat. Mosquitoes were more

Silence about encounters with dying among healthcare professionals in a society that ‘de-tabooises’ death

Directory of Open Access Journals (Sweden)

Ellen Ramvi

2017-09-01

Full Text Available Background: Empirical studies on healthcare personnel indicate that professionals’ experiences with dying and death become silenced and unutterable within the healthcare service. Aim: To explore and interpret silence about encounters with death and dying among healthcare professionals in Norway. Method: The method used was theoretical exploration, using a psychosocial approach. Findings: This analysis reveals complex interrelations and two-way dynamics between subject-worlds, sociocultural and societal worlds when it comes to dealing with death and dying at work. A performance culture saturates these worlds, and may be implicated in silencing death within the healthcare institutions of the Norwegian welfare state. Conclusions: This article suggests that silence about death and dying among healthcare professionals is indicative of crucial emerging and unresolved tensions in the neoliberal episteme, accompanied and reinforced by the ineluctable basic conditions of life and intrapsychic defence against threats towards the self. Implications for practice: Silence about death and dying presents a serious challenge for dying patients and next of kin. Healthcare professionals should be enabled to acknowledge their thoughts and emotions about death in order to be able to support and contain patients and next of kin Learning activities such as peer support and supervision can help the processing of difficult psychological content and allow for emotional aspects of professionals’ work to be acknowledged and thought about in a way that encourages reflective and sound practice Clinical managers should address whether performance pressures induce shameful feelings in staff, who may believe that by providing appropriate levels of care they are compromising productivity. Shame in turn, may undermine professionals’ emotional wellbeing and ability to continue to provide attuned and adequate care for dying patients Creative approaches to facilitate

Silence is golden : keeping a lid on noise quiets opposition to oilpatch operations

International Nuclear Information System (INIS)